(Mana) Maicii Domnului ne scapa de covid19 mai rapid – studiu clinic

Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea noului coronavirus SARS-CoV-2 și accelerează negativarea PCR pacienților infectați Covid19

Descoperiri celulare volum 6 , Număr articol:  54 ( 2020 ) Citați acest articol

Draga editorule,

Pandemia bolii Coronavirus 2019 (COVID-19) este una dintre cele mai grave crize de sănătate publică la nivel mondial până în prezent. Începând cu 12 iulie 2020, peste 12,6 milioane de cazuri de infecție COVID-19 cu 0,56 milioane de decese au fost confirmate în întreaga lume 1 . Deoarece nu există terapii eficiente pentru tratarea sindromului respirator acut sever coronavirus 2 (SARS-CoV-2, virusul cauzal al infecției cu COVID-19) până acum, pandemia se răspândește rapid în întreaga lume. Este urgent să se dezvolte terapii eficiente, nu numai pentru a trata pacienții infectați, ci și pentru a controla pandemia.

Studiile noastre anterioare au demonstrat că un microARN al plantei, MIR2911, care este îmbogățit în decoct de caprifoi/Mana Maicii Domnului (HD), vizează în mod direct virusurile gripei A (IAV), inclusiv subtipurile H1N1, H5N1 și H7N9 prin legarea la ARNm și blocarea translației proteinelor. Administrarea orală de Mana Maicii Domnului HD poate preveni infecția IAV și reduce moartea de șoarece indusă de H5N1 2 . Studiile ulterioare au arătat că MIR2911 inhibă, de asemenea, direct replicarea diferiților viruși, în plus față de IAV-urile 3 , 4 . După absorbția dietetică, acești microARN se autoasamblează în exosomi și sunt apoi secretați în circulație și livrați în țesuturile țintă sau celule specifice, inclusiv ficatul, plămânul, splina, pancreasul și celulele T 5 , 6 , 7. Având în vedere compoziția unică de nucleotide îmbogățită cu GC a MIR2911 (GGCCGGGGGACGGACACGGGA) și după ce am analizat secvența genomului SARS-CoV-2, este cel mai probabil ca genomul virusului să conțină situri de legare MIR2911 și că MIR2911 poate inhiba SARS-CoV-2 replicare directă. În studiul de față, am evaluat efectul inhibitor al absorbției MIR2911 în HD asupra replicării SARS-CoV-2 și am efectuat un studiu clinic pentru a investiga eficacitatea HD la pacienții cu COVID-19.

Prin utilizarea analizei bioinformatice, am prezis că există 179 site-uri putoase de legare MIR2911 în genomul SARS-CoV-2. Douăzeci și opt de situri de legare (tabelul suplimentar S1 ) au fost confirmate prin testul clasic al luciferazei (fig. Suplimentară S1 ), care sunt distribuite pe scară largă în genomul virusului (fig. 1a ), indicând faptul că MIR2911 ar putea inhiba traducerea a aproape toate proteinele SARS-CoV-2.

figura 1
Fig. 1: MIR2911 absorbit în HD inhibă direct replicarea SARS-CoV-2.

Pentru a evalua efectul direct al MIR2911 absorbit asupra replicării SARS-CoV-2, exosomii celulari au fost colectați din mediul de cultură al celulelor HEK293T transfectate cu MIR2911 sintetic sau ARN necodificator de control (ncRNA), ca metodă similară raportului anterior 5 ( Fig. 1b ). Exosomii celulari izolați cu / fără MIR2911 au fost pre-incubați separat cu 5 × 10 4 celule Vero E6 (ATCC-1586) în 0,25 ml mediu celular timp de 8 ore. După schimbarea mediului de cultură, celulele au fost infectate cu SARS-CoV-2 (nCoV-2019BetaCoV / Wuhan / WIV04 / 2019 8) la o multiplicitate de infecție (MOI) de 0,01. Eficacitățile au fost evaluate prin cuantificarea numărului de copii virale în supernatantul celular prin RT-PCR cantitativă în timp real (qRT-PCR) la 24 ore după infecție (pi) (Fig. 1b ). Așa cum se arată în Fig. 1c , exosomul celular-MIR2911 la concentrația de 13,2 pM a inhibat replicarea virusului 93% (de la 4,09 × 10 9 la 2,87 × 10 8 copii / ml), indicând faptul că MIR2911 absorbit inhibă direct și suficient replicarea SARS-CoV-2 (Fig. 1c). Apoi, am evaluat efectul inhibitor al MIR2911 absorbit în HD asupra replicării SARS-CoV-2. Deoarece MIR2911 absorbit în HD este livrat în plămâni prin exosomi prin circulație, exosomii izolați din 62,5 μl de ser donator înainte și după ce au băut 200 ml HD (30 g caprifoi uscat) separat au fost pre-incubați cu 5 × 10 4 celule Vero E6, ca condiție similară cu cea a exosomului celular-MIR2911 (Fig. 1b ). Concentrația MIR2911 în 200 ml HD a fost de 52,5 pM (10,5 pmol / 200 ml / 30 g de caprifoi uscat). Nivelurile serice de MIR2911 în trei receptoare de sănătate după ce au băut timp de 2 ore au fost de 0,42, 0,45 și 1,13 pM (Fig. 1d), care erau nedetectabile înainte de băut). Exozomii (niveluri MIR2911: înainte de băut, nedetectabili; după băut, au fost 9,9, 14,4 și 19,4 amoli) au fost pre-incubați cu 5 × 10 4 celule (Fig. 1e , ~ 180 de copii ale MIR2911 / celulă). Așa cum se arată în Fig. 1e , exosomii care conțin MIR2911 au inhibat semnificativ replicarea virusului (Fig. 1e ). Nu există nicio diferență de viabilitate celulară între exosomi cu / fără MIR2911 colectate de la același donator înainte și după consumul HD (Fig. S2 suplimentar ). Aceste rezultate sugerează cu tărie că MIR2911 este suficient absorbit de consumatorii care consumă HD și că MIR2911 absorbit blochează semnificativ replicarea SARS-CoV-2.

Studiu clinic

Pentru a evalua efectul antiviral al MIR2911 în HD asupra pacienților cu COVID-19, am efectuat un studiu clinic. Șaptezeci și cinci de pacienți de tip moderat COVID-19 care au primit terapie antivirală de rutină (RT) la Spitalul II din Nanjing din ianuarie 2020 până în martie 2020 au fost înscriși în acest studiu. Pacienții au fost împărțiți în două grupuri pe baza tratamentului suplimentar cu MIR2911 în grupul Mana Maicii Domnului HD (MIR2911 + ) sau amestec de medicină tradițională chineză (TCM) (MIR2911  ) în plus față de terapia de rutina antivirala RT. Obiectivul principal a fost rata de conversie negativă în a 7-a zi de la primul tratament. Au fost 6 și 69 pacienți din MIR2911 + și MIR2911  grupuri, respectiv (Tabelele suplimentare S2 – S4). Rata de conversie negativă în a 7-a zi în grupul MIR2911 +  fost de 83,3%, care a fost îmbunătățită dramatic comparativ cu cea a pacienților tratați cu MIR2911  (26,1%, P  = 0,004) (Fig. 1g, f ).

Timpul necesar pentru a deveni SARS-CoV-2 PCR-negativ (TTN) a fost de asemenea, in favoarea pacienții tratați cu HD-MIR2911 (mediană 4.0 vs. 12,0 zile, HR 0,28, IC 95% 0,12-0,67, P  = 0,005) (Fig. 1g , f ).

TTN median al pacienților bărbați în MIR2911 + (1 caz) și MIR2911  (38 cazuri) este de 5,0 zile și 11,0 zile (HR 0,003, IC 95% 0,000018-0,52, P  = 0,027), respectiv.

TTN median al pacienților de sex feminin în MIR2911 +(5 cazuri) și grupurile MIR2911  (31 cazuri) sunt de 3,0 zile și 12,0 zile (HR 0,15, IC 95% 0,031-0,68, P  = 0,014), respectiv.

Mana Maicii Domnului/HD este folosita pentru a trata infecțiile virale de o mie de ani în China. Studiile anterioare au demonstrat că MIR2911 (0,06-0,18 pmol / zi) în 1-3 ml HD inhibă în mod semnificativ replicarea virusului gripal la 20 g șoarece 2 . În plus față de Farmacopeea din Republica Populară Chineză 9 , am ales 30 g de caprifoi uscat (nivel MIR 2911: 10,5 pmol) pe zi pentru utilizare. Rezultatele noastre demonstrează că 30 g de caprifoi uscat este sigur pentru utilizare (tabelul suplimentar S4 ) și are o funcție antivirală suficientă (Fig. 1d, e). Pe de altă parte, datele conform cărora MIR2911 (~ 60 fM) în exosomi inhibă semnificativ replicarea virusului nu numai că confirmă activitatea antivirală extra-ridicată a MIR2911 (comparativ cu cea a remdesivirului: 3,7 μM și a Clorochinei: 10 μM10, dar oferă și o strategie nouă conform căreia utilizarea exosomilor serici colectați de la un donator sănătos oferă cea mai similară condiție in vivo pentru a evalua eficacitatea potențialelor medicamente in vitro.

Pe scurt, rezultatele noastre sugerează că MIR2911 absorbit de plante caprifoi/Mana Maicii Domnului/ HD inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Tratamentul cu Mana Maicii Domnului HD ar putea ajuta la vindecarea pacienților infectați și la oprirea pandemiei COVID-19.

Referințe

  1. 1.OMS. Raport de situație a bolii coronavirus 2019 (COVID-19)-174. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200712-covid-19-sitrep-174 (2020).
  2. 2.Zhou, Z. și colab. MicroRNA2911 atipic codificat cu caprifoi vizează direct virusurile gripei A. Rez. Celulare 25 , 39–49 (2015).CAS Articol Google Scholar 
  3. 3.Huang, Y. și colab. MicroRNA2911 derivat din caprifoi inhibă direct replicarea virusului varicela-zoster prin direcționarea genei IE62. J. Neurovirol. 25 , 457–463 (2019).CAS Articol Google Scholar 
  4. 4.Li, X. și colab. MicroRNA2911 codificat cu caprifoi inhibă replicarea Enterovirus 71 prin direcționarea genei VP1. Antivir. Rez. 152 , 117–123 (2018).CAS Articol Google Scholar 
  5. 5.Zhang, L. și colab. Planta exogenă MIR168a vizează în mod specific LDLRAP1 la mamifere: dovezi ale reglării încrucișate prin microARN. Rez. Celulare 22 , 107–126 (2012).CAS Articol Google Scholar 
  6. 6.Zhao, C., Sun, X. și Li, L. Biogeneza și funcția miARN extracelulare. ExRNA 1 , 38 (2019).Articol Google Scholar 
  7. 7.Zhang, S. & Hong, Z. ARN-uri mobile – elful magic care călătorește între plantă și organismele asociate. ExRNA 1 , 8 (2019).Articol Google Scholar 
  8. 8.Zhou, P. și colab. Un focar de pneumonie asociat cu un nou coronavirus de origine probabilă a liliecilor. Natura 579 , 270-273 (2020).CAS Articol Google Scholar 
  9. 9.Comisia, Farmacopeea CP din Republica Populară Chineză , Vol. I 221 (Editura Medicală a Poporului, 2010).
  10. 10.Wang, M. și colab. Remdesivirul și clorochina inhibă în mod eficient noul coronavirus recent apărut (2019-nCoV) in vitroRez. Celulare 30 , 269-271 (2020).CAS Articol Google Scholar 

Descărcați referințele

Mulțumiri

Mulțumim lui Wei Ye, Yun Chi, Cong Cheng, Lanlan Ma, Guangchang Dai și Qian Shi, de la cel de-al doilea spital din Nanjing, pentru asistența lor în studiul clinic (numărul de registru al studiului clinic chinez, ChiCTR2000029822). În plus, îi mulțumim dr. Zhibin Hu (Universitatea de Medicină din Nanjing) pentru comentariile sale asupra lucrării. Această lucrare a fost susținută de subvenții din cadrul proiectului chinez de știință și tehnologie major al Chinei (2015ZX09102023-003), Programul național de cercetare de bază din China (Programul 973) (2014CB542300 și 2012CB517603), Fundația Națională de Științe Naturale din China (81250044, 81602697 și 31742075 ) și Fundația pentru Științe Naturale din provincia Jiangsu (BE2016737), Fondurile fundamentale de cercetare pentru universitățile centrale (020814380146) și Talentul pentru tineret medical din provincia Jiangsu (QNRC2016056).

Informatia autorului

Note de autor

  1. Acești autori au contribuit în mod egal: Li-Kun Zhou, Zhen Zhou, Xia-Ming Jiang, Yishan Zheng

Afilieri

  1. Nanjing Drum Tower Hospital Center of Molecular Diagnostic and Therapy, Laboratorul cheie de stat de biotehnologie farmaceutică, Jiangsu Engineering Research Center for MicroRNA Biology and Biotechnology, NJU Advanced Institute of Life Sciences (NAILS), NJU Institute of AI Biomedicine and Biotechnology, School of Life Sciences , Universitatea Nanjing, Nanjing, Jiangsu 210023, ChinaLi-Kun Zhou, Zhen Zhou, Xi Chen, Zheng Fu și Chen-Yu Zhang
  2. Tianjin Medical University Cancer Institute and Hospital, Centrul Național de Cercetare Clinică pentru Cancer, Centrul de Cercetare Clinică pentru Cancer din Tianjin, Laboratorul cheie de prevenire și terapie a cancerului, Tianjin, 300060, ChinaLi-Kun Zhou
  3. Laboratorul cheie de stat de virologie, Institutul de virologie Wuhan, Centrul pentru Mega-Științe în domeniul biosecurității, Academia Chineză de Științe, Wuhan, Hubei 430071, ChinaXia-Ming Jiang, Gengfu Xiao și Lei-Ke Zhang
  4. Departamentul de Medicină de îngrijire critică și Centrul de boli infecțioase din Nanjing, al doilea spital din Nanjing, Universitatea de Medicină Chineză din Nanjing, Nanjing, Jiangsu 210003, ChinaYishan Zheng și Yongxiang Yi

Contribuții

YY, L.-K.Zhang și C.-YZ au conceput și proiectat experimentele; L.-K.Zhou, ZZ, X.-MJ, YZ și ZF au participat la mai multe experimente; L.-K.Zhou, ZZ, GX, CZ, L.-K.Zhang și XC au analizat datele. L.-K.Zhou, ZZ, C.-YZ și L.-K.Zhang au scris lucrarea. C.-YZ, L.-K.Zhang și YY au furnizat aprobarea finală a lucrării.

Autori corespondenți

Corespondență cu Chen-Yu Zhang sau Lei-Ke Zhang sau Yongxiang Yi .

Declarații de etică

Conflict de interese

Autorii declară că nu au niciun conflict de interese.

Informatii suplimentare

Nota editorului Springer Nature rămâne neutră în ceea ce privește revendicările jurisdicționale din hărțile publicate și afilierile instituționale.

Informatie suplimentara

Informatie suplimentara

Acces liber Acest articol este licențiat sub o licență internațională Creative Commons Attribution 4.0, care permite utilizarea, partajarea, adaptarea, distribuirea și reproducerea în orice mediu sau format, atâta timp cât acordați creditul autorului (autorilor) original (e) și sursei, furnizați un link către licența Creative Commons și indicați dacă s-au făcut modificări. Imaginile sau alte materiale ale terților din acest articol sunt incluse în licența Creative Commons a articolului, cu excepția cazului în care se indică altfel într-o linie de credit pentru material. Dacă materialul nu este inclus în licența Creative Commons a articolului și utilizarea intenționată a dvs. nu este permisă de reglementările legale sau depășește utilizarea permisă, va trebui să obțineți permisiunea direct de la titularul drepturilor de autor. Pentru a vizualiza o copie a acestei licențe, vizitațihttp://creativecommons.org/licenses/by/4.0/ .

Reimprimări și permisiuni

Despre acest articol

Verificați moneda și autenticitatea prin CrossMark

Citați acest articol

Zhou, L., Zhou, Z., Jiang, X. și colab. Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Cell Discov 6, 54 (2020). https://doi.org/10.1038/s41421-020-00197-3

Descărcați citația

  • Primit07 iunie 2020
  • Admis12 iulie 2020
  • Publicat05 august 2020

https://www.nature.com/articles/s41421-020-00197-3

2 gânduri despre „(Mana) Maicii Domnului ne scapa de covid19 mai rapid – studiu clinic

Exprimati-va pararea!

Completează mai jos detaliile tale sau dă clic pe un icon pentru a te autentifica:

Logo WordPress.com

Comentezi folosind contul tău WordPress.com. Dezautentificare /  Schimbă )

Fotografie Google

Comentezi folosind contul tău Google. Dezautentificare /  Schimbă )

Poză Twitter

Comentezi folosind contul tău Twitter. Dezautentificare /  Schimbă )

Fotografie Facebook

Comentezi folosind contul tău Facebook. Dezautentificare /  Schimbă )

Conectare la %s

Acest site folosește Akismet pentru a reduce spamul. Află cum sunt procesate datele comentariilor tale.