extractul de ceai verde la pacienții cu leziuni premaligne orale cu risc ridicat

Cancer Prev Res (Phila). Manuscris de autor; disponibil în PMC 2014 25 noiembrie.

Publicat în forma finală editată ca:Cancer Prev Res (Phila). 2009 noiembrie; 2 (11): 931-941.

doi:  10.1158 / 1940-6207.CAPR-09-0121

PMCID: PMC4243312

NIHMSID: NIHMS631495

PMID: 19892663

Studiu clinic Faza II, randomizat, controlat cu placebo

Anne S. Tsao , Diane Liu , Jack Martin , Xi-ming Tang , 1, 4 J. Jack Lee , Adel K. El-Naggar , Ignacio Wistuba , 1, 4 Kirk S. Culotta , Li Mao , Ann Gillenwater , Yuko M. Sagesaka , Waun K. Hong , 1 și Vassiliki Papadimitrakopoulou 1

Informații despre autor

 Informații despre drepturi de autor și licență

 Renunțare

Ultima versiune editată a editorului a acestui articol este disponibilă gratuit la Cancer Prev Res (Phila)

Abstract

Datele epidemiologice și preclinice susțin potențialul de prevenire a cancerului oral al extractului de ceai verde (GTE). Am repartizati aleatoriu de pacienti cu risc ridicat orale leziuni premaligne (OPLs) pentru a primi GTE la 500 mg / m 2 , 750 mg / m 2 , sau 1000 mg / m 2 sau placebo TID timp de 12 saptamani, evaluarea biomarkeri în momentul inițial și 12- biopsii săptămânale.

Rata răspunsului clinic OPL a fost mai mare în toate brațele GTE (n = 28; 50%) față de placebo (n = 11; 18,2%; p = 0,09), dar nu a atins semnificația statistică. Cu toate acestea, cele două brațe GTE cu doză mai mare (58,8% [750, 1000 mg / m 2 ], 36,4% [500 mg / m 2], și 18,2%, [placebo], p = 0,03) au avut răspunsuri mai mari, sugerând un efect doză-răspuns. Tratamentul cu GTE a îmbunătățit și histologia (21,4% față de 9,1%, p = 0,65), deși nu este semnificativă statistic. GTE a fost bine tolerat, deși dozele mai mari au crescut insomnia / nervozitatea, dar nu au produs toxicitate de gradul 4. VEGF stromal de bază mediu mai mare corelat cu un răspuns clinic (p = 0,04), dar nu histologic. Scorurile inițiale ale altor biomarkeri (VEGF epitelial, p53, Ki-67, ciclina D1 și metilarea promotorului p16) nu au fost asociate cu un răspuns sau supraviețuire. Metilarea inițială a promotorului p16 (n = 5) a fost asociată cu o supraviețuire mai scurtă fără cancer. VEGF stromal și expresia ciclinei D1 au fost reglate în jos la pacienții cu GTE receptivi clinic și reglate în sus la pacienții care nu răspundeau la 12 săptămâni (comparativ cu momentul inițial). O extinsă (mediană 27.5 luni) de urmărire a arătat un timp mediu până la cancerul oral de 46,4 luni. GTE poate suprima OPL, în parte prin reducerea stimulului angiogen (VEGF stromal). Dozele mai mari de GTE pot îmbunătăți rezultatul OPL pe termen scurt (12 săptămâni). Prezentele rezultate susțin testarea clinică pe termen lung a GTE pentru prevenirea cancerului oral.\

Peste 170.000 de oameni dezvoltă anual cancer la nivel mondial în întreaga lume ( 1 ), iar cancerul oral este asociat cu morbiditate severă și o rată de supraviețuire globală de 5 ani mai mică de 50% ( 2 ). Carcinogeneza orală este un proces în mai multe etape care implică acumularea de modificări genetice care duc la displazie progresivă, creștere celulară nereglementată și cancer. Cancerul oral apare frecvent din leziunile premaligne orale (OPL), care prezintă un risc global de 2% -3% de a se dezvolta în carcinom ( 3 ). Acest risc crește la 17,5% în decurs de 8 ani pentru OPL displazice sau cu risc ridicat ( 4 ). Riscurile raportate de cancer ale OPL cresc, de asemenea, în asociere cu eritroplazie (eritroleucoplazie) și hiperplazie verucoasă proliferativă, antecedente de fumat, polisomie (5 ), modificări cromozomiale timpurii ( 9p , 3p și 17p ; ref ( 6 – 8 )) și inactivarea p16 INK4a ( 9 ).

Extractul de ceai verde (GTE) conține cantități mari de polifenoli, inclusiv epigalocatechina 3-galat (EGCG), care inhibă carcinogeneza în modele preclinice și previne potențial cancerul oral ( 10 , 11 ). Deși EGCG este cel mai abundent și cel mai bine studiat dintre polifenolii de ceai ( 12 ), se pare că efectele preventive sunt mai puternice cu un amestec de catehine de ceai, cum ar fi polifenonul E (un amestec de catehină de ceai verde decofeinizat) sau GTE, decât cu Doar EGCG ( 13 , 14 ). În modelele preclinice, tratamentul EGCG a arestat celulele în faza G 0 / G 1 ; ciclina D1 ( 15 ) reglată în jos ; creșterea p14 ARFși / sau nivelurile de proteine ​​p16 și astfel p53 stabilizat și apoptoza reglată ( 16 ); și a blocat angiogeneza prin scăderea fosforilării receptorului factorului de creștere endotelial vascular (VEGFR; ref. ( 17 )) și inhibarea secreției VEGF de către celulele tumorale ( 18 ).

Dovezile preliminare din numeroase studii susțin potențialul preventiv al ceaiului și al polifenolilor din ceai ( 10 , 19 , 20 ). Studiile asiatice și alte studii epidemiologice au sugerat un potențial efect protector al ceaiului verde împotriva malignităților epiteliale ( 21 ). Un studiu prospectiv de cohortă a peste 8.552 de japonezi a arătat că consumul a peste 10 cești zilnice (120 ml fiecare) de ceai verde a redus malignitatea ( 22 ). GTE oral ( 23) a avut un profil de siguranță rezonabil într-un studiu de fază I efectuat de membrii grupului nostru cu pacienți cu cancer pretratat avansat, cauzând în principal gastrointestinale legate de cofeină (balonare abdominală, durere în gât, greață), cardiovasculare (palpitații) și neurologice (insomnie, parestezie) , neliniște) efecte secundare. Investigatorii faza I a recomandat o doză maximă de 1000 mg / m 2 (echivalent cu 7 până la 8 cesti de ceai verde administrată de 3 ori pe zi (TID; ref . ( 23 ).) Cu toate că acest studiu de faza I ( 23 ) nu au prezentat beneficiu semnificativ împotriva cancerului, GTE este totuși un agent ideal pentru studiul chimioprevenției, deoarece are un cost și o toxicitate reduse și este ușor disponibil.

Agenții chemopreventivi de succes trebuie să fie suficient de eficienți și siguri pentru utilizare prelungită, deoarece nu se așteaptă ca intervențiile pe termen scurt să reducă substanțial riscul de cancer pe termen lung. Majoritatea agenților chimiopreventivi activi studiați până în prezent sunt susceptibili de a întârzia transformarea malignă ( 24 ). De exemplu, deși doza mare de acid 13- cis -retinoic a inversat OPL-urile ( 25 ), utilitatea sa chimiopreventivă a fost limitată de toxicitatea care a împiedicat utilizarea pe termen lung. Toxicitatea GTE în rapoartele clinice inițiale ( 23) și efectele antitumorale din studiile preclinice susțin utilizarea sa în condiții de siguranță pentru o perioadă extinsă de timp și au oferit o justificare științifică rezonabilă pentru studiul randomizat, controlat cu placebo, de fază II a chimioprevenției GTE în cadrul OPL-urilor pe care le raportăm aici.Mergi la:

Pacienți și metode

Selectarea pacientului

Criteriul major de includere a fost prezența unuia sau mai multor OPL confirmabile histologic, măsurabile bidimensional, care ar putea fi prelevate prin biopsie și care au cel puțin una dintre următoarele caracteristici cu risc ridicat ale transformării maligne: adăpostind cel puțin o displazie ușoară, situată într-o zona de risc (de exemplu, podeaua gurii, limba ventrolaterală și palatul moale), amploarea semnificativă a implicării țesutului OPL și prezența simptomelor (durere sau disconfort substanțial). Criteriile suplimentare de includere au inclus vârsta cuprinsă între ≥ 18 și ≤ 75; Starea performanței Zubrod <2; funcție hematologică, hepatică și renală adecvată; funcție cardiacă adecvată (definită ca nicio anomalie a electrocardiogramei semnificativă clinic, aritmii atriale sau ventriculare instabile care necesită control medical sau eveniment ischemic experimentat în ultimele 6 luni);test de sarcină negativ la femeile cu vârsta fertilă în termen de 7 zile înainte de prima doză de medicament de studiu; utilizarea unei metode contraceptive eficiente în timpul procesului; și consimțământul informat în scris pentru participare. Principalele criterii de excludere au fost următoarele: hipersensibilitate cunoscută la GTE orală sau analogii săi; utilizarea agenților prealabili de investigație în termen de 30 de zile; orice boală intercurentă gravă; antecedente de tumori maligne anterioare, cu mai puțin de 1 an fără boală interval înainte de intrarea în studiu; femele care alăptează; pacienții care nu au putut să se abțină de la consumul de produse care conțin metilxantină (inclusiv cafea, ceai, ciocolată, băuturi răcoritoare cu cofeină și teofilină) și ceai decofeinizat.utilizarea unei metode contraceptive eficiente în timpul procesului; și consimțământul informat în scris pentru participare. Principalele criterii de excludere au fost următoarele: hipersensibilitate cunoscută la GTE orală sau analogii săi; utilizarea agenților prealabili de investigație în termen de 30 de zile; orice boală intercurentă gravă; antecedente de tumori maligne anterioare, cu mai puțin de 1 an fără boală interval înainte de intrarea în studiu; femele care alăptează; pacienții care nu au putut să se abțină de la consumul de produse care conțin metilxantină (inclusiv cafea, ceai, ciocolată, băuturi răcoritoare cu cofeină și teofilină) și ceai decofeinizat.utilizarea unei metode contraceptive eficiente în timpul procesului; și consimțământul informat în scris pentru participare. Principalele criterii de excludere au fost următoarele: hipersensibilitate cunoscută la GTE orală sau analogii săi; utilizarea agenților prealabili de investigație în termen de 30 de zile; orice boală intercurentă gravă; antecedente de tumori maligne anterioare, cu mai puțin de 1 an fără boală interval înainte de intrarea în studiu; femele care alăptează; pacienții care nu au putut să se abțină de la consumul de produse care conțin metilxantină (inclusiv cafea, ceai, ciocolată, băuturi răcoritoare cu cofeină și teofilină) și ceai decofeinizat.antecedente de tumori maligne anterioare, cu mai puțin de 1 an fără boală interval înainte de intrarea în studiu; femele care alăptează; pacienții care nu au putut să se abțină de la consumul de produse care conțin metilxantină (inclusiv cafea, ceai, ciocolată, băuturi răcoritoare cu cofeină și teofilină) și ceai decofeinizat.antecedente de tumori maligne anterioare, cu mai puțin de 1 an fără boală interval înainte de intrarea în studiu; femele care alăptează; pacienții care nu au putut să se abțină de la consumul de produse care conțin metilxantină (inclusiv cafea, ceai, ciocolată, băuturi răcoritoare cu cofeină și teofilină) și ceai decofeinizat.

Acest studiu de fază II, controlat cu placebo, de determinare a dozei, a fost realizat exclusiv la Centrul de Cancer MD Anderson al Universității din Texas, aprobat de către Comitetul de revizuire instituțională MD Anderson și realizat în conformitate cu prevederile Declarației de la Helsinki și ale Ghidurilor de bună practică clinică. .

Plan de tratament

La înscriere, pacienții au furnizat un istoric medical (inclusiv antecedente complete de consum de alcool, tutun și cofeină, utilizarea medicamentelor concomitente și simptome adverse) și au fost supuși unui examen fizic, teste clinice de laborator, fotografie color, măsurători bidimensionale și o biopsie de OPL. A fost oferită consiliere privind fumatul și încetarea consumului de alcool. Toate lamele de biopsie au fost revizuite pentru confirmarea diagnosticului și a adecvării pentru analiza biomarkerului. În timpul tratamentului activ, atât evaluarea siguranței, cât și eficacitatea clinică au avut loc la fiecare 4 săptămâni. Evaluările histologice și biomarkere au fost adăugate la celelalte evaluări la momentul inițial și după 3 luni (12 săptămâni) de terapie. Concentrațiile plasmatice de EGCG și cofeină au fost măsurate la momentul inițial, înainte de fiecare doză TID în ultima zi de intervenție,și la 3 ore după ultima doză din ultima zi de intervenție (săptămâna 12) pentru a identifica orice corelații între eficacitate și / sau toxicitate și concentrații plasmatice de EGCG sau cofeină.

Pacienții eligibili au fost randomizați în mod egal la unul din cele patru următoarele brațe de tratament într – o manieră dublu-orb: GTE (500 mg / m 2 ), GTE (750 mg / m 2 ), GTE (1000 mg / m 2 ), sau placebo. Capsulele unei formulări GTE numite THEA-FLAN 30 ARG au fost furnizate de ITO EN, LTD (Tokyo, Japonia); fiecare capsulă conținea 350 mg de GTE. Primul lot de capsule GTE de studiu (numărul lotului 00-09-26A) a fost fabricat la 26 septembrie 2000, stabil timp de cel puțin 45 de luni și înlocuit cu un nou lot (numărul lotului 04-03-30A) în iunie 2004. Compoziția GTE a fost raportată anterior ( 23). GTE și capsulele placebo au fost furnizate farmaciei în blistere conținând câte 10 capsule care au fost sigilate în pungi de folie de aluminiu conținând 10 blistere fiecare. După scoaterea din punga de folie, capsulele au fost depozitate într-un recipient închis la 4 ° C.

În fiecare braț, doza de GTE sau placebo a fost administrată oral TID după mese timp de 12 săptămâni. Nu au fost permise creșteri ale dozei intra-pacient. Randomizarea a fost efectuată cu schema de alocare dinamică Pocock-Simon ( 26 ) pentru a echilibra trei factori de prognostic în fiecare dintre cele patru brațe. Factorii de prognostic au fost consumul de tutun (curent, oprit, niciodată), consumul de alcool (curent, oprit, niciodată) și consumul de ceai (0 până la 4 cani de opt uncii pe zi sau 5 sau mai multe cani de opt uncii pe zi). Calculele dozelor GTE s-au bazat pe suprafața corpului participantului (BSA) conform următoarei formule: BSA (m 2 ) = greutate (kg) 0,425 × înălțime (cm) 0,725× 0,007184. Doza calculată a fost ajustată în jos la cea mai apropiată doză care ar putea fi administrată folosind una sau mai multe capsule de 350 mg. Dozarea sa bazat pe un MD Anderson faza I studiu anterior ( 23 ) de niveluri de doză de 500 mg / m 2 acompaniat de 5050 de mg / m 2 , care a identificat o doza maxima tolerata de 4200 mg / m 2 o dată pe zi și o doză optimă de 1000 mg / m 2dat TID pentru testarea fazei II. Pacienții au primit o cantitate de 1 lună de GTE la fiecare 4 săptămâni și au fost instruiți să înregistreze conformitatea într-un card de jurnal și să returneze orice medicament neutilizat. Monitoarele de studiu au efectuat verificări jurnal și numărarea pilulelor la fiecare 4 săptămâni în timpul terapiei active. Un pacient a fost considerat conform dacă numărul de pilule de 4 săptămâni a determinat că 90% din dozele programate de medicament sau placebo au fost luate în timpul procesului.

Toxicitatea înainte de începerea fiecărui ciclu de 4 săptămâni a fost evaluată în conformitate cu versiunea 2.0 a Criteriilor comune de toxicitate (CTC) revizuite de Institutul Național al Cancerului. Pentru toxicitatea non-hepatică de gradul 2 sau -3, medicația de studiu a fost reținută până când toxicitatea s-a rezolvat la ≤ gradul 1, când GTE a fost repornită cu o doză redusă de 25%; pentru ALT seric crescut de gradul 1 până la -3, GTE a fost reținută până la normalizare, când a fost reluată doza completă. Orice toxicitate de gradul 4 sau care pune viața în pericol a necesitat întreruperea studiului medicamentului. Subiecții au fost renunțați la studiu dacă și-au retras acordul; a solicitat întreruperea; a avut dovezi ale progresiei histologice sau clinice a bolii, grad persistent de gradul 2 sau creștere mai mare a ALT, toxicitate non-hepatică inacceptabilă sau o boală intercurentă care necesită întreruperea prematură; ați fost însărcinată sau nu ați utilizat un control adecvat al nașterilor;nu au fost dispuși să respecte cerințele protocolului și să urmărească; sau a murit. În momentul întreruperii sau cât mai curând posibil, pacienții care au întrerupt prematur tratamentul au fost supuși tuturor evaluărilor și procedurilor (dacă este posibil) care altfel ar fi fost efectuate la sfârșitul programat al tratamentului (săptămâna 12).

Obiectivele studiului și analiza statistică

Obiectivul principal a fost răspunsul clinic și histologic al OPL cu risc crescut la 12 săptămâni la trei doze diferite de GTE în comparație cu placebo. Obiectivele secundare au fost toxicitățile calitative și cantitative ale GTE, efectele tratamentului asupra expresiei biomarkerilor și orice corelație potențială între eficacitatea și / sau toxicitatea tratamentului cu concentrațiile plasmatice de EGCG sau cofeină. Eficacitatea a fost analizată pe bază de intenție de tratat. Pacienții cu boală evaluabilă au fost definiți ca având leziuni bidimensional măsurabile. Leziunile cu margini clar definite au fost măsurate în două dimensiuni și apoi suprafața a fost calculată înmulțind cea mai lungă măsurare a diametrului cu cea mai mare măsurare a diametrului perpendicular. Biopsiile standard de pumn au fost efectuate de același oncolog dentar (J. Martin) pentru toți pacienții din acest studiu.Răspunsurile clinice au fost evaluate conform criteriilor descrise anterior (27) pentru măsurători bidimensionale: dispariția tuturor leziunilor a fost considerată un răspuns complet (CR); Scăderea cu 50% sau mai mare a sumei produselor de diametre ale tuturor leziunilor măsurate a fost considerată un răspuns parțial (PR); și creșterea cu 25% sau mai mare în dimensiunea leziunilor sau apariția de leziuni noi sau progresia către cancer invaziv a fost considerată progresia bolii (PD). Orice răspuns care nu a îndeplinit criteriile pentru CR, PR sau PD a fost considerat boală stabilă (SD). Răspunsul histologic a fost evaluat în funcție de următoarele categorii: CR a fost definită ca o inversare completă a premalignității la epiteliu normal fără leziuni noi, PR a fost definită ca o îmbunătățire a gradului de maturare a epiteliului fără leziuni noi și fără progresia vreunei leziuni ,SD a fost definit ca nici o modificare a histologiei și nici o apariție a unor leziuni noi sau progresia vreunei leziuni. PD histologic a fost definit ca progresia de la hiperplazie și / sau hiperkeratoză la displazie sau de la un grad mai mic la un grad mai ridicat de displazie sau carcinom invaziv sau apariția oricăror leziuni noi. Mărimea eșantionului a cuprins 9 pacienți per braț de tratament, pentru un total de 36 de pacienți evaluabili. Am bazat această dimensiune a eșantionului pe estimări istorice ale răspunsului la agenții de chemoprevenție, cum ar fi retinoizii, având ca scop o estimare conservatoare a ratei de răspuns de 20% (pentru un total de 36 de pacienți evaluabili. Am bazat această dimensiune a eșantionului pe estimări istorice ale răspunsului la agenții de chemoprevenție, cum ar fi retinoizii, având ca scop o estimare conservatoare a ratei de răspuns de 20% (pentru un total de 36 de pacienți evaluabili. Am bazat această dimensiune a eșantionului pe estimări istorice ale răspunsului la agenții de chemoprevenție, cum ar fi retinoizii, având ca scop o estimare conservatoare a ratei de răspuns de 20% (25 , 27). Mărimea minimă a eșantionului a fost calculată pentru a oferi o evaluare preliminară a efectului dozei. Utilizarea a nouă pacienți pe braț de tratament ar exclude o rată de răspuns de 20% sau mai bună, cu o putere de 86%, dacă nu s-a observat niciun răspuns (sau răspuns zero) pentru un braț de tratament specificat. Deși acest studiu nu a fost conceput sau alimentat pentru a detecta diferențe semnificative statistic de răspuns între grupurile de tratament, comparația incidenței răspunsului complet sau parțial față de boala stabilă sau progresivă a fost făcută între grupurile de tratament utilizând testul exact al lui Fisher. Concordanța dintre răspunsul histologic și cel clinic a fost evaluată în cadrul fiecărui tratament (GTE combinat sau placebo) folosind testul Bowker. Ratele de răspuns au fost rezumate și comparate în funcție de fumat, starea consumului de alcool și histologia de bază.Datele biomarkerului de bază au fost rezumate și comparate și corelate cu starea fumatului, consumul de alcool, grupurile de histologie și răspunsul clinic și histologic prin testul Wilcoxon rank sum sau testul Kruskal-Wallis. Diferența în modularea biomarkerului a fost comparată între respondenți versus grupuri care nu răspund și între brațele de tratament folosind testul Wilcoxon rank sum sau testul Kruskal-Wallis. Regresia logistică a fost utilizată pentru a evalua efectele dozei, histologiei și biomarkerilor de bază asupra răspunsului. Curbele Kaplan-Meier au fost utilizate pentru a demonstra supraviețuirea fără cancer oral în diferitele brațe de tratament și a fost utilizat un test log-rank pentru a testa diferența dintre grupuri. Ambele modele Cox univariate și multivariate au fost utilizate pentru a evalua efectul covariabilelor, cum ar fi histologia și biomarkerii, asupra supraviețuirii fără cancer oral.Toate testele au fost bilaterale și au fost considerate semnificative statistic dacă p≤ 0,05. Toate calculele au fost efectuate în SAS 9.1 (Cary, NC) și S-plus 7.0 pentru Windows (Insightful Corporation).

Testele biomarkerului

Imunohistochimie

Biopsiile tisulare (la momentul inițial și 12 săptămâni) au fost evaluate prin imunohistochimie pentru următorii biomarkeri: expresia citoplasmatică a factorului de creștere endotelial vascular (VEGF) în epiteliu și, de asemenea, în stromă, colorarea nucleară pentru p53, Ki-67 și ciclina D1 ( CD1) în epiteliu normal sau premalign (în straturi bazale, suprabazale sau superficiale folosind zona cea mai avansată histologic). Biopsiile au fost procesate și IHC a fost efectuată conform protocolului standard și anticorpilor validați. Diapozitivele subțiri de 4-μM colorate au fost preparate din secțiuni de țesut fixate în formalină și încorporate în parafină pentru analize imunohistochimice. Lamelele au fost deparafinizate, hidratate și încălzite într-un abur timp de 10 minute cu 10 mMol / L de citrat de sodiu (pH 6,0) pentru recuperarea antigenului și spălate în tampon Tris. Lamelele au fost tratate cu 3% H 22 în metanol și non-specifice de proteine de blocare și au fost incubate cu anticorpii primari și apoi a doua. Toate informațiile despre anticorpi și condițiile de incubație sunt prezentate întabelul 1. Cromogenul diaminobenzidinic a fost ulterior aplicat timp de 5 minute și lamele au fost apoi contracolorate cu hematoxilină. Colorarea imunohistochimică a fost evaluată independent de doi patologi (X. Tang și II Wistuba, care au fost amândoi orbi la variabilele clinice și moleculare) utilizând microscopie cu lumină (200 × mărire). Intensitatea colorării (interval 0-3) și procentul de celule pozitive (interval 1-100) au fost documentate și descrise anterior în publicațiile anterioare ( 28). O pată imunohistochimică citoplasmatică a fost marcată prin înmulțirea intensității și extensiei pentru VEGF (scorurile au variat de la 0 la 300) sau pata nucleară a fost marcată ca procent de celule pozitive (0-100%) pentru CD1, Ki-67 și p53 în bazal și epiteliul suprabazal. Intensitatea petei a fost definită după cum urmează: 0, fără colorare apreciabilă; 1, colorare abia detectabilă în comparație cu elementele stromale; 2, colorare ușor de apreciat; 3, colorare maro închis. În plus, intensitatea expresiei VEGF a celulelor stromale a fost înregistrată ca 0-3 pe baza intensității petei și expresia CD1 în stratul superficial epidermic a fost înregistrată ca „prezentă” sau „absentă”.

tabelul 1

Lista anticorpilor utilizați și a condițiilor de tratament pentru biopsia tisulară pentru evaluarea biomarkerului imunohistochimic efectuată la momentul inițial și în săptămâna 12

Fabricare
Numele clonei
2 0 2
bloc

Bloc proteic nespecific
Prima
concentrație de anticorpi
și timpul de
incubație
nd anticorp
polimer și
timpul de incubare
VEGFSanta Cruz Bio
Tech (Santa
Cruz, CA, SUA)
A-20,
RXH
22 ‘Bloc de
proteine ​​fără ser Dako
pentru 7 ‘
1: 200,65 ‘DAKO
LSAB + Streptavidin
pentru 15 ‘, HPR pentru
15′
Ciclina D1Lab Vision
(Fremont, CA,
SUA)
SP-4,
RXH
15 ‘10% FBS pentru
35 ‘
1: 100,65 ‘DAKO Envision
Link + pentru 30 ‘
Ki-67DAKO
(Carpinteria, CA,
SUA)
MIB-
1,
MXH
15 ‘10% FBS pentru
35 ‘
1: 200,65 ‘DAKO Envision
Link + pentru 30 ‘
P53DAKO
(Carpinteria, CA,
SUA)
Do-7,
MXH
15 ‘10% FBS pentru
35 ‘
1: 400,65 ‘DAKO Envision
Link + pentru 30 ‘

Analiza metilării – pirozecvențierea bisulfitului

Secțiunile biopsiilor leziunii au fost microdisecate pentru a obține celule epiteliale pentru extracția ADN genomic. ADN-ul genomic extras a fost utilizat pentru tratamentul cu bisulfit pentru a modifica reziduurile de citozină nemetilate. Piroza secvențierea a fost utilizată pentru a măsura cantitativ nivelurile de metilare a citozinei siturilor CpG ale promotorilor, așa cum s-a descris anterior ( 29 ). Primerii utilizați pentru pirozecvențierea bisulfitului regiunii promotorului p16 (CDKN2A) sunt enumerați aici: etapa PCR 1: p16-270F1 (GGGGTAGGTGGGGAGGAGTT), p16-270R1 (CCCCTCCTCTTTCTTCCTCC); Etapa 2 PCR: p16-169F2 (GGTTGTTTTAGGTTGGTGTTTT), p16-R-Biotin (Biotin-accctatccctcaaatcctctaaaa); Secvențiere: p16-Pyro1F (TTTTTGTTTGGAAAGAT), p16-S3F (GATTTTAGGGGTGTTATATT). Cuantificarea metilării citozinei a fost efectuată utilizând software-ul Pryo-Q-CpG (Biotage, Uppsala, Suedia).

Prelevarea de probe farmacocinetice

Probele de plasmă farmacocinetică au fost colectate la momentul inițial (înainte de tratament) și în ultima zi de intervenție activă în săptămâna 12, ziua 84 (cu 30 de minute înainte de fiecare dintre cele trei doze zilnice și la 3 ore după ultima doză). Timpul mediu scurs între administrarea medicamentului și recoltarea sângelui a fost de 3,3 ore. Sângele întreg a fost colectat și fiecare probă a fost plasată pe gheață imediat după colectare și centrifugată în 30 de minute la 4 ° C timp de 10 minute la 3000 rpm. Două alicote de 1 ml de plasmă au fost transferate în flacoane criogenice de polipropilenă de 5 ml (Corning, Corning, NY) și depozitate la -20 ° C sau mai rece până la analiză.

Metode de analiză farmacocinetică

Ambele concentrații de cafeină și EGCG au fost determinate folosind un test LC / MS / MS. O pompă LC serie Agilent 1100 (Agilent, Santa Clara, CA) a fost asociată cu un spectrometru de masă Micromass Quattro Micro (Waters, Milford, MA) utilizând software-ul MassLynx / QuanLynx pentru achiziționarea și prelucrarea datelor.

Cofeină

Cofeina a fost extrasă din 100 uL plasmă în duplicat folosind MTBE (Sigma-Aldrich, St. Louis, MO) și uscată la 40 ° C sub un flux de azot gazos ușor apoi reconstituită cu 200 uL 20:80, metanol: 0,2% acid formic (v : v). Separarea cromatografică a fost efectuată folosind o coloană analitică Phenomenex Luna C8, 50 × 2,1 mm, 3,5 µm timp de 7 minute la 0,35 ml / min folosind 15:85, metanol: 0,2% acid formic, (v: v) fază mobilă cu o fază liniară gradient la 95% metanol în primele 3 minute. Timpul de retenție a analitului a fost de 2,8 ± 0,1 minute. Spectrometrul de masă a monitorizat tranziția analitului de 195,4> 138,1 (m / z) în modul electrospray cu ionizare pozitivă (ESI +). Curba de calibrare (pătratică) a variat între 0,1 – 20 µg / mL. Pentru a evita interferențele datorate semnalului de fond ridicat al cofeinei din plasma umană donatoare,am achiziționat plasma rhesus proaspătă congelată și am folosit-o ca biomatrică pentru calibrare și probe de control al calității. Standard de referință pentru cafeină, USP a fost achiziționat de la Sigma-Aldrich.

EGCG neconjugat (gratuit)

EGCG a fost extras din 1 ml de plasmă în duplicat folosind MTBE și uscat la 40 ° C sub un flux de azot gazos ușor apoi reconstituit cu 100 uL 10:90, metanol: 0,2% acid formic (v: v). Separarea cromatografică s-a efectuat utilizând o coloană analitică Ascentis Express, 50 × 2,1 mm, 2,7 µm timp de 12 minute la 0,3 mL / min folosind 20:80; 1: 1, metanol: acetonitril: 0,2% acid formic, (v: v) fază mobilă cu un gradient liniar la 100% organic în primele 4,5 minute. Timpul de retenție analitică a fost de 6,1 ± 0,1 minute. Tranziția monitorizată a fost 456,8> 168,9 (m / z) în modul ESI (-). Curba de calibrare a variat între 1 – 1000 ng / ml.Mergi la:

Rezultate

Caracteristicile pacientului și ale tratamentului

Am înrolat 41 de pacienți între august 2002 și martie 2008 pentru a realiza 36 de pacienți evaluabili (9 pe braț). Dintre cei 41 de pacienți, 11 au fost randomizați la placebo, 11 la GTE la 500 mg / m 2 , 9 la GTE la 750 mg / m 2 și 10 la GTE la 1 g / m 2 administrat oral de trei ori pe zi. Analiza noastră de eficacitate a inclus 39 dintre acești pacienți, excluzând 2 care nu au avut o evaluare a eficacității pe 3 luni. Datele demografice inițiale ale pacienților sunt observate înmasa 2. Au fost paisprezece pacienți (34%) cu antecedente anterioare de cancer de cap și gât, dintre care unsprezece au avut anterior un cancer de limbă orală. Ceilalți trei pacienți au avut în antecedente un cancer laringian, o bază a limbii și un cancer amigdalian. Brațele au fost similare în ceea ce privește distribuția pacienților cu antecedente de cancer cu celule scuamoase la nivelul capului și gâtului. Distribuția consumului de tutun între grupurile de tratament a fost similară cu aproximativ 37% nefumători, 54% foști fumători și 10% fumători activi la momentul înscrierii în studiu. Numărul de foști și actuali utilizatori de alcool a fost similar între brațele de tratament, cu excepția mai puține niciodată adăpători în GTE (500 mg / m 2 ) brațul. Un pacient a avut utilizarea anterioară de nuci betel și a fost înscris în GTE 750 mg / m 2braţ. Pacienții au fost, de asemenea, evaluați pentru consumul de cofeină și 39 (95,1%) au utilizat anterior cofeină. Distribuția consumului de cofeină între grupurile de tratament a fost similară. Consumul actual de cofeină la momentul inițial a apărut la 25 (61%) pacienți cu băuturi răcoritoare, 21 (51,2%) cu cafea, 26 (63,4%) cu ceai și 27 (65,9%) cu ciocolată. Niciunul dintre pacienți nu a folosit sau nu a utilizat în prezent medicamente teofiline pentru o indicație medicală.

masa 2

Demografia pacientului

GTE
Placebo
(n = 11)
500 mg / m 2
(n = 11)
750 mg / m 2
(n = 9)
1000 mg / m 2
(n = 10)
Total
(n = 41)
Vârsta medie (interval)57 (33-76)57 (35-71)49 (41–71)59 (36-70)57 (33-76)
Sex, n (%)
  Masculin6 (54,5%)5 (45,5%)4 (44,4%)4 (40%)19 (46,3%)
  Femeie5 (45,5%)6 (45,5%)5 (55,6%)6 (60%)22 (53,7%)
Etnie, n (%)
  caucazian11 (100%)10 (90,9%)8 (88,9%)8 (80%)37 (90,2%)
  asiatic01 (9,1%)1 (11,1%)02 (4,9%)
  Hispanic0002 (20%)2 (4,9%)
Starea fumatului, n (%)
  Nu a fumat niciodată4 (36,4%)4 (36,4%)3 (33,3%)4 (40%)15 (36,6%)
  Fost fumator6 (54,5%)6 (54,5%)5 (55,6%)5 (50%)22 (53,7%)
  Fumător actual1 (9,1%)1 (9,1%)1 (11,1%)1 (10%)4 (9,8%)
Utilizarea trabucului
  Fost1 (9,1%)0001 (2,4%)
  Actual02 (18,2%)01 (10%)3 (7,3%)
Tutun fără fum
  Fost1 (9,1%)0001 (2,4%)
  Actual00000
Alcool, n (%)
  Nu2 (18,2%)1 (9,1%)2 (22,2%)3 (30%)8 (19,5%)
  Fost2 (18,2%)3 (27,3%)2 (22,2%)2 (20%)9 (22%)
  Actual7 (63,6%)7 (63,6%)5 (55,6%)5 (50%)24 (58,5%)
Antecedente anterioare de cancer, n (%)
  HNSCC3 (27,3%)4 (36,4%)3 (33,3%)4 (40%)14 (34,1%)
  Alte1 (9,1%)1 (9,1%)1 (11,1%)3 (30%)6 (14,6%)
Tratament anterior, n (%)
  Fără radioterapie prealabilă10 (90,9%)10 (90,9%)9 (100%)7 (70%)36 (87,8%)
  Fără intervenție chirurgicală anterioară3 (27,3%)01 (11,1%)04 (9,8%)
  Radioterapie prealabilă1 (9,1%)1 (9,1%)03 (30%)5 (12,2%)
  Operație anterioară8 (72,7%)11 (100%)8 (88,9%)10 (100%)37 (90,2%)
Histologie de bază, n (%)
  Hiperplazia5 (45,5%)2 (18,2%)2 (22,2%)2 (20%)11 (26,8%)
  Displazie ușoară5 (45,5%)5 (45,5%)7 (77,8%)6 (60%)23 (56,1%)
  Displazie moderată / -carcinom in situ1 (9,1%)4 (36,4%)02 (20%)7 (17,1%)

Eficacitate

Ratele de răspuns sunt raportate în Tabelul 3. Treizeci și nouă de pacienți au putut fi evaluați pentru evaluările răspunsului clinic și histologic de 12 săptămâni. Rata răspunsului clinic a fost mai mare în cele 3 brațe combinate GTE (50%) față de placebo (18,2%, p = 0,09), la fel ca și rata de răspuns histologic 21,4% (brațe GTE) față de 9,1% (placebo, p = 0,65). Rata de răspuns clinic a fost dependentă de doză de 58% , în combinație cu doze mai mari de arme GTE (750 mg / m 2 și 1000 mg / m 2 ) , comparativ cu 36,4% (GTE la 500 mg / m 2) și 18,2% (placebo; p = 0,03, test de tendință Cochran-Armtage). Dependența de doză nu a fost observată în răspunsul histologic (p = 0,68). La cei cincisprezece pacienți cu răspuns clinic, 3 au avut hiperkeratoză / hiperplazie, 9 au avut displazie ușoară și 3 au avut displazie moderată în biopsia tumorală inițială. În cei șapte respondenți histologici, 3 au avut displazie ușoară, 3 au avut displazie moderată și 1 au avut displazie severă. Nu au existat corelații între rata de răspuns clinic sau histologic de 12 săptămâni și datele demografice inițiale ale pacienților, cu excepția unei rate mai mari de răspuns histologic de 12 săptămâni la cei care nu au băut niciodată (p = 0,01). Nici consumul de cofeină, nici istoricul anterior al cancerului nu au afectat rata de răspuns clinic sau histologic.Fig. 1 ilustrează exemple de răspuns clinic și histologic la tratamentul GTE.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms631495f1a.jpg

Un fișier extern care conține o imagine, o ilustrare etc. Numele obiectului este nihms631495f1b.jpg

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms631495f1c.jpg

Un fișier extern care conține o imagine, o ilustrare etc. Numele obiectului este nihms631495f1d.jpg

figura 1

a) Exemplu fotografic al unui pacient OPL cu risc ridicat la momentul inițial; b) același pacient după tratamentul cu GTE care demonstrează un răspuns clinic; c) exemplu histologic de bază al unui pacient OPL cu risc ridicat la momentul inițial care demonstrează displazie; d) același pacient care demonstrează un răspuns histologic după tratamentul cu GTE.

Tabelul 3

Rezultate de eficacitate (n = 39)

GTE
Parametru de eficacitatePlacebo
(n = 11)
500 mg / m 2
(n = 11)
750 mg / m 2
(n = 8)
1000 mg / m 2
(n = 9)
Toate dozele de GTE
(n = 28)
Valoarea P
Răspuns clinic18,2%50%0,09
CR01001
relatii cu publicul235513
SD44116
PD53238
Răspuns histologic9,1%21,4%0,65
relatii cu publicul13036
SD755313
PD33339

Cu un timp mediu de urmărire de 27,5 luni, 15 pacienți au dezvoltat ulterior cancer oral, cu un timp mediu până la dezvoltarea cancerului oral de 46,4 luni. Nu a existat nicio diferență în supraviețuirea orală fără cancer între brațele GTE și placebo. Niciuna dintre datele demografice inițiale ale pacienților despre vârstă, sex, stare de fumat și nici antecedente de alcool nu s-au corelat cu dezvoltarea cancerului oral. Cu toate acestea, la pacienții cu displazie ușoară până la moderată, a existat un timp mediu mai scurt până la dezvoltarea cancerului oral de 35,9 luni în comparație cu pacienții cu hiperplazie, unde timpul mediu până la dezvoltarea cancerului oral nu a fost atins (p = 0,005). Nici un răspuns clinic sau histologic la intervenția GTE nu a fost asociat cu dezvoltarea cancerului oral.

Toxicitate

În general, terapia a fost bine tolerată și sigură, cu evenimente adverse legate de tratament raportate de 28 din cei 30 (93,3%) pacienți care au primit GTE și 9 din cei 11 (81,8%) pacienți care au primit placebo. Tabelul 4rezumă informațiile despre evenimentele adverse. Cele mai frecvent raportate evenimente adverse de gradul 1-2 au fost insomnia, cefaleea, greața și nervozitatea; incidența insomnie și nervozitate a fost mai mare la pacienții care au primit GTE la 750 mg / m 2 și 1 g / m 2 . Insomnia a fost raportată la 11 (36,7%) pacienți care au primit GTE și la 2 (18,2%) care au primit placebo. Au fost raportate doar trei evenimente adverse de gradul 3 și niciun eveniment advers de gradul 4 sau 5. Toxicitate de grad 3 a fost raportată de 2 pacienți care au primit GTE 750 mg / m 2 și a inclus insomnie, diaree și durere / gât oral. Doi pacienți, unul în fiecare braț GTE 750 mg / m 2 și GTE 1 / gm m 2) întreruperea tratamentului din cauza efectelor secundare ale insomniei, simptomelor gastrointestinale (diaree, flatulență) și nervozitate. Nu au existat diferențe semnificative în rezultatele hematologice sau chimice ale sângelui între brațele GTE și placebo la momentul inițial și săptămâna 12 de tratament.

Tabelul 4

Cele mai frecvente evenimente adverse Clase 1-2

GTE
Evenimente adversePlacebo
(n = 11)
500 mg / m 2
(n = 11)
750 mg / m 2
(n = 9)
1 gm / m 2
(n = 10)
Toate dozele
(n = 30)
Insomnie18,2%18,2%44,4%50%36,7%
Greaţă0%36,4%22,2%30%30%
Nervozitate9,1%9,1%11,1%60%26,7%
Durere de cap18,2%27,3%11,1%40%26,7%
Dispepsie18,2%9,1%11,1%20%13,3%
Flatulență9,1%9,1%11,1%20%13,3%
Diaree18,2%9,1%11,1%10%10%
Durere abdominală18,2%9,1%11,1%0%6,7%
Dureri de spate9,1%9,1%0%10%6,7%
EKG anormal0%9,1%0%10%6,7%
Reflux gastric0%9,1%11,1%0%6,7%
Ameţeală0%9,1%0%10%6,7%
Rinita0%0%22,2%0%6,7%
Sinuzită0%0%11,1%10%6,7%
Zvâcnirea pleoapelor0%18,2%0%0%6,7%
Frecvența urinării0%9,1%0%10%6,7%
Constipație9,1%0%11,1%0%3,3%
Parestezie9,1%0%0%10%3,3%

Rezultate farmacocinetice

Cofeină

Concentrațiile de cafeină în plasmă în ziua 84 au fost dependente de doză și program (TID), variind de la 0,75-2,78 µg / mL în brațul de 500 mg / m 2 până la 6,49-13,07 µg / mL în brațul de 1000 mg / m 2 (Fig. 2). De 5 ori mai mare , concentrația plasmatică maximă medie (12,29 versus 2,14) observată după 1000 mg / m 2 de dozare a fost cel mai probabil , motivul pentru insomnie crescută și nervozitate în acest braț al studiului. Toate concentrațiile din brațul placebo au fost <0,1 ug / ml. Acumulare interday dependentă de doză de cafeină a fost observată în 1000 mg / m 2 brațul atunci când se compară concentrațiile medii minime după ultima doză din ziua precedentă. Concentrațiile minime au fost de 8 ori mai mare (6,92 vs. 0,84) în 1000 mg / m 2 brațul în comparație cu mg / m 500 2 brațul totuși diferența de doză a fost doar de 2 ori. Rezultate similare au fost observate la compararea C maxconcentrații pe o perioadă de 8 săptămâni care au arătat în mod clar o acumulare dependentă de timp de cofeină în studiul de fază I ( 23 ). Căderea așteptat concentrației plasmatice între ultima doză din ziua precedentă și prima doză a doua zi , în 500 mg / m 2 corelările braț bine cu raportată înjumătățire plasmatică terminal pentru cofeina de 5 – 7 ore , dar nu pentru brațul de 1000 mg / m 2 . Acest lucru se poate datora unei interacțiuni medicamentoase între cafeină și catechine din GTE, deoarece ambele sunt metabolizate în ficat prin intermediul enzimelor citocromului P450 ( 30 ). Din eșantionarea limitată de PK disponibilă, nu a existat nicio corelație între răspunsul clinic sau histologic și nivelurile de cofeină.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms631495f2.jpg

Figura 2

Creșteri dependente de doză ale concentrațiilor de cofeină în timpul administrării TID în ziua 84 a GTE. Acumulare dependentă de timp de cafeină timp de 12 saptamani de la GTE este dezvăluit de 8 ori mai mare , concentrația medie minimă observată la 1000 mg / m 2 doză. Timpul mediu scurs între administrarea medicamentului și prelevarea sau prelevarea de sânge după doză a fost de 3,3 ore. Fiecare simbol reprezintă concentrațiile medii aritmetice ± SD.

EGCG

Concentrațiile de liberă EGCG a ajuns la aproape 1 pM , dar au fost relativ mai dezordonat decat cafeina cu o mare variabilitate interindividuală a 1000 mg / m 2 braț. Ziua 84 Concentrațiile plasmatice au variat 1.7-75.3 ng / ml în 500 mg / m 2 braț și 5.7-435.2 ng / ml în mg / m 1000 2 brațul cu concentrațiile maxime de 22.1-75.3 ng / ml și 8.7-435.2 ng / ml, respectiv (Fig. 3). Se pare că există o tendință spre o creștere dependentă de doză în concentrație de EGCG dar distincția nu este la fel de evident ca și cu cafeină datorită gamei largi de concentrații observate la 1000 mg / m 2 doză. Motivele posibile pentru aceasta sunt absorbția orală foarte slabă a EGCG (<1%) sau diferențele de capacitate metabolică dinamică dintre acești câțiva pacienți în momentul administrării ( 30 , 31 ). EGCG gratuit reprezintă doar 12-28% din EGCG total (conjugat și neconjugat), formele principale conjugate fiind produse glucoronidate și sulfatate ( 32). Nu se poate observa nicio diferență semnificativă în concentrațiile minime în ziua 84. Toate concentrațiile placebo au fost <2,0 ng / ml. Din eșantionarea limitată PK disponibilă, nu a existat nicio corelație între răspunsul clinic sau histologic și nivelurile de EGCG.

Un fișier extern care conține o imagine, o ilustrare etc. Numele obiectului este nihms631495f3.jpg

Figura 3

O tendință către o creștere dependentă de doză a concentrațiilor plasmatice de EGCG în timpul administrării TID a extractului de ceai verde (GTE). Fiecare simbol reprezintă concentrațiile medii aritmetice ± SD. Datele arată o anumită acumulare dependentă de doză de EGCG pe parcursul perioadei de eșantionare de aproximativ 9-12 ore , deși variabilitate a concentrațiilor plasmatice de la 1000 mg / m 2 este foarte mare. Concentrațiile minime după ultima doză din ziua precedentă sunt similare pentru ambele brațe și nu se observă o acumulare semnificativă de medicament.

Rezultatele biomarkerului

Analizele de bază au fost efectuate la 35 de eșantioane de țesut pentru VEGF epitelial, expresie p53 și Ki-67 și la 34 de eșantioane de țesut pentru VEGF stromal și expresie CD1. Analizele de trei luni (post-tratament) au fost efectuate la 34 de eșantioane de țesut pentru VEGF epitelial și p53, la 35 de eșantioane pentru Ki-67 și la 33 de eșantioane pentru VEGF stromal și expresie CD1. Singura diferenta semnificativa statistic in biomarkeri de referinta printre brate de studiu a fost o expresie p53 mai mica in 1000 mg / m 2braț (p = 0,007). Nici un nivel de biomarker inițial nu a fost corelat cu datele demografice ale vârstei, sexului, stării de fumat sau consumului de alcool. Cu toate acestea, s-au găsit valori de bază și valori medii mai mari ale VEGF stromal (p = 0,24), p53 (p = 0,34), Ki-67 (p = 0,055) și CD1 (p = 0,04) în displazia ușoară / moderată față de cohorta de hiperplazie (testul sumelor de rang Wilcoxon). Nivelurile de VEGF epitelial au fost aceleași în hiperplazia și în cohortele de displazie ușoară / moderată (p = 1,0).

Nivelurile de expresie inițiale ale biomarkerilor au fost analizate atât în ​​raport cu ratele de răspuns clinic și histologic; și niciunul dintre scorurile de bază ale expresiei biomarkerului, cu excepția celui al VEGF stromal, corelat cu răspunsul. Un scor VEGF stromal inițial mai mare a fost asociat cu un răspuns clinic mai bun la tratamentul cu GTE; cu un nivel mediu de exprimare de 3 în grupul cu răspuns parțial versus 1 în grupul de boală stabilă / boală progresivă (p = 0,02, testul sumelor de rang Wilcoxon). Analiza multi-covariabilă a susținut această constatare arătând că un nivel de bază ridicat al VEGF stromal este singurul predictor cel mai semnificativ pentru răspunsul clinic. Interesant, acest efect a fost observat și la cei 2 pacienți cu remisii spontane în grupul placebo, unde nivelul lor mediu de VEGF stromal de bază a fost de 2.5 comparativ cu nivelul mediu de exprimare inițial de 1 la pacienții cu boală stabilă sau progresivă. Cu toate acestea, această asociere a VEGF stromal la răspuns nu a fost duplicată în evaluarea răspunsului histologic.

Pentru a evalua efectul tratamentului asupra modulației biomarkerilor, nivelul de expresie al biomarkerilor la momentul inițial a fost scăzut din cei obținuți la 12 săptămâni. În general, nu a existat nicio diferență în modularea biomarkerului între cele 3 doze diferite de tratament cu GTE. Cu toate acestea, a existat mai puțină reglare a VEGF stromal în grupul global GTE în comparație cu cea observată în grupul placebo (nivelurile medii VEGF stromale 0,13 față de 0,67, nivelurile mediane 0 față de 1, p = 0,15). În analiza subgrupului de respondenți clinici, tratamentul cu GTE a condus la niveluri mai scăzute de expresie stromală VEGF și CD1 la 12 săptămâni, spre deosebire de cei care nu răspundeau (boală stabilă și progresivă) care au avut o creștere a expresiei stromale VEGF și CD1 la 12 săptămâni. . Aceste diferențe în modularea biomarkerului nu au atins semnificație statistică din cauza numărului mic de pacienți.În grupul placebo (n = 10), s-a observat o tendință spre reglarea descendentă a p53, Ki-67 și CD1 la cei 2 pacienți cu răspuns clinic și în timp ce aceiași biomarkeri au fost reglați în sus în grupul care nu răspundea.

Analiza univariată a modelului Cox a fost realizată utilizând nivelurile de expresie a biomarkerului ca variabilă continuă și a demonstrat că nivelurile mai ridicate ale următorilor biomarkeri de bază au dus la un risc mai mare de dezvoltare a cancerului oral: VEGF stromal (HR 1,88, p = 0,08), p53 (HR 18,2 , p = 0,001), Ki-67 (HR 20,8, p = 0,04) și CD1 (HR 7,4, p = 0,07). Atunci când se utilizează nivelul de expresie median al biomarkerilor, analiza univariată a remarcat, de asemenea, că expresia p53 și Ki-67 peste nivelul median au fost asociate cu un risc mai mare de dezvoltare a cancerului oral (HR 3.1, p = 0.049; HR 3.1, p = 0,06, respectiv). În analiza Cox multivariată la ajustarea pentru histologie, niveluri mai ridicate de p53 prezise pentru o supraviețuire mai gravă fără cancer oral (HR 12,7, p = 0,004).

Analiza de metilare a promotorului p16 a celor 19 specimene de țesut cu țesut suficient pentru analiză a arătat că 5 pacienți au metilare a promotorului p16 la momentul inițial, comparativ cu 14 care nu. La acești 5 pacienți, supraviețuirea mediană fără cancer a fost de 31 de luni, în timp ce pacienții fără metilare inițială a promotorului p16 nu au atins încă supraviețuirea lor mediană fără cancer (p = 0,35). Doar 7 pacienți din studiu au asociat probe de țesut atât din pre-, cât și post-tratament, care au dat rezultate de metilare. La acești șapte pacienți, cinci nu au prezentat metilare a promotorului p16 la momentul inițial și au rămas nemetilați după tratamentele respective. Doi pacienți au avut p16 metilare promotor inițial și ambele au fost tratate pe GTE 500 mg / m 2braţ. Analiza țesutului de tratament post-GTE nu a arătat modularea stării de metilare a promotorului p16 la nici unul dintre cei doi pacienți.Mergi la:

Discuţie

Cele două doze mai mari de GTE în acest studiu controlat cu placebo au produs o tendință către un răspuns clinic mai mare în asociere cu un nivel inițial ridicat și reglarea descendentă a VEGF stromal angiogen. Aceste descoperiri corelative sugerează că activitatea potențială de prevenire a GTE poate fi legată mecanic de inhibarea angiogenezei, despre care se crede că promovează carcinogeneza în condiții premaligne. Populația cu studii mici nu a permis ca analiza noastră a VEGF stromal reglat în jos să atingă semnificația statistică și, prin urmare, nu am putut stabili că modularea acestui biomarker a fost direct legată de activitatea GTE; acest rezultat este totuși consecvent cu datele preclinice care susțin proprietățile anti-angiogenice ale EGCG ( 18 – 20 , 33 , 34). EGCG scade neovascularizarea prin reglarea descendentă a VEGF și scade creșterea celulelor endoteliale prin creșterea factorului-2 de creștere a fibroblastelor ( 19 ). În cap și gât, sân și alte linii celulare de cancer epitelial, tratamentul EGCG a condus la secreția redusă a VEGF ( 18 ) și la legarea de receptorul său ( 35 ).

Evaluările și interpretările biomarkerului într-un studiu clinic sunt dificile și provocatoare. Am evaluat 6 biomarkeri pe bază de țesut – Ki-67, p53, CD1 și p16 metilarea promotorului și VEGF epitelial și stromal legat de angiogeneză. Ki-67 ca marker al fracțiunii proliferative a celulelor OPL părea să crească pe măsură ce țesutul a trecut de la histologia normală la hiperplazie, la displazie la cancer. Mutațiile p53 apar la 40% -50% din cancerele de celule scuamoase ale capului și gâtului și sunt asociate cu o expresie imunohistochimică crescută a p53 în celulele maligne ( 36 , 37). Nu am găsit o corelație între nivelurile expresiei Ki-67 sau p53 și nici un răspuns clinic sau histologic. Un nivel inițial mai ridicat de p53 (peste mediană) a fost, totuși, asociat cu o supraviețuire mai gravă fără cancer oral în analiza noastră multivariantă. Acest rezultat este în concordanță cu studiile anterioare în care supraexprimarea proteinei p53 a apărut frecvent în OPL, cu un răspuns scăzut la chimioprevenția retinoidă și rate crescute de boală progresivă sau cancer ( 38 ).

Amplificarea genei CD1 apare frecvent și este asociată cu o instabilitate genomică crescută în tumorile cu celule scuamoase ale capului și gâtului ( 39 , 40 ). Supraexprimarea CD1 permite celulelor să intre continuu în faza S independent de semnalele stimulatoare externe. Deoarece dereglarea ciclului celular, în special întreruperea punctului de control G1-S, este importantă pentru tumorigeneză la nivelul capului și gâtului, CD1 este un important marker potențial al riscului OPL de cancer oral ( 39 , 41 ). Studiile anterioare au arătat că expresia CD1 de bază are cea mai mare corelație cu riscul crescut de cancer ( 41 , 42). Această constatare implică în mod specific proteina CD1 alternativă trunchiată, despre care se suspectează că este un oncogen nuclear ( 43 ). În studiul nostru, nivelul median al CD1 a fost mai mare la respondenții clinici decât la cei care nu au răspuns (p = 0,9287), iar reducerea reglării CD1 a fost observată la respondenții clinici, în timp ce CD1 a fost reglat la pacienții cu boală stabilă sau progresivă. Deși niveluri mai ridicate ale CD1 inițiale au fost asociate cu un risc mai mare de dezvoltare a cancerului oral (HR 7,4, p = 0,07) în analiza noastră univariată, un rezultat care este în concordanță cu observațiile noastre anterioare ( 39 , 41 ), acest efect a fost mai slab în analiza multivariată. Aceste date se adaugă la tot mai multe dovezi că CD1 poate fi o moleculă de reglare importantă în OPL.

S-a raportat că metilarea promotorului p16 prezice transformarea malignă a leziunilor epiteliale orale ( 44 , 45 ). EGCG a inhibat activitatea ADN-metiltransferazei și a genelor potențial reactivate cu metilare-tăcere în studii preclinice ( 46 ). Concluziile despre acest marker nu au fost posibile, totuși, în analiza noastră limitată. Doar 2 pacienți, ambii au primit 500 mg / m 2din GTE, a avut metilarea inițială a promotorului p16 care ar putea fi evaluată după tratament, ceea ce nu a inversat starea de metilare la niciunul dintre pacienți. Metilarea inițială a promotorului p16 a apărut la 5 pacienți în general, care au avut o supraviețuire mai scurtă fără cancer decât cei 14 pacienți fără această metilare; această diferență nu a atins semnificația statistică, totuși, din cauza numărului limitat de pacienți.

De asemenea, am analizat farmacocinetica componentelor GTE cofeină și EGCG. O analiză anterioară de fază I ( 23 ) a constatat că acumularea de cofeină era dependentă de doză, dar nivelurile de EGCG nu s-au acumulat și nici nu păreau să fie legate de doză. Analiza noastră actuală confirmă creșterea dependentă de doză a concentrațiilor intraday de cafeină în timpul administrării TID de GTE, cu cele mai mari concentrații maxime care apar după ultima doză zilnică (seara). Această constatare explică cel mai probabil incidența mai mare a insomniei și nervozității la doze mai mari de GTE. Nivelurile EGCG au fost prea neregulat pentru a stabili dependență de doză, dar cea mai mare concentrație de vârf de EGCG în mg / m 1000 2 brațul a fost mai mare de 5 ori mai mare decât cea mai mare concentrație de vârf în 500 mg / m 2braţ. Lipsa acumulării de EGCG a fost confirmată în acest studiu și cel mai probabil se datorează biodisponibilității slabe a GTE orală la majoritatea pacienților noștri. Se dezvoltă analogi EGCG orali cu o biodisponibilitate îmbunătățită și, în consecință, concentrații crescute în plasmă.

Produsele de ceai verde promițătoare în cercetarea activă de prevenire a cancerului includ GTE și polifenonul E (Poly E), care sunt proeminenți în cercetarea clinică, și EGCG singur. Atât GTE, cât și Poly E conțin mai multe catechine, inclusiv EGCG cel mai abundent, și poate că distincția majoră dintre ele este cofeina, care este prezentă în GTE, dar nu și în Poly E. Promisiunea amestecurilor de catechine care conțin EGCG a fost întărită prin studii la șoareci care arată că Poli E are efecte mai puternice împotriva cancerului pulmonar decât EGCG singur sau Poli E modificat (eliminat de EGCG; referințe. ( 13 , 14 , 47). Un aspect important al cercetărilor viitoare este acela de a standardiza cât mai mult posibil formularea și conținutul de GTE natural sau Poly E (nu numai constituenții activi, dar și cei care se cred inactivi) care sunt utilizați în cercetare, astfel încât să îmbunătățească interpretarea obiectivă a diferitelor încercări ale aceluiași agent ( 48 ). De exemplu, validitatea testării de urmărire a potențialului clinic pe care îl raportăm aici va depinde în mare măsură de formularea GTE în viitor, aceeași sau foarte similară cu cea a studiului actual.

Actuala sugestie a biomarkerului că un răspuns clinic la GTE poate implica inhibarea angiogenezei este doar preliminară, iar capacitatea GTE de a preveni progresia clinică a OPL rămâne incertă. Răspunsul clinic din studiul nostru nu a fost asociat cu un risc scăzut de cancer oral. Prin urmare, este posibil ca intervenția GTE să nu fi fost suficientă și / sau răspunsul clinic OPL să nu fie un marker surogat intermediar valid pentru dezvoltarea cancerului, lăsând necesitatea unor markeri surogat adevărați. În ceea ce privește prima posibilitate, descoperirile noastre clinice pot indica faptul că GTE nu a fost administrat suficient de mult și, prin urmare, nu a reușit să inverseze complet modificările genetice OPL și, în cele din urmă, să prevină progresia. Am arătat acest efect în OPL-uri tratate cu retinoizi, unde un beneficiu de prevenire tranzitorie s-a oprit odată cu întreruperea terapiei cu retinoizi ( 2425 , 27 ). În ceea ce privește a doua posibilitate, alte studii de prevenire au indicat că răspunsul OPL la tratament nu s-a corelat cu scăderea dezvoltării cancerului ( 41 , 49 ). Prin urmare, identificarea biomarkerilor moleculari care pot servi drept markeri surogat pentru eficacitatea preventivă rămâne o prioritate de cercetare și ar trebui încorporată în viitoarele studii clinice îndreptate spre dezvoltarea unor strategii personalizate de chemoprevenție în cadrul OPL. De exemplu, rezultatele noastre actuale sugerează că nivelurile de VEGF stromale merită investigații prospective suplimentare pentru capacitatea lor de a servi ca biomarker predictiv al tratamentului GTE.

În concluzie, dozele mai mari de GTE timp de 12 săptămâni în studiul nostru au condus la o rată de răspuns clinic mai mare, dar nu au generat o îmbunătățire a supraviețuirii orale fără cancer. Rămâne neclar dacă o durată mai lungă de GTE ar fi condus la un beneficiu preventiv mai mare, dar se pare că GTE administrat la 750 mg / m 2 –1000 mg / m 2 TID este fezabil pe o perioadă mai lungă de timp. Prin urmare, rezultatele noastre clinice actuale susțin studiile viitoare de monoterapie cu GTE administrate pentru o perioadă mai lungă de timp sau în combinație cu un agent vizat, cum ar fi un inhibitor al receptorului factorului de creștere epidermic. Potențialul sinergism al EGCG și al factorilor de creștere epidermici inhibitori ai tirozin kinazei în inhibarea creșterii celulelor tumorale aerodigestive a fost demonstrat în studii preclinice ( 50 –53 ).Mergi la:

Mulțumiri

Mulțumim dr. Robert Newman pentru expertiza sa și revizuirea critică a farmacocineticii din acest manuscris și Nancy Shinn, RN, pentru excelența sa în coordonarea cercetării clinice.Mergi la:

Note de subsol

Dezvăluirea potențialelor conflicte de interese

YM Sagesaka este angajat al Ito En, Ltd., care a finanțat procesul raportat aici. WK Hong este consilier al Ito En, Ltd.Mergi la:

Referințe

1. Petti S. Estimare colectată a prevalenței leucoplaziei mondiale: o analiză sistematică. Oncol oral. 2003; 39 : 770–780. [ PubMed ] [ Google Scholar ]2. Fuller CD, Wang SJ, Thomas CR, Jr., Hoffman HT, Weber RS, Rosenthal DI. Supraviețuirea condiționată în carcinomul cu celule scuamoase la cap și gât: rezultate din setul de date SEER 1973-1998. Cancer. 2007; 109 : 1331–1343. [ PubMed ] [ Google Scholar ]3. Braakhuis BJ, Tabor MP, Kummer JA, Leemans CR, Brakenhoff RH. O explicație genetică a conceptului Slaughter de cancerizare pe teren: dovezi și implicații clinice. Cancer Res. 2003; 63 : 1727–1730. [ PubMed ] [ Google Scholar ]4. Silverman S, Jr., Gorsky M, Lozada F. Leucoplazie orală și transformare malignă. Un studiu de urmărire a 257 de pacienți. Cancer. 1984; 53 : 563-568. [ PubMed ] [ Google Scholar ]5. Hittelman WN, Voravud N, Shin DM, Lee JS, Ro JY, Hong WK. Modificări genetice timpurii în timpul tumorigenezei tractului aerodigestiv superior. J Cell Biochem Suppl. 1993; 17F : 233–236. [ PubMed ] [ Google Scholar ]6. Zhang L, Cheung KJ, Jr., Lam WL, Cheng X, Poh C, Priddy R, Epstein J, Le ND, Rosin MP. Creșterea leziunilor genetice în leucoplakia orală de la siturile cu risc ridicat: impact potențial asupra stadializării și managementului clinic. Cancer. 2001; 91 : 2148-2155. [ PubMed ] [ Google Scholar ]7. Mao L, Lee JS, Fan YH, Ro JY, Batsakis JG, Lippman S, Hittelman W, Hong WK. Modificări frecvente ale microsateliților la cromozomii 9p21 și 3p14 în leziunile premaligne orale și valoarea acestora în evaluarea riscului de cancer. Nat Med. 1996; 2 : 682-685. [ PubMed ] [ Google Scholar ]8. Rosin MP, Cheng X, Poh C, Lam WL, Huang Y, Lovas J, Berean K, Epstein JB, Priddy R, Le ND, Zhang L. Utilizarea pierderii alelice pentru a prezice riscul malign de displazie epitelială orală de grad scăzut . Clin Cancer Res. 2000; 6 : 357–362. [ PubMed ] [ Google Scholar ]9. Papadimitrakopoulou V, Izzo J, Lippman SM, Lee JS, Fan YH, Clayman G, Ro JY, Hittelman WN, Lotan R, Hong WK, Mao L. Inactivarea frecventă a p16INK4a în leziunile premaligne orale. Oncogene. 1997; 14 : 1799–1803. [ PubMed ] [ Google Scholar ]10. Fujiki H, Yoshizawa S, Horiuchi T, Suganuma M, Yatsunami J, Nishiwaki S, Okabe S, Nishiwaki-Matsushima R, Okuda T, Sugimura T. Efecte anticarcinogene ale (-) – epigallocatechin gallate. Anterior Med. 1992; 21 : 503-509. [ PubMed ] [ Google Scholar ]11. Fujiki H, Suganuma M, Okabe S, Sueoka E, Suga K, Imai K, Nakachi K, Kimura S. Constatări mecaniciste ale ceaiului verde ca cancer preventiv pentru oameni. Proc Soc Exp Biol Med. 1999; 220 : 225–228. [ PubMed ] [ Google Scholar ]12. Yang CS, Wang ZY. Ceai și cancer. J Natl Cancer Inst. 1993; 85 : 1038-1049. [ PubMed ] [ Google Scholar ]13. Bode AM, Dong Z. Epigallocatechin 3-Gallate și Ceaine verzi Catechine: Împreună funcționează, împărțiți eșuează. Cancer Prev Res (Phila Pa) 2009 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]14. Fu H, He J, Mei F, Zhang Q, Hara Y, Ryota S, Lubet R, Chen R, Chen D, MY Pulmon Cancer Inhibitory Effect of Epigallocatechin-3-Gallate depinde de prezența sa într-un amestec complex ( Polifenon E) Cancer Prev Res (Phila Pa) 2009; 2 : 531-537. [ PubMed ] [ Google Scholar ]15. Ahmad N, Cheng P, Mukhtar H. Disregularea ciclului celular prin ceai verde polifenol epigalocatechin-3-galat. Biochem Biophys Res Commun. 2000; 275 : 328–334. [ PubMed ] [ Google Scholar ]16. Hastak K, Agarwal MK, Mukhtar H, Agarwal ML. Ablația fie a p21, fie a Bax previne apoptoza dependentă de p53 indusă de polifenolul de ceai verde epigalocatechin-3-galat. Faseb J. 2005; 19 : 789–791. [ PubMed ] [ Google Scholar ]17. Lamy S, Gingras D, Beliveau R. Catechinele de ceai verde inhibă fosforilarea receptorilor factorului de creștere endotelial vascular. Cancer Res. 2002; 62 : 381–385. [ PubMed ] [ Google Scholar ]18. Masuda M, Suzui M, Lim JT, Deguchi A, Soh JW, Weinstein IB. Epigalocatechin-3-galatul scade producția de VEGF în celulele carcinomului capului și gâtului și sânului prin inhibarea căilor de transducție a semnalului legate de EGFR. J Exp Ther Oncol. 2002; 2 : 350–359. [ PubMed ] [ Google Scholar ]19. Cao Y, Cao R. Angiogeneza inhibată de consumul de ceai. Natură. 1999; 398 : 381. [ PubMed ] [ Google Scholar ]20. Beltz LA, Bayer DK, Moss AL, Simet IM. Mecanisme de prevenire a cancerului prin polifenoli ai ceaiului verde și negru. Agenți anticanceroși Med Chem. 2006; 6 : 389–406. [ PubMed ] [ Google Scholar ]21. Yang CS, Lambert JD, Ju J, Lu G, Sang S. Ceaiul și prevenirea cancerului: mecanisme moleculare și relevanță umană. Toxicol Appl Pharmacol. 2007; 224 : 265-273. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]22. Imai K, Suga K, Nakachi K. Efectele preventive ale cancerului ale consumului de ceai verde în rândul unei populații japoneze. Anterior Med. 1997; 26 : 769–775. [ PubMed ] [ Google Scholar ]23. Pisters KM, Newman RA, Coldman B, Shin DM, Khuri FR, Hong WK, Glisson BS, Lee JS. Test de fază I a extractului de ceai verde pe cale orală la pacienții adulți cu tumori solide. J Clin Oncol. 2001; 19 : 1830–1838. [ PubMed ] [ Google Scholar ]24. Papadimitrakopoulou VA, Hong WK, Lee JS, Martin JW, Lee JJ, Batsakis JG, Lippman SM. Doză mică de izotretinoină versus beta-caroten pentru a preveni carcinogeneza orală: urmărire pe termen lung. J Natl Cancer Inst. 1997; 89 : 257–258. [ PubMed ] [ Google Scholar ]25. Hong WK, Endicott J, Itri LM, Doos W, Batsakis JG, Bell R, Fofonoff S, Byers R, Atkinson EN, Vaughan C, și colab. Acid 13-cis-retinoic în tratamentul leucoplaziei orale. N Engl J Med. 1986; 315 : 1501-1505. [ PubMed ] [ Google Scholar ]26. Pocock SJ, Simon R. Atribuirea tratamentului secvențial cu echilibrarea factorilor de prognostic în studiul clinic controlat. Biometrie. 1975; 31 : 103–115. [ PubMed ] [ Google Scholar ]27. Lippman SM, Batsakis JG, Toth BB, Weber RS, Lee JJ, Martin JW, Hays GL, Goepfert H, Hong WK. Compararea izotretinoinei cu doze mici cu beta caroten pentru a preveni carcinogeneza orală. N Engl J Med. 1993; 328 : 15–20. [ PubMed ] [ Google Scholar ]28. Tang X, Varella-Garcia M, Xavier AC, Massarelli E, Ozburn N, Moran C, Wistuba II. Anomalii ale receptorilor factorului de creștere epidermică în patogeneza și progresia adenocarcinoamelor pulmonare. Cancer Prev Res (Phila Pa) 2008; 1 : 192–200. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]29. Issa JP, Gharibyan V, Cortes J, Jelinek J, Morris G, Verstovsek S, Talpaz M, Garcia-Manero G, Kantarjian HM. Studiu de fază II a decitabinei cu doze mici la pacienții cu leucemie mielogenă cronică rezistentă la imatinib mesilat. J Clin Oncol. 2005; 23 : 3948–3956. [ PubMed ] [ Google Scholar ]30. Moridani MY, Scobie H, Salehi P, O’Brien PJ. Metabolizarea catechinelor: formarea conjugatului glutation catalizat de tirozinază, peroxidază și citocrom p450. Chem Res Toxicol. 2001; 14 : 841–848. [ PubMed ] [ Google Scholar ]31. Henning SM, Niu Y, Lee NH, Thames GD, Minutti RR, Wang H, Go VL, Heber D. Biodisponibilitate și activitate antioxidantă a flavanolilor de ceai după consumul de ceai verde, ceai negru sau un supliment de extract de ceai verde. Sunt J Clin Nutr. 2004; 80 : 1558–1564. [ PubMed ] [ Google Scholar ]32. Lee MJ, Wang ZY, Li H, Chen L, Sun Y, Gobbo S, Balentine DA, Yang CS. Analiza polifenolilor din ceai cu plasmă și urină la subiecți umani. Biomarkeri de epidemiol pentru cancer Prev. 1995; 4 : 393-399. [ PubMed ] [ Google Scholar ]33. Cao Y, Cao R, Brakenhielm E. Mecanisme antiangiogene ale polifenolilor derivați din dietă. J Nutr Biochem. 2002; 13 : 380–390. [ PubMed ] [ Google Scholar ]34. Jankun J, Selman SH, Swiercz R, Skrzypczak-Jankun E. De ce consumul de ceai verde ar putea preveni cancerul. Natură. 1997; 387 : 561. [ PubMed ] [ Google Scholar ]35. Kondo T, Ohta T, Igura K, Hara Y, Kaji K. Catechinele de ceai inhibă angiogeneza in vitro, măsurată prin creșterea celulelor endoteliale umane, migrarea și formarea tuburilor, prin inhibarea legării receptorului VEGF. Rac Lett. 2002; 180 : 139–144. [ PubMed ] [ Google Scholar ]36. Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, Couch MJ, Forastiere AA, Sidransky D. Asociere între fumatul țigării și mutația genei p53 în carcinomul cu celule scuamoase al capului și gâtului. N Engl J Med. 1995; 332 : 712–717. [ PubMed ] [ Google Scholar ]37. Nees M, Homann N, Discher H, Andl T, Enders C, Herold-Mende C, Schuhmann A, Bosch FX. Exprimarea p53 mutantă apare la epiteliile la distanță tumorală ale pacienților cu cancer de cap și gât: o posibilă bază moleculară pentru dezvoltarea mai multor tumori. Cancer Res. 1993; 53 : 4189–4196. [ PubMed ] [ Google Scholar ]38. Shin DM, Xu XC, Lippman SM, Lee JJ, Lee JS, Batsakis JG, Ro JY, Martin JW, Hittelman WN, Lotan R, Hong WK. Acumularea proteinei p53 și a receptorului beta al acidului retinoic în chimioprevenția retinoidelor. Clin Cancer Res. 1997; 3 : 875–880. [ PubMed ] [ Google Scholar ]39. Izzo JG, Papadimitrakopoulou VA, Liu DD, den Hollander PL, Babenko IM, Keck J, El-Naggar AK, Shin DM, Lee JJ, Hong WK, Hittelman WN. Genotipul ciclinei D1, răspunsul la biochimoprevenție și rata de progresie la cancerul tractului aerodigestiv superior. J Natl Cancer Inst. 2003; 95 : 198–205. [ PubMed ] [ Google Scholar ]40. Izzo JG, Papadimitrakopoulou VA, Li XQ, Ibarguen H, Lee JS, Ro JY, El-Naggar A, Hong WK, Hittelman WN. Exprimarea ciclinei D1 neregulată la începutul tumorigenezei capului și gâtului: dovezi in vivo pentru o asociere cu amplificarea genetică ulterioară. Oncogene. 1998; 17 : 2313–2322. [ PubMed ] [ Google Scholar ]41. Papadimitrakopoulou V, Izzo JG, Liu DD, Myers J, Ceron TL, Lewin J, William WN, Jr., Atwell A, Lee JJ, Gillenwater A, El-Naggar A, Wu X, Lippman SM, Hittelman WN, Hong WK. Ciclina D1 și dezvoltarea cancerului la pacienții cu premalignitate laringiană. Cancer Prev Res (Phila Pa) 2009; 2 : 14–21. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]42. Marsit CJ, Black CC, Posner MR, Kelsey KT. O examinare genotip-fenotip a ciclinei D1 privind riscul și rezultatul carcinomului cu celule scuamoase al capului și gâtului. Clin Cancer Res. 2008; 14 : 2371–2377. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]43. Lu F, Gladden AB, Diehl JA. O izoformă de ciclină D1 alternată, ciclina D1b, este o oncogenă nucleară. Cancer Res. 2003; 63 : 7056-7061. [ PubMed ] [ Google Scholar ]44. Hall GL, Shaw RJ, Field EA, Rogers SN, Sutton DN, Woolgar JA, Lowe D, Liloglou T, Field JK, Risk JM. p16 Metilarea promotorului este un potențial predictor al transformării maligne în displazia epitelială orală. Biomarkeri de epidemiol pentru cancer Prev. 2008; 17 : 2174–2179. [ PubMed ] [ Google Scholar ]45. Papadimitrakopoulou VA, Izzo J, Mao L, Keck J, Hamilton D, Shin DM, El-Naggar A, den Hollander P, Liu D, Hittelman WN, Hong WK. Modificări ale ciclinei D1 și p16 în leziunile premaligne avansate ale tractului aerodigestiv superior: rol ca răspuns la chimioprevenție și dezvoltarea cancerului. Clin Cancer Res. 2001; 7 : 3127-3134. [ PubMed ] [ Google Scholar ]46. Fang MZ, Wang Y, Ai N, Hou Z, Sun Y, Lu H, Welsh W, Yang CS. Ceaiul polifenol (-) – epigalocatechin-3-galat inhibă ADN metiltransferaza și reactivează genele cu metilare în linii celulare canceroase. Cancer Res. 2003; 63 : 7563-7570. [ PubMed ] [ Google Scholar ]47. Yan Y, Cook J, McQuillan J, Zhang G, Hitzman CJ, Wang Y, Wiedmann TS, You M. Efect chemopreventiv al polifenonului E aerosolizat asupra tumorigenezei pulmonare la șoarecii A / J. Neoplazie. 2007; 9 : 401–405. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Stoner GD. Produse alimentare pentru prevenirea cancerului: dezvoltarea preclinică și clinică a fructelor de pădure. Cancer Prev Res (Phila Pa) 2009; 2 : 187–194. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Papadimitrakopoulou VA, Lee JJ, William WN, Jr., Martin JW, Thomas M, Kim ES, Khuri FR, Shin DM, Feng L, Hong WK, Lippman SM. Test randomizat de 13-cis acid retinoic comparativ cu palmitat de retinil cu sau fără beta-caroten în premalignitate orală. J Clin Oncol. 2008 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]50. Zhang X, Zhang H, Tighiouart M, Lee JE, Shin HJ, Khuri FR, Yang CS, Chen ZG, Shin DM. Inhibarea sinergică a creșterii tumorilor capului și gâtului prin ceaiul verde (-) – epigalocatechin-3-galat și inhibitor EGFR al tirozin kinazei. Int J Rac. 2008; 123 : 1005-1014. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]51. Amin AR, Kucuk O, Khuri FR, Shin DM. Perspective pentru prevenirea cancerului cu compuși naturali. J Clin Oncol. 2009 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]52. Amin AR, Wang D, Khuri FR, Chen ZG, Shin DM. eficacitatea antitumorală sinergică in vitro și in vivo a doi polifenoli dietetici EGCG și luteolin disponibili în mod natural. În: Proceedings of the 100th Annual Meeting of the American Association for Cancer Research, Denver, CO. 2009 Rezumat 33. [ Google Scholar ]53. Amin AR, Khuri FR, Chen ZG, Shin DM. Inhibarea sinergică a creșterii carcinomului cu celule scuamoase a capului și gâtului de către erlotinib și epigalocatechin-3-galat: rolul inhibării dependente de p53 a factorului nuclear-kappaB. Cancer Prev Res (Phila Pa) 2009; 2 : 538–545. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

Exprimati-va pararea!

Completează mai jos detaliile tale sau dă clic pe un icon pentru a te autentifica:

Logo WordPress.com

Comentezi folosind contul tău WordPress.com. Dezautentificare /  Schimbă )

Fotografie Google

Comentezi folosind contul tău Google. Dezautentificare /  Schimbă )

Poză Twitter

Comentezi folosind contul tău Twitter. Dezautentificare /  Schimbă )

Fotografie Facebook

Comentezi folosind contul tău Facebook. Dezautentificare /  Schimbă )

Conectare la %s

Acest site folosește Akismet pentru a reduce spamul. Află cum sunt procesate datele comentariilor tale.