Test deschis, explorator, de fază II, de Itraconazol oral pentru tratamentul carcinomului bazocelular

Daniel J. Kim , James Kim , Katrina Spaunhurst , Javier Montoya , Rita Khodosh , Kalyani Chandra …Afișați mai multe

Itraconazolul, un medicament antifungic aprobat de US Food and Drug Administration, inhibă calea de semnalizare Hedgehog (HH), un factor crucial al tumorigenezei carcinomului bazocelular (BCC) și reduce creșterea BCC la șoareci. Am evaluat efectul itraconazolului asupra căii HH și asupra dimensiunii tumorii în tumorile BCC umane.Pacienți și metode

Pacienții cu ≥ o tumoră BCC> 4 mm în diametru au fost înscriși pe două cohorte pentru a primi itraconazol oral 200 mg de două ori pe zi timp de 1 lună (cohorta A) sau 100 mg de două ori pe zi pentru o medie de 2,3 luni (cohorta B). Punctul final principal a fost modificarea biomarkerilor: proliferarea tumorii Ki67 și activitatea HH ( ARNm GLI1 ). Punctele finale secundare au inclus modificarea dimensiunii tumorii la un subgrup de pacienți cu tumori multiple.Rezultate

Au fost înrolați în total 29 de pacienți, dintre care 19 au fost tratați cu itraconazol. Tratamentul cu Itraconazol a fost asociat cu două evenimente adverse (oboseală de gradul 2 și insuficiență cardiacă congestivă de gradul 4). Itraconazolul a redus proliferarea celulară cu 45% ( P = 0,04), activitatea căii HH cu 65% ( P = 0,03) și a redus aria tumorii cu 24% (IC 95%, 18,2% până la 30,0%). Din opt pacienți cu mai multe tumori nonbiopsiate, patru au obținut un răspuns parțial și patru au avut boală stabilă. Tumorile de la pacienții de control netratați și de la cei tratați anterior cu vismodegib nu au prezentat modificări semnificative ale proliferării sau dimensiunii tumorii.

Concluzie

Itraconazolul are activitate anti-BCC la om. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului, în special în raport cu alți inhibitori ai căii

Carcinomul cu celule bazale (BCC) este cel mai frecvent diagnosticat cancer la om, cu aproximativ 2 milioane de cazuri noi în Statele Unite în fiecare an. 1 Pacienții afectați de sindromul nev de celule bazale (Gorlin), ereditar (mostenire online mendeliană la om nr. 109400) pot dezvolta sute până la mii de BCC. 2 Pacienții cu sindromul nevocelular bazal moștenesc o copie defectă a genei supresoare tumorale PTCH1 , care acționează ca un inhibitor primar al căii de semnalizare Hedgehog (HH). 3 – 5 PTCH1 mutațiilor genetice și pierderea de tip sălbatic rămase alelă apar și în sporadice BCC. 3 – 5În esență, toate BCC au activare malignă a căii de semnalizare HH, care este în mod obișnuit măsurată prin expresia unei gene țintă care codifică factorul de transcripție GLI1 . 2 – 4 Recenta aprobare din partea US Food and Drug Administration (FDA) a vismodegib, un antagonist al componentei esențiale a căii HH Smoothened (SMO), validează eficacitatea inhibării căii HH în tratamentul BCC. 6 Vismodegib este aprobat pentru BCC local avansat (inoperabil) sau metastatic, care cuprinde doar 2% din toate BCC. Majoritatea BCC pot fi tratate prin excizie chirurgicală, deși intervenția chirurgicală poate duce la cicatrici și morbiditate semnificative. 5Având în vedere incidența în creștere a BCC și tratamentul său costisitor – unul dintre cei mai mari în rândul beneficiarilor Medicare 7 – există o mare nevoie clinică nesatisfăcută de forme nechirurgicale de tratament. 8 Deși unele creme chimioterapeutice precum imiquimod și fluouracil sunt aprobate de FDA, aceste opțiuni topice sunt eficiente numai împotriva subtipului superficial al BCC, care cuprinde doar 30% din toate BCC. 9 , 10 Efectele adverse frecvente (căderea părului, pierderea în greutate, crampele musculare) ale vismodegibului îl exclud ca opțiune de tratament viabilă pentru majoritatea BCC-urilor non-avansate. 6

Am efectuat un screening al medicamentelor aprobate de FDA și am identificat itraconazolul, un agent antifungic oral utilizat pe scară largă, ca un puternic antagonist al căii HH. 11 Anterior, am demonstrat că itraconazolul suprimă carcinogeneza BCC murină autohtonă, induce necroza tumorală și reduce expresia ARNm GLI1 la șoareci. 11 Pentru a evalua mecanismul de acțiune și eficacitatea clinică a itraconazolului în BCC umană, am efectuat un studiu deschis, de dovadă a conceptului, de fază II, în două cohorte de pacienți cu BCC sporadică. Obiectivele principale ale celor două cohorte au fost de a evalua dacă inhibarea indusă de itraconazol a activității căii HH ( GLI1 ARNm) ar putea reduce proliferarea tumorii (Ki67) și dimensiunea tumorii la BCC umană și pentru a evalua dacă s-ar putea realiza reduceri semnificative ale dimensiunii tumorii cu doze mai mici de itraconazol administrate pe o durată mai lungă.PACIENTI ȘI METODEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODE <<REZULTATEDISCUŢIEREFERINȚEPacienți și tratamente

Am recrutat pacienți cu ≥ o tumoră BCC> 4 mm (cel mai lung diametru), fără comorbidități și teste normale ale funcției hepatice în decurs de 1 an înainte de înscriere. Cei care au luat medicamente care ar putea afecta tumorile BCC sau metabolismul itraconazolului (de exemplu, anticonvulsivante, corticosteroizi) și cei care nu au putut participa atât la biopsie inițială, cât și la excizia chirurgicală la aceeași instituție au fost excluși din studiu. Toți pacienții au fost măsurați AST / ALT după 1 lună de itraconazol.

Am examinat 67 de pacienți pentru eligibilitate și am înscris 29 la două site-uri; 37 de pacienți au fost excluși de la înscriere din cauza incapacității lor de a avea atât biopsie, cât și excizie în același loc. Cohorta A (Universitatea Stanford, Stanford, CA) a înrolat 25 de pacienți din aprilie 2010 până în decembrie 2010, iar cohorta B (Universidad Católica de Chile, Santiago, Chile) a înrolat patru pacienți din iulie 2010 până în septembrie 2011 (diagrama CONSORT; Fig 1). Un singur pacient a întâmpinat diagnosticul clinic pentru sindromul nevocelular bazal.

Fig. 1.Diagrama CONSORT. qPCR, reacție în lanț cantitativă a polimerazei.

În cohorta A, pacienții au primit itraconazol în comprimate de 200 mg pe cale orală de două ori pe zi, între momentul biopsiei și momentul exciziei definitive (în mod obișnuit 4 săptămâni). Scopul principal al cohortei A a fost evaluarea biomarkerilor tumorali (proliferarea Ki67 și activitatea căii HH [ GLI1mARN]) și dimensiunea tumorii se modifică după 1 lună de tratament. În cohorta B, pacienții au primit comprimate de 100 mg pe cale orală de două ori pe zi. Scopul principal al cohortei B a fost de a determina dacă o doză mai mică de itraconazol administrată pe o durată mai lungă (medie, 2,3 luni; interval, 1 până la 4 luni) ar putea realiza în continuare efecte semnificative clinic. Pacienții eligibili altfel, dar care nu doreau să ia itraconazol, au fost înrolați pe brațul de control al studiului și nu au primit tratament. Studiile paralele au fost aprobate de către comitetele de revizuire instituționale respective.

Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresie în timpul terapiei, probabil ca urmare a rezistenței secundare la vismodegib. 12 Deoarece itraconazolul antagonizează și SMO și se știe puțin despre modul în care rezistența la un medicament poate afecta eficacitatea unui alt inhibitor al SMO, cei tratați anterior cu vismodegib au fost analizați separat de pacienții naivi cu vismodegib. Prin urmare, am analizat în cele din urmă trei grupuri discrete: unul, pacienții care nu au primit nici un itraconazol; doi, pacienți cărora li s-a administrat itraconazol fără tratament anterior cu vismodegib; și trei, pacienți cărora li s-a administrat itraconazol cu ​​tratament anterior cu vismodegib.Biopsii tumorale și evaluări ale biomarkerului (cohorta A)

La momentul înscrierii, pacienții din cohorta A aveau leziuni BCC țintă (una sau două dintre cele mai reprezentative tumori) selectate pentru biopsie. Tumorile biopsiate au fost încorporate în parafină și colorate pentru Ki67 pentru a evalua proliferarea celulară. Celulele cu colorare nucleară pozitivă (indicând celule în proliferare activă) au fost numărate de Flagship Biosciences (Flagstaff, AZ) și normalizate la numărul total de nuclee prezente în BCC. Datele de proliferare celulară prezentate aici sunt exprimate ca procent de celule cu un semnal pozitiv. Pentru a evalua activitatea căii HH, probele de biopsie proaspete au fost congelate rapid, plasate în Trizol (Invitrogen, Carlsbad, CA) și omogenizate utilizând MP FastPrep 24 (MP Biomedicals, Solon, OH). ARN-ul total a fost purificat cu tuburi de fază Lock Gels (Eppendorf, Hamburg, Germania) și un kit ARN PureLink Micro (Invitrogen).ADNc a fost sintetizat cu SuperScript III Reverse Transcriptase (Invitrogen). Reacția în lanț a polimerazei în timp real a fost efectuată pe un iCycler Bio-Rad folosind iQ SyberGreen Supermix (Bio-Rad, Hercules, CA). Schimbare de oriExpresia ARNm GLI1 a fost măsurată utilizând analiza ΔΔC t , cu HPRT1 ca genă de control intern și pielea normală colectată de la pacienții cu BCC ca probe de control pentru normalizarea probelor BCC. Secvențele de primer de reacție în lanț ale polimerazei au fost:

  • GLI1 înainte: 5 ′ GAAGTCATACTCACGCCTCGAA 3 ′
  • GLI1 invers: 5 ′ CAGCCAGGGAGCTTACATACAT 3 ′
  • HPRT1 înainte: 5 ′ GGTCAGGCAGTATAATCCAAAG 3 ′
  • Revers HPRT1 : 5 ′ GGACTCCAGATGTTTCCAAAC 3 ′

În cazurile în care biopsia / excizia a avut un volum tumoral limitat, probele au fost prioritare pentru analiza proliferării celulare. Nici o tumoră nu a fost biopsiată pentru analiza biomarkerului în cohorta B, deoarece scopul său principal a fost de a evalua efectul dozei mici de itraconazol asupra dimensiunii tumorii.Măsurători ale dimensiunii tumorii

În cohorta A, 11 din 15 pacienți au avut o singură tumoare BCC. Această leziune țintă a fost biopsiată și excizată pentru analiza biomarkerului. Leziunile țintă nu au fost evaluate pentru modificarea dimensiunii tumorii, deoarece au fost biopsiate la momentul inițial. Doar patru din 15 pacienți au avut ≥ o tumoră BCC și au fost observate leziuni nedestinate (n = 42) pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial. Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. În schimb, toate tumorile de la cei patru pacienți (n = 14 BCC) din cohorta B au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 200 mg pe zi (durata medie, 2,3 luni).Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) a fost calculată de la data înscrierii până la data ultimei evaluări clinice.

Pentru fiecare pacient măsurat pentru zona tumorii, parametrii de răspuns clinici BCC validați au fost utilizați conform Skvara și colab 13 și definiți după cum urmează: răspuns complet, nu mai există dovezi vizibile ale unei leziuni în concordanță cu BCC; răspuns parțial, deși rămâne un BCC, există o scădere vizibilă a dimensiunii; și fără răspuns, BCC nu a scăzut vizibil în dimensiune. Un investigator dermatolog care a fost orbit de grupurile de tratament a efectuat toate evaluările clinice folosind fotografii făcute înainte și după tratament. Nu am utilizat criterii RECIST pentru tumorile solide, deoarece majoritatea leziunilor BCC aveau o dimensiune <10 mm, iar leziunile tumorale au fost evaluate în primul rând pentru modificările biomarkerului.Analize statistice

Ca studiu exploratoriu, am calculat că un număr minim de 27 de pacienți trebuia să fie înrolați pentru a detecta o diferență de două ori între modificarea Ki67 la pacienții netratați față de cei tratați cu itraconazol (β, 0,80; față-verso α, 0,05). Testul sumelor de rang nonparametric Mann-Whitney a fost utilizat pentru comparații nepereche, iar testul de rang semnat Wilcoxon a fost utilizat pentru comparații pereche. Toate valorile P raportate sunt pe două fețe.REZULTATEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATE <<DISCUŢIEREFERINȚEDemografia pacientului

Am înrolat 29 de pacienți cu un total de 101 tumori BCC; 19 pacienți cu un total de 90 BCC au consimțit la tratamentul cu itraconazol (cohorta A, n = 15; cohorta B, n = 4). La momentul inițial, pacienții tratați cu itraconazol și pacienții martor au fost similari ca vârstă, sex, tip BCC și localizarea tumorilor BCC ( Tabelul 1 ). Tumorile au apărut în regiunile corpului expuse în mod clasic la soare, inclusiv fața, gâtul și trunchiul. Pacienții au fost predominant bărbați mai în vârstă (vârsta medie, 60 de ani) cu subtipuri BCC nodulare. Pacienții cărora li sa administrat itraconazol au avut, în medie, aproape 5 ori mai multe tumori la momentul inițial comparativ cu cei care nu au fost tratați cu itraconazol ( P= .13). Durata medie de observare / tratament a fost de aproximativ 1 lună la pacienții martor și la pacienții tratați cu itraconazol din cohorta A (n = 76 de tumori) și 2,3 luni la pacienții tratați cu itraconazol din cohorta B (n = 14 tumori). Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresia bolii și au oprit vismodegibul timp de ≥ 6 luni înainte de a începe itraconazolul.

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

CaracteristicăControl (n = 10)Itraconazol (n = 19)
Nu.%Nu.%
Vârsta la biopsia inițială, ani
    In medie68,562.2
    Gamă53 la 8144 – 85
Sex
    Masculin8801579
    Femeie220421
Numărul total de tumori BCC prezente1190
Numărul mediu de tumori BCC per pacient1.14,77
Tip tumoră BCC *
    Nodular6432150
    Superficial4291433
    Infiltrativ214512
    Micronodular21425
Localizarea tumorii BCC
    Față6553539
    Înapoi2181719
    Umăr001314
    Gât0089
    Cufăr0067
    Picior1967
    Braţ21822
    Scalp0022
    Ureche0013
Istoria tratamentului cu vismodegib003
Durata medie a tratamentului, luni
    Pacienți cu Stanford (200 mg de două ori pe zi)1.11.0
    Pacienți din Chile (100 mg de două ori pe zi)N / A2.3

Abrevieri: BCC, carcinom bazocelular; NA, nu se aplică.

* Include numai tumorile care au fost biopsiate.Evenimente adverse legate de droguri

Doi din 19 pacienți au întrerupt tratamentul cu itraconazol din cauza efectelor adverse descrise anterior asociate cu itraconazolul. O insuficiență cardiacă congestivă de gradul 4 a apărut la un pacient care a avut o boală cardiacă nediagnosticată în urma tratamentului anterior cu adriamicină pentru limfom Hodgkin acum 20 de aniFig 1). Un al doilea pacient a întrerupt din cauza oboselii de gradul 2. Alte efecte adverse au fost ușoare și toate efectele adverse au fost reversibile la întreruperea tratamentului. Nu s-au detectat creșteri ale testării funcției hepatice (AST / ALT) la niciun pacient în timpul tratamentului.Analiza biomarkerului (numai cohorta A)

Un total de 63 de biopsii de la 22 din 25 de pacienți înscriși în cohorta A au fost disponibile pentru analiza biomarkerului ( Fig 1). Am comparat modificarea proliferării Ki67 în biopsiile luate la momentul inițial și la excizie la o lună mai târziu la pacienții tratați cu itraconazol (20 BCC) și la pacienții netratați / de control (12 BCC). Itraconazolul a scăzut proliferarea celulară cu 35% la pacienții naivi cu vismodegib în analize nepereche ( P = .079; Fig. 2De la A la 2C). În cadrul comparațiilor pacienților cu activitatea Ki67 de la momentul inițial până la excizie, itraconazolul a scăzut proliferarea celulară cu 45% la pacienții naivi cu vismodegib (n = 8; P = 0,04 în perechi ; Fig 2D). În schimb, pacienții martori și cei tratați anterior cu vismodegib nu au prezentat modificări semnificative în proliferarea celulară ( Fig 2E).

Fig 2.Cuantificarea Ki67 și analiza tumorilor de carcinom bazocelular (BCC). (A) Analiza nepereche a tumorilor individuale de la pacienții martor și pacienții tratați cu itraconazol. Colorarea Ki67 a tumorilor BCC la momentul inițial și excizia de la pacienții de control (B) și (C) pacienți naivi cu vismodegib tratați cu itraconazol. Colorarea pozitivă (maro) indică proliferarea nucleelor; colorarea negativă (albastră) nu indică activitate proliferativă. Analiza pereche a pacientului Ki67 medii în rândul pacienților (D) naivi cu vismodegib și (E) pacienți de control tratați cu itraconazol.

Pentru analiza căii de semnalizare HH, un total de 24 de biopsii au fost colectate de la pacienții tratați cu itraconazol și analizați pentru nivelurile de ARNm GLI1 . Într-o analiză nepereche, itraconazolul a scăzut ARNm GLI1 cu 65% în tumorile de la pacienții naivi cu vismodegib comparativ cu valoarea inițială ( P = 0,028; Fig 3A). Examinând numai tumori asociate de la patru pacienți (naivi cu vismodegib), itraconazolul a scăzut ARNm GLI1 cu 45% în tumori după o lună, comparativ cu valoarea inițială ( Fig 3B). Tumorile de la pacienții cu tratament anterior cu vismodegib nu au demonstrat o scădere semnificativă a expresiei ARNm GLI1 . Alte studii clinice BCC nu au demonstrat, de asemenea, nicio modificare a expresiei ARNm GLI1 la pacienții tratați cu placebo sau pacienții de control. 14 , 15

Fig 3.Niveluri de expresie a ARNm GLI1 în tumorile de carcinom bazocelular de la pacienții tratați cu itraconazol timp de 1 lună. Unii pacienți au primit anterior tratament cu vismodegib și nu au mai răspuns la vismodegib. (A) Analiza nepereche a nivelurilor de ARNm GLI1 din tumorile inițiale și tumorile excizate după tratamentul cu itraconazol. Ca martor, ARNm GLI1 a fost evaluat pe pielea normală nontumorală. ARNm GLI1 a scăzut cu 65% la pacienții naivi cu vismodegib tratați cu itraconazol de la momentul inițial până la excizie ( P = .028). (B) În analiza asociată a tumorilor de la aceiași pacienți, itraconazolul a scăzut expresia GLI1 cu 45% după o lună numai la pacienții naivi cu vismodegib.Modificări ale dimensiunii tumorii și răspunsul clinic (cohorte A și B)

Itraconazolul a redus dimensiunea tumorii și a favorizat reepitelizarea în tumorile BCC a opt din cei 29 de pacienți naivi cu vismodegib ( Fig 4). În cohorta A, patru pacienți au avut> o tumoră BCC, iar aceste leziuni nedestinate au fost observate pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial (n = 43). Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. La cei patru pacienți din cohorta B, toate cele 14 tumori BCC au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 100 mg de două ori pe zi (durata medie, 2,3 luni). Niciuna dintre tumorile cohortei B nu a fost biopsiată pentru analiza biomarkerului, deoarece scopul cohortei B a fost de a evalua o doză mai mică de itraconazol pentru o durată mai lungă. Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) este prezentată în Figura 5. În medie, tumorile de la pacienții naivi cu vismodegib au scăzut cu 24% (IÎ 95%, 18,2% până la 30,0%) după tratamentul cu itraconazol ( Fig 5). Mai mult, reducerile medii ale tumorilor la pacienții din cohorta B au fost comparabile cu cele ale cohortei A ( P = .435). Această constatare sugerează că administrarea alternativă de itraconazol (doze mai mici pe o durată mai lungă) poate realiza în continuare reduceri semnificative clinic.

Fig 4.Reducerea sau reepitelizarea tumorilor de carcinom bazocelular (BCC) de către itraconazol la pacienții fără vismodegib. (A) Tumoră BCC nodulară pe picior de la înrolare până în ziua 25. (B) Tumoră BCC infiltrativă pe umăr de la înrolare până în ziua 28. (C) Vedere laterală și (D) laterală a tumorii BCC nodulare pe frunte de la înrolare până în ziua 59.

Fig 5.Modificarea procentuală a zonei tumorale pentru 57 de tumori de carcinom bazocelular (BCC) de la opt pacienți tratați cu itraconazol. În timpul tratamentului cu itraconazol, aria tumorii a scăzut în medie cu 24% (IC 95%, 18,2% până la 30,0%). În cohorta A, patru pacienți au avut mai multe tumori BCC, iar leziunile nedestinate au fost disponibile pentru măsurarea dimensiunii tumorii. Aria tumorii a fost aproximată prin înmulțirea celor mai lungi diametre perpendiculare ale tumorilor, măsurate cu etriere. Tumorile nonbiopsiate au fost evaluate pentru modificarea zonei tumorale la momentul inițial și după 4 săptămâni. În cohorta B, tumorile BCC nu au fost evaluate pentru biomarkeri; au fost evaluați numai pentru modificarea dimensiunii clinice la momentul inițial (după biopsia inițială care confirmă diagnosticul BCC) și după tratamentul cu itraconazol 200 mg în medie 2,3 luni.Procentul de modificare a zonei a fost calculat de la data înscrierii până la data ultimei evaluări clinice.

În ciuda reducerii generale a dimensiunii, niciuna dintre tumorile BCC nu a dispărut complet cu tratamentul cu itraconazol după o medie de 1,1 luni (cohorta A, n = 43 tumori) și 2,3 luni (cohorta B, n = 14 tumori). Patru pacienți au prezentat răspuns parțial și patru au prezentat o boală stabilă folosind liniile directoare descrise anterior. 16 În evaluările clinice, nici pacienții de control, nici pacienții cu antecedente de tratament cu vismodegib nu au prezentat modificări ale dimensiunii tumorii

În acest studiu de dovadă a conceptului, am demonstrat prima utilizare off-label, după cunoștințele noastre, a unui medicament aprobat de FDA pentru tratamentul BCC care vizează activitatea căii HH. Itraconazolul poate reduce dimensiunea tumorii BCC prin inhibarea căii de semnalizare HH după 1 lună de tratament. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului.

Ca un studiu exploratoriu de fază II, scopul principal al acestui studiu a fost de a determina dacă itraconazolul la doze prescrise în mod obișnuit de 200 până la 400 mg zilnic ar putea reduce proliferarea tumorii și calea HH în BCC umane după o lună. Doar patru pacienți din cohorta B au fost tratați timp de> 1 lună și, prin urmare, nu avem rezultate privind eficacitatea clinică anti-BCC a itraconazolului pe o perioadă mai lungă de tratament. Mai mult, nu putem compara în mod direct eficacitatea pe termen scurt a itraconazolului cu cea a vismodegibului, primul inhibitor de HH aprobat de FDA care a prezentat o rată de răspuns de 40% la pacienții cu BCC avansat local tratați timp de> 10 luni. 6Itraconazolul pare să aibă o utilitate clinică mai mică în comparație cu vismodegib ca tratament de primă linie, deoarece concentrația inhibitoare jumătate maximă a itraconazolului este de 100 × mai puțin puternică in vitro comparativ cu vismodegib, iar itraconazolul reduce calea HH cu 65% după 1 lună, spre deosebire de Reducere de 90% cu vismodegib. 15 Itraconazolul poate fi eficient ca terapie de linia a doua, deoarece itraconazolul acționează asupra SMO într-un loc distinct de ciclopamină și vismodegib. 11 După cum se demonstrează prin teste de semnalizare in vitro, 17eficacitatea itraconazolului este dependentă de doză, iar studiile viitoare ar trebui să examineze dacă dozele mai mari de itraconazol administrate pe perioade mai lungi de tratament pot aborda eficacitatea observată cu vismodegib și alți antagoniști SMO. Cu toate acestea, administrarea cronică a itraconazolului ar putea avea, de asemenea, efecte adverse și toxicitate suplimentare, care nu au fost observate în acest studiu exploratoriu, deși au fost raportate tratamente pe termen lung cu 600 până la 900 mg pe zi, cuprinse între 3 și 16 luni, cu toxicități controlabile. 18 , 19

Studiul nostru are mai multe limitări. În primul rând, a fost limitată de mărimea eșantionului, deoarece am înrolat doar 29 de pacienți; cu toate acestea, mulți pacienți au avut mai multe tumori, iar acest studiu a evaluat 101 BCC. În al doilea rând, toți, cu excepția unuia dintre pacienții din acest studiu, au avut BCC non-avansat și niciunul nu a avut boală metastatică; astfel, rezultatele noastre nu pot fi comparate cu rata globală de răspuns de 40% observată cu vismodegib la pacienții cu BCC avansat sau metastatic. 6În al treilea rând, am avut doar trei pacienți care au prezentat progresia cu vismodegib și nu au efectuat analize de secvențiere pentru a determina mecanismul de rezistență la medicamente vismodegib. Astfel, nu am putut testa în mod direct dacă itraconazolul ar putea fi o opțiune viabilă ca tratament de linia a doua după eșecul vismodegibului. În al patrulea rând, am evaluat doar eficacitatea pe termen scurt a itraconazolului și este necesară administrarea cronică pentru a compara eficacitatea și toxicitatea itraconazolului în raport cu vismodegib. Viitoare studii clinice randomizate sunt necesare pentru a determina eficacitatea itraconazolului la o gamă mai largă de pacienți cu sarcini variate ale bolii, o eficacitate diferențială potențială în tumorile rezistente la vismodegib versus tumorile naive cu vismdoegib și posibilitatea dacă un dublu atac anti-SMO ar fi da rezultate superioare.Rezultatele noastre preclinice sugerează că o dublă inhibare anti-SMO reduce creșterea tumorii mai eficient decât itraconazolul sau ciclopamina în monoterapie.11

Recent, terapia combinatorie cu trioxid de arsen (ATO), aprobată de FDA pentru leucemia promielocitară acută, s-a dovedit a fi eficientă în BCC murin și medullobloastomul rezistent la vismodegib. 20 ATO acționează ca un antagonist HH prin prevenirea traficului ciliar și destabilizarea GLI2, un factor de transcripție în aval de SMO. 17 Tratamentul combinat cu itraconazol și ATO s-ar putea dovedi deosebit de benefic în tumorile BCC rezistente 21 la antagoniștii SMO, cum ar fi vismodegib, care imită și concurează pentru legarea cu ciclopamina. 20 Presupunând că BCC rezistente la vismodegib se comportă similar cu meduloblastomul, 22 , 23 terapia combinată cu itraconazol-ATO poate depăși rezistența rezultată dinMutații SMO și amplificări GLI2 , deoarece itraconazolul inhibă SMO printr-un mecanism distinct de ciclopamină, 11 și ATO inhibă factorii de transcripție GLI . În acest scop, am inițiat un studiu al combinației de itraconazol și ATO la pacienții cu BCC metastatice pentru care vismodegib a eșuat (clinictrials.gov NCT01791894).© 2014 de Societatea Americană de Oncologie Clinică

Vezi editorialul însoțitor la pagina 720

Susținut de Stanford Clinical and Translational Science Institute (SPARK) și Damon Runyon Clinical Investigator Award (JYT).

Prezentat parțial la reuniunea anuală a Asociației Americane pentru Cercetarea Cancerului, Orlando, FL, 2-6 aprilie 2011.

Dezvăluirile autorilor despre posibilele conflicte de interese și contribuțiile autorilor se găsesc la sfârșitul acestui articol.

Informații despre studiile clinice: NCT01108094.DIVULGAREA AUTORILOR PRIVIND POTENȚIALELE CONFLICTE DE INTERES

Deși toți autorii au completat declarația de divulgare, următorii autor (i) și / sau membrii apropiați ai familiei unui autor au indicat un interes financiar sau de altă natură care este relevant pentru subiectul examinat în acest articol. Anumite relații marcate cu „U” sunt cele pentru care nu s-a primit nicio compensație; acele relații marcate cu „C” au fost compensate. Pentru o descriere detaliată a categoriilor de divulgare sau pentru mai multe informații despre politica ASCO privind conflictele de interese, vă rugăm să consultați Declarația de divulgare a autorului și secțiunea Dezvăluiri de potențiale conflicte de interese din Informații pentru contribuabili.

Ocuparea forței de muncă sau poziția de conducător: Niciun Consultant sau Rol consultativ: Jean Y. Tang, Genentech (C) Proprietate de acțiuni: Niciun Onorariu: Niciun Finanțare pentru cercetare: Niciun Mărturie de expert: Niciun Brevete, Redevențe și Licențe: Niciun Alt Remunerație: Nici unulCONTRIBUȚIILE AUTORULUI

Concepție și design: Philip A. Beachy, Jean Y. Tang

Sprijin financiar: Philip A. Beachy, Jean Y. Tang

Sprijin administrativ: Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Furnizarea de materiale de studiu sau pacienți: Jean Y. Tang

Colectarea și asamblarea datelor: Daniel J. Kim, Katrina Spaunhurst, Javier Montoya, Rita Khodosh, Kalyani Chandra, Teresa Fu, Anita Gilliam, Monserrat Molgo, Philip A. Beachy, Jean Y. Tang

Analiza și interpretarea datelor: Daniel J. Kim, James Kim, Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Scriere manuscrisă: Toți autorii

Aprobarea finală a manuscrisului: Toți autoriiREFERINȚEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATEDISCUŢIEREFERINȚE <<

1.DL Miller , MA Weinstock : Cancer de piele nonmelanom în Statele Unite: Incidență J Am Acad Dermatol 30: 774 – 778 , 1994 Crossref , Medline ,  Google Scholar
2.MR Gailani , SJ Bale , DJ Leffell , etal: Defecte de dezvoltare în sindromul Gorlin legate de o genă suppresivă tumorală putativă pe cromozomul 9 Celula 69: 111 – 117 , 1992 Crossref , Medline ,  Google Scholar
3.H Hahn , C Wicking , PG Zaphiropoulous , etal: Mutații ale omologului uman al Drosophila patch-uri în sindromul nevoid carcinom bazocelular Celula 85: 841 – 851 , 1996 Crossref , Medline ,  Google Scholar
4.RL Johnson , AL Rothman , J Xie , etal: Omolog om al patchei, o genă candidată pentru sindromul nevului cu celule bazale Știință 272: 1668 – 1671 , 1996 Crossref , Medline ,  Google Scholar
5.EH Epstein : Carcinoame bazocelulare: Atacul ariciului Nat Rev Cancer 8: 743 – 754 , 2008 Crossref , Medline ,  Google Scholar
6.A Sekulic , MR Migden , AE Oro , etal: Eficacitatea și siguranța vismodegibului în carcinomul bazocelular avansat N Engl J Med 366: 2171 – 2179 , 2012 Crossref , Medline ,  Google Scholar
7.TS Housman , SR Feldman , PM Williford , etal: Cancerul de piele este printre cele mai costisitoare dintre toate tipurile de cancer de tratat pentru populația Medicare J Am Acad Dermatol 48: 425 – 429 , 2003 Crossref , Medline ,  Google Scholar
8.E de Vries , M Louwman , M Bastiaens , etal: Creșteri rapide și continue ale ratelor de incidență a carcinomului bazocelular în sud-estul Țărilor de Jos din 1973 J Invest Dermatol 123: 634 – 638 , 2004 Crossref , Medline ,  Google Scholar
9.H Gollnick , CG Barona , RG Frank , etal: Rata de recurență a carcinomului bazocelular superficial după tratamentul cu cremă imiquimod 5%: Încheierea unui studiu de urmărire pe termen lung de 5 ani în Europa Eur J Dermatol 18: 677 – 682 , 2008 Medline ,  Google Scholar
10.K Gross , L Kircik , G Kricorian : 5% cremă 5-fluorouracil pentru tratamentul carcinomului bazocelular superficial mic: Eficacitate, tolerabilitate, rezultat cosmetic și satisfacția pacientului Dermatol Surg 33: 433 – 439 , 2007 discuție 440 Medline ,  Google Scholar
11.J Kim , JY Tang , R Gong , etal: Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii Hedgehog și creșterea cancerului Celula cancerului 17: 388 – 399 , 2010 Crossref , Medline ,  Google Scholar
12.RL Yauch , GJ Dijkgraaf , B Alicke , etal: Mutația netezită conferă rezistență la un inhibitor al căii Hedgehog în meduloblastom Știința 326: 572 – 574 , 2009 Crossref , Medline ,  Google Scholar
13.H Skvara , F Kalthoff , JG Meingassner , etal: Tratamentul topic al carcinoamelor bazocelulare în sindromul carcinomului bazocelular nevoidic cu un inhibitor netezit J Invest Dermatol 131: 1735 – 1744 , 2011 Crossref , Medline ,  Google Scholar
14.DD Von Hoff , PM LoRusso , CM Rudin , etal: Inhibarea căii arici în carcinomul bazocelular avansat N Engl J Med 361: 1164 – 1172 , 2009 Crossref , Medline ,  Google Scholar
15.JY Tang , JM Mackay-Wiggan , M Aszterbaum , etal: Inhibarea căii arici la pacienții cu sindromul nevului bazocelular N Engl J Med 366: 2180 – 2188 , 2012 Crossref , Medline ,  Google Scholar
16.GJ Dijkgraaf , B Alicke , L Weinmann , etal: inhibarea moleculei mici a GDC-0449 mutanți refractari neteziți și mecanisme din aval de rezistență la medicamente Cancer Res 71: 435 – 444 , 2011 Crossref , Medline ,  Google Scholar
17.J Kim , JJ Lee , J Kim , etal: Arsenicul antagonizează calea Hedgehog prin prevenirea acumulării ciliare și reducerea stabilității efectorului transcripțional Gli2 Proc Natl Acad Sci SUA 107: 13432 – 13437 , 2010 Crossref , Medline ,  Google Scholar
18.K Takagi , A Yoshida , T Yamauchi , etal: Tratamentul cu succes al spondilodiscitei Aspergillus cu doze mari de itraconazol la un pacient cu leucemie mielogenă acută Leucemie 15: 1670 – 1671 , 2001 Crossref , Medline ,  Google Scholar
19.PK Sharkey , MG Rinaldi , JF Dunn , et al: doze mari de itraconazol în tratamentul micozelor severe Antimicrob Agents Chemother 35: 707 – 713 , 1991 CrossRef , Medline ,  Google Academic
20.J Kim , BT Aftab , JY Tang , etal: Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți Celula cancerului 23: 23 – 34 , 2013 Crossref , Medline ,  Google Scholar
21.AL Chang , AE Oro : Evaluarea inițială a creșterii tumorale după vismodegib în carcinomul bazocelular avansat Arch Dermatol 148: 1324 – 1325 , 2012 Crossref , Medline ,  Google Scholar
22.CM Rudin , CL Hann , J Laterra , etal: Tratamentul meduloblastomului cu inhibitor al căii arici GDC-0449 N Engl J Med 361: 1173 – 1178 , 2009 Crossref , Medline ,  Google Scholar
23.S Buonamici , J Williams , M Morrissey , etal: Interferența cu rezistența la antagoniști neteziți prin inhibarea căii PI3K în medulloblastom Sci Transl Med 2: 51ra70 , 2010 Crossref , Medline ,  Google Scholar

Exprimati-va pararea!

Completează mai jos detaliile tale sau dă clic pe un icon pentru a te autentifica:

Logo WordPress.com

Comentezi folosind contul tău WordPress.com. Dezautentificare /  Schimbă )

Poză Twitter

Comentezi folosind contul tău Twitter. Dezautentificare /  Schimbă )

Fotografie Facebook

Comentezi folosind contul tău Facebook. Dezautentificare /  Schimbă )

Conectare la %s

Acest site folosește Akismet pentru a reduce spamul. Află cum sunt procesate datele comentariilor tale.