Canabidiolul inhibă replicarea SARS-CoV-2 prin inducerea stresului ER al gazdei și a răspunsurilor imune înnăscute

Abstract

Răspândirea SARS-CoV-2 și pandemia COVID-19 în curs de desfășurare subliniază necesitatea unor noi tratamente. Aici raportăm că canabidiolul (CBD) inhibă infecția cu SARS-CoV-2 în celule și șoareci. CBD și metabolitul său 7-OH-CBD, dar nu THC sau alți canabinoizi congeneri testați, blochează puternic replicarea SARS-CoV-2 în celulele epiteliale pulmonare. CBD acționează după intrarea virală, inhibând expresia genelor virale și inversând multe efecte ale SARS-CoV-2 asupra transcripției genei gazdă. CBD inhibă replicarea SARS-CoV-2 parțial prin reglarea în sus a răspunsului la stres al reticulului endoplasmatic (ER) IRE1α RNază gazdă și a căilor de semnalizare a interferonului.

În grupurile de pacienți umani din National COVID Cohort Collaborative, CBD (100 mg/ml soluție orală pe fișa medicală) a avut o asociere negativă semnificativă cu testele pozitive pentru SARS-CoV-2. Acest studiu evidențiază CBD ca un potențial agent preventiv pentru infecția cu SARS-CoV-2 în stadiu incipient și merită studii clinice viitoare. În prezent, vă avertizăm împotriva utilizării formulărilor non-medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.

INTRODUCERE

Sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) este responsabil pentru boala coronavirus 2019 (COVID-19), o pandemie care continuă să provoace morbiditate și mortalitate pe scară largă pe tot globul. SARS-CoV-2 este a șaptea specie de coronavirus cunoscută că infectează oamenii. Aceste coronavirusuri, care includ SARS-CoV, 229E, NL63, OC43, HKU1 și MERS-CoV, provoacă o serie de simptome de la răceala obișnuită până la patologii mai severe ( 1 ). În ciuda disponibilității recente a vaccinurilor, SARS-CoV-2 se răspândește în continuare rapid ( 2), subliniind necesitatea unor tratamente alternative, în special pentru populațiile cu înclinație sau acces limitat la vaccinuri. Până în prezent, au fost identificate puține terapii care blochează replicarea SARS-CoV-2 și producția virală.SARS-CoV-2 este un virus învelit cu ARN simplu (+ssRNA) cu sens pozitiv, compus dintr-un strat dublu lipidic și patru proteine ​​structurale care conduc la formarea particulelor virale. Spicul (S), membrana (M) și învelișul (E) sunt proteine ​​​​integrale ale membranei virale și promovează înmugurirea virionului în timp ce, de asemenea, recrutează proteina nucleocapside (N) și ARN-ul genomic viral în virionii în curs de dezvoltare. La fel ca ruda sa apropiată SARS-CoV, SARS-CoV-2 intră în principal în celulele umane prin legarea proteinei virale S de receptorul enzimei de conversie a angiotensinei 2 (ACE2) ( 3 – 5 ).), după care proteina S suferă proteoliza de către protează serină transmembranară 2 (TMPRSS2) sau alte proteaze în două peptide legate necovalent (S1, S2) care facilitează intrarea virală în celula gazdă. N – terminalul S1 leagă receptorul ACE2, iar C – terminalul S2 mediază fuziunea membranei celulare virale în urma clivajului proteolitic. În funcție de tipul de celulă, intrarea virală poate apărea și după legarea ACE2, independent de clivajul proteolitic ( 6 – 8 ). După intrarea în celule, genomul SARS-CoV-2 este tradus în două polipeptide mari care sunt scindate de două proteaze virale, Mpro și PLpro ( 9 , 10 ), pentru a produce 15 proteine, pe lângă sinteza ARN-urilor subgenomice care codifică alte 10 proteine ​​accesorii plus cele 4 proteine ​​structurale. Aceste proteine ​​permit replicarea virală, asamblarea și înmugurirea. Într-un efort de a suprima infecția cu SARS-CoV-2 beta-coronavirus, precum și cu alte viruși patogeni în evoluție, am testat potențialul antiviral al unui număr de molecule mici care vizează căile de răspuns la stres ale gazdei.Un potențial regulator al stresului gazdei și al răspunsurilor inflamatorii antivirale este canabidiolul (CBD), un membru al clasei canabinoide de produse naturale ( 11 ) produse de Cannabis sativa (Cannabaceae; marijuana/cânepă). Cânepa se referă la plantele de canabis sau la materialele derivate din acestea care conțin 0,3% sau mai puțin tetrahidrocannabinol psihotrop (THC) și au de obicei un conținut relativ ridicat de CBD. Prin contrast, marijuana se referă la materialele C. sativa cu mai mult de 0,3% THC în greutate uscată. THC acționează prin legarea de receptorul canabinoid, iar CBD potențează această interacțiune ( 11). În ciuda numeroaselor studii și a multor afirmații nefondate legate de produsele care conțin CBD, acțiunile biologice ale CBD în sine sunt neclare și țintele specifice sunt în mare parte necunoscute ( 12 ). Cu toate acestea, o soluție orală de CBD este un medicament aprobat de FDA, în mare parte pentru tratamentul epilepsiei ( 13 ). Astfel, CBD are statut de medicament, este viabil ca și terapeutic și nu poate fi comercializat ca supliment alimentar în Statele Unite ( 12 ). Deși limitate, unele studii au raportat că anumiți canabinoizi au efecte antivirale împotriva virusului hepatitei C (VHC) și a altor virusuri ( 14 ).

REZULTATE

CBD de înaltă puritate inhibă replicarea SARS-CoV-2 în celulele epiteliale pulmonare umane

Pentru a testa efectul CBD asupra replicării SARS-CoV-2, am pretratat celulele de carcinom pulmonar uman A549 care exprimă receptorul ACE-2 uman exogen (A549-ACE2) timp de 2 ore cu 0-10 μM CBD înainte de infectarea cu SARS-CoV- 2. După 48 de ore, am monitorizat celulele pentru exprimarea proteinei spike virale (S) și titrul viral. CBD a inhibat puternic replicarea virală în condiții netoxice cu o EC50 de ~ 1 μM ( Fig. 1A; smochin. S1A). CBD a inhibat replicarea SARS-CoV-2 în plămânul uman Calu3 și celulele epiteliale ale rinichilor de maimuță Vero E6 (fig. S1B) și nu a fost observată nicio toxicitate la dozele eficiente (fig. S1C,D). În cele din urmă, am testat trei variante de îngrijorare SARS-CoV-2 (α, β și γ) în plus față de tulpina originală SARS-CoV-2, iar capacitatea lor de a infecta celulele a fost inhibată în mod comparabil de CBD ( Fig. 1C ).

FIG. 1 . Canabidiolul (CBD) este un inhibitor puternic al infecției cu SARS-CoV-2 in vitro . ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de CBD de la patru furnizori diferiți, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. ( B ) Spectrele 1H qNMR ale materialului de referință CBD și probelor CBD de la patru furnizori diferiți. ( C) Celulele A549-ACE2 au fost tratate cu CBD de la furnizorul A urmată de infecție cu SARS-CoV-2 sau variante α,β sau γ la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50.

Când este izolat din planta sa sursă, CBD natural nesintetic este de obicei extras împreună cu alți canabinoizi, reprezentând complexitatea reziduală inevitabilă a produselor naturale ( 12 ). Pentru a verifica dacă CBD este într-adevăr responsabil pentru inhibarea virală, am analizat un standard de referință CBD, precum și CBD din patru surse diferite pentru puritate, folosind 100% RMN cantitativ (qNMR). Aceste surse au inclus doi furnizori de produse chimice (Furnizorii A și B) și doi vânzători comerciali (Furnizorii C și D). Congruența izbitoare dintre 1H RMN experimental și HiFSA mecanic cuantic recent stabilit ( 1Profilurile H Iterative Full Spin Analysis) observate pentru toate materialele au confirmat că 1) compușii utilizați au fost într-adevăr CBD cu purități de cel puțin 97% ( Fig. 1B ) și 2) canabinoizii congeneri nu erau prezenți la niveluri mai mari de 1,0%. Analiza acestor probe diferite de CBD în testul de infecție virală A549-ACE2 a arătat EC50 similare cu un interval de la 0,6-1,8 μM, reflectând probabil variabilitatea intrinsecă a testului biologic ( Fig. 1A ). Nu a fost observată nicio toxicitate pentru niciunul dintre preparatele CBD la dozele utilizate pentru a inhiba infecția virală (fig. S1 EG).

Metabolitul CBD 7-OH-CBD, dar nu un grup de congeneri CBD strâns înrudiți, prezintă activitate antivirală

CBD este adesea consumat ca parte a unui extract de C. sativa , în special în combinație cu THC psihoactiv îmbogățit în plante de marijuana. Prin urmare, am stabilit dacă canabinoizii congeneri, în special analogii cu structuri și polarități strâns înrudite produse de planta de cânepă, sunt, de asemenea, capabili să inhibe infecția cu SARS-CoV-2. În mod remarcabil, din acest grup, numai CBD a fost un agent puternic, în timp ce nu a fost prezentată activitate antivirală sau foarte limitată de acești congeneri strâns înrudiți din punct de vedere structural care împărtășesc căi de biosinteză și formează complexitatea reziduală determinată biogenetic a CBD purificat din C. sativa : THC, canabidiolic. acid (CBDA), canabidirina (CBDV), canabicromen (CBC) sau canabigerol (CBG) ( Fig. 2 A ,D ; vezi Metode). Niciunul dintre acești canabinoizi nu a fost toxic pentru celulele A549-ACE2 în intervalul de doză de interes (fig. S2). În special, combinarea CBD cu THC (1:1) a suprimat semnificativ eficacitatea CBD în concordanță cu inhibarea competitivă a THC.

FIG. 2 . Inhibarea limitată sau deloc a infecției cu SARS-CoV-2 de către canabinoizi, alții decât CBD. ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de diverși canabinoizi sau un amestec CBD/THC 1:1 urmat de infecția cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Toți canabinoizii testați au fost izolați dintr-un extract de cânepă așa cum este descris în Metode. ( B ) Structurile chimice ale canabinoizilor și 7-OH CBD. ( C) Celulele A549-ACE2 au fost tratate cu doze indicate de 7-OH CBD, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Datele reprezentative ale CBD din Figura 1C (furnizorul A) sunt utilizate pentru comparație. Sunt indicate valorile EC50.

CBD este metabolizat rapid în intestin și ficat în doi metaboliți principali, 7-carboxi-cannabidiol (7-COOH-CBD) și 7-hidroxi-cannabidiol (7-OH-CBD). Nivelul de 7-COOH-CBD este de 40 de ori mai mare, iar nivelul de 7-OH-CBD este de 38% din nivelul CBD din plasma umană ( 15 ). CBD și metabolitul său 7-OH-CBD sunt ingredientele active și echipotente pentru tratamentul epilepsiei ( 13 ). La fel ca CBD, 7-OH-CBD a inhibat eficient replicarea SARS-CoV-2 în celulele A549-ACE2 ( Fig. 2C ) și a fost netoxic pentru celule (fig. S2H, I). Analiza nivelurilor plasmatice din sânge la pacienții sănătoși care luau 1500 mg zilnic de soluție CBD aprobată de FDA (Epidiolex) a arătat o concentrație maximă (C max) la 7 zile pentru CBD și 7-OH-CBD de 1,7 μM și, respectiv, 0,56 μM; C max poate fi crescut în continuare de câteva ori prin administrarea concomitentă cu o masă bogată în grăsimi ( 15 ). Luate în ansamblu, aceste rezultate sugerează că concentrațiile plasmatice eficiente ale CBD și metabolitul său se află în intervalul terapeutic pentru a inhiba infecția cu SARS-CoV-2 la oameni.

CBD acționează într-un pas timpuriu după intrarea virală în celule

CBD ar putea acționa prin blocarea pătrunderii virale în celulele gazdă sau în etapele ulterioare după infecție. Deoarece s-a raportat că CBD scade expresia ACE2 în unele celule epiteliale, inclusiv A549 ( 16 ), am stabilit mai întâi dacă CBD a suprimat receptorul SARS-CoV-2 în celulele A549-ACE2, Calu-3 și Vero E6. Nu a fost observată nicio scădere a expresiei ACE2 ( Fig. 3A ; fig. S4A, B). Mai mult, analiza lentivirusurilor pseudotipizate fie cu proteina spike SARS-CoV-2, fie cu glicoproteina virusului stomatitei veziculoase (VSV) ( 17 ).) a arătat că 10 μM CBD a inhibat doar slab intrarea în celule de către virusul care exprimă vârful, sugerând că alte mecanisme sunt în mare măsură responsabile pentru efectele sale antivirale. Robustețea testului a fost confirmată prin utilizarea anticorpilor anti-spike care au blocat eficient infecția virală a lentivirusului pseudotipizat cu spike, dar nu VSVg ( Fig. 3B și fig. S3 A ​​și B). Spre deosebire de efectul neglijabil asupra intrării virale, CBD a fost foarte eficient (~95–99%) la inhibarea expresiei proteinei spike SARS-CoV-2 în celulele gazdă la 2 și 6 ore după infecție după intrare ( Fig. 3C ). Acest lucru a fost adevărat chiar și în prezența anticorpilor la proteina spike pentru a preveni reinfecția ( Fig. 3D) sugerând că CBD acționează la începutul ciclului de infecție, într-o etapă de după intrare. CBD a fost, de asemenea, parțial eficient (~60%) la inhibarea SARS-CoV-2 la 15 ore după infecție ( Fig. 3C ), sugerând un posibil efect secundar asupra adunării și eliberării virale. Pentru a evalua dacă CBD ar putea împiedica procesarea proteinelor virale de către proteazele virale Mpro sau PLpro, am testat activitatea acestora in vitro (fig. S4C, D). CBD nu a afectat activitatea niciunei proteaze, crescând posibilitatea ca CBD să țintească procesele celulei gazdă.

FIG. 3 . CBD inhibă replicarea virală după intrarea SARS-CoV-2 în celula gazdă. ( A ) Imunobloturi ale expresiei proteinei ACE2 din lizatele de celule A549-ACE2 fie netratate, fie tratate cu vehicul sau CBD la dozele indicate (n = 3). Petele au fost testate cu anticorpi împotriva ACE2 și tubulinei. Nivelurile de expresie a proteinei ACE2 au fost normalizate la semnalul tubulinei din fiecare probă. Nivelurile de expresie ACE2 au fost reprezentate grafic în raport cu probele netratate. ( B ) Celulele 293 T-ACE2 au fost infectate cu pseudovirusul spike sau VSV-G timp de 72 de ore cu dozele indicate de tratament cu CBD, iar procentul de celule infectate a fost reprezentat grafic. ( C) Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. S-a adăugat apoi DMSO sau 10 μM CBD la 2, 6 sau 15 ore după infectare. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. ( D) Panoul din stânga: celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. DMSO sau 10 μM CBD a fost apoi adăugat la 2 ore după infectarea cu anticorpul de neutralizare a vârfurilor pentru a preveni reinfectarea. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. Panoul din dreapta: Validarea eficacității anticorpilor neutralizanți. 400 pfu de virus SARS-CoV-2 au fost incubate cu sau fără 100 μM de anticorp neutralizant timp de 1 oră. Celulele A549-ACE2 au fost tratate cu amestecul timp de 16 ore și au fost cuantificate celulele Spike pozitive.

CBD inhibă expresia ARN viral și inversează modificările induse de virus în expresia genei gazdă

În conformitate cu această interpretare, analiza ARN-seq a celulelor A549-ACE2 infectate tratate cu CBD timp de 24 de ore arată o suprimare izbitoare a modificărilor induse de SARS-CoV-2 în expresia genelor. CBD a eradicat în mod eficient expresia ARN viral în celulele gazdă, inclusiv ARN-ul care codifică proteinele cu vârf, membrană, înveliș și nucleocapsid ( Figurile 4 A și B ). Atât SARS-CoV-2, cât și CBD au indus fiecare modificări semnificative în expresia genelor celulare (figurile S5 și S6). Analiza componentelor principale (PCA) a ARN-ului celulei gazdă arată inversarea aproape completă a modificărilor virale, dar, în loc să revină la o stare normală a celulei, celulele infectate cu virusul CBD + seamănă cu cele tratate numai cu CBD ( Fig. 4C).). Analiza grupării folosind Metascape dezvăluie câteva modele interesante și teme asociate ( Fig. 4D , figurile S7 și S8). De exemplu, inducerea virală a genelor asociate cu modificarea și transcripția cromatinei (Cluster 1) este inversată de CBD, deși CBD singur nu are niciun efect. În mod similar, inhibarea virală a genelor asociate cu ribozomi și neutrofile (Cluster 3) este în mare măsură inversată de CBD, dar medicamentul în sine nu are niciun efect. Acest lucru contrastează cu Clusterele 5 și 6 în care CBD singur induce activarea puternică a genelor asociate cu răspunsul la stres al gazdei. Împreună, aceste rezultate sugerează că CBD acționează pentru a preveni traducerea proteinelor virale și modificările celulare asociate.

FIG. 4 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBD la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Pentru fiecare genă sunt indicate modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBD (CBD_mock) și infectate cu SARS-CoV-2 plus tratate cu CBD (CBD_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

Pentru a obține o mai bună înțelegere a acțiunii antivirale specifice a CBD, am analizat ARNseq din lizate de celule neinfectate sau infectate cu SARS-CoV-2 tratate timp de 24 de ore cu omologul CBDV inactiv. Inducerea genelor virale pentru proteinele cu vârf, înveliș și nucleocapsid este redusă cu doar 60% cu CBDV, spre deosebire de ~99% cu CBD ( Fig. 5A,B ). Tratamentul CBDV provoacă mai puține modificări transcriptomice decât CBD în celulele A549-ACE2 și este în mare măsură ineficient în inversarea modificărilor transcripționale induse de SARS-CoV-2 ( Fig. 5C ). Analiza grupării folosind Metascape dezvăluie doar câteva grupuri care arată inversarea CBDV a modificărilor transcriptomice virale ( Fig. 5D). Acestea includ autofagia și metabolismul lipidic (Cluster 1) care sunt induse de CBDV, precum și traducerea proteinelor/ciclul celular/replicarea ADN-ului (Cluster 3) care sunt suprimate de CBDV.

FIG. 5 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBDV. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBDV la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD sunt indicate pentru fiecare genă. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBDV (CBDV_mock) și infectate cu SARS-CoV-2 plus tratate cu CBDV (CBDV_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

CBD induce răspunsul la stres ER și activitatea IRE1α ca un mecanism cheie pentru acțiunea sa antivirale

De interes deosebit sunt trei seturi de gene legate de răspunsul la stres reticulului endoplasmatic (ER), răspunsul proteic desfășurat (UPR) și inducerea interferonului care sunt reglate selectiv în sens pozitiv de CBD, dar nu de CBDV ( Fig. 6A ). Prin contrast, genele asociate cu răspunsul la stres oxidativ sunt induse de ambii canabinoizi. Celulele se confruntă cu stresul ER atunci când volumul de muncă al mașinilor de pliere a proteinei ER depășește capacitatea sa. Sub stresul ER, proteinele secretoare se acumulează în forme desfășurate în organele pentru a declanșa un set de căi de semnalizare intracelulare numite UPR, care face parte dintr-un răspuns la stres celular mai mare care menține proteostaza în întreaga celulă ( 18 ).). Calea UPR este controlată de trei proteine ​​transmembranare ER – IRE1α, PERK și ATF6 – care conțin un domeniu luminal ER capabil să detecteze direct sau indirect proteinele pliate greșit. Ca răspuns la stresul ER, fiecare dintre acești senzori pune în mișcare modificări transcripționale și translaționale care cresc capacitatea de pliere a proteinelor și încearcă să restabilească homeostazia. Cu toate acestea, dacă stresul asupra ER este iremediabil, UPR comută ieșirile și semnalează moartea celulei. Am validat inducerea CBD a expresiei genelor IRE1α, PERK și ATF6 prin qRT-PCR (fig. S9A), în concordanță cu rapoartele anterioare ( 19 ). Analiza ingeniozității a confirmat că CBD induce UPR semnificativ mai mult decât CBDV (fig. S9B, S10B, S11).

FIG. 6 . CBD promovează răspunsurile la stres ER ale celulei gazdă și splicing-ul IRE1α/XBP1, iar IRE1α contribuie la activitatea anti-virale CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament cu CBD sau CBDV la 10 μM (A,B) sau conform indicațiilor (C) timp de 24 de ore (A, B) sau conform indicațiilor (C). ). ( A ) Harta termică a activării căii prezise pe baza analizei Ingeniozității a scorurilor z de activare pentru fiecare cale și fiecare comparație. Roșu: calea este activată. Albastru: calea este inhibată. Alb: calea este neschimbată. Gri: nicio predicție din cauza lipsei de semnificație. ( B) Analiza îmbinării XBP1 de către RNază IRE1α. Au fost identificate și cuantificate citirile reprezentând XBP1 spliced ​​sau nespliced ​​pentru celulele care au fost tratate simulat, SARS-CoV-2 tratate sau tratate cu CBD sau CBDV fie singure, fie în prezența virusului (panoul din stânga). Au fost reprezentate grafice procentul de citiri îmbinate alternativ pentru probele de ARN-seq și au fost efectuate teste t nepereche comparând probele simulate ale fiecărui experiment cu alte probe (panoul din dreapta). ( C ) Celulele A549-ACE2 au fost tratate cu concentrațiile indicate de CBD timp de 3 și 6 ore. Relația dintre concentrația CBD și îmbinarea XBP1 a fost determinată prin qRT-PCR. ( D) Efectul IRE1α asupra răspunsului la doză pentru activitatea antivirală a CBD. Celulele A549-ACE2 sau A549-ACE2 lipsite de IRE1α (IRE1 KO) au fost tratate cu doze indicate de CBD, urmate de infectare cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. Testele t nepereche au fost efectuate la fiecare concentrație și au fost arătate valori p semnificative. Acesta este reprezentativ pentru trei experimente independente (Compozit EC50 1,7 v. 1,2, p < 0,05). ( E ) Schemă care ilustrează efectul CBD și SARS-CoV-2 asupra activității IRE1α RNază și îmbinării XBP1.

Numeroase studii raportează dovezi convingătoare că UPR este hiperactivat și necesar pentru replicarea altor membri ai familiei coronavirusului strâns înrudiți ( 20 , 21 ). În mod surprinzător, deși analiza de îmbogățire GSEA a datelor ARN-seq a arătat că calea IRE1α este puternic activată de CBD în prezența sau absența virusului, această cale nu a fost activată numai de SARS-CoV-2 ( Tabelul 1 ).; smochine. S12, S13, S14). PERK, prin contrast, a fost activat funcțional atât de SARS-CoV-2, cât și de CBD. IRE1α este o proteină transmembranară ER cu o singură trecere cu activități bifuncționale kinază/endoribonuclează (RNază). Ca răspuns la stresul ER, IRE1α suferă oligomerizare și autofosforilare, care își activează alosteric RNaza pentru a iniția îmbinarea productivă a ARNm XBP1. XBP1 îmbinat codifică un factor de transcripție care reglează în sus multe răspunsuri la stresul gazdei, inclusiv inducerea însoțitorului ER și componentele de degradare asociată ER (ERAD) ( 22 ) ( Fig. 6E ).

Comparaţiefiliala UPRGSEA NESARN-seq
schimbare de pliere
CBD vs mockPERK1.432.46
IRE11,382.29
ATF6ND*1.40
Virus vs batjocurăPERK1,921,85
IRE1Nu este îmbogățit2,67
ATF6ND*0,91
CBD + virus vs simulatPERK1.453.24
IRE11.442,76
ATF6ND*1.24

TABELUL 1 . Inducerea expresiei genelor PERK, IRE1 sau ATF6 și a funcției ca răspuns la virusul CBD și/sau SARS-CoV-2. Datele de expresie a genei ARN-seq sunt utilizate pentru GSEA pe trei termeni GO „UPR mediat de PERK”, „UPR mediat de IRE1” și „UPR mediat de ATF6” (numere Ontologie genică 36498, 36499, 36500). Scorul de îmbogățire normalizat este afișat în coloana „GSEA NES” (scor mai mare = mai multă îmbogățire). Schimbarea plierii pentru diferențele de expresie transcripțională între PERK, IRE1 și ATF6 este afișată pentru fiecare comparație în coloana „ARN-seq fold-change”. 

*ND = Nedeterminat din cauza lipsei de gene pentru a obține valori fiabile.CBD activează puternic activitatea IRE1α RNază așa cum se arată prin analiza splicing-ului XBP1 folosind atât datele ARNseq pentru a cuantifica XBP1 spliced, cât și confirmarea directă prin qRT-PCR ( Fig. 6B ; fig. S15). După cum sa prezis, CBD a indus îmbinarea XBP1 în prezența sau absența virusului, în timp ce CBDV nu a avut un efect semnificativ și este comparabil doar cu virusul. Curbele de timp și de răspuns la doză pentru inducerea CBD a splicing-ului XBP1 în absența virusului au fost în concordanță cu cursul în timp și răspunsurile la doză pentru inhibarea CBD a exprimării proteinei spike virale în celulele A549-ACE2 ( Fig. 6C).). În plus, în timp ce un knockout IRE1α nu a avut un efect semnificativ asupra infecției cu SARS-CoV-2, a schimbat răspunsul la doză și a redus semnificativ efectele antivirale ale CBD, ducând la o creștere de aproximativ 2 ori a EC50 împotriva SARS-CoV- 2 ( fig. 6D ; fig. S16). Împreună, aceste rezultate indică faptul că inducerea CBD a IRE1α este o componentă critică a acțiunii sale antivirale împotriva SARS-CoV-2.

CBD induce expresia interferonului ca parte a activității sale antivirale

Un alt mecanism prin care CBD ar putea suprima infecția virală și poate promova degradarea ARN viral este prin inducerea căii de semnalizare a interferonului. Interferonii sunt printre cele mai timpurii răspunsuri imune înnăscute ale gazdei la expunerea la patogen ( 23 ). După cum sa raportat ( 24 ), infecția cu SARS-CoV-2 suprimă calea de semnalizare a interferonului ( fig. 7A și fig. S17). Multe gene din cale, cum ar fi ISG15, IFIT1, IFIT3, SOCS1 și OAS1, o genă indusă de interferon care duce la activarea RNazelor L și a degradării ARN ( 25 ), au fost moderat up-reglate numai de CBD, dar puternic induse de CBD în prezența virusului ( Fig. 7Asi smochine. S18,19). Aceste din urmă rezultate sunt în concordanță cu posibilitatea ca CBD să reducă titrul viral efectiv suficient pentru a permite activarea normală a căii interferonului a gazdei. În același timp, CBD a inversat eficient inducerea virală a citokinelor care poate duce la furtuna mortală de citokine în stadiile ulterioare ale infecției ( Fig. 7B ). Prin contrast, omologul inactiv CBDV nu induce în mod semnificativ gene în cadrul căii interferonului și nici nu previne inducerea citokinelor ( Fig. 6A , 7A , 7C , figurile S20A, B și S21).

FIG. 7 . CBD promovează răspunsurile la interferonul celulei gazdă și inhibă inducerea virală a citokinelor. ( A ) Harta termică a schimbării de pliere (log2) a genelor din calea canonică de răspuns la interferon pentru toate probele tratate cu virus sau CBD în comparație cu probele tratate simulat. Coloanele 1-3 folosesc mostre din experimentul ARN-seq pe CBD și SARS-CoV-2. Coloanele 4-6 folosesc mostre din experimentul ARN-seq pe CBDV și SARS-COV-2. ( B ) Hartă termică a nivelurilor de expresie normalizate ale genelor GO Cytokine Activity care au fost reglate în sus de infecția virală, dar au fost reglate în jos prin tratamentul CBD pentru toate probele de ARN-seq din experimentul pe CBD și SARS-CoV-2. ( C) Hartă termică a nivelurilor de expresie normalizate ale acelorași gene pentru toate probele de ARN-seq din experimentul pe CBDV și SARS-CoV-2. ( D ) Celulele A549-ACE2 au fost tratate cu 2,5 μM de vehicul sau CBD cu sau fără anticorp uman IFN-γ și amestec uman de neutralizare a IFN de tip I cu 2 ore înainte de infectare. Celulele au fost apoi infectate cu 0,5 MOI SARS-CoV-2 și incubate timp de 24 de ore, iar virusul activ a fost măsurat utilizând un test pe placă. Rezultatele sunt reprezentative pentru trei experimente independente.

Pentru a testa direct posibilitatea ca interferonii să țină cont parțial de activitatea antivirală a CBD, am expus celulele ACE2-A549 la un amestec de anticorpi împotriva interferonilor de tip I (α,β,ο) și de tip II (γ) înainte de Tratament cu CBD de 2,5 μM și infecție virală. Rezultatele arată că anticorpii anti-interferon reduc efectele anti-virale ale CBD și salvează parțial infecția cu SARS-CoV-2 ( Fig. 7D ). Colectiv, aceste rezultate sugerează că CBD inhibă infecția cu SARS-CoV-2 parțial prin activarea IRE1α și a căilor interferonului, ceea ce duce la degradarea ARN viral și la modificări ulterioare induse de virus în expresia genei gazdă, inclusiv citokinele.

Tratamentul cu CBD inhibă semnificativ replicarea SARS-CoV-2 la șoareci

Deoarece mai mulți agenți, inclusiv medicamente amfipatice cationice, blochează replicarea SARS-CoV-2 în celulele cultivate, dar nu in vivo ( 26) , am determinat dacă CBD reduce titrul viral la șoarecii femele K18-hACE2 ( 27 ). Șoarecii au fost injectați intraperitoneal de două ori pe zi cu CBD (20 sau 80 mg/kg) timp de 7 zile înainte de provocarea intranazală cu SARS-CoV-2 (2×104 PFU ). După provocare, administrarea CBD a continuat de două ori pe zi timp de încă 4 zile ( Fig. 8A ). Tratamentul cu CBD a inhibat semnificativ replicarea virală în plămâni și cornetele nazale în ziua 5 după infecție într-o manieră dependentă de doză ( Figurile 8B-C). Doza mai mică de CBD a redus încărcătura virală de 4,8 ori în plămâni și de 3,7 ori în cortinele nazale, în timp ce doza mai mare a scăzut titrurile virale de 40 și, respectiv, de 4,8 ori în plămâni și, respectiv, în cortinele nazale. În această perioadă, șoarecii nu au prezentat semne de boală clinică, iar greutățile lor corporale nu au fost modificate semnificativ ( Fig. 8D ). Aceste rezultate stabilesc eficacitatea preclinica a CBD ca medicament antiviral pentru SARS-CoV-2 în stadiile incipiente ale infecției.

FIG. 8 . CBD inhibă replicarea SARS-CoV-2 la șoareci. ( A ) Cronologia experimentului cu șoarece. ( B ) Titrul viral în plămâni de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( C ) Titrul viral în cornetele nazale de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( D ) Măsurătorile de greutate ale șoarecilor din fiecare grup de tratament (n = 10) în timpul studiului. Greutatea corporală a fiecărui șoarece este normalizată la greutatea sa măsurată în ziua 0. Toate animalele au fost provocate cu SARS-CoV-2 prin instilare intranazală în ziua 7.

Utilizarea CBD este asociată negativ cu indicațiile de infecție cu SARS-CoV-2 la pacienți

Având în vedere că preparatele CBD de înaltă puritate sunt luate de un număr mare de persoane, am examinat dacă înregistrările de medicamente ale prescripțiilor sau utilizării CBD sunt asociate cu indicații ale infecției cu SARS-CoV-2 (adică, teste COVID-19 pozitive și/sau COVID-19). diagnostice proximale testelor COVID-19). O soluție orală de CBD 100 mg/mL (CBD100) este adesea utilizată pentru tratamentul convulsiilor (vezi suplimentul de analiză a pacientului). Analiza a 1.212 de pacienți din National COVID Cohort Collaborative (N3C) ( 28) cu un istoric de afecțiuni legate de convulsii și un dosar de medicație CBD100 a evidențiat 6,2% (75 de pacienți) cu o indicație de infecție cu SARS-CoV-2 proximă la datele primului lor test COVID-19 în datele lor N3C. Aceasta a fost o rată semnificativ mai mică decât ratele grupurilor de control potrivite de pacienți care nu au avut nicio înregistrare CBD100 (de exemplu, 6,2% pentru pacienții cu CBD100, comparativ cu 8,9% pentru pacienții non-CBD100, p = 0,014; raportul cotelor modelului logit multivariabil ( OR) de 0,65, p = 0,009, 95% CI [0,47, 0,90]). Datele demografice și istoricul medicației pacienților cu CBD100 au fost similare cu cele ale grupului de control potrivit. Istoricul stării medicale pentru acești pacienți a inclus afecțiuni legate de convulsii, lista CDC a afecțiunilor cu risc ( 29) și alți factori potențiali de confuzie, cum ar fi condițiile de mobilitate redusă, durerea cronică sau dizabilitățile de dezvoltare care pot limita interacțiunea publică și expunerea la COVID-19. Asocierea negativă a fost și mai semnificativă în analizele unui subgrup de 531 de pacienți cu CBD100 care probabil luau CBD100 la datele primelor lor teste COVID-19 (de exemplu, 4,9% dintre acești pacienți CBD100, comparativ cu 9,0% dintre 531 de martori potriviți, p. = 0,011; OR = 0,48, p = 0,006, 95% CI [0,29, 0,81]) ( Fig. 9 ; Tabelul S4 din Suplimentul de analiză a pacientului care descrie metodele și constatările de analiză a datelor pacientului în detaliu).

FIG. 9 . Înregistrările de medicamente CBD 100 mg/mL la pacienți sunt asociate în mod semnificativ cu o mai puțină pozitivitate pentru COVID-19. Schemă care arată derivarea eșantionului nostru principal de analiză și a grupurilor de pacienți cu canabidiol (CBD) obținute din National COVID Cohort Collaborative (N3C). Sunt ilustrate analize succesive ale subgrupurilor de pacienți. Panoul final arată asocieri între a avea o înregistrare a medicamentelor CBD de 100 mg/mL la data primului test COVID-19 și starea pozitivă pentru COVID-19 în rândul grupurilor de control potrivite de mărime în creștere (adică, 1-la-1, 2-la). -1 și 3 la 1 dintre controale față de pacienții cu CBD). O covariabilă nepotrivită are o diferență medie standardizată mai mare de 0,10 și o valoare p a testului exact Fisher pe două fețe mai mică de 0,05 atunci când se compară distribuția sa între pacienții cu CBD și martorii lor potriviți. AUC se referă la aria sub curba caracteristică de funcționare a receptorului.Informații detaliate cu privire la metodele și constatările de analiză a datelor pacientului se găsesc în Suplimentul de analiză a pacientului.

DISCUŢIE

Rezultatele noastre sugerează că CBD și metabolitul său 7-OH-CBD pot bloca infecția cu SARS-CoV-2 în stadiile incipiente și chiar ulterioare ale infecției. Mecanismul pare să fie mediat parțial de activarea căilor IRE1α RNază și interferon. În plus față de aceste descoperiri bazate pe celule, studiile preclinice arată că tratamentul cu CBD a redus titrurile virale în plămânii și turbinatele nazale ale șoarecilor infectați cu SARS-CoV-2. În cele din urmă, analiza unui eșantion național de pacienți cu înregistrări active de consum de 100 mg/ml CBD la momentul testării COVID a dezvăluit o asociere cu mult mai puține rezultate pozitive ale testelor SARS-CoV-2. Această asociere negativă a fost solidă pentru multe analize de sensibilitate, inclusiv modificări ale modelelor de potrivire și rezultate și merită cercetări suplimentare asupra potențialului CBD de a combate infecția cu SARS-CoV-2,cum ar fi validarea în alte seturi de date mari, cu mai multe site-uri, pentru dosarele de sănătate electronice sau proiecte experimentale prospective.Un mecanism care contribuie la activitatea antivirală a CBD este inducerea căii interferonului, atât direct, cât și indirect, după activarea răspunsului imun al gazdei la agentul patogen viral. De fapt, interferonii au fost testați clinic ca potențiale tratamente pentru COVID-19 ( 30 ). Când este hiperactivată de stres sever al ER, activitatea RNazei IRE1α duce la dezintegrarea endonucleolitică a multor ARNm localizați în ER (RIDD) și la activarea ulterioară a RIG-I și interferonilor ( 18 ).). Deși SARS-CoV-2 induce activitatea kinazei IRE1α, nu își activează activitatea RNază monitorizată prin splicing XBP1. Astfel, activitatea RNază a IRE1α indusă de CBD poate explica atât degradarea ARN viral, cât și inducerea interferonilor de către fragmentele de ARN. Vor fi necesare investigații suplimentare pentru a determina dacă ambele efecte antivirale ale CBD sunt legate de răspunsul la stres ER. Important, CBD suprimă, de asemenea, activarea citokinelor ca răspuns la infecția virală, reducând probabilitatea recrutării celulelor imune și a furtunilor ulterioare de citokine în plămâni și în alte țesuturi afectate. Aceste rezultate completează descoperirile anterioare care sugerează că CBD suprimă producția de citokine în celulele imune recrutate, cum ar fi macrofagele ( 31 ).). Astfel, CBD are potențialul nu numai de a acționa ca agent antiviral în stadiile incipiente ale infecției, ci și de a proteja gazda împotriva unui sistem imunitar hiperactiv în stadiile ulterioare.CBD are o serie de avantaje ca potențial agent preventiv împotriva SARS-CoV-2. CBD ca aditiv alimentar cu un conținut de THC mai mic de 0,3% este disponibil pe scară largă fără acces restricționat. Cu o formulare adecvată, control al calității și livrare, CBD ar putea fi utilizat profilactic, spre deosebire de medicamentele antivirale recente. Sunt posibile mai multe mijloace de ingerare a CBD, inclusiv potențialul de inhalare și livrare nazală. CBD blochează replicarea virală după intrarea în celule și, prin urmare, este probabil să fie eficient împotriva variantelor virale cu proteine ​​​​pic mutante. Spre deosebire de medicamente precum remdesivir sau anticorpii antivirali, administrarea CBD nu necesită injectare în spitale. În cele din urmă, CBD este asociat doar cu efecte secundare minore ( 32 ).Cu toate acestea, mai multe probleme necesită o examinare atentă înainte ca CBD să poată fi luat în considerare în continuare sau chiar explorat ca o pistă terapeutică pentru COVID-19 ( 12mai ales în lumina descoperirilor noastre care sugerează că alți canabinoizi, cum ar fi THC, ar putea acționa pentru a contracara eficacitatea antivirale CBD. Acest lucru elimină în esență fezabilitatea ca marijuana să servească drept sursă eficientă de CBD antiviral, în plus față de problemele legate de statutul său legal. În cele din urmă, alte mijloace de administrare a CBD, cum ar fi vapoarea și fumatul, ridică preocupări suplimentare cu privire la potențialele leziuni pulmonare.Vor fi necesare studii viitoare pentru a explora mijloacele optime de livrare a CBD către pacienți, împreună cu studii clinice, pentru a evalua în continuare promisiunea CBD ca medicament terapeutic pentru blocarea infecției cu SARS-CoV-2. Studiile noastre pe animale oferă suport preclinic pentru evaluarea CBD ca agent terapeutic anti-SARS-CoV-2 în studiile clinice. Susținem studii clinice controlate cu placebo concepute cu atenție, cu concentrații cunoscute și formulări foarte caracterizate, pentru a defini rolul CBD în prevenirea și tratarea infecției precoce cu SARS-CoV-2. Omul necesar in vivoconcentrația și calea optimă și formularea rămân de definit. Avertizăm cu tărie împotriva tentației de a lua CBD în formulările disponibile în prezent, inclusiv comestibile, inhalante sau topice ca terapie preventivă sau de tratament în acest moment, mai ales fără cunoștințele unui studiu clinic riguros randomizat cu acest produs natural ( 33 ).

MATERIALE SI METODE

Design de studiu

Am demonstrat utilizând celule knockout IRE1α și anticorpi anti-interferon care blochează că atât IRE1, cât și interferonii contribuie la activitatea anti-virală a CBD. În cele din urmă, utilizând înregistrările medicale pentru grupuri de pacienți umani din National COVID Cohort Collaborative în cadrul protocoalelor IRB adecvate, am analizat asocierea pacienților care iau CBD cu riscul lor de a fi testat pozitiv pentru SARS-CoV-2. Statisticile sunt furnizate în cifrele corespunzătoare și în metode.

Materiale, celule și viruși

CBD de înaltă puritate a fost achiziționat de la două companii chimice sau de la două surse comerciale online. 7-OH-CBD a fost achiziționat de la Cerilliant Corporation (Round Rock, TX). Toți compușii comerciali utilizați au fost validați prin RMN așa cum este descris mai jos. Uleiul de cânepă infuzat cu canabinoizi care conține peste 1.500 mg de canabinoizi a fost de la Bluebird Botanicals (Louisville, CO, SUA). Extractul de cânepă din biomasa C. sativa a fost de la Hopsteiner Ltd. (Yakima, Washington, SUA). Uleiul de cânepă cu conținut scăzut de CBD a fost obținut dintr-o sursă comercială online. Celulele A549-ACE2 au fost furnizate cu generozitate de tenOever și colegii ( 24). Celulele Vero E6 și celulele Calu3 au fost achiziționate de la ATCC. SARS-CoV-2 (nCoV/Washington/1/2020) a fost furnizat de Natalia Thornburg (Centre pentru Controlul Bolilor) prin Centrul Mondial de Referință pentru Viruși și Arbovirusuri Emergente (Galveston, Texas) și de la BEI Resources for the in vivostudii. Variantele SARS-CoV-2 au fost furnizate de resursele BEI. Varianta α este numărul BEI NR-54000, izolat hCoV-19/England/204820464/2020 provenit de la Public Health England. Varianta β este numărul BEI 54009, B.1.351(20H/501Y.V2) provenită de la Institutul de Cercetare în Sănătate din Africa. Varianta γ este numărul BEI 54982, izolat hCoV-19/Japan/TY7–503/2021 provenit de la Institutul Național de Boli Infecțioase din Japonia. Stocurile virale au fost realizate prin două treceri în celulele Vero E6 și titrurile stoc au fost determinate prin limitarea titrului plăcii de diluție pe celulele VeroE6 (descris mai jos).

Test de infecție cu SARS-CoV-2

Toate infecțiile cu SARS-CoV-2 au fost efectuate în condiții de nivel 3 de biosecuritate la Laboratorul Regional de Bioconteniment Howard T. Rickett, Universitatea din Chicago. In vivoinfecțiile au fost efectuate în condiții ABSL-3 la Centrul de Medicină Predictive pentru Bioapărare și Boli Infecțioase Emergente, Laboratorul Regional de Biocontainment al Universității din Louisville. Celulele din DMEM + 2% FBS au fost tratate cu CBD sau alți inhibitori sau 2 ore cu diluții de 2 ori începând cu 10 μM în triplicat pentru fiecare test. Celulele A549-ACE2 au fost infectate cu un MOI (multiplicitatea infecției) de 0,5 în medii care conțineau concentrația adecvată de medicamente. Celulele Vero E6 au fost infectate cu un MOI de 0,1 în medii care conțineau concentrația adecvată de medicamente. După 48 de ore, celulele au fost fixate cu formol 3,7%, blocate și testate cu anticorp anti-Spike de șoarece (GTX632604, GeneTex) diluat 1:1.000 timp de 4 ore, clătite și testate cu HRP anti-șoarece timp de 1 oră, spălat, apoi dezvoltat cu substrat DAB 10 minute. 40) au fost cuantificate prin microscopie cu lumină ca probe orbite. Titrurile virale au fost determinate prin analiza pe placă. Pe scurt, un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns. un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns.

Test de toxicitate Crystal Violet

Celulele au fost tratate cu concentrații diferite de compuși diferiți în 2% DMEM, începând cu 10 μM și coborând cu 1/2 pentru încă șase diluții. Celulele au fost incubate cu medicamentul timp de 48 de ore. Celulele au fost fixate cu soluție de formol 10% timp de 30 de minute. Apoi au fost colorați cu soluție Crystal Violet 1% timp de 30 de minute, după care plăcile au fost uscate și cantitatea de colorare Crystal Violet a fost evaluată prin măsurarea absorbanței la 595 nm pe un cititor de plăci TECAN M200. Citirile de absorbție au fost normalizate la cele ale godeurilor de control netratate cu medicament pentru a măsura diferențele de creștere a celulelor cu sau fără tratamentul medicamentos.

Test de neutralizare a proteinelor și a anticorpilor în vârf

Celulele A549-ACE2 au fost tratate cu 10 μM de CBD fie cu 2 ore înainte de infectare, fie cu 2, 6 sau 15 ore după infecție. Celulele au fost infectate cu MOI de 0,5 timp de 2 ore. Apoi, mediul de infecție a fost înlocuit cu mediu care conține CBD sau DMSO și probele au fost incubate la 37°C timp de 16 ore. Într-un experiment când CBD a fost adăugat la 2 ore după infecție, mediul de infecție a fost înlocuit cu CBD sau DMSO și μM de anticorp neutralizant (Active Motif 001414). După 16 ore, probele au fost fixate cu formol 10% și au fost supuse IHC pentru proteina spike. Eficiența anticorpului de neutralizare a fost testată prin incubarea a 400 pfu de virus cu sau fără 100 μM de anticorp la 37°C timp de 1 oră. Apoi celulele A549-ACE2 au fost infectate cu amestecul timp de 16 ore. Celulele Spike pozitive au fost cuantificate așa cum este descris mai sus.

Test de neutralizare a anticorpilor interferonului

Celulele A549-ACE2 au fost tratate cu 2,5 μM de CBD, 1 μg/ml anticorp IFN-γ uman (MAB285–100) și diluție 1:25 de amestec de Ab neutralizant IFN uman de tip I (PBL Assay Science 39000–1) cu 2 ore înainte infecţie. Celulele au fost apoi infectate cu 0,5 MOI și incubate timp de 24 de ore, după care supernatanții au fost colectați și virusul activ măsurat folosind testul pe placă descris mai sus.

Generarea de celule knockout IRE1α de către CRISPR-Cas9

Stocurile de lentivirus au fost prin utilizarea lentiCRISPR v2 (Addgene) cu ARN ghid unic (sgRNA) care vizează secvența IRE1 (CGGTCACTCACCCCGAGGCC). Celulele A549-ACE2 infectate au fost selectate policlonal și menținute folosind mediu suplimentat cu 4 μg/mL puromicină timp de 1 săptămână.

Descrierea canabinoizilor

CBD poate fi obținut prin izolarea acidului canabidiolic (CBDA) din materialul vegetal de Cannabis sativa și apoi inducerea decarboxilării chimice sau prin decarboxilarea canabinoizilor conținuti în materia primă de plante sau extract și izolarea ulterioară a CBD. Cannabidivarina (CBDV) este un omolog CBD natural care are un n -propil în locul lanțului lateral n – pentil al CBD . Cannabigerol (CBG), sub formă de acid cannabigerolic, este precursorul metabolic atât al acidului tetrahidrocannabidiolic, cât și al CBDA în C. sativa. Tetrahidrocannabinolul (THC) este un congener ciclizat al CBD care se obține după decarboxilarea acidului tetrahidrocannabinolic. THC este prezent în C. sativa atât în stereoizomerii Δ 9 – cis cât și Δ 9 – trans . Canabicromenul (CBC), sub formă de acid canabicromenic, reprezintă un al treilea metabolit posibil al acidului canbigerolic cu un inel de cromen în restul de geranil.

Achiziția, izolarea și caracterizarea canabinoizilor

În studiul de față, purificarea CBD din surse naturale a folosit (a) ulei de cânepă infuzat cu canabinoizi, care conține 1.500+ mg de canabinoizi în trigliceride cu lanț mediu pe uncie fluide, fabricat de Bluebird Botanicals (Louisville, CO, SUA) și (b) cânepă extract preparat prin extracție cu fluid supercritic (SFE) cu CO 2 din C. sativabiomasă care se califică drept cânepă, fabricată de Hopsteiner Ltd. (Yakima, Washington, SUA) cu un conținut total de 54,7% CBD, calculat ca CBD + CBDa*0,877. Puritățile tipice ale acestor preparate CBD sunt în intervalul 90-97%, inclusiv impuritățile străine (de exemplu, solvent rezidual) determinate de qHNMR. Detaliile metodologiilor de purificare și analiză a structurii sunt detaliate într-o publicație concomitentă, care este în prezent în presă (Journal of Natural Products). Pe scurt, metodologiile pot fi rezumate după cum urmează:

Procedura de purificare

CBD, CBC, CBG, Δ 9 – trans -THC, Δ 9 – cis -THC și CBDV au fost izolate din uleiul de cânepă, iar CBDA din extractul brut de cânepă SFE, utilizând cromatografia de partiție centrifugală (CPC), o tehnică de separare în contracurent. , și un sistem bifazic lichid-lichid.

Metodologia de elucidare a structurii

Identitățile CBD din sursă comercială și ale altor eșantioane de canabinoizi au fost verificate prin analiză 1D 1H RMN , efectuată ca măsurare qNMR, prin comparație cu un profil HiFSA autentic al CBD așa cum a fost publicat ( 12 ). Pe lângă o potrivire excelentă generală a profilurilor, semnalul de amprentă puternic cuplat al axului H-4” a servit ca un marker de identitate foarte specific. Structurile canabinoizilor care au fost obținute comercial sau purificate din surse naturale au fost stabilite printr-o combinație de analiză 1D/2D RMN și LC-HRMS, ținând cont de datele de referință din literatură.

Prepararea probelor RMN

Pentru probele comerciale furnizate ca soluție, solventul a fost îndepărtat cu grijă în vid și 450 μL de metanol deuterat (MeOH- 4) adăugat la reziduu folosind o seringă de precizie. Soluția a fost transferată într-un tub RMN de 5 mm cu o pipetă de sticlă, flaconul a fost clătit de trei ori cu 25 μL de solvent și soluția de clătire a fost transferată în același tub RMN, pentru un volum final de 525 μL. Probele comerciale și izolate disponibile ca solide au fost cântărite direct într-un tub RMN de 5 mm și au fost adăugate 500 μL de solvent cu o seringă de precizie. Pentru analiza preparatului comercial de ulei de cânepă, s-au adăugat direct 10 picături (0,25 ml echivalent cu 14-15 picături) într-un tub RMN de 5 mm. Greutatea netă a uleiului de cânepă în tubul RMN a fost de 198,50 mg, determinată pe o balanță de precizie de 0,01 mg și s-au adăugat 0,90 mg de acid dinitrobenzoic ca calibrant intern pentru IC-qHNMR; 325 μL de CDCl 3 și 10 μL de CD 3S-au adăugat OD, iar tubul a fost sigilat la flacără.

Achiziția și prelucrarea datelor RMN și evaluarea qNMR

Toate datele 1H RMN au fost achiziționate pe un Bruker 600 Avance III cu o sondă criogenică directă 13C cu două canale . Domeniul de timp (TD) a fost setat la 64 k, întârzierea de relaxare (D1) a fost de 60 de secunde, au fost utilizate impulsuri de excitație de 90 de grade pentru un total de 32 de scanări mediate de semnal. Câștigul receptorului (RG) a fost de 32 pentru toate probele, cu excepția unei probe cu masă limitată < 1 mg (RG = 101) și a probei de ulei de cânepă în cantitate mare (RG = 2; puls de excitație de 15 grade utilizat). Determinarea purității probei și a conținutului de CBD în uleiul de cânepă prin RMN cantitativ (qNMR) folosind abordarea 100% qNMR și foi de lucru publicate în mod deschis ( https://gfp.people.uic.edu/qnmr/content/qnmrcalculations/100p.html). Puritatea qNMR a tuturor probelor de CBD a fost > 97%, inclusiv impuritățile străine, și nu au putut fi detectați congeneri canabinoizi la niveluri de peste 1,0%. Folosind metoda absolută qHNMR cu calibrare internă (IC abs-qNMR), conținutul de CBD din uleiul de cânepă a fost determinat ca 0,30%.

Producția de lentivirus pseudotipizat

Celulele 293 T și 293 T-ACE2 au fost cultivate în DMEM (Corning 10017CV) cu piruvat de sodiu 1X (Gibco 11360070) și 10% FBS (HyClone SH30910). Particulele de lentivirus pseudotipizate cu proteina spike SARS-CoV-2 (Wuhan-Hu-1) sau VSV-G au fost generate așa cum este descris ( 19). Pe scurt, 293 de celule T au fost transfectate folosind TransIT-LT1 (Mirus) cu vectori de ambalare lentivirus de a treia generație (HDM-Hgpm2, HDM-tat1b, pRC-CMV-Rev1b), vector de transfer (pHAGE-CMV-ZsGreen-W) și fie SARS – Spike CoV-2 (HDM-IDTSpike-fixK) sau VSV-G (HDH-VSVG). Supernatanții colectați la 36 și 60 de ore după transfecție au fost reuniți, seringa filtrată și congelată în alicote de unică folosință la -80°C. Toate plasmidele utilizate pentru producerea de lentivirus au fost oferite cu amabilitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de legare a pseudovirusului

293 de celule T-ACE2 au fost însămânțate la 1,2 × 104 celule per 96 de godeuri în perete negru, plăci de fund clare. A doua zi, au fost preparate diluții de două ori de stoc CBD (10 mM) în DMSO, urmate de diluții 1:1000 fie în DMEM complet, fie în preparat pseudovirus. Pseudovirusul SARS-CoV-2 a fost utilizat nediluat, în timp ce pseudovirusul VSV-G a fost diluat 1:1.500 în DMEM complet. Celulele și pseudovirusul au fost pre-tratate cu diluții de CBD timp de 2 ore și, respectiv, 1 oră la 37°C. Celulele au fost infectate cu pseudovirus timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu un marker nuclear (Hoechst 33342, ThermoFisher H3570) și fotografiate. 293 de celule T-ACE2 au fost furnizate cu generozitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de neutralizare a pseudovirusului

Celulele 293 T sau 293 T-ACE2 au fost însămânțate la 1,2 × 104 celule pe 96 de godeuri în perete negru, plăci de fund clar. A doua zi, anticorpul de neutralizare a vârfului SARS-CoV-2 (Sino Biological 40592-R001) a fost diluat în DMEM complet la o concentrație finală inițială de 300 ng per 100 ul per 96 de godeuri, urmată de diluții ulterioare de 3 ori. Anticorpul de neutralizare a fost incubat cu pseudovirus timp de 1 oră. la 37°C. Celulele au fost infectate cu pseudovirus +/- anticorp neutralizant timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu marker nuclear Hoechst 33342 și fotografiate.

Test de inhibiție a proteazei

Testele au fost efectuate în duplicat, la temperatura camerei, în plăci negre cu 96 de godeuri la 25°C. Reacțiile care conțineau concentrații diferite de inhibitor (10 sau 50 μM) și enzima 3CLpro (0,4 μM) sau enzima PLpro (0,3 μM) în Tris-HCl pH 7,3, 1 mm EDTA au fost incubate timp de aproximativ cinci minute. Reacțiile 3CLpro au fost apoi inițiate cu substratul sondei TVLQ-AMC (40 μM), iar reacțiile PLpro au fost inițiate cu substratul sondei LKGG-AMC (40 μM). Placa de reacție a fost agitată liniar timp de 5 s și apoi măsurată pentru intensitatea emisiei de fluorescență (excitație λ: 364 nm; emisie λ: 440 nm) în timp (1 min-3 h) pe un Synergy Neo2 Hybrid). Fiecare test a conținut 2-3 godeuri de control pozitiv (DMSO) și 2 godeuri de control negativ (componentele testului fără protează). Datele au fost normalizate la godeurile de control pozitiv la 3 ore,căruia i s-a atribuit o valoare arbitrară de 100.

Imunoblotting

Celulele A549-ACE2 au fost tratate cu CBD, vehicul (DMSO) sau nu au fost tratate timp de 24 de ore. Celulele au fost mai întâi spălate cu PBS rece cu gheață. Extracția celulelor întregi a fost preparată prin lizarea directă a celulelor cu tampon de probă Laemmli (Bio-rad 1610747) suplimentat cu inhibitor de protează (Roche 4693159001), PMSF (Roche 10837091001) și inhibitor de fosfatază (GB-450) la 44°C. Probele de proteine ​​au fost în cele din urmă fierte la 98°C timp de 5 minute. Western blot a fost efectuat folosind anticorpi pentru ACE2 (Abcam 108252) și α-tubulină (Invitrogen MA1–19401) pentru control. Pentru validările knockout-ului IRE1α în A549-ACE2, au fost utilizate celule, anticorpi pentru IRE1α (Cell Signaling, 3294S) și GAPDH (Cell Signaling, 5174S). Petele au fost fotografiate și cuantificate folosind Licor Odyssey Fc.

secvențierea ARN

Celulele A549 alveolare pulmonare au fost supraexprimate stabil cu proteina enzimei de conversie a angiotensinei umane 2 (ACE2) și au fost însămânțate la 10.000 de celule per godeu într-o placă cu 96 de godeuri. Canabidiolul sau vehiculul au fost adăugate împreună la celule. Canabidiolul (Cayman Chemical, 90080) a fost dizolvat într-o soluție stoc 10 mM cu DMSO (Sigma-Aldrich, D2650-100 mL). Concentrația finală de CBD a fost de 10 μM. Stocul de virus a fost apoi îndepărtat și înlocuit cu mediu proaspăt 2% FBS DMEM cu medicament. Celulele au fost incubate încă 24 de ore înainte de extracția totală a ARN-ului cu trusa NucleoSpin 96 ARN (Takarabio, 740709). Au fost efectuate trei replici biologice independente per condiție experimentală, cu 12 probe totale de ARN. Verificarea calității probei de ARN, construcția bibliotecii,și secvențierea au fost efectuate de Universitatea din Chicago Genomics Facility urmând protocoale standard. Scorul mediu de integritate ARN a fost de 8,9. Toate cele 12 probe au fost secvențiate în două rulări de un secvențietor NovaSeq 6000 pentru a genera citiri de 100 bp la capătul pereche. Pentru fiecare probă, fișierele FASTQ brute din două celule de flux au fost combinate înainte de procesarea în aval. Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și s-au efectuat studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Datele ARN-seq pentru celulele tratate cu CBD și CBDV au fost analizate separat folosind o instanță locală Galaxy 20.05 pentru următorii pași ( 34 ). Calitatea și tăierea adaptorului au fost efectuate pe citirile de secvențiere brută folosind Trim Galore! 0,6,3 ( 35 ). Citirile au fost mapate atât la genomul uman (UCSC hg19 cu adnotare GENCODE), cât și la genomul SARS-COV-2 (NCBI Assembly ASM985889v3 cu adnotare Ensembl) folosind ARN STAR 2.7.5b ( 36 ). Citirile mapate rezultate din fiecare probă au fost numărate de featureCounts 1.6.4 ( 37) pentru a genera numere de citire pe genă. Numărările brute au fost analizate pentru expresia diferențială între condițiile experimentale folosind DESeq2 1.22.1 ( 38 ), care a generat, de asemenea, o matrice de expresie genică normalizată și o diagramă PCA a probelor.Numărul de citiri XBP1 îmbinate alternativ a fost numărat de Integrative Genomics Viewer 2.9.4 ( 39 ) folosind date de citire aliniate de la ARN STAR (vezi mai sus). Numărul total de citiri XBP1 a fost contorizat de featureCounts ca mai sus. Pentru fiecare probă, îmbinarea XBP1 relativă a fost determinată prin împărțirea citirilor care conțin locul de îmbinare alternativ la citirile totale XBP1.

qRT-PCR

ADNc a fost sintetizat din probe de ARN folosind kitul de transcripție inversă ADNc de mare capacitate (ThermoFisher, 4368813). Probele de ADNc au fost diluate în apă de calitate pentru biologie moleculară și au fost efectuate experimente qRT-PCR pe un instrument Roche LightCycler 96 folosind Applied Biosystems PowerUp SYBR Green Master Mix (ThermoFisher, A25776). Rezultatele au fost analizate de software-ul Roche LightCycler 96. RPL13A a fost folosit ca genă de referință. Au fost utilizate următoarele perechi de primeri (numele genei: primer primer, primer invers):ERN1: CCGAACGTGATCCGCTACTTCT, CGCAAAGTCCTTCTGCTCCACA.EIF2AK3: GTCCCAAGGCTTTGGAATCTGTC, CCTACCAAGACAGGAGTTCTGG.ATF6: CAGACAGTACCAACCGCTTATGCC, GCAGAACTCCAGGTGCTTGAAG.IFIT1: GCCTTGCTGAAGTGTGGAGGAA, ATCCAGGCGATAGGCAGAGATC.IFIT3: CCTGGAATGCTTACGGCAAGCT, GAGCATCTGAGAGTCTGCCCAA.ISG15: CTCTGAGCATCCTGGTGAGGAA, AAGGTCAGCCAGAACAGGTCGT.OAS1: AGGAAAGGTGCTTCCGAGGTAG, GGACTGAGGAAGACAACCAGGT.SOCS1: TTCGCCCTTAGCGTGAAGATGG, TAGTGCTCCAGCAGCTCGAAGA.Alt. XBP1 îmbinat: GCTGAGTCCCGCAGCAGGT, CTGGGTCCAAGTTGTCCAGAAT.Total XBP1: TGAAAACAGAGTAGCAGCTCAGA, CCCAAGCGCTGTCTTAACTC.RPL13A: CTCAAGGTGTTTGACGGCATCC, TACTTCCAGCCAACCTCGTGAG.

Clustering de gene variabile

Au fost selectate primele 5.000 de gene cele mai variabile, iar datele de expresie a genelor normalizate au fost analizate de software-ul Morpheus ( https://software.broadinstitute.org/morpheus ). Gruparea K-means cu 6 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBD și SARS-CoV-2, iar gruparea K-means cu 5 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBDV și SARS-CoV-2. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice.

Testul de îmbinare XBP1

qRT-PCR a fost utilizat pentru a cuantifica expresia relativă a versiunii spliced ​​a XBP1 (XBP1s) prin utilizarea perechilor specifice de primeri pentru XBP1 spliced ​​uman alternativ și XBP1 total (secvențele de primer sunt descrise mai sus) așa cum s-a descris anterior ( 40 ). Procentul relativ de îmbinare alternativă a XBP1 (%XBP1s) a fost indicat prin calcularea raportului de semnale dintre XBP1s și XBP1 total.

Analiza căii ingeniozității

Datele de exprimare (modificarea log 2 ) și starea de activare prezisă a genelor au fost suprapuse pe calea de semnalizare a interferonului și pe hărțile căii de stres al reticulului endoplasmatic utilizând Ingenuity Pathway Analysis. Cifrele au fost generate prin utilizarea IPA (QIAGEN Inc). Valorile normalizate ale expresiei genelor sau schimbarea pliului (log2) ale genelor au fost analizate de software-ul Morpheus. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice. Scorurile z de activare prezise de IPA ale căilor relevante din datele ARN-seq au fost, de asemenea, reprezentate grafic de software-ul Morpheus.

Analize de îmbogățire a setului de gene

Pentru a identifica temele din cele 6 clustere, au fost efectuate analize de îmbogățire a setului de gene funcționale pentru genele din fiecare cluster folosind Metascape ( 41).). Următoarele categorii au fost selectate pentru analizele de îmbogățire: Funcții moleculare GO, Seturi funcționale KEGG, Procese biologice GO, Căi canonice și Calea KEGG. Parametri suplimentari pentru Metascape: Min Overlap = 3, p-value Cutoff = 0,05, Min Enrichment = 1,5. Pentru a identifica seturile de gene care activitățile au fost inversate de CBD cu infecție virală, lista de gene de intrare include gene reglate în mod semnificativ în jos de virus (expresie diferențială comparând veh-infect vs veh-mock, limită pentru valoarea q 0,01), în timp ce, de asemenea, în creștere semnificativă. reglementat de CBD (expresie diferențială comparând CBD-infect vs veh-infect, limită pentru valoarea q 0,01). Analizele de îmbogățire a setului de gene au fost efectuate pe aceste două liste de gene folosind aceeași metodă Metascape. Aceleași analize au fost, de asemenea, efectuate asupra datelor de expresie diferențială din experimentele ARN-seq care implică CBDV și SARS-CoV-2 cu o valoare limită a q de 0,05. GSEA v4.1.0 a fost utilizat pentru a efectua analize specifice de îmbogățire a setului de gene pe termenii Ontologiei genetice Răspuns proteic nepliat mediat de PERK și Răspuns proteic nepliat mediat de IRE1 folosind datele de expresie diferențială din experimentul ARN-seq care implică CBD și SARS-CoV-2 ( 42 , 43 ).

Tratamentul CBD și provocarea SARS-CoV-2 la șoareci

Șoareci femele K18-hACE2 în vârstă de nouă până la unsprezece săptămâni ( 27) au fost achiziționate de la Jackson Laboratory (stock #034860). După aclimatizare, șoarecii au primit tratament cu CBD (20 sau 80 mg/kg) prin injecție intraperitoneală de două ori pe zi într-un volum de 0,1 ml. Soluția injectabilă a fost preparată imediat înainte de fiecare tratament. În primul rând, pulberea CBD de la furnizorul D a fost dizolvată în etanol 100%. Apoi soluția de CBD a fost amestecată cu Cremophor EL (Millipore Sigma 238470) urmată de soluție de PBS într-un raport de 1:1:18. Soluția de injecție vehicul a fost preparată prin amestecarea etanolului 100%, Cremophor EL și PBS la 1:1:18. Pentru fiecare injecție, cantitatea finală de CBD a fost fie de 20 mg, fie de 80 mg per kg de greutate corporală la șoarece, în funcție de grupul de tratament. Grupurile de control au fost tratate numai cu vehicul sau nu au primit niciun tratament. După șapte zile de tratament,

Titrarea virusului SARS-CoV-2 din țesuturile de șoarece prin testul TCID 50

Celulele Vero E6 (ATCC # CRL-1586) au fost însămânțate la o densitate de 20.000 celule/godeu în plăci de cultură de țesut cu fund plat cu 96 de godeuri (Nunc) și incubate peste noapte la 37°C cu 5% C02 și umiditate. Țesuturile omogenizate au fost centrifugate la 8.000 rpm timp de 10 minute la 4°C, iar supernatantul a fost colectat și diluat în serie de zece ori (până la 10 -7 ) în mediu de creștere virală (DMEM care conține 5% FBS și 1% soluție antibiotic/antimicotică) . După incubarea peste noapte, plăcile de celule au fost spălate de două ori cu PBS și diluțiile în serie adăugate în fiecare godeu în patru exemplare. Plăcile au fost incubate în continuare la 37°C într-un incubator umidificat cu 5% CO2. După 3 zile, celulele au fost colorate cu violet cristal 0,1% care conține 10% formol tamponat neutru și au fost marcate pentru dezvoltarea efectului citopatic (CPE). Doza TCID 50 a fost calculată conform metodei Reed și Muench ( 44 ) și corectată pentru greutatea pe gram a fiecărui omogenat pulmonar. Toate lucrările la animale au fost aprobate de Comitetul instituțional pentru îngrijirea și utilizarea animalelor de la Universitatea din Louisville. Toate lucrările cu SARS-CoV-2 viu au fost aprobate de Comitetul Instituțional de Biosecuritate al Universității și desfășurate în limita nivelului de biosecuritate trei.

Analiza datelor pacientului

Toate analizele datelor pacienților au fost aprobate de National COVID Cohort Collaborative și de comitetul de revizuire instituțional al Diviziei de Științe Biologice a Universității din Chicago (IRB21–0591), care a acordat o renunțare la consimțământ, deoarece identitățile participanților la studiu nu pot fi verificate cu ușurință de către anchetatori, anchetatorii nu contactează participanții, iar anchetatorii nu vor reidentifica participanții. O descriere detaliată a metodelor și constatărilor de analiză a datelor pacientului se găsește în Suplimentul de analiză a pacientului.

analize statistice

Datele sunt afișate ca medii ± SD. Pentru analiza expresiei diferențiale ARN-seq, a fost utilizată versiunea DESeq2 1.22.1 cu un prag de semnificație minim al valorii P corectate cu FDR (valoarea Q) de 0,01 pentru experimentul ARN-seq care implică CBD și SARS-CoV-2 și un prag de 0,05 pentru experimentul ARN-seq care implică CBDV și SARS-CoV-2. Pentru analiza îmbogățirii setului de gene, Metascape a fost utilizat cu un P minimpragul de semnificație a valorii de 0,05. Pentru calculele EC50 ale tratamentelor medicamentoase, software-ul GraphPad Prism a fost utilizat cu o potrivire a curbei neliniare cu patru parametri. Prism a fost, de asemenea, utilizat pentru teste t nepereche și ANOVA unidirecțional cu semnificație statistică definită ca p < 0,05. Pentru metodele de analiză statistică a datelor pacientului, vă rugăm să consultați secțiunea Analiză statistică din Suplimentul de analiză a pacientului.

Mulțumiri

Per total . Următorul reactiv a fost depus de către Centers for Disease Control and Prevention și obținut prin BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate USA-WA1/2020, NR-52281. Figura 8A a fost creată folosind BioRender.comSCR_019196) în special Sandhiya Arun și Pieter Faber, pentru asistența acordată cu secvențierea ARN. În cele din urmă, dorim să mulțumim viceprovostului pentru cercetare de la Universitatea din Chicago, Karen Kim, și decanului diviziei de științe biologice, Kenneth Polonsky, pentru sprijinul lor ferm.National COVID Cohort Collaborative (N3C) . Analizele datelor pacientului descrise în această publicație au fost efectuate cu date sau instrumente accesate prin intermediul Enclavei de date NCATS N3C covid.cd2h.org/enclave și susținute de NCATS U24 TR002306. Această cercetare a fost posibilă datorită pacienților ale căror informații sunt incluse în datele de la organizațiile participante ( covid.cd2h.org/dtas ) și organizațiile ( https://ncats.nih.gov/n3c/resources/data-contribution/data ). -semnatarii-acordului de transfer ) și oameni de știință care au contribuit la dezvoltarea continuă a acestei resurse comunitare ( 28). Proiectul descris a fost susținut de Institutul Național de Științe Medicale Generale, 5U54GM104942-04. Conținutul este responsabilitatea exclusivă a autorilor și nu reprezintă neapărat opiniile oficiale ale NIH. Analiza a folosit doar date de-identificate (adică, N3C Data Access Tier 2, descris la https://covid.cd2h.org/N3C_governance ). Mulțumim cu recunoștință contribuțiile următoarelor echipe principale N3C:• Investigatori principali : Melissa A. Haendel, Christopher G. Chute, Kenneth R. Gersing, Anita Walden• Lideri de lucru, subgrup și administrativi : Melissa A. Haendel, Tellen D. Bennett, Christopher G. Chute, David A. Eichmann, Justin Guinney, Warren A. Kibbe, Hongfang Liu, Philip RO Payne, Emily R. Pfaff, Peter N Robinson, Joel H. Saltz, Heidi Spratt, Justin Starren, Christine Suver, Adam B. Wilcox, Andrew E. Williams, Chunlei Wu• Legături cheie pe site-urile partenerilor de date• Personal de reglementare la site-urile partenere de date• Persoane de pe site-uri care sunt responsabile pentru crearea seturilor de date și transmiterea datelor către N3C• Echipa de asimilare și armonizare a datelor : Christopher G. Chute, Emily R. Pfaff, Davera Gabriel, Stephanie S. Hong, Kristin Kostka, Harold P. Lehmann, Richard A. Moffitt, Michele Morris, Matvey B. Palchuk, Xiaohan Tanner Zhang, Richard L. Zhu• Echipa Phenotype (Persoane care creează scripturile pe care site-urile le folosesc pentru a-și trimite datele, pe baza definițiilor COVID și Long COVID) : Emily R. Pfaff, Benjamin Amor, Mark M. Bissell, Marshall Clark, Andrew T. Girvin, Stephanie S. Hong, Kristin Kostka, Adam M. Lee, Robert T. Miller, Michele Morris, Matvey B. Palchuk, Kellie M. Walters• Echipa de management și operațiuni de proiect : Anita Walden, Yooree Chae, Connor Cook, Alexandra Dest, Racquel R. Dietz, Thomas Dillon, Patricia A. Francis, Rafael Fuentes, Alexis Graves, Julie A. McMurry, Andrew J. Neumann, Shawn T O’Neil, Usman Sheikh, Andréa M. Volz, Elizabeth Zampino• Parteneri de la NIH și alte agenții federale : Christopher P. Austin, Kenneth R. Gersing, Samuel Bozzette, Mariam Deacy, Nicole Garbarini, Michael G. Kurilla, Sam G. Michael, Joni L. Rutter, Meredith Temple-O’Connor• Echipa de analiză (persoane care construiesc infrastructura Enclave, ajută la crearea seturi de coduri, variabile și ajută echipele de domeniu și echipele de proiect cu seturile de date) : Benjamin Amor, Mark M. Bissell, Katie Rebecca Bradwell, Andrew T. Girvin, Amin Manna, Nabeel Qureshi• Echipa de management al Comitetului de Publicare: Mary Morrison Saltz, Christine Suver, Christopher G. Chute, Melissa A. Haendel, Julie A. McMurry, Andréa M. Volz, Anita Walden• Echipa de revizuire a Comitetului de publicație : Carolyn Bramante, Jeremy Richard Harper, Wenndy Hernandez, Farrukh M Koraishy, ​​Federico Mariona, Saidulu Mattapally, Amit Saha, Satyanarayana Vedula• Parteneri de date cu date publicate ( 50). Universitatea Stony Brook — U24TR002306 • Centrul de Științe ale Sănătății al Universității din Oklahoma — U54GM104938: Institutul de Științe Clinice și Translaționale din Oklahoma (OCTSI) • Universitatea Virginia de Vest — U54GM104942: Institutul de Științe Clinice și Translaționale din Virginia de Vest (WVCTSI) • Centrul Medical al Universității din Mississippi — U5454GM:1 Centrul Mississippi pentru Cercetare Clinică și Translațională (CCTR) • Centrul Medical al Universității din Nebraska — U54GM115458: Great Plains IDeA-Clinic & Translational Research • Maine Medical Center — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Wake Forest Universitatea de Științe ale Sănătății — UL1TR001420: Wake Forest Clinical and Translational Science Institute • Northwestern University din Chicago — UL1TR001422:• Parteneri suplimentari de date care au semnat DTA și eliberarea datelor în așteptare ( 35). Universitatea Rockefeller — UL1TR001866: Centrul pentru Științe Clinice și Translaționale • Institutul de Cercetare Scripps — UL1TR002550: Institutul de Cercetare Scripps Translațional • Centrul de Științe ale Sănătății al Universității din Texas din San Antonio — UL1TR002645: Institutul pentru Integrarea Medicină și Știință • Universitatea din Texas Centrul de Știință din Houston — UL1TR003167: Centrul pentru Științe Clinice și Translaționale (CCTS) • NorthShore University HealthSystem — UL1TR002389: Institutul pentru Medicină Translațională (ITM) • Spitalul Yale New Haven — UL1TR001863: Centrul Yale pentru Investigații Clinice • Universitatea Emory — UL1371TR00 Georgia Clinical and Translational Science Alliance • Weill Medical College of Cornell University — UL1TR002384:Centrul de Științe Clinice și Translaționale de Medicină Weill Cornell • Centrul Medical Montefiore — UL1TR002556: Institutul de Cercetare Clinică și Translațională de la Einstein și Montefiore • Colegiul Medical din Wisconsin — UL1TR001436: Institutul de Științe Clinice și Translaționale din Wisconsin de Sud-Est • Centrul de Științe ale Sănătății al Universității din New Mexico — UL1TR001449: Centrul de știință clinică și translațională de la Universitatea din New Mexico • Universitatea George Washington — UL1TR001876: Institutul de știință clinică și translațională de la Children’s National (CTSA-CN) • Universitatea Stanford — UL1TR003142: Spectrul: Centrul Stanford pentru cercetare și educație clinică și translațională • Institutul Regenstrief — UL1TR002529: Indiana Clinical and Translational Science Institute • Cincinnati Children’s Hospital Medical Center — UL1TR001425:Centrul pentru Știință și Formare Clinică și Translațională • Campusul Medical al Universității din Boston — UL1TR001430: Institutul de Științe Clinice și Translaționale al Universității din Boston • Universitatea de Stat din New York din Buffalo — UL1TR001412: Institutul de Științe Clinice și Translaționale • Aurora Health Care — UL1TR002373: Rețeaua Wisconsin pentru Cercetare în sănătate • Universitatea Brown — U54GM115677: Cercetare translațională clinică avansată (Advance-CTR) • Rutgers, Universitatea de Stat din New Jersey — UL1TR003017: Alianța din New Jersey pentru Științe Clinice și Translaționale • Universitatea Loyola din Chicago — UL1TR002389: Institutul pentru Medicină Translațională ( ITM) • #N/A — UL1TR001445: Institutul de Științe Clinice și Translaționale Langone Health • Spitalul de Copii din Philadelphia — UL1TR001878:Institutul pentru Medicină Translațională și Terapeutică • Centrul Medical al Universității din Kansas — UL1TR002366: Frontiere: Institutul de Științe Clinice și Translaționale de la Universitatea din Kansas • General Brigham din Massachusetts — UL1TR002541: Catalizator Harvard • Școala de Medicină Icahn din Muntele Sinai — UL1TR001433: Institutul ConduITS pentru Științe Translaționale • Ochsner Medical Center — U54GM104940: Centrul Louisiana Clinical and Translational Science (LA CaTS) • HonorHealth — Niciunul (voluntar) • Universitatea din California, Irvine — UL1TR001414: Institutul UC Irvine pentru Științe Clinice și Translaționale (ICTS) • Universitatea din California, San Diego — UL1TR001442: Altman Clinical and Translational Research Institute • Universitatea din California, Davis — UL1TR001860: UCDavis Health Clinical and Translational Science Center • Universitatea din California,San Francisco — UL1TR001872: UCSF Clinical and Translational Science Institute • Universitatea din California, Los Angeles — UL1TR001881: UCLA Clinical Translational Science Institute • University of Vermont — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Arkansas Children’s Hospital — UL1TR003107: Institutul de Cercetare Translațională UAMS• Confirmări suplimentare N3C . De asemenea, am dori să le mulțumim altora care nu sunt enumerate mai sus: Joy Alamgir (ARIScience), Seth Russell, MS (Universitatea din Colorado) și Hui Zhang, PhD MBA (Universitatea din Chicago), care au creat seturi de concepte N3C pe care le-am folosit pentru a defini unele a covariatelor indicatorului de stare medicală pentru analiza noastră statistică. De asemenea, am dori să mulțumim lui Steve Johnson, PhD (Universitatea din Minnesota) pentru că a scris un obiect de cunoștințe de calcul al IMC pe care l-am modificat pentru a calcula valorile IMC din datele de greutate și înălțime.Finanțarea:Această lucrare a fost susținută direct de: Grantul BIG Vision de la Universitatea din Chicago (MRR). National Institutes of Health grant R01 GM121735 (MRR). National Institutes of Health grant R01 CA184494 (MRR). Grantul National Institutes of Health R01 AI137514 (GR). Grantul Institutului Național de Sănătate R01 AI127518 (GR). Grantul Institutului Național de Sănătate R01 AI134980 (GR). National Institutes of Health grant R01 CA219815 (SAO). National Institutes of Health acordă R35 GM119840 (BCD). Grantul Institutului Național de Sănătate P30 CA014599 (grant de sprijin pentru Centrul de Cancer de la Universitatea din Chicago). Harry B. și Leona M. Helmsley Charitable Trust (KE P). Componenta de analiză a pacientului a acestei lucrări a fost susținută indirect de finanțarea enumerată în secțiunea N3C a secțiunii Mulțumiri.Contribuții ale autorului:Conceptualizare: MRR, LCN, DY, GR, SAO, GFP, DOM, ND, TJB. Metodologie: MRR, LCN, DY, GR, SAO, DOM, GFP, ND, BCD, TJB. Software: DY, TJB. Analiză formală: DY, TJB. Ancheta: LCN, DY, VN, TJB, TO, SN-C, JBF, ND, AM, CD, Diane Silva, HG, LS, LR-M, AV, ES, KAJ, S-AA. Resurse: GR, MRR, GFP, ST, BCD. Curatarea datelor: DOM, TJB, DY, National COVID Cohort Collaborative Consortium. Redactare – schiță originală: MRR. Scriere – revizuire și editare: LCN, DY, VN, TJB, SN-C, JBF, ND, AM, KAJ, Diane Silva, JMM, BCD, ST, SAO, GFP, DOM, GR, MRR. Vizualizare: LCN, DY, ND, AM, SN-C, BCD, JBF. Supraveghere: MRR. GR, DOM, GFP, SAO, ST, BCD. Administrare Proiect: MRR. Achiziție finanțare: MRR. Pentru experimentul pe animale: Investigație: Divyasha Saxena, CDA. Analiză formală: Divyasha Saxena, JDG. Metodologie: JDG, JKD, Divyasha Saxena, WES, KEP.Obținerea aprobărilor: WES, JDG. Achiziție finanțare: KEP.Interese concurente: SAO este cofondator și consultant la OptiKira., LLC (Cleveland, OH). Autorii nu declară alte interese concurente.Disponibilitatea datelor și a materialelor: Toate datele necesare pentru evaluarea concluziilor din lucrare sunt prezente în lucrare, Materialele suplimentare și/sau Datele suplimentare S1. Datele brute și procesate ARN-seq au fost depuse în baza de date GEO (GSE168797).

Materiale suplimentare

Acest fișier PDF include:

Figurile. S1 până la S24Supliment pentru analiza datelor pacientuluiTabelele de la S1 la S6DESCĂRCAȚI (9,91 MB)

Alte materiale suplimentare pentru acest manuscris includ următoarele:

Date S1DESCĂRCAȚI (9,91 MB)Vizualizați/solicitați un protocol pentru această lucrare de la Bio-protocol .

REFERINȚE ȘI NOTE

1SR Weiss, JL Leibowitz, Patogeneza coronavirusului. Adv. Virus Res. 81 , 85–164 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC2SE Galloway, P. Paul, DR MacCannell, MA Johansson, JT Brooks, AM Neil, RB Slayton, S. Tong, BJ Silk, GL Armstrong, M. Biggerstaff, VG Dugan, Apariția SARS-CoV-2 B.1.1. 7 descendență – Statele Unite, 29 decembrie 2020–12 ianuarie 2021. MMWR Morb Mortal Wkly Rep 70 , 95–99 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC3M. Hoffmann, H. Kleine-Weber, S. Schroeder, N. Krüger, T. Herrler, S. Erichsen, TS Schiergens, G. Herrler, N.-H. Wu, A. Nitsche, MA Müller, C. Drosten, S. Pöhlmann, intrarea în celulele SARS-CoV-2 depinde de ACE2 și TMPRSS2 și este blocată de un inhibitor de protează dovedit clinic. Celula 181 , 271–280.e8 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC4J. Jaimes, J. Millet, G. Whittaker, Clivajul proteolitic al proteinei spike SARS-CoV-2 și rolul site-ului roman S1/S2. iScience 23 , 101212 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC5S. Matsuyama, N. Nao, K. Shirato, M. Kawase, S. Saito, I. Takayama, N. Nagata, T. Sekizuka, H. Katoh, F. Kato, M. Sakata, M. Tahara, S. Kutsuna, N. Ohmagari, M. Kuroda, T. Suzuki, T. Kageyama, M. Takeda, Izolarea îmbunătățită a SARS-CoV-2 de către celulele care exprimă TMPRSS2. Proc. Natl. Acad. Sci. SUA 117 , 7001–7003 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC6R. Wang, CR Simoneau, J. Kulsuptrakul, M. Bouhaddou, KA Travisano, JM Hayashi, J. Carlson-Stevermer, JR Zengel, CM Richards, P. Fozouni, J. Oki, L. Rodriguez, B. Joehnk, K Walcott, K. Holden, A. Sil, JE Carette, NJ Krogan, M. Ott, Ecranele genetice identifică factorii gazdă pentru SARS-CoV-2 și coronavirusurile comune ale răcelii. Celula 184 , 106–119.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC7WM Schneider, JM Luna, H.-H. Hoffmann, FJ Sánchez-Rivera, AA Leal, AW Ashbrook, JL Pen, I. Ricardo-Lax, E. Michailidis, A. Peace, AF Stenzel, SW Lowe, MR MacDonald, CM Rice, JT Poirier, Genome-scale identification of Rețelele de factori gazdă SARS-CoV-2 și pan-coronavirus. Celula 184 , 120–132.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC8Z. Daniloski, TX Iordania, H.-H. Wessels, DA Hoagland, S. Kasela, M. Legut, S. Maniatis, EP Mimitou, L. Lu, E. Geller, O. Danziger, BR Rosenberg, H. Phatnani, P. Smibert, T. Lappalainen, BR tenOever, NE Sanjana, Identificarea factorilor gazdă necesari pentru infecția cu SARS-CoV-2 în celulele umane. Celula 184 , 92–105.e16 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC9DW Kneller, G. Phillips, HM O’Neill, R. Jedrzejczak, L. Stols, P. Langan, A. Joachimiak, L. Coates, A. Kovalevsky, Plasticitatea structurală a cavității site-ului activ SARS-CoV-2 3CL Mpro revelată prin cristalografie cu raze X la temperatura camerei. Nat. comun. 11 , 3202 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC10J. Osipiuk, SA Azizi, S. Dvorkin, M. Endres, R. Jedrzejczak, KA Jones, S. Kang, RS Kathayat, Y. Kim, VG Lisnyak, SL Maki, V. Nicolaescu, CA Taylor, C. Tesar, YA Zhang, Z. Zhou, G. Randall, K. Michalska, SA Snyder, BC Dickinson, A. Joachimiak, Structura proteazei asemănătoare papainei din SARS-CoV-2 și complexele sale cu inhibitori necovalenti. Nat. comun. 12 , 743 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC11F. Shahbazi, V. Grandi, A. Banerjee, JF Trant, Cannabinoids and cannabinoid receptors: The story so far. iScience 23 , 101301 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC12KM Nelson, J. Bisson, G. Singh, JG Graham, SN Chen, JB Friesen, JL Dahlin, M. Niemitz, MA Walters, GF Pauli, The essential medicinal chemistry of cannabidiol (CBD). J. Med. Chim. 63 , 12137–12155 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC13K. Sekar, A. Pack, Epidiolex ca terapie adjuvantă pentru tratamentul epilepsiei refractare: O revizuire cuprinzătoare, cu accent pe efectele adverse. F1000Res 8 , F1000 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC14HI Lowe, NJ Toyang, W. McLaughlin, Potentialul canabidiolului pentru tratamentul hepatitei virale. Farmacia. Res. 9 , 116–118 (2017).GOOGLE ACADEMIC15L. Taylor, B. Gidal, G. Blakey, B. Tayo, G. Morrison, A faza I, randomizat, dublu-orb, controlat cu placebo, doză crescătoare unică, doză multiplă și efect alimentar privind siguranța, tolerabilitatea și farmacocinetica canabidiolului înalt purificat la subiecții sănătoși. CNS Drugs 32 , 1053–1067 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC16SM Anil, N. Shalev, AC Vinayaka, S. Nadarajan, D. Namdar, E. Belausov, I. Shoval, KA Mani, G. Mechrez, H. Koltai, Compușii de canabis prezintă activitate antiinflamatoare in vitro în COVID-19 -inflamația asociată celulelor epiteliale pulmonare și activitatea proinflamatoare la macrofage. Sci. Rep. 11 , 1462 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC17KHD Crawford, R. Eguia, AS Dingens, AN Loes, KD Malone, CR Wolf, HY Chu, MA Tortorici, D. Veesler, M. Murphy, D. Pettie, NP King, AB Balazs, JD Bloom, Protocol și reactivi pentru pseudotiparea particulelor lentivirale cu proteina spike SARS-CoV-2 pentru teste de neutralizare. Virusuri 12 , 513 (2020).CROSSREFGOOGLE ACADEMIC18C. Hetz, E. Chevet, SA Oakes, Controlul proteostazei prin răspunsul proteic desfășurat. Nat. Cell Biol. 17 , 829–838 (2015).CROSSREFPUBMEDGOOGLE ACADEMIC19R. Dash, MC Ali, I. Jahan, YA Munni, S. Mitra, MA Hannan, B. Timalsina, DF Oktaviani, HJ Choi, IS Moon, Emerging potential of cannabidiol in reversing proteinopathies. Imbatranire Res. Rev. 65 , 101209 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC20J. Bechill, Z. Chen, JW Brewer, SC Baker, Infecția cu virusul hepatitei la șoarece activează calea Ire1/XBP1 a răspunsului proteic desfășurat. Adv. Exp. Med. Biol. 581 , 139–144 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC21TS Fung, DX Liu, senzorul de stres ER IRE1 și MAP kinaza ERK modulează inducerea autofagiei în celulele infectate cu virusul bronșitei infecțioase cu coronavirus. Virologie 533 , 34–44 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC22C. Hetz, K. Zhang, RJ Kaufman, Mecanisme, reglare și funcții ale răspunsului proteic desfășurat. Nat. Pr. Mol. Cell Biol. 21 , 421–438 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC23O. Haller, G. Kochs, F. Weber, The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344 , 119–130 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC24D. Blanco-Melo, BE Nilsson-Payant, W.-C. Liu, S. Uhl, D. Hoagland, R. Møller, TX Jordan, K. Oishi, M. Panis, D. Sachs, TT Wang, RE Schwartz, JK Lim, RA Albrecht, BR tenOever, Răspunsul dezechilibrat al gazdei la SARS- CoV-2 stimulează dezvoltarea COVID-19. Celula 181 , 1036–1045.e9 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC25H. Di, H. Elbahesh, MA Brinton, Caracteristicile proteinelor izoforme umane OAS1. Virusuri 12 , (2020).CROSSREFGOOGLE ACADEMIC26TA Tummino, VV Rezelj, B. Fischer, A. Fischer, MJ O’Meara, B. Monel, T. Vallet, Z. Zhang, A. Alon, HR O’Donnell, J. Lyu, H. Schadt, KM White , NJ Krogan, L. Urban, KM Shokat, AC Kruse, A. García-Sastre, O. Schwartz, F. Moretti, M. Vignuzzi, F. Pognan, BK Shoichet, Fosfolipidoza este un mecanism comun care stă la baza activității antivirale in vitro a multor medicamente reutilizate împotriva SARS-CoV-2. bioRxiv 10.1101 /2021.03.23.436648 (2021).GOOGLE ACADEMIC27PB McCray Jr., L. Pewe, C. Wohlford-Lenane, M. Hickey, L. Manzel, L. Shi, J. Netland, HP Jia, C. Halabi, CD Sigmund, DK Meyerholz, P. Kirby, DC Look , S. Perlman, Infecția letală a șoarecilor K18-hACE2 infectați cu coronavirus de sindrom respirator acut sever. J. Virol. 81 , 813–821 (2007).CROSSREFPUBMEDGOOGLE ACADEMIC28MA Haendel, CG Chute, TD Bennett, DA Eichmann, J. Guinney, WA Kibbe, PRO Payne, ER Pfaff, PN Robinson, JH Saltz, H. Spratt, C. Suver, J. Wilbanks, AB Wilcox, AE Williams, C Wu, C. Blacketer, RL Bradford, JJ Cimino, M. Clark, EW Colmenares, PA Francis, D. Gabriel, A. Graves, R. Hemadri, SS Hong, G. Hripscak, D. Jiao, JG Klann, K Kostka, AM Lee, HP Lehmann, L. Lingrey, RT Miller, M. Morris, SN Murphy, K. Natarajan, MB Palchuk, U. Sheikh, H. Solbrig, S. Visweswaran, A. Walden, KM Walters, GM Weber, XT Zhang, RL Zhu, B. Amor, AT Girvin, A. Manna, N. Qureshi, MG Kurilla, SG Michael, LM Portilla, JL Rutter, CP Austin, KR Gersing; Consorțiul N3C, Cohorta Națională COVID (N3C): justificare, proiectare, infrastructură,și desfășurare. J. Am. Med. Informa. conf. univ. 28 , 427–443 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC29Centre pentru Controlul și Prevenirea Bolilor, COVID-19, Persoane cu risc crescut, Persoane cu anumite afecțiuni medicale (2021).GOOGLE ACADEMIC30Q. Zhou, V. Chen, CP Shannon, XS Wei, X. Xiang, X. Wang, ZH Wang, SJ Tebbutt, TR Kollmann, EN Fish, Interferon-α2b Treatment for COVID-19. Față. Imunol. 11 , 1061 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC31T. Mutumalage, I. Rahman, Cannabidiolul reglează diferențial răspunsurile inflamatorii bazale și induse de LPS în macrofage, celule epiteliale pulmonare și fibroblaste. Toxicol. Aplic. Pharmacol. 382 , 114713 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC32Administrația pentru Alimente și Medicamente (FDA), numărul de cerere 210365Orig1s000,” Clinical Pharmacology and Biopharmaceutics Reviews (2017).GOOGLE ACADEMIC33BC Sorkin, AJ Kuszak, G. Bloss, NK Fukagawa, FA Hoffman, M. Jafari, B. Barrett, PN Brown, FD Bushman, SJ Casper, FH Chilton, CS Coffey, MG Ferruzzi, DC Hopp, M. Kiely, D Lakens, JB MacMillan, DO Meltzer, M. Pahor, J. Paul, K. Pritchett-Corning, SK Quinney, B. Rehermann, KDR Setchell, NS Sipes, JM Stephens, DL Taylor, H. Tiriac, MA Walters, D. Xi, G. Zappalá, GF Pauli, Îmbunătățirea traducerii cercetării produselor naturale: de la sursă la studiu clinic. FASEB J. 34 , 41–65 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC34E. Afgan, D. Baker, B. Batut, M. van den Beek, D. Bouvier, M. Čech, J. Chilton, D. Clements, N. Coraor, BA Grüning, A. Guerler, J. Hillman-Jackson , S. Hiltemann, V. Jalili, H. Rasche, N. Soranzo, J. Goecks, J. Taylor, A. Nekrutenko, D. Blankenberg, Platforma Galaxy pentru analize biomedicale accesibile, reproductibile și colaborative: actualizare 2018. Acizi nucleici Res. 46 , W537–W544 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC35F. Krueger, Trim Galore. Un instrument de împachetare în jurul Cutadapt și FastQC pentru a aplica în mod constant calitatea și tăierea adaptorului fișierelor FastQ. 517 (2015).GOOGLE ACADEMIC36A. Dobin, CA Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, TR Gingeras, STAR: Ultrafast universal ARN-seq aligner. Bioinformatica 29 , 15–21 (2013).CROSSREFPUBMEDGOOGLE ACADEMIC37Y. Liao, GK Smyth, W. Shi, featureCounts: Un program eficient de uz general pentru atribuirea de secvențe citirilor caracteristicilor genomice. Bioinformatica 30 , 923–930 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC38MI Love, W. Huber, S. Anders, Estimarea moderată a schimbării pliului și a dispersiei pentru datele ARN-seq cu DESeq2. Genom Biol. 15 , 550 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC39JT Robinson, H. Thorvaldsdóttir, W. Winckler, M. Guttman, ES Lander, G. Getz, JP Mesirov, Integrative genomics viewer. Nat. Biotehnologia. 29 , 24–26 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC40SB Yoon, YH Park, SA Choi, HJ Yang, PS Jeong, JJ Cha, S. Lee, SH Lee, JH Lee, BW Sim, BS Koo, SJ Park, Y. Lee, YH Kim, JJ Hong, JS Kim, YB Jin, JW Huh, SR Lee, BS Song, SU Kim, Cuantificarea PCR în timp real a proteinei de legare a casetei X spliced ​​1 (XBP1) folosind o metodă de primer universal. PLOS ONE 14 , e0219978 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC41Y. Zhou, B. Zhou, L. Pache, M. Chang, AH Khodabakhshi, O. Tanaseichuk, C. Benner, SK Chanda, Metascape oferă o resursă orientată către biologi pentru analiza seturilor de date la nivel de sisteme. Nat. comun. 10 , 1523 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC42A. Subramanian, P. Tamayo, VK Mootha, S. Mukherjee, BL Ebert, MA Gillette, A. Paulovich, SL Pomeroy, TR Golub, ES Lander, JP Mesirov, Analiza îmbogățirii setului de gene: O abordare bazată pe cunoștințe pentru interpretarea genomului -profiluri largi de expresie. Proc. Natl. Acad. Sci. SUA 102 , 15545–15550 (2005).CROSSREFPUBMEDGOOGLE ACADEMIC43C. Hetz, F. Martinon, D. Rodriguez, LH Glimcher, The unfolded protein response: Integrating stress signals through the stress sensor IRE1α. Physiol. Apoc. 91 , 1219–1243 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC44LJ Reed, H. Muench, O metodă simplă de estimare a punctelor finale de cincizeci la sută. A.m. J. Epidemiol. 27 , 493–497 (1938).CROSSREFGOOGLE ACADEMIC45Institutul OHDS, ATLAS. (2021).GOOGLE ACADEMIC46OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Standardized Derived Elements, Drug Era table (2021).GOOGLE ACADEMIC47Centers for Disease Control and Prevention, COVID-19: When to Carantine (CDC, 2021).GOOGLE ACADEMIC48Bibliotecă de servicii de procesare a textului, Operațiuni regulate de expresie (Servicii de procesare a textului, 2021).GOOGLE ACADEMIC49JJ Beltran-Montoya, T. Herrerias-Canedo, A. Arzola-Paniagua, F. Vadillo-Ortega, OF Dueñas-Garcia, H. Rico-Olvera, A randomized, clinical trial of ketorolac tromethamine vs ketorolac trometamine plus complex B vitamins for analgezie prin cezariană. Saudi J Anaesth 6 , 207–212 (2012).CROSSREFPUBMEDGOOGLE ACADEMIC50Centers for Disease Control and Prevention, COVID-19-spitalizare și deces în funcție de vârstă (CDC, 2021).GOOGLE ACADEMIC51OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Clinical Data Tables, Person table. (2021).GOOGLE ACADEMIC52L. Kompaniyets, AB Goodman, B. Belay, DS Freedman, MS Sucosky, SJ Lange, AV Gundlapalli, TK Boehmer, HM Blanck, Indicele de masă corporală și riscul de spitalizare asociată cu COVID-19, internarea la terapie intensivă, ventilația mecanică invazivă , și Death – Statele Unite, martie-decembrie 2020. MMWR Morb. Muritor. Wkly Rep. 70 , 355–361 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC53CB Weir, A. Jan, în StatPearls . (Insula comorilor (FL), 2021).GOOGLE ACADEMIC54F. a. D. Administrație, (2020).GOOGLE ACADEMIC55EC Leas, EM Hendrickson, AL Nobles, R. Todd, DM Smith, M. Dredze, JW Ayers, Cannabidiol auto-raportat (CBD) pentru afecțiuni cu terapii dovedite. JAMA Netw. Deschis 3 , e2020977 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC56M. Hepburn, N. Mullaguri, P. George, S. Hantus, V. Punia, A. Bhimraj, CR Newey, Convulsii simptomatice acute la pacientii critici cu COVID-19: Is there an association? Neurocrit. Care 34 , 139–143 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC57S. Corp., Manual de referință Tabulate Twoway (2021).GOOGLE ACADEMIC58D. Ho, K. Imai, G. King, E. Suart, A. Whitworth, N. Greifer, MatchIt: Nonparametric Preprocessing for Parametric Causal Inference (2021).GOOGLE ACADEMIC59PC Austin, Diagnosticarea echilibrului pentru compararea distribuției covariatelor inițiale între grupurile de tratament în eșantioanele potrivite cu scorul de tendință. Stat. Med. 28 , 3083–3107 (2009).CROSSREFPUBMEDGOOGLE ACADEMIC60D. Pregibon, Metode analitice de date pentru modele liniare generalizate, disertație, (1979).GOOGLE ACADEMIC61L. Blizzard, DW Hosmer, Parameter estimation and goodness-of-fit in log binomial regresion. Biom. J. 48 , 5–22 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC62Centrul JHCR, (2021).GOOGLE ACADEMIC63National COVID Cohort Collaborative, COVID-19 Pehnotyope 3.0 Additional Information (N3C, 2021).GOOGLE ACADEMIC

https://www.science.org/doi/10.1126/sciadv.abi6110

Exprimati-va pararea!

Completează mai jos detaliile tale sau dă clic pe un icon pentru a te autentifica:

Logo WordPress.com

Comentezi folosind contul tău WordPress.com. Dezautentificare /  Schimbă )

Poză Twitter

Comentezi folosind contul tău Twitter. Dezautentificare /  Schimbă )

Fotografie Facebook

Comentezi folosind contul tău Facebook. Dezautentificare /  Schimbă )

Conectare la %s

Acest site folosește Akismet pentru a reduce spamul. Află cum sunt procesate datele comentariilor tale.