Rezultatele căutări pentru: AHCC

raspuns imunitar puternic la administrarea AHCC cancer prostata

Medicamente anticanceroase. 2009 Mar; 20 (3): 215-6. doi: 10.1097 / CAD.0b013e3283163c26.

Castrat de cancer de prostată (CRPC) este o boală incurabilă cu opțiuni de tratament limitate. Suplimentele pe bază de plante sunt tratamente neconvenționale pentru o varietate de boli. Compusul hemicelulozic activ (AHCC) este un supliment japonez descoperit prin hibridizarea mai multor ciuperci imunitare folosite în vindecarea tradițională /naturala a cancerului, în scopul menținerii „super imunității”.

Raportăm cazul unui domn de 66 de ani cu CRPC cu un răspuns serologic excelent la AHCC.

Acest caz presupune/implica că AHCC poate avea activitate potențială împotriva CRPC.

PMID: 19104437 DOI: 10.1097 / CAD.0b013e3283163c26

https://www.ncbi.nlm.nih.gov/pubmed/19104437

Dramatic prostate-specific antigen response with activated hemicellulose compound in metastatic castration-resistant prostate cancer.

Turner J1, Chaudhary U.

Division of Hematology/Oncology, Department of Medicine, Medical University of South Carolina, Charleston, South Carolina, USA.

Efectele suplimentării genisteinei asupra metilării ADN la nivelul genomului și a expresiei genice la pacienții cu cancer de prostată localizat

Birdal Bilir , 1, 5 Nitya V. Sharma , Jeongseok Lee , Bato Hammarstrom , 2, 7 Aud Svindland , 3, 4 Omer Kucuk , 5, 6 și Carlos S. Moreno 1, 6

Genisteina [4 ‘, 5,7-trihidroxiizoflavonă sau 5,7-dihidroxi-3- (4-hidroxifenil) cromen-4-onă] este o formă de agliconă izoflavonoidă, derivată din plante, genistină (un glicozid) (Nayeem et. al., 2019 [ 16 ]; Sansai și colab., 2020 [ 20 ]). Genisteina se găsește în principal în plantele leguminoase, în special în soia împreună cu alte izoflavone importante, daidzeina și gliciteina (Kalaiselvan și colab., 2010 [ 12 ]). Alte surse de genisteină includ fasole, naut, legume, fructe, nuci, alimente pe bază de soia și suplimente de genisteină. De asemenea, s-a raportat că boabele de soia nefermentate conțin mai multă genisteină decât cele fermentate (Kuligowski și colab., 2017 [ 13 ]; Li și Zhang, 2017 [ 14]]). În plus, genisteina poate fi sintetizată prin introducerea genei IFS (gena izoflavonei sintază) în celulele de drojdie și liniile de orez, ceea ce duce la un conținut crescut de genisteină în orez (până la 30 de ori) (Spagnuolo și colab., 2015 [ 23 ]) .

1 Departamentul de patologie și medicină de laborator, Universitatea Emory, Atlanta, GA, SUA2 Departamentul de Urologie, Institutul de Cercetare a Cancerului, Spitalul Universitar Oslo3 Departamentul de Medicină Clinică, Universitatea din Oslo4 Departamentul de Patologie, Spitalul Universitar Oslo, Oslo, Norvegia5 Departamentul de hematologie și oncologie medicală6 Winship Cancer Institute, Emory University, Atlanta, GA, SUACorespondență cu: Dr. Carlos S. Moreno, Departamentul de patologie și medicină de laborator, Winship Cancer Institute, Emory University, Whitehead Research Building, camera 105J, 615 Michael Street, Atlanta, GA 30322, SUA, E-mail: ude.yrome@oneromcAdresa actuală: Departamentul de Medicină de Mediu și de Muncă, Spitalul Universitar Oslo, Oslo, NorvegiaAcest articol a fost citat de alte articole din PMC.Mergi la:

Abstract

Studiile epidemiologice au arătat că compușii dietetici au efecte semnificative asupra carcinogenezei prostatei. Dintre agenții dietetici, genisteina, izoflavona majoră din soia, prezintă un interes deosebit, deoarece consumul ridicat de produse din soia a fost asociat cu o incidență scăzută a cancerului de prostată, sugerând un rol preventiv al genisteinei în cancerul de prostată. În ciuda numeroaselor studii pentru a înțelege efectele genisteinei asupra cancerului de prostată, mecanismele de acțiune nu au fost pe deplin elucidate. Am investigat diferențele dintre nivelurile de metilare și expresie genică ale specimenelor de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie folosind Illumina HumanMethylation450 și Illumina HumanHT-12 v4 Expression BeadChip Microarrays Prezentul studiu a fost un studiu randomizat, controlat cu placebo,studiu clinic dublu-orb pe pacienți norvegieni care au primit zilnic 30 mg genisteină sau capsule placebo timp de 3-6 săptămâni înainte de prostatectomie. Modificările exprimării genei au fost validate prin PCR cantitativă (qPCR). Metilarea genomului întreg și profilarea expresiei au identificat site-uri metilate diferențial și au exprimat gene între grupurile placebo și genisteină. Genele reglementate diferențial au fost implicate în procesele de dezvoltare, markerii celulelor stem, proliferarea și reglarea transcripțională. Analiza îmbogățirii a sugerat reducerea generală a activității MYC și creșterea activității PTEN la pacienții tratați cu genisteină. Aceste descoperiri evidențiază efectele genisteinei asupra modificărilor globale în expresia genelor în cancerul de prostată și efectele sale asupra căilor moleculare implicate în tumorigeneză de prostată.Cuvinte cheie: genisteină, cancer de prostată, metilare ADN, expresie geneticăMergi la:

Introducere

Cancerul de prostată este cea mai frecvent diagnosticată afecțiune malignă și a doua cauză principală de deces prin cancer în rândul bărbaților din Statele Unite. Se estimează că aproximativ 180.890 de cazuri noi de cancer de prostată și 26.120 de decese cauzate de cancer de prostată au avut loc în SUA în 2016 ( 1 ). Factorii de risc comuni pentru cancerul de prostată sunt vârsta, rasa / etnia, geografia, istoricul familial și stilul de viață ( 2 ). În funcție de gravitatea bolii, opțiunile actuale de tratament pentru cancerul de prostată includ terapii unice sau o combinație de terapii, cum ar fi supravegherea activă, chirurgia, radioterapia, chimioterapia, terapia hormonală sau vaccinurile ( 3). Deși aceste intervenții au îmbunătățit semnificativ calitatea vieții pacienților și ratele globale de supraviețuire, tratamentul eficient al cancerului de prostată este încă limitat datorită provocărilor majore, cum ar fi eterogenitatea genetică, recurența tumorii (~ 30% din cazuri) și rezistența la medicamente chimioterapeutice convenționale ( 4 – 6 ). Prin urmare, este crucial să se dezvolte noi strategii preventive și terapeutice care au potențialul de a îmbunătăți rezultatele pentru pacienții cu cancer de prostată.

Studiile epidemiologice au arătat că există o diferență semnificativă în ratele de incidență și mortalitate ale cancerului de prostată între diferite țări, cu cele mai ridicate rate în SUA și țările europene și cele mai mici rate în țările asiatice, cum ar fi Japonia și China ( 7 , 8 ). Această variabilitate largă a ratelor de cancer de prostată între țări sugerează că mai mulți factori, inclusiv diferențele genetice, epigenetice și de mediu, joacă un rol cheie în etiologia bolii. În special, s-a demonstrat că imigranții asiatici din SUA au o incidență crescută a cancerului de prostată în comparație cu acei indivizi cu același background genetic care trăiesc în Asia, indicând faptul că factorii de mediu, în special dieta, sunt factorii determinanți majori ai incidenței cancerului de prostată (9 ). Una dintre diferențele dietetice remarcabile dintre țările asiatice și cele occidentale este cantitatea de consum de alimente pe bază de soia. Populațiile asiatice consumă cantități mari de alimente din soia, care sunt bogate în izoflavone (~ 2 g de izoflavone pe kg de soia proaspătă) ( 10 ). S-a demonstrat că concentrațiile plasmatice și de lichide prostatice ale izoflavonelor la bărbații asiatici sunt de 10 până la 100 de ori mai mari decât cele la bărbații occidentali, cu niveluri deosebit de ridicate ale genisteinei de izoflavonă ( 11 , 12 ). Un număr tot mai mare de studii bazate pe populație a demonstrat că aportul ridicat de izoflavone din soia este asociat cu un risc redus cu 25-30% de cancer de prostată ( 13 , 14 ).

Fiind principala izoflavonă biologic activă în dieta soia, genisteina a fost investigată pe larg pentru potențialul său chimiopreventiv în diferite tipuri de cancer, inclusiv în cancerul de prostată. Aportul zilnic mediu de genisteină la populațiile asiatice sa dovedit a fi de 20-80 mg, în timp ce este de 1-3 mg în SUA, susținând efectele protectoare ale genisteinei împotriva cancerului de prostată la bărbații asiatici ( 15 ). Genistein atinge concentrațiile plasmatice de 1-5 u , M 6-8 ore după ingestia de dieta bogata soia ( 11 , 16 ). Timpul de înjumătățire plasmatică al genisteinei a fost raportat la 7,9 ore la adulți. În plus, concentrațiile de izoflavone totale din soia din țesutul prostatei s-au arătat de ~ 6 ori mai mari decât nivelurile serice de izoflavone ( 17). Studiile de siguranță și farmacocinetice ale izoflavonelor din soia au demonstrat că s-a observat o toxicitate clinică minimă la subiecții sănătoși administrați cu izoflavone din soia purificate la doze care depășesc aporturile alimentare normale ( 18 ).

Datorită similarității sale structurale cu hormonul steroid 17β-estradiol, se leaga genisteina la receptorii de estrogen, ER-α și ER-β, cu o afinitate mai mare pentru ER-β, și acționează ca un modulator naturale selectiv al receptorului de estrogen ( 16 , 19 , 20 ). Genisteina își exercită efectele inhibitoare asupra celulelor canceroase de prostată prin reglarea în sus a expresiei ER-β, care are roluri anti-proliferative și pro-apoptotice în celulele prostatei ( 21 , 22 ). În plus față de activitățile sale estrogenice, genisteina reglează căile mediate de receptorul androgen (AR) în cancerul de prostată ( 23 , 24 ). De remarcat, s-a arătat că efectul inhibitor al genisteinei asupra expresiei AR este mediat și de ER-β (25 ). Mai multe alte mecanisme moleculare care stau la baza efectelor preventive ale genisteinei asupra cancerului de prostată includ inhibarea proliferării celulare prin inducerea opririi ciclului celular G1 și / sau G2 / M ( 26 – 28 ), angiogeneză ( 29 , 30 ) și metastază ( 31 – 33 ) și inducerea apoptozei ( 34 , 35 ). Genisteina își exercită efectele pleiotrope în contextul cancerului de prostată prin modularea mai multor căi de transducție a semnalului celular, cum ar fi IGF-1 ( 36 ), TGF-β ( 37 ), Wnt / β-catenină ( 36 ), NF-κB ( 38 ) , AKT și MAPK ( 39) semnalizare. Această modulare ar putea fi legată direct de receptorii nucleari sau modificarea stării de fosforilare a proteinelor de transducție a semnalului. În plus, genisteina inhibă activitățile tirozin kinazei ( 40 ) și prezintă proprietăți antioxidante ( 41 , 42 ) în celulele prostatei. Swami și colab. ( 43 ) au demonstrat că genisteina reduce progresia cancerului de prostată prin inhibarea sintezei și activității prostaglandinelor. De asemenea, sa raportat că genisteina are posibile efecte asupra deteriorării și reparării ADN-ului în celulele canceroase de prostată ( 42 ). Mai mult, genisteina inhibă metilarea ADN-ului ( 44 – 48 ) și modificările histonice ( 47 ,48 ) și reglează miARN ( 49 – 52 ) în cancerul de prostată. Este de interes că genisteina sa dovedit a spori eficacitatea radioterapiei și a chimioterapiei ( 53 , 54 ).

Deși au fost efectuate numeroase studii in vitro și in vivo pentru a înțelege efectele protectoare ale genisteinei împotriva cancerului de prostată, demonstrate prin studii epidemiologice, mecanismele moleculare care guvernează modul în care genisteina afectează patogeneza cancerului de prostată rămân în continuare evazive. Este de remarcat faptul că o provocare majoră este variabilitatea largă a efectelor genisteinei în funcție de doză, de forma de administrare sau de momentul și durata expunerii ( 55). În ciuda bogăției de studii efectuate pe linii celulare umane și modele animale, doar câteva studii clinice prospective randomizate au fost efectuate pentru a examina efectele moleculare ale genisteinei asupra cancerului de prostată. În studiul de față, după cunoștințele noastre pentru prima dată, am investigat efectele intervenției genisteinei asupra metilării globale și a modelelor de expresie genică la pacienții cu cancer de prostată localizat și am identificat ținte noi care sunt modulate diferențial prin suplimentarea cu genisteină, oferind alte perspective mecaniciste asupra efectelor genisteinei asupra carcinogenezei prostatei.Mergi la:

Materiale și metode

Subiecte

Probele de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie ( 56 ) au fost analizate pentru modificări globale în metilarea ADN și expresia genelor. Participanții au fost recrutați din ambulatoriul de la Departamentul de Urologie, Spitalul Universitar Oslo, Oslo, Norvegia în perioada aprilie 2007 – august 2008. Studiul a fost aprobat de Agenția Norvegiană pentru Medicamente, Comitetul Regional de Etică, Ombudsmanul pentru confidențialitate și Prostate Biobank la Spitalul Universitar Oslo, Aker.

Profilarea metilării la nivelul genomului

ADN-ul total a fost izolat din țesuturile de prostată înghețate folosind kitul DNeasy Blood and Tissue (Qiagen, Valencia, CA, SUA) conform instrucțiunilor producătorului. ADN-ul a fost supus nucleului de genomică integrată Emory pentru analiza metilării ADN-ului folosind Illumina HumanMethylation450 BeadChip Microarrays. Datele de metilare sunt disponibile pe GEO (numărul de acces GSE84749 ).

Profilarea expresiei la nivel de genom

ARN-ul total a fost extras din țesuturile de prostată înghețate folosind kitul de izolare miVNA mirVana (Life Technologies, Grand Island, NY, SUA), urmat de curățarea ARN folosind kitul RNeasy Mini (Qiagen). ARN-ul total a fost trimis la nucleul de genomică integrat Emory pentru analiza expresiei genice utilizând Illumina HumanHT-12 v4 Expression BeadChip Microarray. Datele despre microarray sunt disponibile pe GEO (numărul de acces GSE84748 ).

Analiza PCR cantitativă (qPCR)

ARN a fost transcris invers în ADNc folosind kitul de sinteză ADNc iScript (Bio-Rad Laboratories, Hercules, CA, SUA). Grundurile au fost proiectate folosind instrumentul Primer3. Secvențele primerilor sunt enumerate înTabelul I. qPCR a fost efectuat folosind iQ SYBR-Green Supermix (Bio-Rad Laboratories) pe un iCycler Bio-Rad conform protocoalelor producătorului. Gena β-actină umană, care s-a dovedit a fi o genă validă de referință pentru normalizarea qPCR în probe de țesut uman de cancer de prostată, a fost utilizată ca control intern în prezentul studiu ( 57 ). Ca calibrator s-a folosit o probă normală de țesut prostatic. Modificările relative ale datelor de exprimare a genei au fost analizate prin metoda 2 −ΔΔCT . S-au efectuat triplicate pentru fiecare probă. Datele sunt prezentate ca medie ± deviație standard.

Tabelul I

Secvențe ale primerilor utilizați în analiza PCR cantitativă.

Numele primarSecvență primară (5 ′ → 3 ′)
CKS2-FPTTAGTCTCCGGCGAGTTGTTG
CKS2-RPCATAACATGCCGGTACTCGT
JAG1-FPAGTCGTGCATGCTCCAATCG
JAG1-RPCCCCACACACACTTGGCTC
NOTCH3-FPGATGTGGACGAGTGTGCTGG
NOTCH3-RPCAGGCATGGGTTGGGGTC
MMP26-FPGGACTTTGTTGAGGGCTATTTCCA
MMP26-RPGGAGGTGTCGGACCCATCAG
HIF1A-FPCACCACAGGACAGTACAGGAT
HIF1A-RPCGTGCTGAATAATACCACTCACA
CDK6-FPGCTGACCAGCAGTACGAATG
CDK6-RPGCACACATCAAACAACCTGACC
CD24-FPCGCGGACTTTTCTTTTGGGG
CD24-RPACTGGAATAAATCTGCGTGGGT
AMACR-FPCCGTTCTGTGCTATGGTCCTG
AMACR-RPAGCCTTGGATTTTCCCGCTG
MYC-FPCCTACCCTCTCAACGACAGC
MYC-RPTTGTTCCTCCTCAGAGTCGC
SPP1-FPCAAACGCCGACCAAGGAAAA
SPP1-RPGGCCACAGCATCTGGGTATT
NEU1-FPCGCAGCTATGATGCCTGTGA
NEU1-RPGGTCAGGTTCACTCGGAACTC
ADCY4-FPCCTGGGACCAGGTGTCCTAT
ADCY4-RPCAAGATACAGCCCGAGGACC
β-actină-FPCACAGAGCCTCGCCTTTGCC
β-actină-RPTGACCCATGCCCACCATCAC

Analiza qPCR.

Analiza datelor

Analiza expresiei genice a fost efectuată utilizând modulul GenePattern ComparativeMarkerSelection ( 58 ) comparând tumorile tratate cu genisteină cu tumorile tratate cu placebo. Datele Illumina Microarray au fost filtrate pentru a include gene care au fost detectate (P <0,05) în cel puțin un grup experimental pentru a rezulta într-un set de date de 15918 gene pentru analiză. Modulul de selecție a markerului comparativ al GenePattern a fost utilizat pentru a calcula testele t-Student ale celor două fețe între grupuri cu 10.000 permutări pentru a calcula ratele de descoperire false. Sămânța aleatorie utilizată a fost 779948241. Clusterul ierarhic a fost realizat utilizând software-ul Cluster ( 59 ) și Java TreeView ( 60 ). Analiza microarray de metilare a fost efectuată în R utilizând modulul CpGassoc în Bioconductor ( 61). Datele de la sondele de 450K au fost filtrate la cele în care valoarea β maximă – minimă a fost> 0,2 pentru a rezulta sonde de 160K pentru analiza diferențială a metilării. CpGassoc a fost utilizat pentru a identifica 162 de sonde semnificative care au fost metilate diferențial. Trei sonde au fost metilate diferențial între probele tumorale tratate cu genisteină și probele tumorale tratate cu placebo, trei sonde au fost semnificative între probele tumorale tratate cu genisteină și probele normale și 156 au fost semnificativ diferite între probele tumorale tratate cu placebo și probele normale.

analize statistice

Testul U Mann-Whitney (cu două cozi) a fost utilizat pentru a determina diferențe semnificative între două grupuri de date. P <0,05 a fost considerat semnificativ statistic.Mergi la:

Rezultate

Caracteristici clinicopatologice

Am analizat probe de țesut prostatic dintr-un studiu anterior, care a fost un studiu clinic randomizat, controlat placebo, dublu-orb, de fază 2, pe pacienți norvegieni cu cancer de prostată localizat care au primit 30 mg genisteină sintetică sau capsule placebo zilnic timp de 3-6 săptămâni înainte de radical prostatectomie ( 56 ). Caracteristicile clinice și patologice ale cazurilor au fost descrise anterior ( 56 ). Disponibilitatea țesutului înghețat a limitat dimensiunea eșantionului în acest studiu și am investigat metilarea ADN și nivelurile de expresie genică a probelor de tumori de prostată de la 10 pacienți care au primit genisteină și 10 pacienți care au primit placebo. Au fost de asemenea analizate patru probe adiacente de țesut normal de prostată. Datele clinice pentru cei 20 de pacienți analizați aici sunt furnizate înTabelul II. Nu au existat diferențe semnificative statistic în ceea ce privește vârsta, nivelurile PSA serice și scorul Gleason între cele două grupuri de tratament.

Tabelul II

Date clinice pentru cei 20 de pacienți analizați în prezentul studiu.

TratamentID-ul pacientuluiGleasonSuma GleasonEtapăVârstăPSA
Genisteină (n = 10)13 + 4726812.0
73 + 4726810.9
83 + 362596.2
103 + 473a615.1
133 + 362587.6
144 + 373a648.5
174 + 482616.1
183 + 362576.0
193 + 362637.8
203 + 472687.9
Media (SD)6,7 (0,7)62,7 (4,2)7,8 (2,2)
Placebo (n = 10)243 + 362616.4
253 + 362574.2
263 + 473a689.9
274 + 482699.2
304 + 372555.1
333 + 362566.4
343 + 362637.6
353 + 473a605.7
383 + 472629.9
393 + 362667.0
Media (SD)6,6 (0,7)61,7 (4,9)7.1 (2.0)

Metilare diferențială în țesutul tratat cu genisteină în comparație cu țesutul tratat cu placebo

Profilurile de metilare a ADN-ului la nivelul genomului unui total de 24 de probe de prostată din țesuturi tumorale sau normale au fost generate folosind trusa Illumina HumanMethylation450 BeadChip. Starea de metilare a fiecărei probe a fost analizată pentru 485.577 de situri, acoperind 21.231 de gene. Am comparat profilurile de metilare ale probelor de tumori tratate cu genisteină cu cazurile tratate cu placebo. În general, modificările de metilare au fost modeste și nu a existat o genă metilată semnificativ diferențiat după corecție pentru testarea ipotezelor multiple. Cu toate acestea, valorile P necorectate au indicat faptul că RBM28 și CYTSBgenele au fost demetilate în probe tumorale tratate cu genisteină comparativ cu probele tratate cu placebo. Lipsa semnificației statistice s-a datorat probabil numărului mic de probe analizate în acest studiu. Am observat 156 de sonde cu metilare crescută semnificativ în țesuturile tumorale tratate cu placebo față de țesuturile normale care nu au fost semnificative între țesuturile tumorale tratate cu genisteină și țesuturile normale, sugerând că genisteina ar putea avea unele efecte de demetilare (disponibile la cerere). Aceste 156 de sonde corespundeau a cel puțin 92 de gene separate, inclusiv ADCY4 , ALOX12 , HAAO , LRRC4 , NEU1 , RAPGEFL1 și WNT7B (Tabelul III).

Tabelul III

Lista a 156 de sonde metilate diferențial (92 de gene).

ID țintăNumele geneiValoarea P (GT vs. PT)Valoarea P (GT vs. N)Valoarea P (PT vs. N)
cg00353923LRRC4; SND1nsns0,000214451
cg00420348EFCAB4Ansns0,000247793
cg00459232CD9nsns0,000270319
cg00494665nsns0,000274219
cg00506168PDXKnsns0,000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0,000393857
cg01228355CORINnsns0,000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0,000942104
cg01561916HAAOnsns0,00015216
cg01684881FZD2nsns0,000472597
cg01856645DMGDH; BHMT2nsns0,000876054
cg02072400nsns3.73E-05
cg02131967ASnsns0,000468338
cg02215070AKR1B1nsns0,000607743
cg02493798ALOX12nsns0,000106934
cg02534363NBEAL2nsns0,000263128
cg02659920EPS8L2nsns0,000563556
cg02665650ANKS1Ansns0,000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0,000993538
cg03119308RBM280,000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0,000320776
cg03452174RAB34nsns0,000820466
cg03456213C9orf3nsns0,000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0,000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

Deschideți într-o fereastră separată

GT, tumoare tratată cu genisteină; PT, tumoare tratată cu placebo; N, normal; NS, nu semnificativ.

Profilul expresiei genei se modifică după tratamentul cu genisteină

Pentru a identifica efectele moleculare ale genisteinei asupra nivelurilor de ARNm în cancerul de prostată, am comparat profilurile de expresie genică ale tumorilor tratate cu genisteină cu probele tratate cu placebo. Din nou, nu au existat probe exprimate diferențial care să rămână semnificative statistic după corecție pentru testarea ipotezelor multiple. Cu toate acestea, au existat 628 de sonde care au atins valori P semnificative nominal (disponibile la cerere). Gruparea ierarhică a acestui set de date a arătat o segregare puternică a pacienților cu și fără tratament cu genisteină (Fig. 1). Genele cu valori P semnificative nominal au inclus gene NOTCH3 , JAG1 , CKS2 , HIF1A , CDK6 , MYC , CD24 , AMACR , MMP26 și SPP1 (Tabelul IV). NEU1 și ADCY4 nu au atins semnificație nominală , dar a avut o tendință spre semnificație, și integrarea datelor de metilare cu nivelurile de expresie expresia genelor pereche de profile de date indicate au scăzut stare de metilare și crescute de ADCY4 si NEU1 gene in cazurile tratate genisteina.figura 1

Profilarea expresiei întregului genom al probelor de tumori tratate cu placebo sau genisteină. Gruparea ierarhică a modificărilor în expresia genelor pentru acele gene cu un P <0,05 nominal între probele genistein-tumorale și probele placebo-tumorale.

Tabelul IV

Gene cu expresie diferențială a genelor analizate prin qPCR.

Simbol genicExpresia genelor se schimbă
MicroarrayqPCR
CKS2−2,02−2,50
NOTCH31,722.08
HIF1A−1,63−1,80
CDK6−2,87−1,57
JAG11,916.00
NEU1 a1,771,50
ADCY4 a1,671,60
C-UL MEU−1,57−2.30
CD24−2,02−2,64
AMACR−1,95−2.14
MMPP26−2,78−2,84
SPP1−2,36−3.09

Modificările de pliuri sunt genisteină-tumoră / placebo-tumorăo stare de metilare a ADN-ului este corelată cu expresia genelor în NEU1 și ADCY4. qPCR, PCR cantitativă.

Validarea datelor microarray

Am investigat nivelurile de expresie a 12 gene selectate (Tabelul IV) în toate cele 24 de eșantioane analizate prin microarrays folosind qPCR și au observat că datele microarray au fost corelate cu rezultatele qPCR (Fig. 2). Creșterea nivelurilor de expresie qPCR ale genelor NOTCH3 și JAG1 în tumorile tratate cu genisteină comparativ cu tumorile tratate cu placebo au fost semnificative statistic prin testul U Mann-Whitney.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este IJO-51-01-0223-g01.jpg

Deschideți într-o fereastră separatăFigura 2

Analiza qPCR a nivelurilor de expresie a 12 gene din grupurile placebo și genisteină. Modificările de expresie ale genelor selectate din datele microarray au fost validate folosind qPCR. Datele sunt prezentate ca modificări ale pliurilor în raport cu probele de control. qPCR, PCR cantitativă.

Analiza îmbogățirii

Am efectuat analize de îmbogățire a genei pe cele 628 de sonde semnificative nominal care au fost exprimate diferențial între probele de genisteină și placebo (Tabelul V) folosind Analiza căii de ingeniozitate ( 62 ) și baza de cunoștințe DAVID ( 63). Valoarea P indică distribuția hipergeometrică Valorile P ale suprapunerii pentru seturile de gene și categoriile funcționale. FDR indică o rată de descoperire falsă, corectate valorile P ale suprapunerii. Scorul z de activare este o indicație a consistenței membrilor în sus și în jos reglementați ai unui set de gene, cum ar fi o funcție biologică (tabelul de sus) sau țintele unui regulator în amonte (tabelul de mijloc). Scorurile de activare z> 2 sau <−2 sunt semnificative statistic pentru consistența activării sau inhibării. Moleculele indică numărul de molecule din setul de 628 de sonde analizate care se suprapun cu o anumită categorie. Rețeaua mecanistică indică numărul total de gene țintă ale unui regulator în amonte, iar numărul de gene suprapuse este indicat între paranteze. Am observat îmbogățirea termenilor asociați cu angiogeneza, apoptoza, tranziția epitelială la mezenchimală,progresia tumorii și legarea PDGF. Analiza potențialelor regulatoare din amonte prin analiza IPA a sugerat că PTEN și PDGF au fost activate, în timp ce MYC, β-estradiol, receptorul glucocorticoid NR3C1 și interferon-γ au fost reprimate ca răspuns la tratamentul cu genisteină.

Tabelul V

Analiza îmbogățirii a 628 de sonde semnificative nominal exprimate diferențial între grupurile de genisteină și placebo.

AnalizăValoarea PActivare scor zNumărul de moleculeFuncţie
IPA5.92E-080,77318Progresia tumorii
IPA4.88E-071,01355Neoplasm abdominal
IPA1.09E-061.92728Diferențierea liniilor celulare tumorale
IPA1.34E-06−1.01719Tranziția epitelial-mezenchimală
IPA7.46E-062.41222Tumora neuroendocrină
IPA7.98E-052.05428Necroza tumorii
AnalizăValoarea P a suprapuneriiActivare scor zRețea mecanicistăRegulator în amonte
IPA3.85E-08−0,692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0,832144 (13)IFNG
IPA2.17E-061,608141 (16)PTEN
IPA4.59E-06−2.995133 (13)C-UL MEU
AnalizăFDRActivare scor zNumărul de moleculeTermen
DAVID7.90E-04N / A17GO: 0005840 ribozom
DAVID1.19E-02N / A34mitocondrie
DAVID2.00E-02N / A16GO: 0001568 dezvoltarea vaselor de sânge
DAVID1.77E-02N / A10GO: 0019838 legarea factorului de creștere
DAVID3.52E-02N / A7GO: 0008629 inducerea apoptozei prin semnale intracelulare
DAVID3.16E-02N / A4GO: 0048407 legarea factorului de creștere derivat din trombocite

Deschideți într-o fereastră separatăMergi la:

Discuţie

Din câte știm, prezentul studiu este primul care evidențiază efectele genisteinei asupra modificărilor globale ale metilării ADN și ale expresiei genice la pacienți dintr-un studiu clinic de genisteină în cancerul de prostată. Analiza integrativă a metilării genomului întreg și profilarea expresiei au identificat un număr de situri candidate metilate diferențial și au exprimat site-uri între grupurile placebo și genisteină. Cu toate acestea, diferențele dintre grupurile placebo și grupurile cu genisteină nu au fost semnificative statistic după corecție pentru testarea multiplelor ipoteze, posibil datorită numărului mic de cazuri din acest studiu. Deși modificările induse de genisteină nu sunt semnificative, aceste rezultate pot ajuta la elucidarea mecanismelor moleculare care stau la baza activităților genisteinei în cancerul de prostată.Matricile de metilare a ADN-ului la nivel de genom au arătat că un număr de gene, inclusivRBM28 și CYTSB , păreau a fi demetilate în probele tumorale tratate cu genisteină, comparativ cu probele din grupul placebo. Cu toate acestea, nu am observat modificări ale nivelurilor de expresie ale acestor gene. Printre genele exprimate diferențial identificate prin analiza microarray s-au numărat CKS2 , NOTCH3 , HIF1A , CDK6 , JAG1 , NEU1 , ADCY4 , MYC , CD24 , AMACR , MMP26 și SPP1. Datele microarray au fost confirmate prin analiza qPCR a acestor gene. Alte gene cu semnificație nominală prin microarray, dar care nu au fost testate de qPCR au inclus ZNF639 , CRIM1 , PGC și USP54 (disponibil la cerere).

Este interesant de remarcat faptul că statutul de metilare ADN – ul a fost corelat invers cu expresia genelor pentru NEU1 si ADCY4 gene, care a scazut de metilare și expresia crescută a ARNm în grupul genisteina comparativ cu grupul placebo. Descoperirea noastră care arată potențialul genisteinei pentru demetilarea ADN-ului este în concordanță cu datele raportate anterior care sugerează că genisteina acționează ca un inhibitor al DNMT, provocând astfel demetilarea insulelor CpG în promotorii genelor. De exemplu, s-a demonstrat că genisteina reactivează genele supresoare tumorale cu tăcere hipermetilată, inclusiv p16INK4a , receptorul de acid retinoic β ( RARβ ) și O 6-metilguanină metiltransferază ( MGMT), în celulele canceroase de prostată și esofag ( 46 ). Mai mult, genisteina a fost implicată în demetilarea promotorului WNT5a în celulele cancerului de colon ( 64 ). Una dintre genele care s-au dovedit a fi demetilate de genisteină în studiul de față este ADCY4, care este un membru al familiei adenilat ciclaselor, enzimele legate de membrană care catalizează formarea adenozinei monofosfat ciclic mesager secundar (AMPc) ( 65 ). În concordanță cu constatările noastre, s-a demonstrat recent că ADCY4 este un marker de metilare a ADN-ului care reprezintă evenimente epigenetice timpurii în tumorigeneză de prostată, susținând ipoteza noastră că genisteina poate inversa modelul metilării ADN-ului în ADCY4 în cancerul de prostată ( 66).). Cealaltă genă care a fost modulată prin intervenția genisteinei în prezentul studiu a fost NEU1, care este o sialidază lizozomală implicată în catabolismul glicoconjugatului și semnalizarea celulară, inclusiv răspunsurile imune și transducția semnalului mediată de receptorul elastinei ( 67 ). De fapt, NEU1 este esențial pentru desialilarea integrinei β4 și inhibarea FAK, ducând la suprimarea metastazelor hepatice în cancerul de colon ( 68 ). Kato și colab. ( 69 ) au raportat că supraexprimarea NEU1 a dus la suprimarea metastazelor pulmonare în melanom. În plus, suprimarea NEU1 de către miR-125b sa dovedit a promova migrația, invazia și metastaza în cancerele gastrice ( 70). Cu toate acestea, NEU1 poate avea, de asemenea, efecte pro-metastatice în cazurile de cancer pancreatic și ovarian ( 71 ) și, prin urmare, nu este pe deplin clar care ar putea fi impactul general al nivelurilor crescute de NEU1 în cancerul de prostată. Prin urmare, este important să se examineze modificările expresiei NEU1 la nivelul proteinelor și sunt necesare studii moleculare și celulare pentru a evalua consecințele funcționale ale modificărilor induse de reglarea ascendentă a NEU1 în celulele cancerului de prostată.

Dintre genele exprimate diferențial care au fost validate de qPCR, doar expresia mARN-urilor NOTCH3 și JAG1 au fost semnificativ mai mari în grupul cu genisteină comparativ cu grupul placebo de qPCR. Pe baza constatărilor noastre la nivel de ARNm, fără nici o confirmare la nivel proteic sau funcțional, ar fi speculativ să sugerăm că semnalizarea Notch poate juca un rol în mecanismul de acțiune al genisteinei asupra cancerului de prostată. NOTCH3 este important pentru EMT indus de TGFβ în cancerul de prostată ( 72 ) și este indus de hipoxie și contribuie la progresia cancerului de prostată ( 73 ). Ligandul Notch JAG1 este, de asemenea, asociat cu cancer de prostată mai agresiv ( 74 , 75 ), EMT și angiogeneză (76 ). Cu toate acestea, un rol de supresie tumorală a semnalizării Notch a fost raportat și în diferențierea neuroendocrină indusă de hipoxie a celulelor canceroase de prostată, precum și în alte tipuri de cancer, inclusiv cancerul vezicii urinare, tumorile maligne hematologice, gliomul, carcinomul tiroidian și cancerul pulmonar ( 77 – 82 ), indicând posibilitatea ca expresia crescută a NOTCH3 / JAG1 prin tratamentul cu genisteină să îmbunătățească rezultatele prin funcția sa de supresoare tumorală. Datele noastre sugerează că studii suplimentare pentru a delimita efectul genisteinei asupra căii de semnalizare Notch în cancerul de prostată pot fi justificate.

Analizele de îmbogățire a modificărilor ARNm induse de genisteină au indicat faptul că modificările subtile ale expresiei genice observate între probele de genisteină și placebo sunt în concordanță cu multe efecte raportate anterior ale genisteinei pe căile tumorale critice, inclusiv PTEN, PDGF, MYC, β-estradiol, receptor glucocorticoid și interferon- y ( 41 , 83 – 89 ). Genisteina pare să promoveze activitatea PTEN și inhibă activitatea MYC, în concordanță cu utilitatea sa potențială în îmbunătățirea rezultatelor în cancerul de prostată.

Pe scurt, rezultatele noastre indică faptul că intervenția genisteinei induce modularea mai multor gene, inclusiv NOTCH3 , JAG1 , ADCY4 și NEU1, sugerând că aceste gene pot avea potențialul de a fi ținte moleculare noi ale genisteinei în cancerul de prostată. Aceste gene sunt implicate în multe procese biologice critice, inclusiv ciclul celular, angiogeneza, răspunsul imun celular și transducția semnalului intracelular, oferind o perspectivă suplimentară asupra multiplelor căi moleculare implicate în tumorigeneză de prostată. Cu toate acestea, sunt necesare studii mecaniciste suplimentare pentru a investiga efectele genisteinei asupra reglării expresiei acestor gene la nivelul proteinelor și funcțiilor celulare. Aceste descoperiri pot contribui apoi la proiectarea de noi strategii pentru prevenirea și tratamentul cancerului de prostată. O avertisment al studiilor de profilare a expresiei genice este incapacitatea identificării mecanismelor de acțiune care sunt modulate la nivel post-transcripțional,sugerând posibilitatea ca genisteina să modifice procese celulare suplimentare. Un alt punct care trebuie făcut este momentul și durata expunerii la genisteină. Studiile de control al cazurilor au demonstrat că consumul ridicat de soia la începutul vieții (în timpul copilăriei și / sau adolescenței) este asociat cu o reducere de 25-60% a riscului de cancer mamar (90 , 91 ). În mod similar, aportul ridicat de soia la pubertate, perioada în care prostata suferă o creștere indusă de androgen, ar putea fi mai eficientă în prevenirea cancerului de prostată. O limitare a prezentului studiu este numărul mic de probe de pacienți. Alte studii clinice controlate randomizate de mari dimensiuni ar oferi rezultate mai definitive ale efectelor genisteinei asupra țesuturilor prostatei pacientului.Mergi la:

Mulțumiri

Prezentul studiu a fost susținut parțial de nucleul de genomică integrat Emory (EIGC), care este subvenționat de Grantul de asistență al Centrului de Cancer NCI P30CA138292 și de Școala de Medicină a Universității Emory și este una dintre facilitățile de bază integrate Emory. Acesta a fost susținut în continuare de un Premiu de Cercetare a Soia din cadrul Programului de Cercetare în Sănătate al Soia al United Soybean Board.Mergi la:

Referințe

1. Siegel RL, Miller KD, Jemal A. Statistici despre cancer, 2016. CA Cancer J Clin. 2016; 66 : 7–30. doi: 10.3322 / caac.21332. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Fapte și cifre despre cancerul de prostată 2016. American Cancer Society Inc; Atlanta, GA: 2016. [ Google Scholar ]3. Dunn MW, Kazer MW. Prezentare generală a cancerului de prostată. Semin Oncol Nurs. 2011; 27 : 241-250. doi: 10.1016 / j.soncn.2011.07.002. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Sartor AO. Progresia cancerului de prostată metastatic rezistent la castrate: impactul intervenției terapeutice în spațiul post-docetaxel. J Hematol Oncol. 2011; 4 : 18. doi: 10.1186 / 1756-8722-4-18. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W, III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, și colab. American Cancer Society ghiduri de îngrijire pentru supraviețuirea cancerului de prostată. CA Cancer J Clin. 2014; 64 : 225–249. doi: 10.3322 / caac.21234. [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, și colab. Sarcina de modificare a numărului de copii prezice recăderea cancerului de prostată. Proc Natl Acad Sci SUA. 2014; 111 : 11139–11144. doi: 10.1073 / pnas.1411446111. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Ferlay J, Bray F, Pisani P, Parkin DM. Globocan 2000: Incidența, mortalitatea și prevalența cancerului la nivel mondial. Presa IARC; Lyon: 2001. [ Google Scholar ]8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Statistici globale privind cancerul. CA Cancer J Clin. 2011; 61 : 69–90. doi: 10.3322 / caac.20107. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Kimura T. East întâlnește vestul: Diferențe etnice în epidemiologia cancerului de prostată între asiatici de est și caucazieni. Cancerul Chin J. 2012; 31 : 421-429. doi: 10.5732 / cjc.011.10324. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Reinli K, Block G. Conținutul de fitoestrogen din alimente – un compendiu al valorilor literaturii. Cancerul Nutr. 1996; 26 : 123–148. doi: 10.1080 / 01635589609514470. [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Adlercreutz H, Markkanen H, Watanabe S. Concentrații plasmatice de fitoestrogeni la bărbații japonezi. Lancet. 1993; 342 : 1209–1210. doi: 10.1016 / 0140-6736 (93) 92188-Y. [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S, Griffiths K. Lignans și izoflavonoizi în plasmă și lichid prostatic la bărbați: eșantioane din Portugalia, Hong Kong , și Regatul Unit. Prostata. 1997; 32 : 122–128. doi: 10.1002 / (SICI) 1097-0045 (19970701) 32: 2 <122 :: AID-PROS7> 3.0.CO; 2-O. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hwang YW, Kim SY, Jee SH, Kim YN, Nam CM. Consumul de alimente din soia și riscul de cancer de prostată: o meta-analiză a studiilor observaționale. Cancerul Nutr. 2009; 61 : 598-606. doi: 10.1080 / 01635580902825639. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Van Poppel H, Tombal B. Chimioprevenția cancerului de prostată cu substanțe nutritive și suplimente. Cancer Manag Res. 2011; 3 : 91–100. doi: 10.2147 / CMAR.S18503. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Barnes S, Peterson TG, Coward L. Justificare pentru utilizarea matricelor de soia care conțin genisteină în studiile de chemoprevenție pentru cancerul de sân și de prostată. J Cell Biochem (Suppl) 1995; S22 : 181–187. doi: 10.1002 / jcb.240590823. [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, și colab. Analiza farmacocinetică și farmacodinamică de fază I a izoflavonelor de soia neconjugate administrate persoanelor cu cancer. Biomarkeri de epidemiol pentru cancer Prev. 2003; 12 : 1213–1221. [ PubMed ] [ Google Scholar ]17. CD Gardner, Oelrich B, Liu JP, Feldman D, Franke AA, Brooks JD. Concentrațiile de izoflavonă din soia prostatică depășesc nivelurile serice după suplimentarea dietei. Prostata. 2009; 69 : 719–726. doi: 10.1002 / pros.20922. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA și colab. Siguranța și farmacocinetica izoflavonelor purificate din soia: Administrare cu doză unică la femeile aflate în postmenopauză. Sunt J Clin Nutr. 2002; 76 : 1126–1137. [ PubMed ] [ Google Scholar ]19. Yildiz F. Fitoestrogeni în alimente funcționale. CRC Press; Boca Raton, FL: 2005. https://doi.org/10.1201/9781420027594 . [ CrossRef ] [ Google Scholar ]20. Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M, Masamune Y. Interacțiunea fitoestrogenilor cu receptorii de estrogen alfa și beta. Biol Pharm Bull. 2001; 24 : 351–356. doi: 10.1248 / bpb.24.351. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Chang WY, Prins GS. Receptorul de estrogen-beta: Implicații pentru glanda prostatică. Prostata. 1999; 40 : 115–124. doi: 10.1002 / (SICI) 1097-0045 (19990701) 40: 2 <115 :: AID-PROS7> 3.0.CO; 2-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP, Gupta G. Mecanisme sinergice chimioprotectoare ale fitoestrogenilor dietetici într-o combinație selectă împotriva cancerului de prostată. J Nutr Biochem. 2011; 22 : 723–731. doi: 10.1016 / j.jnutbio.2010.06.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Wang J, Eltoum IE, Lamartiniere CA. Chimioprevenția genisteinei a cancerului de prostată la șoarecii TRAMP. J Cancer. 2007; 6 : 3. doi: 10.1186 / 1477-3163-6-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Davis JN, Kucuk O, Sarkar FH. Expresia antigenului specific prostatei este reglată transcripțional de genisteină în celulele cancerului de prostată. Mol Carcinog. 2002; 34 : 91–101. doi: 10.1002 / mc.10053. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Reglarea receptorilor de androgen prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgen este mediată de receptorul de estrogen beta. Eur Urol. 2004; 45 : 245–251. doi: 10.1016 / j.eururo.2003.09.001. discuție 251. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S, Hursting SD. Doza mică de genisteină induce inhibitori de kinază dependenți de ciclină și oprirea ciclului celular G (1) în celulele cancerului de prostată uman. Mol Carcinog. 2000; 29 : 92–102. doi: 10.1002 / 1098-2744 (200010) 29: 2 <92 :: AID-MC6> 3.0.CO; 2-Q. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Reglarea în sus a p21WAF1 indusă de genisteină, reglarea în jos a ciclinei B și inducerea apoptozei în celulele canceroase de prostată. Cancerul Nutr. 1998; 32 : 123–131. doi: 10.1080 / 01635589809514730. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH, Hillman GG. Genisteina inhibă activarea NF-kappaB indusă de radiații în celulele canceroase de prostată, promovând apoptoza și oprirea ciclului celular G2 / M. Cancer BMC. 2006; 6 : 107. doi: 10.1186 / 1471-2407-6-107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Li Y, Sarkar FH. Reglarea descendentă a invaziei și a genelor legate de angiogeneză identificate prin analiza microarray cDNA a celulelor canceroase de prostată PC3 tratate cu genisteină. Cancer Lett. 2002; 186 : 157–164. doi: 10.1016 / S0304-3835 (02) 00349-X. [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Guo Y, Wang S, Hoot DR, Clinton SK. Suprimarea interacțiunilor autocrine și paracrine mediate de VEGF între celulele cancerului de prostată și celulele endoteliale vasculare de către izoflavonele din soia. J Nutr Biochem. 2007; 18 : 408–417. doi: 10.1016 / j.jnutbio.2006.08.006. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Reglarea expresiei genelor și inhibarea metastazei osoase experimentale a cancerului de prostată de către genisteina dietetică. Neoplazie. 2004; 6 : 354–363. doi: 10.1593 / neo.03478. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY, He DL. Un nou efect anticanceros al genisteinei: inversarea tranziției mezenchimale epiteliale în celulele canceroase de prostată. Acta Pharmacol Sin. 2008; 29 : 1060–1068. doi: 10.1111 / j.1745-7254.2008.00831.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Kumi-Diaka JK, Hassanhi M, Merchant K, Horman V. Influența genisteinei izoflavonei pe expresia matricei metaloproteinazei-2 în celulele cancerului de prostată. J Med Food. 2006; 9 : 491–497. doi: 10.1089 / jmf.2006.9.491. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kazi A, Daniel KG, Smith DM, Kumar NB, Dou QP. Inhibarea activității proteazomului, un mecanism nou asociat cu capacitatea genisteinei de inducere a apoptozei celulare tumorale. Biochem Pharmacol. 2003; 66 : 965–976. doi: 10.1016 / S0006-2952 (03) 00414-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Kumi-Diaka J, Sanderson NA, Sala A. Rolul mediator al proteazei caspase-3 în mecanismul intracelular al apoptozei induse de genisteină în liniile celulare de carcinom prostatic uman, DU145 și LNCaP. Biol Cell. 2000; 92 : 595-604. doi: 10.1016 / S0248-4900 (00) 01109-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Lee J, Ju J, Park S, Hong SJ, Yoon S. Inhibarea semnalizării IGF-1 de către genisteină: Modularea expresiei E-cadherinei și reglarea descendentă a semnalizării β-cateninei în celulele cu cancer de prostată PC-3 hormon refractare. Cancerul Nutr. 2012; 64 : 153–162. doi: 10.1080 / 01635581.2012.630161. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Xu L, Bergan RC. Genisteina inhibă activarea matricei metaloproteinazei tip 2 și invazia celulelor cancerului de prostată prin blocarea factorului de creștere transformant activarea mediată de beta a căii proteinei kinazei 2-27-kDa proteinei șocului termic activat prin mitogen-activat kinază 2-27-kDa. Mol Pharmacol. 2006; 70 : 869–877. doi: 10.1124 / mol.106.023861. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Davis JN, Kucuk O, Sarkar FH. Genisteina inhibă activarea NF-kappaB în celulele canceroase de prostată. Cancerul Nutr. 1999; 35 : 167–174. doi: 10.1207 / S15327914NC352_11. [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Li Y, Sarkar FH. Inhibarea activării factorului nuclear kappaB în celulele PC3 de către genisteină este mediată prin calea de semnalizare Akt. Clin Cancer Res. 2002; 8 : 2369–2377. [ PubMed ] [ Google Scholar ]40. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y. Genistein, un inhibitor specific al protein kinazelor specifice tirozinei. J Biol Chem. 1987; 262 : 5592–5595. [ PubMed ] [ Google Scholar ]41. Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS, Ha J. Efectele antioxidante ale genisteinei sunt asociate cu activarea proteinei kinazei activate de AMP și inducerea PTEN în celulele canceroase de prostată . J Med Food. 2010; 13 : 815–820. doi: 10.1089 / jmf.2009.1359. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Raschke M, Rowland IR, Magee PJ, Pool-Zobel BL. Genisteina protejează celulele prostatei împotriva deteriorării ADN-ului induse de peroxidul de hidrogen și induce expresia genelor implicate în apărarea împotriva stresului oxidativ. Carcinogeneză. 2006; 27 : 2322–2330. doi: 10.1093 / carcin / bgl082. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM, Feldman D. Inhibarea sintezei și acțiunilor prostaglandinelor de către genisteină în celulele canceroase de prostată umane și de izoflavone din soia la pacienții cu cancer de prostată. Int J Rac. 2009; 124 : 2050–2059. doi: 10.1002 / ijc.24161. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L, Bernard-Gallon D. Metilarea ADN și fitoestrogeni din soia: Studiu cantitativ în liniile celulare umane de cancer de prostată DU-145 și PC-3. Epigenomica. 2011; 3 : 795–803. doi: 10.2217 / epi.11.103. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L și colab. Fitoestrogenii din soia modifică metilarea ADN a promotorului GSTP1, RASSF1A, EPH2 și BRCA1 în celulele cancerului de prostată. În Vivo. 2010; 24 : 393–400. [ PubMed ] [ Google Scholar ]46. Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang C. Inversarea hipermetilării și reactivării a 16 gene INK4a , RARbeta și MGMT de către genisteină și alte izoflavone din soia. Clin Cancer Res. 2005; 11 : 7033–7041. doi: 10.1158 / 1078-0432.CCR-05-0406. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV, Dahiya R. cancer de prostată. Cancer. 2010; 116 : 66–76. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M, Dahiya R. Acetilarea histonei mediată de genisteină și demetilarea activează genele supresoare tumorale din celulele cancerului de prostată. Int J Rac. 2008; 123 : 552-560. doi: 10.1002 / ijc.23590. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Li Y, Kong D, Ahmad A, Bao B, Dyson G, Sarkar FH. Dereglarea epigenetică a miR-29a și miR-1256 de către izoflavonă contribuie la inhibarea creșterii și invaziei celulelor canceroase de prostată. Epigenetica. 2012; 7 : 940–949. doi: 10.4161 / epi.21236. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ, Bernard-Gallon DJ. miARN exprimate diferențial în liniile celulare de cancer de prostată după tratamentul cu soia. În Vivo. 2011; 25 : 917–921. [ PubMed ] [ Google Scholar ]51. Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y, Dahiya R. MicroRNAs 221/222 și reglarea mediată de genisteină a genei supresoare tumorale ARHI în cancerul de prostată. Cancer Prev Res (Phila) 2011; 4 : 76–86. doi: 10.1158 / 1940-6207.CAPR-10-0167. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, ​​Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I și colab. Genisteina reglează în sus microRNA-574-3p supresor tumoral în cancerul de prostată. Plus unu. 2013; 8 : e58929. doi: 10.1371 / journal.pone.0058929. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J, Sarkar FH. Genisteina potențează efectul radiației asupra celulelor carcinomului de prostată. Clin Cancer Res. 2001; 7 : 382–390. [ PubMed ] [ Google Scholar ]54. Li Y, Kucuk O, Hussain M, Abrams J, Cher ML, Sarkar FH. Activitățile antitumorale și antimetastatice ale docetaxelului sunt îmbunătățite de genisteină prin reglarea osteoprotegerinei / receptorului activator al factorului nuclear-kappaB (RANK) / ligand RANK / semnalizarea MMP-9 în cancerul de prostată. Cancer Res. 2006; 66 : 4816–4825. doi: 10.1158 / 0008-5472.CAN-05-3752. [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, și colab. Genisteina și cancerul: starea actuală, provocările și direcțiile viitoare. Adv Nutr. 2015; 6 : 408–419. doi: 10.3945 / an.114.008052. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Katoh M. Rețea de WNT și alte cascade de semnalizare de reglementare în celule stem pluripotente și celule stem canceroase. Curr Pharm Biotechnol. 2011; 12 : 160–170. doi: 10.2174 / 138920111794295710. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV. Atât beta-actina, cât și GAPDH sunt gene de referință utile pentru normalizarea RT-PCR cantitativă în probe de țesut uman FFPE de cancer de prostată. Prostata. 2008; 68 : 1555–1560. doi: 10.1002 / pros.20815. [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006; 38 : 500-501. doi: 10.1038 / ng0506-500. [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci SUA. 1998; 95 : 14863–14868. doi: 10.1073 / pnas.95.25.14863. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Saldanha AJ. Java Treeview – vizualizare extensibilă a datelor micro-matrice. Bioinformatică. 2004; 20 : 3246–3248. doi: 10.1093 / bioinformatics / bth349. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Barfield RT, Kilaru V, Smith AK, Conneely KN. CpGassoc: O funcție R pentru analiza datelor despre microarray de metilare a ADN-ului. Bioinformatică. 2012; 28 : 1280–1281. doi: 10.1093 / bioinformatics / bts124. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Qiagen’s Ingenuity Pathway Analysishttp://www.qiagen.com/ingenuity .63. Dennis G, Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Baza de date pentru adnotare, vizualizare și descoperire integrată. Genomul Biol. 2003; 4 : 3. doi: 10.1186 / gb-2003-4-5-p3. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Wang Z, Chen H. Genisteinul crește expresia genelor prin demetilarea promotorului WNT5a în linia celulară de cancer de colon SW1116. Anticancer Res. 2010; 30 : 4537–4545. [ PubMed ] [ Google Scholar ]65. Gao BN, Gilman AG. Clonarea și exprimarea unei adenilil ciclaze distribuite pe scară largă (tip IV). Proc Natl Acad Sci SUA. 1991; 88 : 10178-10182. doi: 10.1073 / pnas.88.22.10178. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG, Freije D. Un panou de markeri de metilare a ADN-ului dezvăluie metilare extinsă în nucleele biopsiei prostatei histologice benigne de la pacienții cu cancer. Biomark Res. 2014; 2 : 25. doi: 10.1186 / s40364-014-0025-9. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Monti E, Bonten E, D’Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R, Tettamanti G. Sialidases in vertebrates: O familie de enzime adaptate pentru mai multe funcții celulare. Adv Carbohydr Chem Biochem. 2010; 64 : 403–479. doi: 10.1016 / S0065-2318 (10) 64007-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H, Miyagi T. Contribuția sialidazei NEU1 la suprimarea metastazelor celulelor canceroase ale colonului uman prin desialilarea integrinei beta4. Oncogene. 2009; 28 : 1218–1229. doi: 10.1038 / onc.2008.471. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S, Miyagi T. Supraexprimarea sialidazei de tip lizozomal conduce la suprimarea metastazelor asociate cu reversia fenotipului malign în celulele melanomului B16 murin. Int J Rac. 2001; 92 : 797–804. doi: 10.1002 / ijc.1268. [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W, Che X. MicroRNA-125b promovează invazia și metastaza cancerului gastric prin vizarea STARD13 și NEU1. Tumora Biol. 2016; 37 : 12141–12151. doi: 10.1007 / s13277-016-5094-y. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Haxho F, Neufeld RJ, Szewczuk MR. Neuraminidază-1: O țintă terapeutică nouă în tumorigeneză în mai multe etape. Oncotarget. 2016; 7 : 40860–40881. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H, Zhou Y. Notch3 este important pentru tranziția epitelial-mezenchimală indusă de TGF-β în osul cancerului pulmonar cu celule mici. metastază prin reglarea ZEB-1. Cancer Gene Ther. 2014; 21 : 364–372. doi: 10.1038 / cgt.2014.39. [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, și colab. Notch3 este activat de hipoxia cronică și contribuie la progresia cancerului de prostată uman. Int J Rac. 2013; 133 : 2577–2586. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, și colab. Corelarea Sprouty1 și Jagged1 cu celule agresive de cancer de prostată cu diferite sensibilități la privarea de androgen. J Cell Biochem. 2014; 115 : 1505-1515. doi: 10.1002 / jcb.24805. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A, Trindade A. Dinamica semnalizării crestăturii în prostata adultă sănătoasă și în dezvoltarea tumorilor de prostată. Prostata. 2016; 76 : 80–96. doi: 10.1002 / pros.23102. [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH, Duarte A. Endotelial Jagged1 promovează creșterea tumorilor solide atât prin funcții pro-angiogenice, cât și prin funcții angiocrine. Oncotarget. 2015; 6 : 24404–24423. doi: 10.18632 / oncotarget.4380. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, și colab. Semnalizarea prin crestături modulează diferențierea neuroendocrină indusă de hipoxie a celulelor cancerului de prostată uman. Mol Cancer Res. 2012; 10 : 230–238. doi: 10.1158 / 1541-7786.MCR-11-0296. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A, Klinakis A. Un nou rol de supresor tumoral pentru calea Notch în cancerul de vezică urinară. Nat Med. 2014; 20 : 1199–1205. doi: 10.1038 / nm.3678. [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Hernandez Tejada FN, Galvez Silva JR, Zweidler-McKay PA. Provocarea vizării crestăturii în tumorile maligne hematologice. Front Pediatr. 2014; 2 : 54. doi: 10.3389 / fped.2014.00054. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, și colab. O funcție de supresie tumorală pentru semnalizarea Notch în subtipurile tumorale din creier anterior. Celula cancerului. 2015; 28 : 730–742. doi: 10.1016 / j.ccell.2015.10.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB și colab. Rolul supresorului tumorii al Notch3 în carcinomul tiroidian medular, dezvăluit prin inducție genetică și farmacologică. Mol Cancer Ther. 2015; 14 : 499–512. doi: 10.1158 / 1535-7163.MCT-14-0073. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Semnalizarea prin crestături induce oprirea ciclului celular în celulele cu cancer pulmonar cu celule mici. Cancer Res. 2001; 61 : 3200–3205. [ PubMed ] [ Google Scholar ]83. Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX, Yang YM. Genisteina induce arestarea G2 / M în celulele canceroase gastrice prin creșterea expresiei PTEN supresoare tumorale. Cancerul Nutr. 2013; 65 : 1034–1041. doi: 10.1080 / 01635581.2013.810290. [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY, Chow NH. Romanul vizează anti-angiogeneza genisteinei pe celulele canceroase umane. Biochem Pharmacol. 2005; 69 : 307-318. doi: 10.1016 / j.bcp.2004.09.025. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Jagadeesh S, Kyo S, Banerjee PP. Genisteina reprimă activitatea telomerazei prin intermediul mecanismelor transcripționale și posttranslaționale în celulele canceroase de prostată umane. Cancer Res. 2006; 66 : 2107-2115. doi: 10.1158 / 0008-5472.CAN-05-2494. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genisteina crește expresia beta a receptorilor de estrogen în cancerul de prostată prin reducerea metilării sale promotor. J Steroid Biochem Mol Biol. 2015; 152 : 62-75. doi: 10.1016 / j.jsbmb.2015.04.018. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Whirledge S, Senbanjo LT, Cidlowski JA. Genisteina perturbă semnalizarea receptorilor glucocorticoizi în celulele Ishikawa endometriale uterine umane. Perspectiva sănătății Environ. 2015; 123 : 80-87. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]88. Bhamre S, Sahoo D, Tibshirani R, Dill DL, Brooks JD. Modificări ale expresiei genetice induse de genisteină în linia celulară de cancer de prostată LNCaP. Open Prostate Cancer J. 2010; 3 : 86–98. doi: 10.2174 / 1876822901003010086. [ CrossRef ] [ Google Scholar ]89. Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A, Vakili MA. Genisteina induce un efect imunomodulator de protecție la un model de șoarece de cancer de col uterin. Iran J Immunol. 2012; 9 : 119–127. [ PubMed ] [ Google Scholar ]90. Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN, Ziegler RG. Consumul de soia în copilărie și riscul de cancer mamar la femeile asiatice americane Biomarkeri de epidemiol pentru cancer Prev. 2009; 18 : 1050–1059. doi: 10.1158 / 1055-9965.EPI-08-0405. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W. Consumul de alimente din soia pentru adolescenți și adulți și riscul de cancer mamar: Rezultate din Studiul de sănătate al femeilor din Shanghai . Sunt J Clin Nutr. 2009; 89 : 1920–1926. doi: 10.3945 / ajcn.2008.27361. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Oncologie sunt furnizate aici prin amabilitatea Spandidos Publications

suplimente anticancer din ” naturopathic oncology „

Licopenul reduce stimularea IGF-1 a creșterii celulelor canceroase în tumorile dependente de hormoni și se gaseste in roșiile fierte. L.O.M. este un supliment cu doze mari de licopen și carotenoizi asemănători licopenului ficoen și fitofluen, dintr-o roșie special crescută. Doza este de 1 comprimat de două ori pe zi.

Aveți grijă să păstrați acest produs în afara luminii.

Luteina se găsește în spanac, broccoli, portocale, morcovi, salată, roșii, țelină și legume verzi.

Betacarotenul sintetic sau ca supliment cu doze mari fără alți carotenoizi naturali nu este recomandat în îngrijirea cancerului. Acestea pot deveni un catalizator pro-oxidant în țesuturile cu conținut ridicat de oxigen – astfel crește riscul apariției cancerelor pulmonare atunci când sunt administrate fumătorilor. Cu toate acestea, retinoizii reduc riscul de a dezvolta cancer atunci când sunt administrați după renunțarea la fumat. Vitamina E sprijină repararea plămânilor.

Vitamina E este o familie de compuși numiți tocoferoli și tocotriene, care sunt antioxidanți liposolubili. Cea mai comună formă naturală a vitaminei E este d-alfa-tocoferolul. Vitamina E sintetică nu s-a dovedit niciodată utilă din punct de vedere medical și este de siguranță discutabilă. Eu prescriu doar „tocoferoli amestecați” care conțin forma gamma a vitaminei E. „Sursă naturală” obișnuită tocoferolul pur d-alfa nu este un substitut acceptabil. Compușii cu vitamina E protejează grăsimile din membranele celulare de oxidare. Atunci când nivelurile de vitamina E sunt prea scăzute, membranele celulare devin rigide și nu mai poate trece nutriția și deșeurile.

 Vitamina E promovează apoptoza independent de genele p21 și p53, în special succinatul de vitamina E injectabil sau VES.

 Vitamina E stimulează diferențierea celulară, inhibă angiogeneza, inhibă TNF, oprește NFkB și alte gene pro-inflamatorii.Vitamina E protejează foarte mult plămânii, creierul și alte țesuturi cu conținut ridicat de oxigen. În acest sens, este sinsergetic cu extractul de semințe de struguri. Vitamina E protejează împotriva cancerului de sân, colon și prostată. S-a descoperit că forma alfa a tocoferolului in doze mari reduce riscul de cancer pulmonar – până la 53%. Se crede, de asemenea, că forma alfa este mai bună decât gama tocoferol pentru riscul de cancer de prostată – insa am îndoielile mele.

 Vitamina E este menținută într-o stare anti-oxidantă de Co-enzima Q-10 și, de asemenea, face sinergie cu seleniu și vitamina C.

 Dozele mari de vitamina E pot reduce semnificativ eficacitatea radiației împotriva celulelor canceroase și, prin urmare, nu este recomandata în timpul radioterapiei.

 Vitamina E crește activitatea citotoxică a 5-fluorouracilului, doxorubicinei și cisplatinei prin inducerea p53.

 Reduce mucozitatea.

 Vitamina E este adesea descrisă ca un diluant de sânge, dar rareori crește sângerarea în doze de până la 400 UI pe zi. Unii indivizi pot vedea o activare inexplicabilă a vitaminei K menaquinone MK-4, deci nu le amestecați.

Co-enzima Q-10 sau ubiquinonă este un antioxidant solubil în grăsimi, critic pentru producerea de energie celulară. Co-Q-10 transportă protoni și electroni în membrana interioară a mitocondriilor – camerele de ardere a zahărului-oxigenului din interiorul tuturor celulelor – pentru a ajuta la producerea de energie. Poate reactiva producția de energie bio-chimică ATP pentru repararea și vindecarea în celule, țesuturi și organe deteriorate.

 absorbția intestinală este slabă și poate limita eficacitatea; luați-l cu ulei sau grăsime ( ulei de măsline, in, ulei de pește).

 esențiala pentru producerea de imuno-globuline.

 menține vitamina E și tocoferolii și tocotrienolii înrudiți într-o stare anti-oxidantă.

 Co-Q-10 este absolut o necesitate pentru orice insuficiență a organelor, cum ar fi insuficiența cardiacă congestivă, insuficiența hepatică sau insuficiența renală, care poate fi declanșată de otrăvirea medicamentoasă prin chimioterapie.

 utilizați preventiv înainte, în timpul și după chimioterapie cu medicamente care dăunează inimii – de exemplu Herceptin sau antracilcine precum Adriamicina, Doxorubicina, Epirubicina.

 nu utilizați Co-Q-10 în timpul radioterapiei, deoarece reduce eficacitatea

. Co-Q-10- poate îmbunătăți supraviețuirea în mai multe tipuri de cancer; studii recente arată rate de regresie dramatice în cancerul de sân avansat – în combinație cu acid alfa lipoic, seleniu, vitaminele B1 ca benfotiamină, B3 ca nicotinamida, vitamina C, vitamina E, beta caroten, acizi grași esențiali 3-6-9 și magneziu.

 Co-Q-10 va restabili controlul mitocondrial asupra apoptozei, rezultând în uciderea dramatică a celulelor canceroase și eliminarea tumorilor.

 Inhibă puternic metastaza în melanom.

 Studii stiintifice sustin ca ajuta la eliminarea metastazelor hepatice și revărsărilor pleurale

Eu prescriu cel puțin 300 mg pe zi de ubiquinonă sau cel puțin 100 mg din noua formă de ubiquinol.

La doze de 600 până la 1.200 mg de ubiquinonă pot apărea probleme cu arsuri la stomac, dureri de cap si oboseala.

Acidul alfa lipoic sau acidul tioctic este un antioxidant tiol solubil în apă și grăsimi. Se numește anti-oxidant universal, deoarece funcționează atât în ​​membranele plasmatice ale celulelor grase, cât și în interiorul apos (citosol) al celulei. Este un inhibitor de 100 de ori mai puternic al radicalilor liberi de oxigen decât vitaminele E și C combinate. Protejează ADN-ul și energia mitocondriei prin reducerea inflamației celulare.

 crește activitatea glutationului. sprijină foarte mult detoxifierea de la droguri și otrăvuri.

 reduce fibroza prin refacerea unei izoenzime a factorului de creștere tranzitoriu (transformant) beta TGFβ responsabil pentru depunerea matricei de fibroblaste. Foarte important în restabilirea filtrării rinichilor.

 reciclează vitamina C și E. Inhibitor NFkB.

 blochează proteinele heat shock.

 îmbunătățește funcția insulinei și scade rezistența la insulină. esențiale pentru producerea de imunoglobuline.

 îmbunătățește producția de energie mitocondrială prin eliminarea stresului oxidativ.

 inhibă piruvatul dehidrogenază kinază (sinergică cu C0-Q10), reducând lactatul, crescând apoptoza.

 trateaza toate formele de neuropatie – de la medicamente chimioterapice, cum ar fi platinele sau diabetul.

 reduce angiogeneza prin chelarea cuprului.

 chelează și metalele grele.

 neuroprotector.

 permite omocisteinei toxice să se acumuleze în celulele canceroase.

 dozele mari pot declanșa glicemia scăzută (hipoglicemie) la pacienții sensibili.

 poate inhiba funcția tiroidiană prin limitarea activării T4 în T3.

R + este forma naturală. Din anumite motive, formele orale bune se numesc R-ALA, în timp ce formele intravenoase se numesc D-ALA. Dacă produsul nu spune R +, R- sau D-, dar spune DL- sau RL- atunci este sintetic, iar 50% este în formă L +. Forma L nu este doar inutilă, este toxică. Nu vă pierdeți timpul, banii și sănătatea cu produse care nu îndeplinesc acest standard de 100% în forma R (sau D).

Doza – 300 mg de două până la trei ori pe zi de R-ALA. Prefer de două ori pe zi, deoarece o doza mai mare dă mai multe probleme de hipoglicemie (glicemie scăzută).

Este excelent administrat intravenos de două ori pe săptămână.

Utilizați numai D-ALA, DL-ALA nu este bine tolerat sau efectiv.

Doza standard este de 150 mg D-ALA. Unii cresc până la 300 mg, dar acest lucru nu este cu adevărat necesar. Doza: 10 mL de 15 mg / mL D-ALA în 250 mL ser fiziologic.

Nu il amestecati cu nimic altceva pentru ca ALA este predispus la oxidare, polimerizare și desulfurare și este insolubil în apă.

Vă rugăm să utilizați numai acid injectabil D-alfa lipoic de calitate injectabilă provenit din Europa.

Continuați administrarea ALA orală de două ori pe zi, concomitent cu terapia IV.

D-ALA poate fi, de asemenea, nebulizat de 1-2 ori pe zi acasă.

R-ALA este extrem de sinergic cu extractul de semințe de struguri, care îl reciclează în starea sa activă. Este, de asemenea, extrem de sinergic cu dicoloroacetatul DCA și poate cu hidroxicitrat de Garcinia cambogia.

R-ALA este incompatibil cu artemisinina.

Sinergic cu curcumina în cancerele pulmonare.

Poly-MVA este un complex de paladiu-acid lipoic administrat oral 10-20 ml bid-tid și IV la 5-40 ml în soluție salină 100-250 ML sau D5W.

Gheata pisicii

Uncaria tomentosa sau Gheata pisicii este o viță de vie din Amazonia pe care triburile indigene o consideră o plantă sacră. Coaja interioară conține alcaloizi oxindoli pentaciclici și esteri carboxilalchilici care sunt antioxidanți și inhibitori remarcabil de puternici ai sintezei TNF-alfa.

Poate juca un rol important în tratarea pierderii în greutate din cașexie și anorexie.

Poate reduce efectele secundare ale radioterapiei și chimioterapiei – pacienții raportează mai puțină cădere a părului, greață, probleme ale pielii și infecții secundare.

Are steroizi și alcaloizi cu proprietăți antibiotice, antifungice, antivirale și antialergice – pe scurt, este modulant imun. Se spune că medicii tradiționali peruvieni îl folosesc pentru cancer și alte boli grave și, din 1960, este folosit în unele spitale din America de Sud pentru cancer, cu rapoarte neconfirmate de „rezultate consistente”. Un important medic specialist în plante medicinale James Duke raportează că o combina cu curcumina și Dracontium loretanum. Studiile in vitro arată 5 alcaloizi cu activitate împotriva celulelor limfomului și leucemiei.

Utilizați 1 ml de tinctură sau până la 2 grame de extract de trei ori pe zi. Personal, mi se pare puțin de folos. Mulți oameni îl folosesc deoarece cred că sistemul imunitar poate ataca și depăși cancerul – dar această plantă nu este specifică cancerului și are un impact redus.

Ashwagandha

Withania somnifera – Ashwagandha sau cireșul de iarnă este o plantă din tradiția ayurvedică hindusă. Gândiți-vă la acesta ca la echivalentul ginsengului din India de Est. Este un adaptogen, care ajută corpul să facă față stresului. Este o nervină ușor sedativă, antioxidantă, imunomodulantă, de sânge și întinerire. Ashwaganda previne pierderea funcției glandei suprarenale, a vitaminei C și a greutății corporale atunci când este sub stres. Este antiinflamator, prin inhibarea ciclooxigenazei. Este destul de netoxic chiar și în cazul utilizării pe termen lung.

Ashwagandha este un mare protector împotriva deteriorării celulelor sănătoase prin chimioterapie și radiații. Protejează în special măduva osoasă de daune și stimulează proliferarea celulelor stem pentru a înlocui celulele roșii din sânge, celulele albe din sânge și trombocitele. De asemenea, îmbunătățește eficacitatea terapeutică a radiațiilor împotriva celulelor canceroase reducand dramatic a glutationului tumoral.

Precauții:

 Poate crește testosteronul, deci nu este recomandat în cancerul de prostată.

 Contraindicat la pacienții cu hemacromatoză.

 Poate reduce toleranța la opiacee și analgezice narcotice.

 Poate potența sedativele precum benzodiazepinele și barbituricele.

Urzicile sau Urtica dioca sunt puternic antiinflamatorii deoarece blochează seria LOX-5 reducand nivelurile de leucotriene LTB4. Extractul de urzica suprimă semnificativ TNFα. Poate fi consumata proaspăt primăvară, între 40 și 60 de grame pe porție. Ca ceai, luați 3 până la 4 căni pe zi. Doza: 500 până la 850 mg extract de urzică de două ori pe zi, între mese.

DMSO

Di-metil sulfoxidul sau (CH3) 2SO este un solvent puternic, capabil să transporte molecule sub 1000 Kilo-Daltoni prin piele. Este util și ca purtător pentru a muta medicamentele prin membranele celulare. DMSO are proprietăți analgezice (vindecarea rănilor) și antiinflamatoare. Utilizarea intravenoasă este mai riscantă decât pe cale orală sau prin clismă.

Poate fi un adjuvant util în leucemie, cancer de uter și de col uterin. Modifică permeabilitatea membranei, crescând supraviețuirea în cancerele colorectale și gastrice.

Dozele orale de 500 mg de 4 ori pe zi sau administrarea intravenoasă au ca rezultat probleme imense de miros, o aromă destul de neplăcută de usturoi-stridie. Aceasta poate fi redusă prin administrarea concomitentă de uree, 10 până la 15 grame pe zi, în aproximativ 6 doze divizate.

DMSO poate provoca dureri de cap, amețeli, greață și sedare.

DMSO este, de asemenea, utilizat local, o concentrație de 60% timp de aproximativ 30 de minute.

Metil sulfonil metanul (MSM) sub formă de capsulă poate oferi multe beneficii similare și poate fi mai bun în cancerul de vezică.

Honokiol este un polifenol cu ​​molecule mici care se găsește în Magnolia. Este antiangiogen, antiinflamator, anti-viral și antitumoral. De asemenea, este ușor sedant.

Panax ginseng sau Ren Shen conține ginsenozide despre care se știe că sunt antineoplazice – citotoxice

 provoacă oprirea G1 similară cu proteina p53

 induce rediferențierea induce apoptoza.

 activează și modulează sistemul imunitar reticulo-endotelial

 activați transcrierea genei p21 și expresia proteinei p27.

 suprimă receptorii Bcl-2, caspaza 3, 5-alfa-reductază, androgeni, aderența celulelor, invazia și metastaza.

În mod tradițional, ginsengul este folosit ca tonic pentru digestie și oboseală la vârstnici și ca panaceu pentru longevitate. S-a dovedit că reduce glicemia crescând receptorii de insulină, reduce reacția la stres și îmbunătățește imunitatea. Se crede că îmbunătățește toleranța la durere, concentrarea mentală, memoria, vitalitatea fizică și apetitul.Stilul tradițional de utilizare este un ceai din rădăcină de ginseng. Aceasta este o băutură care încălzește și stimulează digestiv. Ginsengul singur sau cu lăptișor de matcă și alte plante este energizant și tonifiant pentru pacienții cu deficit de yang și chi. Ajuta digestia la vârstnici. În China, ginsengul este de obicei utilizat pentru tratamentul stomacului inflamat și a ulcerului stomacal.

Ginsengul poate fi sinergic cu vitamina C pentru leucemie – dar nu folosesc doze mari de vitamina C în leucemii.

Produsul natural brevetat Careseng este un extract îmbogățit cu 8% Rh2 și 75% ginsenoside legate de aglican, care sunt sinergice. Se spune că este foarte puternic și puternic sinergic cu compușii citotoxici, activând caspazele de execuție. Se susține că poate reduc rezistența la mai multe medicamente (gena MDR). Poate bloca angiogeneza si intrarea celulelor canceroase în faza de creștere G1, oprind creșterea tumorii.

O formă sintetică a acestor ginsenozide este dezvoltată ca medicament sub denumirea PBD-2131. Utilizați 10 – 50 ml în picături.

Poate provoca frisoane și dureri severe și prezintă un risc ridicat de reacții de anafilaxie.

În timp ce mulți dintre colegii mei îl folosesc, încă nu am fost convins că are vreo valoare. Este foarte scump, ajungând la mii de dolari pe lună pentru mulți pacienți. Am vorbit cu un medic din China care a făcut aceste perfuzii la pacienții cu cancer timp de 4 ani, fără a vedea răspunsuri semnificative.

AHCC – este un compus japonez cu greutate moleculară mică din shiitake fermentat și alte ciuperci medicinale cultivate în tărâțe de orez, care s-a dovedit că previne multe efecte secundare ale chimioterapiei și crește eficacitatea metotrexatului, 5-fluorouracilului și ciclofosfamidei atunci când utilizat la doze de 3 grame zilnic.

De asemenea, poate proteja împotriva daunelor provocate de radiații și reduce stresul în urma intervenției chirurgicale.

Este deosebit de util în protejarea pacienților care fac chimioterapie împotriva deteriorării măduvei osoase, prevenirea căderii părului și a demonstrat că poate reduce greața, vărsăturile, durerea și poate îmbunătăți pofta de mâncare în doză de 3 până la 6 grame pe zi.

Se zvonește că Cordyceps este contraindicat în cazurile de cancer hormonodependent, dar nu inteleg de ce.

Ciupercile Chaga cultivate pe mesteacăn convertesc betulina din scoarță în acid betulinic. JHS Naturals are un bun extract de Chaga. Ciupercile Chaga inhibă comunicarea intercelulară joncțională gap prin inactivarea kinazei MAP ERK1 / 2 și p38

Shiitake lentinan corectează rezistența cancerului ovarian la cisplatină sau 5-FU. La unele persoane sensibile ciupercile shiitake crude sau insuficient gătite pot provoca o dermatită toxică.

Extractele Coriolus versicolor PSP și PSK sunt extracte din micelii fungici si contine cea mai mare cantitate de beta-glucani dintre toate ciupercile. Sunt imunomodulatori dovediți prin inhibarea citokinelor IL-8 și TNFα. Coriolus PSK stimulează celulele NK și limfocitele.

Studiile cu 1.500 mg de două ori pe zi au arătat o supraviețuire crescută la pacienții supuși chimioterapiei cu cisplatină pentru multe tipuri de cancer.

Coriolus induce apoptoza în celulele leucemice, crescând IL-6 și IL-1β, reducând în același timp IL-8. Această ciupercă este foarte utilă în chimioterapie și radiații.coriolus versicolor

Ciupercile Reishi sau Ganoderma lucidum sau ling zhi conțin triterpene citotoxice care au dovedit ca inhiba sinteza ADN prin ADN polimeraza beta. Reishi este de ajutor în cașexie, deoarece reduce TNFα.

Aceasta influențează, de asemenea, apoptoza și reduce rezistența la chimio. Reishi echilibrează citokinele inflamatorii Th1 și Th2 și interferonul gamma IFNγ. Reishi reduce IL-3 și IL-4. Extractele Reishi cresc numărul de limfocite IL-2, IL-6, CD3, CD4, CD56 și CD + și reactivitatea mitogenă la fitohemaglutinină. Extractele inhibă factorii de transcripție NFkB și AP-1, care la rândul lor inhibă uPA-activatorul plasminogen uro-kinazic și receptorul său uPAR.

Extractul Reishi suprimă aderența celulară și migrația celulară, reducând metastazele în cancerele de sân și de prostată. Reishi este un adaptogen și este foarte sinergic cu ginseng și coriolus. Am fost foarte inspirat de Dr. Steven Aung, MD, care folosește reishi sălbatic și reishi formulat cu polen, perlă, Gynostemma pentaphylla, Coriolus versicolor sau ginseng Panax.

Rădăcina de struguri din Oregon – Berberis sau Mahonia aquifolium conține alcaloidul berberină care are o utilizare îndelungată în tradițiile chinezești și în alte tradiții medicale ca antimicrobian și antiinflamator cu spectru larg. Alte ierburi care conțin acest alcaloid sunt Coptis chinensis sau fir auriu, andrografite, berberis Berberis vulgaris și Hydrastis canadensis. Aceste ierburi „reci” răcesc inflamația, inclusiv rănirea prin radiații. toate sunt utilizate pentru infecții, inclusiv paraziți. Berberina este un anti-biotic natural, imuno-stimulant și crește numărul de leucocite. NU o luati in perioada transplantului de celule stem.

 berberina este un alcaloid izotochinolic citotoxic pe bază de plante care otrăvește topoizomerazele ADN I și II. Profilul său farmacologic este foarte similar cu medicamentul natural Camptothecin, care este acum utilizat pentru o varietate de tipuri de cancer. Berberina induce apoptoza în cancerele cerebrale, leucemiile și carcinoamele. Reduce migrația și metastaza cancerelor de hepatom (ficat).

 berberina este un excelent eliminator de radicali liberi al oxigenului singlet și al radicalului anionic superoxid.

 berberina este anti-mutagenă prin modularea transcrierii ADN-ului.

 scade nivelurile moleculei de aderență ICAM-1 și transformă factorul de creștere beta TGF-β1.

 berberina inhibă semnificativ expresia antigenelor de activare pe limfocitele T și blochează, de asemenea, progresia ciclurilor celulare ale limfocitelor, sugerând că este imunosupresivă. reduce rezistența la insulină în același timp cu Metformin și nu provoacă hipoglicemie

. Reduce cardiomiopatia din chimioterapia cu doxorubicină.

 Doza: 500 mg de două până la trei ori pe zi, in functie de toleranță intestinală

Silybum marianum sau armurariu este cel mai blând și mai eficient vindecător al ficatului. Principiile active includ silbinina și silimarina. Silibinina este un polifenol format din quercitină legată de un lignan.Foarte hepatoprotector împotriva deteriorărilor chimice, de aceea este recomandat pentru orice pacient supus chimioterapiei.

Nu va diminua eficacitatea acestora.

Va sprijini funcția hepatică în cazul în care exista metastaze hepatice sau un cancer primar al ficatului.

Crește fluxul biliar și ajută ficatul să conserve glutationul.

 dozele standard cresc glutationul hepatic GSH cu aproximativ 35%, crescând în același timp GSH-S-transferaza din ficatul și intestinul subțire de 6 până la 7 ori.

 induce Cip-1 / p21 și Kip-1 / p27. inhibă factorii de necroză tumorală – grupul TNF.

 inhibă direct producția de IL-1a și IL-1b, care mediază răspunsul pro-inflamator în fază acută, inclusiv activarea celulelor imune T și B.

 inhibă IL-6.

 inhibă puternic factorul de creștere epidermic EGF și receptorul acestuia EGFR, un factor de creștere în toate tipurile de carcinom.

 inhibă kinazele ciclin-dependente ciclina-D1, CDK-2 și CDK-4.

 silibinina inhibă creșterea celulelor canceroase cu 48% și induce apoptoza să crească cu un factor de 2,5

. reduce semnificativ proteina kinază activată cu fosfo-mitogen / proteina kinază extracelulară reglată cu semnal 1/2 (MAPK / ERK1 / 2) pentru a inhiba creșterea. Reglează în sus proteina kinază activată prin stres / jun NH (2) kinază terminală (SAPK / JNK1 / 2) și activarea proteinei kinazei activate cu mitogen (p38 MAPK). inhibă factorul angiogen VEGF.

 inhibă factorul de creștere a fibroblastelor FGF. inhibă receptorul IGFR al factorului de creștere asemănător insulinei.

 încetinește creșterea cancerului de prostată, colorectal, ficat și piele.

Graviola / Asimina triloba (L.) Dunal cunoscuta ca paw paw are compuși de acetogenină anonacee mult mai puternici decât Annona muricata L. cunoscuta ca graviola sau soursop.În 1976, Institutul Național al Cancerului a descoperit că acetogeninele sunt citotoxice pentru celulele canceroase. Cele mai puternice acetogenine au inele bis-tetrahidrofuran adiacente (THF), de ex. bullatacin. Mecanismul citotoxicității are legatura cu inhibarea transportului de electroni mitocondrial complex I, reducand nivelul de energie ATP. În celulele tumorale, ele inhibă, de asemenea, NADH oxidaza membranelor plasmatice care cu reducerea energiei împiedică mecanismele de rezistență dependente de energie.Acetogeninele sunt deosebit de eficiente împotriva celulelor canceroase MDR în care rezistența la medicament se datorează pompelor de eflux dependente de ATP în membrana plasmatică (28-31). Acetogeninele scad funcția glicoproteină P-170 și cresc acumularea intracelulară de agenți anticanceroși.

Experiența mea cu graviola indică faptul că este buna împotriva cancerului, dar poate provoca adesea tulburări gastrointestinale severe, în special emeză și diaree.

Există dovezi că creează leziuni asemănătoare Parkinson în creier! Utilizați cu prudență.

Se preferă extractul standardizat de paw paw, deoarece are puțini acetogeni neurotoxici.

Dozele de extract de 12,5 mg de 4 ori pe zi cu alimente sunt bine tolerate.susținătorii susțin că este imunitar, antibacterian, antiviral, antiparazitar și tonifiant.

Doza uzuală este de 2 până la 5 grame de două ori pe zi din frunza sub formă de pulbere, 1 până la 3 ml de două ori pe zi dintr-o tinctură de 4: 1 sau ½ cană de 1 până la 3 ori pe zi cu un ceai de frunză sau scoarță.

Vechiul copac Ginkgo biloba a supraviețuit din timpul dinozaurilor. Este un tonic extraordinar pentru memorie și circulație periferică. În cancer îl folosim pentru neuropatie periferică. Deoarece interacționează cu Cyp 3A4 intestinal, nu este utilizat în timpul chimioterapiei. A fost studiat ca un protector împotriva cancerului ovarian.

Dozele de extract de 12,5 mg de 4 ori pe zi cu alimente sunt bine tolerate.

Aloe Vera

Această planta suculentă are în frunza sa polizaharide acemannan care stimulează imunitatea, stimulează timusul, cresc citotoxicitatea dependentă de anticorpi și inhibă angiogeneza. Aloe emodina este anti-metastatică. Aloe reduce PGE-2, inhibă kininele, histamina și agregarea plachetară.Extractul de Aloe vera are antioxidanți puternici care măresc catalaza, glutationul GSH și superoxid dismutaza SOD. Acest lucru îl face deosebit de valoros în reducerea peroxidării lipidelor în timpul radioterapiei. Folosiți-l pe piele (dar nu folosiți niciodată uleiuri sau vreo cremă pe bază de ulei!) Pentru a trata arsurile provocate de radiații.Rădăcina de aloe, în special din pelerina sud-africană, are o lungă istorie de utilizare ca vindecător al ulcerațiilor și inflamațiilor gastro-intestinale GI și ameliorează constipația.Am avut o serie de răspunsuri foarte dramatice la o formulă laxativă veche numită # 42 la pacienții cu dureri mari și dependenți de morfină care au devenit constipat morbid, fără pofta de mâncare și se simt grav bolnavi. # 42 sunt fabricate din două părți de pelin dulce Artemesia vulgaris sau Artemesia annua si pe o parte pulbere de rădăcină de Aloe Capoe Aloe capensis. Doza uzuală este de 2 capsule de 3 ori pe zi sau după cum este necesar. Este remarcabil cât de puțină durere au oamenii după ce se mișcă intestinele și cum își revine întreaga sănătate. Odată ce intestinele se mișcă și durerea scade, acestia pot reduce analgezicele narcotice. Întrerupe un ciclu vicios de paralizie intestinală, toxine intestinale din constipație, durere crescută și mai multe medicamente. Această mică bijuterie pe bază de plante a salvat un număr de pacienți de moarte prematură sau moarte fără conștientizare din cauza faptului că a fost „înzăpezit” mental de opiacee.

Avemar și Metaprol Pro sunt extracte fermentate din germeni de grâu cu eficacitate documentată in îmbunătățirea calității vieții și a supraviețuirii, cu chimioterapie și nu numai. Fermentarea germenilor de grâu produce flavonele naturale 2,6-dimetoxi-p-benzoquinonă (2,6-DMBQ), un regulator redox care protejează metabolismul glucozei celulelor canceroase. Împiedică creșterea celulelor canceroase, crește apoptoza, inhibă metastazele și are efecte imunomodulatoare. De asemenea, este un inhibitor ușor de poli (ADP-riboză) polimerază (PARP) – celulele canceroase mutante folosesc această enzimă pentru a repara daunele ADN cauzate de chimio și radiații. Alți inhibitori de PARP includ vinul roșu, cafeaua, niacina și acidul R-alfa lipoic.

CASEXIA/ANOREXIA

Cachexia este legata de pierderea in greutate a corpului declanșată de modificările metabolice ale cancerului. Este mult mai mult decât simpla pierdere a poftei de mâncare (anorexie) și a puterii digestive. Este o schimbare critică într-un dezechilibru chimic în care organismul se consumă pentru a alimenta tumoarea cu azot, citrat și alte elemente. Apare foarte devreme, deoarece chiar și tumorile foarte mici deviază resursele de la grăsimea și țesutul muscular îndepărtat. Este o cauză de mare suferință, slăbiciune și îi răpește persoanei bolnave demnitatea. Este adesea gestionabil, ceea ce poate preveni moartea și suferința prematură.Pierderea involuntară de 5% din masa corporală în ultimele 3 luni sau o schimbare de 10% în greutate în ultimele 6 luni este un indicator cu risc negativ ridicat. O pierdere de 20% este o condiție critică.Cachexia este un răspuns la stresul oxidativ copleșitor. Produsele tumorale, cum ar fi factorul mobilizator de lipide LMF, stimulează direct lipoliza (arderea grăsimilor) într-un sistem dependent de AMPc. Proteina IMPL2 poate fi eliberată de tumori, blocând răspunsul insulinei în tot corpul, reducând importul de zahăr și declanșând consumul de grasimi si pierderea muschilor. Aceste substante sunt deviate către tumori pentru a face componentele din care pot fi construite noi celule. NFkB activează un sindrom inflamator specific în fibrele musculare scheletice, care la rândul său inițiază catabolismul mușchilor scheletici. Factorul PIF care induce proteoliza implică activarea NFκB și a activatorului de transcripție a proteinei de fază acută STAT-3. Cașexia este, de asemenea, declanșată de factori imuni ai gazdei, cum ar fi citokinele IL-1, IL-1B, IL-6, INF-gamma, TNF-alfa. TNF și reglează în sus acumularea de zinc mediată de ZIP14 în mușchi, inducând pierderea lanțului greu de miozină.Factorul de necroză tumorală alfa TNFα produs de macrofage, limfocite și celule NK, se mai numește cahectin, deoarece provoacă anorexie și scăderea în greutate, prin centrul de sațietate hipotalamică din creier și prin inhibarea golirii gastrice. Crește absorbția glucozei, rezistența la insulină, catabolismul proteinelor în mușchii scheletici, epuizează depozitele de grăsime și este asociată cu oboseală și modificări ale simțului gustului. TNF induce, de asemenea, specii reactive de oxigen, care sunt implicate în epuizarea țesuturilor.

TNF poate fi inhibat într-un mod semnificativ clinic de doze adecvate de curcumină, ceai verde epigalocatechine EGCG, acid eicosapentanoic ulei de omega 3 EPA.

Cașexia la pacienții cu cancer răspunde în mod constant la suplimentele EPA cu acid eicosapentanoic, cum ar fi uleiul de pește sau uleiul de focă. Uleiul Omega 3 va îmbunătăți calitatea vieții, pofta de mâncare și creșterea în greutate. EPA este cel mai eficient supliment pentru gestionarea pierderii în greutate luand cel puțin 2 grame EPA pe zi. Eu prescriu ulei de focă harpă, 2+ capsule de două ori pe zi. Există câteva uleiuri de pește distilate din sardine și hamsii, care sunt de o calitate acceptabilă, iar uleiul de krill poate acționa similar. Colegii americani recomandă ulei de cocos extravirgin pentru trigliceride cu lanț mediu și făină de cocos sau lapte de cocos.

Oferiți, de asemenea, melatonină, vitamina E sau vitamina E succinat VES și produsele botanice Uncaria tomentosa – gheară de pisică și Silybum marianum – ciulin de lapte.

Lăptișorul de matcă cu ginseng este un tonic general nutritiv plăcut și eficient pentru qi și sânge, întărește și revigorează bolnavul de oboseală.

Cele mai bune rezultate se văd atunci când sunt combinate cu ciuperca ganoderma (reishi). Acestea pot restabili apetitul, absorbția nutrienților și a medicamentelor și greutatea corporală.

Arsenicum iodatum homeopatic este util în cașexie.

Phytolacca ajută la emaciație și epuizare rapidă. Colegii mei folosesc aminoacizi cu lanț ramificat, magneziu, colostru, supa de oase (cu maduva), ulei de ficat de cod fermentat, L-glutamină și L-carnitină. L-carnitina inhibă inflamația și cașexia în cazurile de cancer pancreatic.

Pentru apetit și creștere în greutate se poate da extractul de iarbă de secară activată Oralmat, 3 picături sublingual de trei ori pe zi.

Dr. David Baker, MD, era medic de familie în Victoria, care lucrează acum în primul rând cu pacienți cu SIDA, la nivel local și în Africa. David a dezvoltat un remediu eficient pentru cașexie la pacienții cu SIDA care contine inclusiv anti-oxidanții acid R-alfa lipoic, extractul de semințe de struguri, vitamina C, semințe de dovleac și nuci de Brazilia.

Progesteronul este folosit in stimularea apetitului și al bunăstării subiective. Megace este prescris în mod obișnuit. Se presupune că scade sinteza și eliberarea citokinelor. Crește greutatea corporală, dar, din păcate, aceasta este doar reținerea apei, nu o schimbare a masei corporale slabe. Terapia cu progesteron poate duce la cheaguri de sânge precum tromboza venoasă profundă, precum și probleme menstruale și disfuncții sexuale. Nu este clar dacă terapia cu progesteron nu va stimula tumorile mamare PR +.

Talidomida a demonstrat unele beneficii potențiale asupra poftei de mâncare, greață și bunăstare. Alte medicamente studiate sunt Ibuprofenul la 50 mg de două ori pe zi pentru a reduce proteina C reactivă;

pentifilină I.V. pentru a reduce TNFα; și inhibitorii COX-2 celecoxib sau rofecoxib pentru a modula prostaglandinele implicate în cașexie, precum și în dezvoltarea cancerului. Există mulți inhibitori naturali ai COX-2.

Corticosteroizii sunt utilizați pentru a inhiba prostaglandinele și pentru a suprima producția de TNF. Rezultatele privind apetitul, aportul alimentar și calitatea vieții sunt de scurtă durată și există riscuri semnificative de efecte adverse.

Steroizii sunt cel mai bine rezervați pentru paliația finală. Doza: 4 până la 8 mg zilnic de Dexametazonă.

Medicamentul sulfat de hidrazină a fost dezvoltat de Dr. Joseph Gold, MD, pentru a opri procesul cachexic. A fost prima chimioterapie non-toxică dezvoltată, provocând doar greață și slăbiciune a membrelor în unele cazuri. Este foarte ieftin. Inhibă gluconeogeneza, încetinește sau oprește creșterea tumorii și produce îmbunătățiri semnificative ale simptomelor subiective în cel puțin jumătate din cazurile terminale – cu alte cuvinte, pacienții se simt mai bine, au mai puțină durere, mai multă energie și apetit crescut. În ciuda studiilor puternice din America și Rusia, instituțiile de cancer precum Institutul Național al Cancerului și Societatea Americană a Cancerului au blocat sistematic eforturile de cercetare și au marginalizat acest medicament. Se stie ca sulfat de hidrazină necesită multe restricții dietetice, deoarece interacționează cu mulți alți inhibitori de monoamină oxidază din alimentele și medicamentele obișnuite.

Cred că omega 3 EPA, L-carnitina și melatonina sunt alegeri mult mai bune.

Dieteticienii recomanda o dietă cu un aport zilnic de 1,4 până la 1,5 g de proteine ​​pe kilogram de greutate corporală și 30-35 de calorii zilnic pe kilogram de greutate corporală pentru un pacient oncologic în stadiul IV intrat in casexie

ceai verde

Ceaiul verde și extractele sale sunt incluse în substanțele botanice, mai degrabă decât ca băutură alimentară, deoarece dozele terapeutice eficiente depășesc cu mult ceea ce este posibil prin consumul de ceai. Este un fito-nutraceutic.Frunzele din ceaiul verde nefermentat Camellia sinensis este o sursă de polifenoli, cum ar fi epigalocatechin-3-gallat EGCG, epigallocatechin EGC și epicatechin-3-gallat ECG. EGCG este un antioxidant de 200 de ori mai puternic decât vitamina E si este principalul candidat pentru cel mai activ principiu medical din extractul de ceai verde.Multe studii epidemiologice la scară largă arată o valoare preventivă semnificativă în ceaiul verde ca băutură zilnică, în special la aporturile de 5 până la 10 căni de ceai pe zi. Cu toate acestea, este mult lichid și prea multă cofeină pentru mulți oameni. Ceaiul negru variază până la 80 mg de cofeină pe ceașcă, iar ceaiul verde este mai mic, dar totuși produce cel puțin 10 mg pe ceașcă și poate ajunge la 40 mg pe ceașcă. Alți alcaloizi de stimulare din frunza de ceai sunt teobromina și teofilina.Extractele standardizate încapsulate, cu conținut scăzut de cofeină, sunt necesare pentru a atinge dozele necesare pentru a utiliza EGCG și polifemoli înrudiți ca terapie împotriva cancerului. Ceaiul verde EGCG este o terapie de bază în protocoalele mele din 1996. Efectele largi și puternice ale ceaiului verde asupra cancerului sunt cu adevărat remarcabile:· inhibă multe tipuri de cancer prin blocarea celulelor în faza G0-G1 și oprirea celulelor în faza G2-M a ciclului celular. Acest lucru este reglementat prin efectele sale asupra proteinelor genei p21 și p27.· inducerea apoptozei este dependentă de doză. Induce apoptoza în celulele canceroase prin proteina anti-apoptotică bcl-2 care reglează în jos, Bax pro-apoptotic care reglează în sus și activarea caspazelor 3, 7 și 9.· îmbunătățește expresia p53 de tip sălbatic.· inhibă expresia oncogenă, inclusiv Kirsten-ras sau K-ras care reglează tirozin kinazele.reduce expresia genei de rezistență multi-medicament mdr-1.· inhibă activarea protein kinazei C de către promotorii tumorali. Inhibarea proteazei reduce proliferarea celulară, angiogeneza, producția inflamatorie de citokine și crește apoptoza.· inhibă dihidrofolatul reductază, reducând sinteza proteinelor celulelor canceroase și a acizilor nucleici.· inhibă receptorul de hidrocarburi arii prin legarea proteinei HSP90 a chaperonei receptorului, crescând rezistența la cancerul de sân. Sinergic cu quercitina în reglarea acestui receptor. Prin suprimarea transformării receptorului de hidrocarbură arii, acesta protejează împotriva agenților cancerigeni xenobiotici, cum ar fi dioxinele. Ceaiul verde EGCG ajută, de asemenea, la detoxifierea din solvenți cancerigeni, cum ar fi benzenul.· inhibă NFκB, controlând inflamația, apoptoza și degradarea proteinelor.· reglează calikreinele umane, active în cancerul de prostată.· anti-angiogen, inhibă puternic inducția VEGF a factorului de creștere endotelial vascular prin IGF-1 și, astfel, supraexprimarea VEGF.· inhibă IGF-1, crește IGF-BP-3, poate bloca hormonul de creștere uman HGH sau receptorii acestuia.· ceai verde pro-oxidant EGCG poate crește stresul de peroxid de hidrogen H2O2 asupra ADN-ului. Prin urmare, dați tocoferol amestecat vitamina E pentru a echilibra.· EGCG este un inhibitor major al proteazomului, modulând multe proteine ​​reglatoare. De exemplu, EGCG inhibă în mod specific enzimele multi-catalitice ducând la acumularea de p27 / Kip1 și IkBα, un nhibitor al NFκB. Aceasta oprește celula la G1 și elimină protecția împotriva apoptozei prin inhibarea AP-1 prin fosforilarea inhibată a c-jun.inhibă ciclina D1 și ciclina E.· inhibă tNOX în celulele canceroase, dar nu și în celulele sănătoase. tNOX este o enzimă de suprafață care reglează creșterea.· anti-cașexic, fenolul catehină primară inhibă TNF alfa.· promovează diferențierea prin modularea factorului de creștere transformant beta doi -TGFβ-II.· polifenolii din ceai sunt inhibitori ai matricei proteazei MMP-2 și MMP-9, care controlează răspândirea tumorii.· inhibă topoizomeraza I, o enzimă care joacă un rol critic în metabolismul și structura ADN-ului, făcându-l esențial pentru supraviețuirea celulelor tumorale. Medicamentele eficiente care inhibă această enzimă sunt limitate de toxicitate. Inhibitorii topoisomerazei nu se amestecă cu compușii glucozaminici.· inhibă 5-alfa-reductaza, reducând nivelul de testosteron. Inhibă ornitina decarboxilaza în prostată.· EGCG inhibă urokinaza uPA, o enzimă implicată în invazia tumorii și metastaza, prin descompunerea joncțiunilor celulare ale membranei bazale. uPA este supra-exprimată în majoritatea cancerelor.· crește Xantina oxidaza XO, care inhibă ADN-ul adenozin deaminazei, scăzând rotația ADN-ului în celulele canceroase.· catechinele din ceaiul verde transferă rapid electroni sau hidrogen din siturile de deteriorare a ROS pe ADN, prevenind dezvoltarea rupturilor de catenă. Foarte activ împotriva peroxidului de hidrogen, deci nu utilizați în timpul tratamentului cu vitamina C IV.· polifenolii din ceaiul verde reduc daunele ADN cauzate de radiațiile ultraviolete UV-A și UV-B, reducând inflamația, eritemul și hiperproliferarea celulelor pielii. Astfel, previne cancerul de piele și va reduce creșterea tumorilor stabilite în piele.· va epuiza gama tocoferolului vitamina E, în special în rinichi și ficat.· EGCG inhibă telomeraza.· efectele imune includ creșterea puternică a activității celulelor B, creșterea IL-1α și IL-1β de la monocite, creșterea activității limfocitelor T citotoxice și a NK, iodarea PMN și a monocitelor.· reduce riscul de reapariție a cancerului cu 50% în cancerul de sân post-operațional I și II.· s-a demonstrat că inhibă cancerele de sân, colon, prostată, plămâni, esofag, stomac, pancreas, vezică urinară și melanom.· unicul aminoacid teanină crește absorbția de Adriamicină de către tumori, crescând semnificativ eficacitatea.· sinergic cu curcumina, extract din semințe de struguri, extract de reishi și quercitină.· incompatibil cu terapia intravenoasă cu vitamina C. IVC curăță sângele într-un timp foarte scurt, deci nu utilizați ceai verde concentrat în ziua picurării de vitamina C.· nu există interacțiuni medicamentoase cunoscute. Modifică foarte slab activitatea CYP3A4 la om, la doze mari.Frunza de ceai conține 8 până la 12% antioxidanți polifenoli și 1 până la 4% cofeină. O ceașcă de ceai verde preparat produce 10 până la 40 mg cofeină. Pentru terapie, ar trebui să beți zilnic zeci de căni. Se prepară un ceai mai bun folosind apă la o temperatură sub fierbere. O infuzie rece peste noapte de două linguri de ceai verde într-un litru de apă la temperatura camerei este, de asemenea, bună pentru uz medicinal, dacă aportul de cofeină este tolerabil.Ceaiul verde este un remediu excelent pentru tratarea cancerul primar. Previne cancerul prin inhibarea ADN metiltransferazelor (DNMT), reglând metilarea epigenetică.Eu prescriu un extract de polifenol 95% din ceai verde. – cel puțin 3 din capsule de 700 mg zilnic, de obicei 2 la micul dejun și 1 la cină.Polifenolii de ceai verde absorb mai bine dacă sunt luați cu bioperină din piper negru sau cu acid tartric, așa cum se găsește în struguri, vin, banane și tamarind. Acidul tartric este un derivat dihidroxi natural al acidului succininic.

Uneori s-a observat o epuizare a depozitelor de vitamina E va apărea în urma terapiei cu ceai verde și ar cauza leziuni la rinichi și pierderea filtrării dacă nu este verificată. Luați întotdeauna 400 UI zilnic de tocoferol mixt vitamina E care conține cel puțin 10% gamma tocoferol când luați doze mari de medicamente EGCG. Pentru a vă proteja rinichii și ficatul trebuie să aveți zilnic gamma tocoferol, nu doar alfa tocoferol! Acest lucru se aplică chiar dacă luați un medicament care diluează sângele, cum ar fi warfarina (Coumadin).

Extractul de ceai verde nu dăunează ficatului, ci extractele cu solvenți răi.Doza mare de EGCG (peste 1.000 mg) poate acționa ca un pro-oxidant, creând stres oxidativ în celulele canceroase. Acest lucru poate fi util în unele regimuri de chimioterapie.

Ceaiul verde nu are nicio activitate aparentă asupra Cyp1A2, Cyp2D6, Cyp12D6 și Cyp12C9 și poate produce o inhibare ușoară a Cyp3A4, deși un studiu spune că nu există niciun efect al catechinelor de ceai verde asupra Cyp3A4. Unele dovezi preclinice sugerează posibila inhibare a Cyp1A1, 2B1, 17 și 2E1, care sunt de mică relevanță clinică în chimioterapie. Încă nu dau concentrate de ceai verde în timpul chimio, dar unii dintre colegii mei o fac. În cazuri foarte rare, extractul de ceai verde poate provoca leziuni hepatice care duc la greață, vărsături, dureri abdominale, îngălbenirea pielii / ochilor, urină închisă la culoare, transpirație, oboseală neobișnuită și / sau pierderea poftei de mâncare. Luați cu alimente pentru a reduce acest risc.

Usturoi

Efectele benefice ale usturoiului sunt cunoscute de secole, iar înțelegerea mecanismelor moleculare care stau la baza acestor efecte este în continuă creștere. Aici, arătăm că un extract de usturoi de casă are activități anti-cancer atât in vitro, cât și in vivo, și că activitatea este stabilă mai mult de șase luni dacă este depozitată într-un congelator. În acord cu mai multe studii recente, datele noastre susțin un mecanism prin care OSC-urile din GE declanșează apoptoza, prin stres ER și efecte asupra reglării redox celulare. Cu toate acestea, mecanismele moleculare ale efectelor anticanceroase mediate de usturoi sunt extrem de complexe și probabil diferite în diferite celule canceroase. Extract de usturoi de casă Extractul nostru de usturoi (GE) a fost facut din 350 g căței de usturoi zdrobiti (pentru a activa alinaza) si 250 ml etanol 40%. Pentru a obtine amestecul, am folosit un blender. Acest amestec brut de usturoi-etanol a fost pus într-un borcan de sticlă cu capacul inchis ermetic și depozitat în întuneric la 4 ° C timp de 5 zile. Lichidul a fost apoi stors printr-o cârpă sau ciorap de nylon. Masa uscată a fost aruncată, în timp ce soluția a fost pusa în tuburi de centrifugă de 50 ml și centrifugată la 5000 rpm timp de 10 minute. Lichidul decantat a fost colectat și depozitat la -20 ° C. Extractul conținea ~ 22% etanol (măsurat utilizând setul de concentrație de etanol enzimatic Megazyme).

Fragmente traduse din Naturopathic Oncology despre suport in chimio si radioterapii

Suplimente in timpul radioterapie

Luați în timpul radioterapiei și timp de o lună după ultima doză de radiație urmatoarele suplimente:Cu o săptămână înainte de radioterapie: pre-tratați cu anti-angiogenice, inclusiv ceai verde EGCG și Can-Arrest.

Opriți aceste medicamente când începe radiația.

Acordați, de asemenea, o săptămână pre-tratament cu alglicerol și pe tot parcursul radiației, în special dacă este la nivelul creierului sau dacă sunt expuse oasele măduvei.

În timpul radioterapiei:

Extract de curcumină din tumeric pentru a controla inflamația și a favoriza oxigenarea tumorii. TheraCumin „2X 120 mg ”o dată sau de două ori pe zi. Nu lăsați eticheta sa ca „antioxidant” să vă dezamăgească, este sigur.

Uleiurile omega 3 sursă marină 3.000-4.000 mg sunt, de asemenea, antiinflamatoare sigure de utilizat cu radioterapie.

Melatonina – Îmbunătățește ratele de remisie, supraviețuirea la 1 an și reduce efectele adverse. Luați numai la culcare, până la toleranță, până la MINIM 20 mg. Melatonina este numită anti-oxidant, dar la fel ca vitamina C, poate fi și pro-oxidant.

Fara zahar! Urmăriți scrupulos planul de dietăcu indic glicemic redus. Acest lucru face o mare diferență.

Vin roșu – un pahar pe zi va reduce deteriorarea pielii în timpul radiațiilor, fără a reduce eficacitatea.

Polizaharide de ciuperci – extract de apă fierbinte de ciuperci Reishi, Rx 2 până la 3 capsule de două ori pe zi.

Niacinamida 500 până la 1.000 mg de până la 3 ori pe zi la mese. Niacinamida ajută prin creșterea fluxului sanguin tumoral.

Berberina reduce anorexia, greața și oboseala la cei supuși radiațiilor intestinale și pelvine. Protejează vezica și intestinul de leziuni. Doza uzuală este de 300-500 mg de 2 până la 3 ori pe zi sau pentru toleranța intestinului.

Citratul de zinc 25 mg la fiecare masă reduce dermatita și mucozita, stimulează funcția imunitară, îmbunătățește repararea și vindecarea țesuturilor, îmbunătățind în același timp controlul local al cancerului.

Obligatoriu pentru radiații la cap și gât.

Calendula(GALBENELE) – Pentru dureri în gât și probleme de înghițire cu radiații în cap și gât, sorbiți ceai de Calendula officinalis (floare de gălbenele) sau tinctură diluată.

Pachete de argilă – Aplicați o pastă subțire pe pielea iradiată neîntreruptă 45 de minute, apoi faceți duș.

Ashwagandha Withania somnifera pentru a face celulele tumorale mai sensibile la radiații, dar protejează celulele sănătoase! Rx – 2 capsule sau 1 picurător de tinctură de 3 ori pe zi, la mese. Acest adaptogen sau modulator de stres reduce adrenalina, ceea ce crește numărul de celule canceroase care aruncă întrerupătorul (apoptoza). De asemenea, este un modulator imun, protejând sistemul imunitar de colaps în timpul radioterapiei. Ashwagandha poate crește DHEA, deci nu este bun pe termen lung în cazurile de cancer dependente de hormoni. În astfel de cazuri, luați în considerare adaptogenii asociați:

 Rhodiola Rhodiola rosea îmbunătățește somnul, cunoașterea și eficacitatea radioterapiei împotriva cancerului.  Ginsengul siberian Eleutherococcus senticosus este, de asemenea, un bun radio-protector recomandat de Keith Block, la 500 mg pe zi. Controlează peroxidarea lipidelor și deteriorarea ADN-ului. Ajută cu adevărat la oboseală cu uleiuri omega 3.

 Notoginseng-Panax pseudoginseng îmbunătățește distrugerea celulelor canceroase prin radioterapie.

În ciuda eforturilor noastre de a preveni problemele, oamenii sunt răniți de radiații. Majoritatea problemelor vor fi bine abordate de către medicii și asistenții oncologici. Cu toate acestea, substantele naturale pot fi mai puțin costisitoare și mult mai eficiente.

ANEMIA – leziunile măduvei osoase durează de 1 până la 3 săptămâni după administrarea unei doze toxice de chimio-medicament insa pot evolua până la eșecul complet de a produce oricare dintre tipurile de celule sanguine. Dacă măduva nu mai produce globule roșii, pacientul devine anemic. Lipsa celulelor roșii înseamnă insuficiența hemoglobinei pentru a transporta oxigenul în țesuturi și dioxidul de carbon înapoi în plămâni pentru a fi expirat ca deșeu. Medicul dumneavoastră vă poate comanda transfuzii de sânge dacă hemoglobina scade sub 90.

Folosiți fierul cu precauție, deoarece este foarte oxidant, producând ROS care dăunează ADN-ului. Este mai sigur să verificați starea fierului măsurând feritina serică înainte de a lua fier.

Vitamina B-12 administrată prin injecție intramusculară poate declanșa producția de celule sanguine.

Ajutati-va măduva osoasă cu ulei de ficat de rechin alchilgliceroli 1-2 capsule de trei ori pe zi și supă din oase de măduvă.

Shih Chuan Da Bu Wan sau Shiquan 8 pelete de trei ori pe zi este genial.

Marrow Plus de la Health Concerns 3 – 4 capsule de trei ori pe zi, Panax ginseng 500 – 1000 mg. de doua ori pe zi. AHCC (compus activ corelat cu hexoză) este un compus japonez cu greutate moleculară mică din shiitake fermentat și alte ciuperci medicinale cultivate în tărâțe de orez, care s-a dovedit că previne multe efecte secundare chimio și crește eficacitatea metotrexatului, 5-fluorouracilului și ciclofosfamidei. Doza este de 3 grame zilnic.

Rezistența la eritropoietină este redusă prin administrarea concomitentă de L-carnitină și vitamina A. De asemenea și de vitamina C și complexul B.

Eritropoietina poate provoca un mare prejudiciu la unii pacienți, uneori ducand la moarte din cauza cheagurilor de sânge.

ANOSMIA – Pierderea mirosului duce la pierderea gustului, cu degradarea calității vieții și a apetitului. Se folosesc hormoni steroizi și putem folosi și extract de Ginkgo biloba, citrat de zinc, Zincum metallicum homeopatic sau Mercurius solubilis, vitamina B-12 prin injecție intramusculară, acetil-L-carnitină, acid R + alfa lipoic și N-acetil-cisteină. Pentru pierderea gustului, încercați biotina și zincul. Coenzima-Q-10 ajută la miros și gust metalic.

APETITUL- pierderea poftei de mâncare sau anorexia este ajutată de ghimbir, mentă, tiamină, melatonină, extract de ciuperci Marinol și reishi, lăptișor de matcă. Faceți mese mici și controlați mirosurile. Acupuncturistul poate acționa ST-36, SP-6, CV-12, BL-20 și 21 pentru pofta de mâncare. Pentru pierderea gustului adăugați LI -4. Formula TCM din plante medicinale Bu Zhong Yi Qi Wan. Alte ierburi includ gentiană, catnip, fenicul, mentă, Acorus calamus și ginseng.

Exercitiile fizice ajuta.

Citrat de zinc luat la mese.

Rețineți că bromelina utilizată în doze mari ca antiinflamator poate inhiba puternic apetitul.

ATITUDINE – Așteptarea joacă un rol central în apariția efectelor secundare. Dacă pacientul crede că poate rămâne bine, vizualizează succesul și afirmă și acceptă în mod pozitiv terapia, probabil că se va descurca mai bine decat dacă ar fi înspăimântat. Acesta este un motiv bun pentru a integra rugaciune in protocoalele ortodoxe!

ARSURI – Radiațiile pot provoca arsuri severe ale pielii și țesuturilor subiacente la unele persoane. De la saptamana 2 până la 4 săptămâni: uscăciune, epilare a foliculilor, eritem datorat eliberării citokinelor și modificări ale pigmentului melaninei. De la saptamana 3 până la 6 săptămâni: descuamare uscată, descuamare și mâncărime. De la saptamana 4 până la 5 săptămâni: descuamare umedă: celulele bazale se pierd, emană lichid. Arsurile extreme provoacă necroză dermică. După 12 săptămâni: atrofie, fibroză datorată activității crescute a firbroblastelor, TFGβ provoacă îngroșare dermică și edem. După 6 luni: telangiectazie – vase de sânge roșii de tip păianjen, vizibile în piele.

Homeopatiile Apis mellifica, Causticum, Cantheris, Arsenicum bromatum, X-ray 200C, Radium bromatum, Cadmium sulphuricum și Causticum pot vindeca arsurile sau leziunile cauzate de radiații.

Nu utilizați uleiuri pe piele în domeniul radiațiilor, chiar dacă ați putea crede că le puteți spăla înainte de următoarea expunere la radiații. Reziduurile de ulei măresc peroxidarea lipidelor, ceea ce vă poate provoca arsuri!!!

Notă: arsurile grave ale pielii și inflamațiile cauzate de radioterapie nu răspund întotdeauna bine la emolienți.

Utilizați numai produse aprobate de medic pe pielea deteriorată de radiații.

Extractul de ceai verde sau Calendula (extract de flori de gălbenele) pot fi utilizate pe pielea arsă, insa nu utilizati cremele pe bază de ulei.

Studiile sunt în desfășurare cu spray de calendula pe bază de apă pentru a preveni arsurile la radiații.

Afectarea și arderea pielii pot fi tratate cu gel de frunze de aloe vera în timpul terapiei.

Consider că gelul îmi ajută pacienții, chiar dacă au fost publicate unele studii negative. Asistentele oncologice par să fie de acord cu mine în această privință.

După ultima doză de radiații putem lua în considerare utilizarea anumitor uleiuri și emolienți, cum ar fi uleiul Rosa mosqueta (măceșe) cu vitamina A și D3 în zonele arse.

Uleiul canadian de emu calmează și vindecă rapid arsurile ușoare și dermatita.

Uleiul / crema de măceșe previne și tratează cicatricile arsurilor. Folosiți creme Ferlow Brothers aloe sau rosa – substanțe organice organice într-o bază de ulei organic de semințe de struguri, cu vitamina E.

Uleiul de vitamina E poate fi pulverizat pe pielea sloughing (descuamare umedă).

Centella asiatica topică cu vitamina E este utilă pentru cicatrici. Pentru decolorarea pielii folosiți vitaminele A și D3 local și oral.

Extractul din semințe de struguri reduce inflamația. Folosesc NASOBIH ™ Nutra-Cream cu extract de semințe de struguri Protovin ™, adăugând adesea vitamine sau uleiuri.

Colegii folosesc cremă pe bază de plante / homeopate Lymphdiaral Sensitive și cremă boswellia.

Unii folosesc argint coloidal micronizat 10-30 ppm pentru a preveni ruperea bacteriană a pielii în vezicule deschise sau zone dehiscate.

Se pare că uleiul de arbore de ceai ajută la calmarea iritației pielii.

CONSTIPAȚIE – folosesc un vechi remediu naturist care combină aloe și pelinul dulce. De asemenea, luăm în considerare tinctura de plante Hoxsey, sucul de aloe vera, fibra de psyllium, acupunctura, clisme și, ocazional, irigarea colonului de către un terapeut de colon certificat.

Vă recomandăm întotdeauna o bună hidratare, exerciții fizice regulate și fructe precum prune uscate, papaya și rubarbă.

De asemenea, recomandăm urmatoarea reteta: 2 căni de tărâțe, 2 căni de mere, 1 cană de suc de prune neîndulcit – luați 2 până la 3 linguri de două ori pe zi.

De asemenea puteti utiliza Colace sau Docusate, supozitoare de glicerină sau lactuloză sau Sennokot laxativ, care este doar extract natural de frunze de senna. PEG 3350 (Miralax) este un laxativ osmotic din polietilen glicol, dozat la 17-34 grame o dată pe zi, până la 68 grame pentru efecte peste noapte.

DESHIDRATARE – tratați agresiv cu supa de miso, suc de mango și băuturi electrolitice, cum ar fi formula OMS – 1/2 linguriță sare, 3/4 linguriță bicarbonat de sodiu, până la 8 lingurițe zahăr sau 4 lingurițe. sirop de arțar și până la o cană de suc de fructe la 1 litru de apă. Se poate adăuga suc de lămâie. Terapia intravenoasă este soluție salină normală, 0,9% sare, cu 5% glucoza

DERMATITA – Vezi și ARSURI. Preveniți-o cu curcumină. Remediul meu preferat pentru a corecta roșeața și modificările vaselor de sânge ale pielii cauzate de radiații este anti-oxidantul NASOBIH Nutra-cream ™, care conține cel mai puternic extract de semințe de struguri din lume OPC – Protovin ™ – și are, de asemenea, acid alfa lipoic, vitamina A, MSM , CoQ10, DMAE, EDTA, măceș, uleiuri esențiale și multe alte componente naturale strălucitoare. Colegii oncologi naturisti sugerează remedii topice și orale, cum ar fi ceai de calendula și rozmarin, gel de frunze interne de aloe vera, ulei de lavandă, ulei de emu, curcumină, miere, cătină, vitamina U, L-carnozină, extracte de ceai verde.

DIARREA – Dieta BRAT (banane, orez, mere, pâine prăjită). Luati probiotice. . Folosesc Vitazan Ultimate Acidophilus – un amestec puternic de miliarde de acidophilus și alte probiotice. Înlocuiți sărurile de electroliți, precum și apa, cu supă de miso, bulion, sucuri sau o băutură de electroliți – cel puțin un pahar de 8 uncii per mișcare a intestinului.Formula aprobată de OMS pentru înlocuirea electroliților este de 1⁄2 linguriță de sare, 3⁄4 linguriță de bicarbonat de sodiu, o ceașcă de suc de fructe, îndulcit la gust cu echivalentul a până la 8 lingurițe de zahăr, în 1 litru de apă. Rehidratare intravenoasă: ser fiziologic normal, 0,9% sare, cu 5% glucoză. Argila bentonitică poate absorbi toxinele. L- glutamina dă energie pentru a vindeca mucoasa intestinului. Pastilele Po Chai sau pastile de vindecare sunt o plantă chineză extraordinară pentru diaree toxică, dar ia în considerare și formulele Xiang Sha Yang Wei Pien și Ba Zheng Wan. Punctele de acupunctură ST 25, 37 și BL 62. Luați în considerare uleiurile omega 3 și nucă de cocos mărunțită.

GURA SECĂ – Xerostomia este frecventă după radiații către gât și maxilar. Preveniți dăunarea glandelor salivare cu prickly ash extract (nu am gasit traducerea) . Există mai multe produse de salivă artificială în spray-uri și pastile. Spray-ul Mouth Kote combină iarba yerba santa, xilitol, sorbitol și acid citric pentru a umezi gura și a elimina gusturile neplăcute. Am văzut beneficii cand se apeleaza la acupunctură Folositi uleiul de cătină sau tincturi de Echinacea sau prickly ash extract(Xanthoxylum).

OBOSEALA – este legata de inflamație, NFκB, CRP, IL-1β și IL-6. Exercițiu in aer liber – începeți înainte de terapie! Utilizați L-carnitină 500 până la 1000 mg de trei ori pe zi pentru energie, sau chiar mai bine acetil-L-carnitină. ALC traversează bariera hematoencefalică pentru a ajuta la vindecarea creierului de rănirea radiației. Panax ginseng este un tonic minunat. Îmi place să dau 1 până la 2 flacoane zilnic cu formula de plante tonice chinezești Ling Chih Feng Wang Jiang cu ciuperci reishi, codonopsis, lăptișor de matcă și suc de fructe de litchi. Dacă nu este disponibil, dați lăptișor de matcă, Codonopsis, extract de ciuperci reishi sau vitamina B5. Uleiurile marine Omega 3 reduc oboseala și depresia prin reducerea interleukinei IL-6. Medicii naturopati pot oferi pune intravenos cocktailul Myer de vitamine și minerale pentru a stimula sistemul imunitar și a revitaliza. S-ar putea să simplificăm acest lucru cu o cantitate de vitamină B12. Alge Chlorella sau suc de iarbă de grâu pentru clorofilă. Luați în considerare ierburile rhodiola, urzicile, astragalul, ginsengul siberian Eleutherococcus senticosus, ashwagandha, shitake și cordyceps.

NECROZA Tesuturilor adipoase – Radiațiile pot provoca moartea bruscă a țesuturilor adipoase. Recomandare: Rx alchilgliceroli din ulei de ficat de rechin 600 până la 1.200 mg pe zi.

PIERDEREA PĂRULUI – Unii susțin că vitamina E va reduce pierderea părului sau cel puțin o va bloca. Compusul AHCC pretinde, de asemenea, că protejează foliculii de păr. Acupuncturistii pot folosi ST 36, SP 6, LV 8, BL 20 și 23 și moxa până la BL 17. Ulterior, folosim tablete Shou Wu Pian cu plante Polygoni multiflori, pentru a regenera părul mai rapid. Este posibil să trebuiască să învățați să vă iubiți craniul sau pălăriile, eșarfele și perucile.

LEZIUNI PULMONARE – iradierea pulmonară poate duce la inflamație (pneumonită) care duce la cicatrizare (fibroză) care devine acută la 1 până la 6 luni după tratament, provocând tuse cu sânge în spută, dificultăți de respirație, piept 59 durere și chiar moarte. Curcumina vindecă fibroza pulmonară, împreună cu proantohoocianine din semințe de struguri și extract de fructe de padure de hawthorne, gamma tocoferol vit.E

SINDROMUL maini-picioare începe cu furnicături, amorțeală sau roșeață a pielii pe zone de presiune precum mâini, picioare, coate sau genunchi. Poate evolua spre înroșirea și descuamarea severă a pielii la nivelul extremităților ceea ce poate duce la infecții grave. Utilizați emolienți topici, cum ar fi loțiune de aloe vera sau creme hidratante, cum ar fi Bag Balm. Luați vitamina B6 sub formă de piridoxal-5- fosfat, Rx 100 mg de două ori pe zi. Dozele de 400 mg pot reduce eficacitatea chimioterapică, așa că aveți grijă. Evitați să frecați pielea, presiunea, dușurile fierbinți și expunerea la soare. Aplicați ad lib. Aller-C și Apis mellifica homeopatică si luati quercitina O formulă topică pentru prevenirea acestui sindromului este Versabase: Diclofenac 2%, Vitamina B6 2,5% și Uree 10%. Sig: Aplicați un strat subțire pe mâini și picioare de până la 3 ori pe zi. Curcumina susține eficacitatea familiei de medicamente 5FU, dar poate declanșa HFS.

DAUNE LA INIMĂ – Rx-ul meu preferat: pentru leziunile cardiace cauzate de chimioterapie este Co-enzima Q-10 300 mg pe zi, vitamina E 400 UI pe zi, Convallaria majus, Crataegus oxycantha și Naja tripudans 6CH ca tinctură 1 picurător până la 1 linguriță. De 3 ori pe zi. Oncologii naturisti folosesc, de asemenea, OPC din extract de semințe de struguri, Ginkgo biloba, uleiuri omega 3, L-carnitină, Angelica, Lycium și Ginseng. Tratati orice leziune ale organelor cu Coenzima Q-10, în doze de 100 până la 300 mg pe zi. Acidul R-alfa lipoic este crucial pentru refacerea membranei bazale filtrante glomerulare, prevenind și inversând fibroza datorită acțiunii TGFβ-1. Am administrat 300 mg de 2-3 ori pe zi, iar cu unele avertismente s-ar putea să dau N-acetil-cisteină, cel puțin 500 mg de două ori pe zi. Pentru afectarea tubulului renal ajutată quercitină, 1.500 mg pe zi. Folositi gamma tocoferol, precum și uleiuri de astragal și omega 3. DHA acidul docosahexanoic cu grăsimi omega 3 previne nefrotoxicitatea cisplatinei. Insuficiența renală este uneori evitată cu formula Jin Gui Shen Qi Wan, numită și Rehmannia Eight sau Sexoton. Pentru recuperarea rinichilor folosim, de asemenea, astragal, angelică, semințe de urzică, pelitorie-de-perete și pătrunjel.

LEUKOPENIA – Eșecul producerii de celule albe din sistemul imunitar poate apărea pe o perioadă citopenică până la 11 zile după chimioterapia Intravenoasa.

Primele intervenții imune sunt neutrofile, deci acestea sunt atent monitorizate și susținute, pentru a preveni infecțiile letale, cum ar fi pneumonia. Sf. Francisc Herb Farm Deep Immune astragalus formula 3 capsule bid este profilactic în multe cazuri.

Cel mai agresiv produs pentru creșterea numărului este alchilglicerolii din uleiul de ficat de rechin, în doze de 1200 mg. Oferiți zilnic 50.000 UI de vitamina A.

Luați în considerare plantele chinezești ginseng siberian, astragalus, ligustrum, codonopsis, milletia, atractylodes albi, salvia miltorrhizae, liceul, rădăcina salix, scutellaria și lăptișorul de matcă, de exemplu formula Golden Flower Ji Xue sau Shih Chuan da Bu Wan (Shiquan).

Medicii naturopati au avut mult timp succes în reconstrucția sănătății imune cu extracte glandulare de timus și splină. Colegii mei americani folosesc peptide splenice Polyerga.

Eu dau alge chlorella, până la 20 de grame pe zi. Produsele botanice de luat în considerare sunt Phytolacca (rădăcină de poke) sau Hydrastis (rădăcină de focă aurie) și Echinacea (floare de con).

Putem da acid clorhidric intravenos diluat 1: 500 sau 2 mg / ml, împingeți 3 până la 5 ml în soluție salină. Medicina ayurvedică ar considera Podophyllum hexandrum.

Punctele de acupunctură includ TW-5.

Adăugați zinc, seleniu, vitaminele A, C, E și B6. O injecție intramusculară de B12 va pompa neutrofilele, primii noștri care răspund la infecție.

Evitați aglomerația, evitați persoanele cu boli infecțioase și spălați-vă mâinile des, mai ales după ce ați folosit toaleta și înainte de a mânca.

Exercițiu fizic.

Raportați medicului dumneavoastră orice semn de infecție, cum ar fi febră peste 38oC, frisoane, tuse, dureri în gât, urinare dureroasă sau inflamații precum roșeață, umflături și durere oriunde.

Neupogenul poate provoca dureri musculare, care pot fi tratate cu antihistaminice precum quercitina.

Limfocitele cronice scăzute pot indica o intoleranță la gluten. AFTE – răni în gură și sângerarea gingiilor fac dificil ca bolnavul sa manance si creste riscul de infectii.

Am avut rezultate strălucitoare cu „Vitamina U”, cum ar fi Biotics Research Gastrazyme 3 tid sau TCM Fare You 4 tid. Vit. U, în general, va preveni sau vindeca rapid rănile la nivelul gurii sau în tot tractul gastro-intestinal, inclusiv ulcere gastrice, colită și diverticulită.

Se spune că vitamina E 800 UI previne rănile bucale. Se administrează L-glutamină până la 15 grame de două ori pe zi sau 2 gm / m2 sau o linguriță rotunjită dizolvată într-o băutură caldă de trei ori pe zi.

Nu uitați să opriți L-glutamina de îndată ce chimio se termină, cu excepția cazului în care medicul vă recomandă acest lucru.

Gliciriza ca extract DGL de lemn dulce sau extract de glicerită.

Ceai sau tinctură de mușețel, ceai verde cu floare de caprifoi, suc de flori de gălbenele

Calendula officianalis succus sau ceaiuri puternice din plante înghețate în cuburi de gheață mici / așchii.

Gel de aloe vera.

Clorofilă, scoarță de ulm alunecos Ulmus fulva, gel de vitamina E, Traumeel homeopat.

Miere de Manuka și bicarbonat de sodiu. O clătire orală simplă de ½ linguriță fiecare de bicarbonat de sodiu și sare într-un pahar cu apă caldă poate fi utilizată de mai multe ori pe zi. Utilizați o periuță de dinți foarte moale sau un deget sau un tampon de gheață și luați în considerare bicarbonatul de sodiu, mai degrabă decât pasta de dinți. Gura va fi liniștită de iaurt rece sau înghețat și de mâncare moale și blândă.

Evitați apele de gură fără prescripție medicală, cum ar fi Listerine, Scope. Evitați alimentele crocante, condimentate și acide.

Clătire orală Radiacare sau „Magic Mouth Rinse” al Agenției BC Cancer: apă distilată, anti-fungice Nistatină, elixir Benadryl anti-histamină și succinat de sodiu hidrocortizon Solu-Cortef

EXCESUL DE MUCUS- O clătire a gurii cu lidocaină și sifon de va da o senzatie de ușurare.

GREATA – ghimbirul este foarte bun. SeaBand este o bandă de presopunctură cu un buton care apasă pe PC-6. Ace ST-36, PC-6, HT-1, CV-12.

Homeopatiile Arsenicum, Nux vomica, Tabacum, Ipecac sau Cuprum metallicum au funcționat adesea foarte bine.

Mănâncti în cantități mici, în special amidon, cum ar fi biscuiții uscați, și beti multe lichide.

Cannabinoizi de marijuana medicală (canabis, cânepă), cum ar fi tetrahidrocannabinol THC, funcționează bine pentru unii, dacă pot tolera celelalte efecte.

Dacă greața apare dintr-o reacție intestinală la stres prescrieți Ventorrid (formula Xiao Chai Hu Tang).

De asemenea, prescriu Metoclopramidă 10 mg înainte de mese și la culcare;

Proclorperazină 10 mg la fiecare 4 până la 6 ore după cum este necesar;

Haloperidol 0,5 până la 1,0 mg la fiecare 8 până la 12 ore după cum este necesar; sau Dexametazona 4 până la 8 mg pe zi.

Leziuni nervoase – Acetil-L-carnitină (dacă apar convulsii) de 1 până la 2 grame de 3 ori pe zi și acid R-alfa lipoic, 300 mg de două până la trei ori pe zi pentru orice leziuni ale nervilor sau neuropatie – amorțeală, senzații fantomatică sau durere. IV-D- ALA 150-300 mg bisăptămânal.

N-acetil-cisteină 1.200 mg de două ori pe zi și 2.000 mcg metilcobalamină vitamina B-12 și vit. B-1 (tiamină) 100 – 200 mg cel puțin în fiecare săptămână.

Piroloquinolona chinona (PQQ) reduce stresul oxidativ, re-mielinizează, regenerează mitocondriile prin biogeneză, reduce neuro-excitația și multe alte fiziopatologii neurologice.

Consumati legume și alimente fermentate, suplimentați 20 mg zilnic.

Sulfatul de agmantină este arginina decarboxilată, care previne și tratează neuropatia în doze de 3 până la 4 grame pe zi.

Extractul de frunze de Ginkgo biloba poate ajuta la neuropatie și leziuni cerebrale.

L-glutamină -6 până la 10 grame pe zi, vitamina B6 – 500 mg bid sau piridoxal-5-fosfat formează 100 mg de două ori pe zi, complex B, calciu, vitamina E, melatonină, uleiuri omega 3, extract din semințe de struguri și extract de ciulin lapte/armurariu/milk thistle .

Extract de ciuperci Lion’s Mane (Hericium erinaceus) 400 mg pe zi. Unii colegi utilizează marca Metagenics Neurosol, care conține ulei GLA de boragă, vitamine din complexul B și beta-caroten, extracte de ciuperci Lion’s Mane și cremă topică de 1-3% diclofenac.

Naturopatia tradițională pentru neuropatia și edemul piciorului este tratamentul cu șosete umede, cel mai bine cu diluarea 1: 1 a oțetului, Încălziți întotdeauna bine picioarele, apoi puneți șosete umede, acoperiți-le cu șosete de lână uscate și mergeți la culcare.

DETERIORAREA ORGANELOR – asigurați-vă că solicitați medicului oncolog și tehnicienilor în radiații să stabilească un fascicul cât mai îngust posibil și să mascheze sau să protejeze țesuturile și glandele vitale.

Utilizați protectoare radio precum ceai verde, vitamina A, melatonină, glutation și ashwagandha.

Organele au nevoie de co-enzima Q10 pentru a repara; într-adevăr face o mare diferență în vindecare.

Colegii mei americani sugerează melatonină 20 mg de două ori pe zi, boswellia 500 mg de 4 ori pe zi, seleniu până la 1.000 mcg pe zi, trigliceride cu bărbie medie de 13-26 grame și extract de secară Oralmat adaptogen.

SOD de la boabe Goji repară rănirea RTx.

Pentru leziunile cerebrale cauzate de radiații, adăugați DHA din uleiurile marine omega

PLACHETE – eșecul de a produce trombocite sau trombocitopenie poate face imposibilă formarea unui cheag, cu risc de hemoragie severă. Medicul dumneavoastră vă poate prescrie o transfuzie de trombocite dacă numărul scade sub 20.

Extractul de frunze de papaya ajută adesea la 1.000 mg tid sau 1 lingură. pe doză de extract de glicerină.

Luați în considerare, de asemenea, rechinul viu Yunnan Pai Yao Panax pseudo-ginseng 1 – 2 capsule de trei până la patru ori pe zi este o terapie rapidă și fiabilă pe care am văzut-o ca efectele medicamentelor sintetice.

Melatonina, hormonul glandei pineale, ajută la reglarea producției de trombocite, cu o eficacitate comparabilă cu Neupogen și este mult mai sigură.

Luați în considerare, de asemenea, ulei de ficat de rechin alchilgliceroli, rădăcină de lemn dulce, plantă ashwagandha și extracte de ciuperci maitake.

Doze mari de vitamina C poate ajuta la recuperare.

Se crede că consumul de ananas proaspăt crud poate ajuta la creșterea numărului de trombocite.

Evitați aspirina (ASA) și Advil (ibuprofen), Ginko biloba și alți diluanți ai sângelui.

Păstrați doza de vitamina E sub 600 UI zilnic.

Raportați medicului dumneavoastră orice semne de sângerare, cum ar fi vânătăi, pete roșii pe piele, urină sângeroasă sau scaune negre, gudronate.

Evitați ghimbirul, care reduce numărul de trombocite și este un anticoagulant direct. Fiti precauti cu curcuma din motive similare.

PROCTITA – Oferiți culturi de bacterii prietenoase cu probiotice.

Inflamația rectului și a anusului din radiațiile pelvine poate răspunde la terapia hiperbară cu oxigen.

La fel și uretrita sau orice altă inflamație cronică cauzată de radiații. Insuflarea rectală zilnică cu ozon.

Berberină, L-glutamină, gel de aloe vera, 25% gel DMSO. Utilizați SOD, fructe de padure Goji, supozitoare timp de 7 nopți din extract de flori de gălbenele de casă (Calendula officinalis).

Folositi alantoină, marshmallow (Althea), calendula homeopatică 6X, unt de cacao, retinol vitamina A și vitamina E.

Stari de voma – tratați agresiv deshidratarea – beți înlocuitor de electroliți (minerale din sânge), preparați o ceașcă de supă miso, luați în considerare acupunctura. Formula de înlocuire a electroliților OMS este 1⁄2 linguriță sare, 3⁄4 linguriță bicarbonat de sodiu, 8 lingurițe zahăr / o cană de suc pe litru de apă.

PIERDERE DE GREUTATE – 80% dintre bolnavii de cancer sunt malnutriți, iar 40% mor din cauza malnutriției. Pierderea a peste 20% din masa corporală slabă este extrem de periculoasă; crește aportul de carbohidrați și proteine. Cancerul poate provoca cașexie, un sindrom metabolic cu slăbire profundă.

Utilizați uleiuri marine bogate în acid gras eicosapentanoic EPA – în special ulei de focă, 2 capsule de două ori pe zi la mese. Puteți folosi uleiuri de pește până la 1 lingură. zilnic.

Luați în considerare melatonina, L-glutamina, pepenele amar, Momordica charantia.

CELULE ALBE – Leucopenia sau eșecul de a produce suficiente celule albe din sânge înseamnă pierderea celulelor imune vitale, astfel încât rezistența persoanei la infecție poate cădea. Neutrofilele sunt primii care răspund la infecție și, așadar, sunt cei mai critici de protejat.

Cel mai agresiv produs pentru creșterea numărului este alchilglicerolii din uleiul din ficat de rechin, în doze de 1.200 mg sau 2 capsule de două până la trei ori pe zi.

Oferiți zilnic 50.000 UI de vitamina A.

Luați în considerare plantele chinezești ginseng siberian, astragalus, ligustrum, codonopsis, milletia, atractilode albe, salvie Salvia miltorrhizae, rădăcină de salix, scutellaria și lăptișor de matcă. de exemplu, Shih Chuan Da Bu Wan sau poate formula Golden Flower Ji Xue.

Putem da acid clorhidric intravenos diluat 1: 500 sau 2 mg / ml, împingeți 3 până la 5 ml în soluție salină.

Medicii naturopati au avut mult timp succes în reconstrucția sănătății imune cu extracte glandulare de timus și splină.

Îmi place să folosesc timulina homeopatică pentru a echilibra celulele imune activate de timus.

Colegii mei americani folosesc peptide splenice Polyerga.

Eu dau alge chlorella, până la 20 de grame pe zi.

Produsele botanice care trebuie luate în considerare sunt rădăcina Phytolacca decandra sau rădăcina de focă aurie Hydrastis 30 de picături de tinctură de două ori pe zi.

Ayurveda sugerează Podophyllum hexandrum.

Punctele de acupunctură includ TW-5.

Suplimentează zinc, seleniu, vitaminele A, C, E, B6 și B12. O injecție intramusculară de B12 va pompa neutrofilele, primii noștri care răspund la infecție.

Evitați aglomerația, evitați persoanele cu boli infecțioase și spălați-vă mâinile des, mai ales după ce ați folosit toaleta și înainte de a mânca.

Exercițiu fizic

Raportați medicului dumneavoastră orice semn de infecție, cum ar fi febră peste 38oC, frisoane, tuse, dureri în gât, urinare dureroasă sau inflamații precum roșeață, umflături și durere oriunde.

EFECTELE RADIOTERAPIEI INTARZIATE și CRONICE

Radiația declanșează o pierdere neîncetată a microcirculației. Radiația modifică permanent matricea extracelulară care înconjoară și susține celulele noastre, inclusiv celulele imune de memorie și celulele stem din ECM care reglează creșterea celulară. Zona iradiată nu va fi niciodată aceeași și, de fapt, poate deveni o problemă medicală mulți ani mai târziu. Procesul de vindecare este implacabil și insidios, dar puteți face multe pentru a-l corecta în mod natural.

     Pentru a reduce fibroza cronică și alte efecte tardive în țesuturile expuse, prescriu

 curcumina – spectru micronizat, lipozomal sau complet, de obicei 1 până la 2 capsule de două ori pe zi la mese.

 Acid R-alfa lipoic 300 mg de două ori pe zi la mese.

 vitamina A – 3.000 UI zilnic, după încărcarea dozei mari la 30.000 UI zilnic, de 2 până la 3 luni ..

 vitamina D3 – 2.000 până la 3.000 UI zilnic sau mai mult dacă se monitorizează 25 (OH) D.

 ulei marin omega 3 – ulei de focă 2.000 mg sau 3.000 până la 4.000 mg krill sau ulei de pește

 quercitina – 1 – 2 grame, inhibă TGFβ. Sinergic cu ceai verde, acid alfa lipoic.

 pentoxifilen (Trental) 400 mg bid cu 500 UI tocoferol mixt vit E – timp de 1 an

 refacerea biomului intestinal accelerează recuperarea după radiațiile pelvine.

Mănâncă o dietă pe bază de plante bogat în fibre și lignani poate genera acizi grași cu lanț scurt SCFA pentru a restabili echilibrul biomului în doar 3 până la 4 zile.

De asemenea, puteți lua suplimente de bacterii prietenoase cu probiotice.

Nu uitați să exprimați întotdeauna recunoștință pentru îngrijirea și ajutorul pe care vi le-a acordat radioterapia oncologă, în timp ce vă iertați pentru stresul la care v-a pus corpul.

Încercați să fiți plini de recunoștință. Este vindecător.

Tratarea expunerii la radiațiile provocate de imagistica medicală

Radiațiile pot provoca cancer. Imagistica cu radiații, cum ar fi scanările CT, reprezintă o doză mare de radiații. Scanările PET nu prezintă de fapt un risc, deoarece folosesc un tip mult mai ușor. Avem mecanisme de reparare pentru a face față radiațiilor ambientale din sol, apă și nucleotide radioactive aeriene și razelor cosmice din afară. Expunerea la surse de imagistică sau terapii cu radiații crește riscul de a suferi daune. Radiațiile pot fi foarte toxice pe termen scurt și pot declanșa, de asemenea, un declin neîncetat în circulație din cauza fibrozei sau a cicatricilor mucoasei vaselor de sânge. Țesuturile pot pierde capacitatea de vindecare.

Fiți proactivi, deoarece toate dozele de radiații provoacă leziuni, iar simptomele pot să nu se dezvolte pentru o perioadă lungă de timp. Pentru a reduce deteriorarea țesutului sănătos afectat de radiații puteti lua:

 vitamina A (retinol palmitat) – 5 X 10.000 UI de două ori pe zi timp de 2 zile înainte și aproximativ 2 săptămâni după fiecare scanare. Eu prescriu picături de 10.000 UI fiecare, dar sunt disponibile și capsule.

 ashwaganda este un protector semnificativ al celulelor sănătoase.

 alchilglicerolii din uleiul de ficat de rechin reduc deteriorarea țesutului secundar cu aproximativ 60%.

 curcumina reduce inflamația. Alți agenți care trebuie luați în considerare pentru protecția împotriva radiațiilor din imagistica medicală: quercitină, beta caroten, vitamina B1 – tiamină, vitamina B3 – niacină, vitamina B5 – acid pantotenic, seleniu, glutation, squalen, ceai verde, melatonină, aspartat de zinc, taurină, ginseng, reishi, cordyceps, fructe bael Aegle marmelos, uleiuri omega 3 marine, busuioc și PSK.

Medicamentele homeopate sunt utile pentru restabilirea homeostaziei. Luați în considerare Radium bromatum, Radium iodatum, raze X, Thuja occidentalis, Cadmium iodatum, Cadmium sulpuricum, Calcarea fluoricum, Fluoric acidicum, Phosphoricum acidicum, Cobaltum metallicum, Rhus venatum și Belladonna. Arsenicum bromatum este deosebit de util pentru arsurile provocate de radiații. Dr. Christopher, maestru în plante medicinale, recomanda rădăcina de struguri din Oregon Berberis aquifolium pentru recuperarea radiațiilor. S-a demonstrat că berberina reduce pneumonita prin radiații. Planta tradițională vietnameză pentru detoxifiere Vigna radiata conține vitexina flavenoidă care s-a dovedit a proteja de inducerea prin radiație a pierderii în greutate și de deteriorarea celulelor sanguine periferice. Rețineți că această plantă tratează afecțiunea numită „căldură deficitară” observată de medicii din medicina tradițională chineză TCM la pacienții iradiați. Folosesc formula Da Bu Yin Wan în acest scop. Formulele TCM precum Radio-Support vor aborda probleme precum qi deficitar, sânge și yin, căldură din sânge și stază de sânge.

Vinul roșu poate reduce riscul de toxicitate acută la radiații, inclusiv de înaltă calitate a pielii, fără a afecta eficacitatea antitumorală. Se suspectează că resveratrolul este ingredientul activ. Bucurați-vă de un pahar zilnic pentru o sănătate bună!

CISPLATIN, CARBOPLATIN, OXALIPLATIN

Complexele de platină leagă ADN-ul și deamidează gena Bcl-xL care inactivează un comutator care ar putea declanșa apoptoza. Monitorizați electroliții serici de sodiu, calciu, potasiu și magneziu.

Administrarea de magneziu reduce neuropatia.

Îmbunătățirea eficienței cu câștigul net de quercitină este cu până la 30% mai multă apoptoză.

Se poate lua, de asemenea, coenzima Q-10, genestein, seleniu, vasc, coriolus PSK, shitake lentinan, resveratrol, vitamine A, niacină sau un complex B, C și E.

Medicamentele cu platină sunt o excepție de la regula împotriva curcuminei, deoarece îmbunătățește cu siguranță eficacitatea acestora.

Zincul este sinergic cu toate platinurile, reduce rezistența la chimio, inhibă microtubulii.

ARMURARIU Milk thistle, curcumina și selenometionina pot reduce rezistența tumorii la cisplatină și carboplatină, sporind eficacitatea. Milk thistle este, de asemenea, un mare protector al ficatului.

Teanina crește concentrația medicamentului într-o tumoare prin inhibarea transportorului de glutamat prin intermediul pompei GS-X.

Uleiul de pește Omega 3 poate preveni afectarea rinichilor și poate crește eficacitatea, dar acest lucru a devenit controversat din cauza unui studiu la șobolani care arată eficacitatea redusă a Cisplatinei. Nu se cunoaște dacă acest lucru se aplică oamenilor sau altor medicamente cu platină.

Compușii de platină pot provoca leziuni nervoase severe, pierderea auzului, toxicitate severă a rinichilor, greață, vărsături și supresia măduvei osoase. Reduceți toxicitatea cu astragalus (protector pentru rinichi), L-glutamină (protector pentru nervi și GI), quercitină, melatonină și vitamina C.

Nivelul scazut al vitaminei E se corelează cu afectarea severă a nervilor periferici de la cisplatină, astfel încât Rx 600+ mg impreuna cu tocoferoli zilnic, plus acetil-L-carnitină prevene ototoxicitatea Cisplatinului.

Sublingual sau vaccinuri cu vitamina B-12 (metilcobalamină) sunt necesare pentru a preveni leziunile nervoase și pentru a menține hemogramele.

Seleniul la 200 mcg zilnic reduce supresia măduvei osoase, toxicitatea rinichilor și dezvoltarea rezistenței la medicamente.

Ba Zhen Tang – Decoct de opt perle – reduce efectele secundare gastro-intestinale ale GI, la fel ca formula Bu Zhong Yi Qi Wan.

Unii dintre colegii mei folosesc decoctul Jian Pi Yi Qi Li Shui, acidul retinoic all-trans ATRA sau extractul de splină Polygera.

chimioterapia pe baza de Platina reduce depozitele de magneziu și vitamina D, deci este esențial să le înlocuiți, dar numai cantități moderate, deoarece interacționează cu Cyp3A4.

Uleiul de pește Omega 3 poate preveni afectarea rinichilor și poate crește eficacitatea, dar acest lucru a devenit controversat din cauza unui studiu la șobolani care arată eficacitatea redusă a Cisplatinei.

Nu se cunoaște dacă acest lucru se aplică oamenilor sau altor medicamente cu platină.

Venlafaxina (Effexor) la 50 mg cu 1 oră înainte de perfuzie sau 37,5 mg cu eliberare prelungită de două ori pe zi, previne și vindecă neuropatia.

La fel și vaccinurile’/injectiile săptămânale de vitamina B-12 cu metil-cobalamină și tiamină B1.

Cisplatina este un inhibitor al proteinei șocului termic HSP-90, care induce oprirea ciclului celular independent de p53. Poate fi un radiosensibilizator semnificativ, dat cu aproximativ 6 ore de pre-radiație.

Oxaliplatina este mai eficientă în combinație cu timochinona din negrilica. Protejați-va bacteriilor intestinale cu psyllium, uleiuri omega 3 și o dietă pe bază de plante.

Probioticele sunt foarte utile, dar nu mai le oferim dacă numărul neutrofilelor scade la 1,5 sau mai puțin.

Carboplatina este mai puțin toxică pentru rinichi, dar este mai mutagenă și dăunătoare pentru numărul măduvei osoase și celulelor sanguine decât cisplatina. Carboplatinul produce dezechilibre electrolitice (minerale din sânge), greață și vărsături, funcții hepatice anormale, leziuni ale nervilor și dureri musculare.

Luați în considerare glutamina și milk thistle cu carboplatină și modulatorii de citokine, cum ar fi astragalus și ganoderma.

DCA este bun cu carboplatină.

Nu amestecați platina cu dicloroacetat (DCA), N-acetil cisteină (NAC), glutation (GSH), acid alfa lipoic (ALA), Ginkgo biloba, squalen sau doză mare de vitamina B6.

Faceți acest lucru conform instrucțiunilor unui medic naturist instruit și calificat în oncologie integrativă.

Medicii italieni utilizează glutationul intravenos IV-GSH cu cisplatină și ciclofosfamidă chimio în cazurile de cancer ovarian.

Taxotere (Docetaxol) și Paclitaxel

sunt taxani sintetici.

Taxanii pot provoca reacții de șoc anafilactic, astfel încât pentru a evita probleme serioase veți fi tratat în prealabil cu Benadryl și / sau Decadron – un antihistaminic și un medicament steroid. De asemenea, pot apărea leziuni ale nervilor senzoriali, dureri musculare, dureri articulare, răni la nivelul gurii, greață, vărsături, pierderea celulelor imune din sângele alb și toxicitate cardiacă.

Vitaminele complexe B metilate îmbunătățesc eficacitatea și previn neuropatia. Îmbunătățiți eficacitatea în continuare cu vitamina C – 4 până la 6 grame pe zi, vitamina E gamma tocoferol și injecții cu vasc Iscador.

Fac sinergie cu acizii grași esențiali, cum ar fi GLA din uleiul de primăvară, și cu planta Ashwagandha Withania sonifera.

Susținut puternic de vitamina D3 – îmbunătățește eficacitatea, reducând în același timp toxicitatea.

Genesteina din soia crește eficacitatea prin reducerea legării ADN-ului cu factorul nuclear NFκB.

Taxanii provoacă dureri articulare și musculare prin creșterea enzimelor COX-2 care promovează inflamația. Utilizați inhibitori naturali COX-2, cum ar fi uleiurile marine omega 3, boswellia și enzimele serrapeptidazei. Curcumina poate îmbunătăți eficacitatea Docetaxolului.

S-a exprimat o anumită îngrijorare cu privire la chimiorezistență prin reglarea în sus a chimioprotectorului Nrf2 de curcumină, ceai verde, ciulin de lapte, ashwagandha și Bacopa monniera.

L-glutamina de 2 până la 3 grame de până la trei ori pe zi reduce riscurile de afectare a nervilor și dureri musculare. Acest lucru poate fi susținut în continuare cu acetil-L-carnitină și vitamina B6 sub forma activă piridoxal-5-fosfat. Piridoxina B6 tratează, de asemenea, erupțiile cutanate pe mâini și picioare, numite EIP palmar-plantar.

Nu amestecați cu quercitină, resveratrol, berberină, N-aceytl-cisteină, Black cohosh sau sunătoare, deoarece acestea pot reduce eficacitatea.

Sorafenib (nexavar)

inhibă mai multe proteine ​​kinaze ale tirozinei, inclusiv factorul de creștere derivat din trombocite PDGF, receptorul factorului de creștere vascular endotelial VEGFR kinazele 2 și 3, receptorul factorului de celule stem cKit și Raf kinaza – care se leagă de kinaza MAP prin intermediul Raf / Mek / Erk cale de semnalizare a creșterii. În prezent este aprobat pentru carcinomul cu celule renale și hepatocelulare. Fiți conștienți de riscul semnificativ de sângerare.

Nu amestecați cu substanțe anticoagulante.

Nu amestecați cu Metformin.

Jingli neixao poate ajuta la oboseală, diaree, greață, anorexie, hipertensiune și icter.

Suport cu curcumină și melatonină.

Letrozolul

sau Femara este un inhibitor al aromatazei capabil să reducă estrogenul și estrona de două ori mai mult decât Anastazolul. Când Letrozolul eșuează, aproximativ 15% din cazuri pot fi salvate de medicamentul asociat Exemastane sau Aromasin. Cel mai grav risc este subțierea oaselor.

Susțineți sănătatea oaselor cu citrat de stronțiu, vitamina D3, vitamina K2 și exerciții fizice.

Gestionați durerile articulare cu excercitiu fizic , uleiuri marine omega 3, ulei emu topic, melatonină, curcumină.

Suport cu quercitină naturală AI, extract din semințe de struguri, indol-3-carbinol / DIM și ciuperci albe.

De asemenea, susținut de inhibitori ai Bcl-2, cum ar fi curcumina și extractul de ceai verde.4

Irinotecanul

este un compus semisintetic – un compus natural modificat de către un chimist – din „Copacul fericit” chinezesc.

Îmbunătățiți retenția acestui medicament în celulele canceroase cu aproximativ 30% cu quercitină.

Teanina crește concentrația medicamentului într-o tumoare prin inhibarea transportorului de glutamat prin intermediul pompei GS-X.

Îmbunătățiți eficacitatea cu melatonină, extract de armurariu/ milk thistle, curcumină, genesteină din soia și seleniu.

Tratați diareea declanșată de iritarea intestinului de la metabolitul său cu 2-4 capsule de cărbune de două ori pe zi.\

5-FLUORO-URACIL

5-FU este un piramididină „anti-vitamină” sau agent anti-metabolit care interferează cu metabolismul unui nutrient necesar pentru a produce ADN-ul. Leucovorina, care este administrată în mod obișnuit ca parte a protocoalelor care conțin 5-FU, este o formă de folat redus și crește afinitatea 5-FU pentru enzima sa țintă, timidilat sintază. 5-FU determină pierderea poftei de mâncare, greață, răni bucale, diaree, chelie, insuficiență renală, pierderea globulelor albe ale sistemului imunitar, erupții cutanate, întunecarea pielii sau tendință crescută de arsură la soare.

Îmbunătățiți eficacitatea cu quercitina, melatonina, aloe vera, shitake lentinan și vitaminele A, vitamina C, vitamina E.

Multe FABNO recomandă IV-C cu FOLFOX și regimuri chimio conexe pentru a reduce daunele.

Reduceți toxicitatea cu L-glutamină, glutation, apă de gură cu mușețel, coenzima Q10 și vitamina B6.

Atenție: nu amestecați cu doze mari de carotenoizi, inclusiv beta caroten, luteină și licopen.

Consumul de ceai verde în timpul chimioterapiei cu 5 FU crește nivelul sanguin al medicamentului, deci nu este recomandat.

Păstrați dozele de B6 sub 400 mg, probabil 200 mg este cel mai bun.

Suplimentarea cu folat poate provoca reacții grave, chiar fatale!

DOXORUBICINĂ (ADRIAMICINĂ)

a fost numita inițial Adriamicină, deoarece a fost extras dintr-o ciupercă unică găsită doar într-un turn de piatră în ruină, cu vedere la Marea Adriatică. Doxorubicina este un antibiotic antracinic care intercalează ADN-ul (se leagă în interiorul firelor spiralate), inhibând sinteza ADN-ului și ARN-ului și poate provoca pauze cromozomiale. Doxorubicina este un pro-oxidant și este deosebit de toxică pentru celulele cu conținut scăzut de oxigen. Este extrem de toxică pentru mușchii inimii la expuneri totale de 500 mg / m2. Apoptoza cardiomiocitară este indusă de ananamida endocannabinoidă, prevenită de inhibitorii receptorilor CB-1. OPC-urile din extract de semințe de struguri pot elimina complet stresul oxidativ miocardic. Provoacă mielosupresie – inhibă grosolan celulele măduvei osoase și, prin urmare, numărul de celule sanguine, în special celulele imune albe, adică leucopenia. Poate provoca leucemie mielocitară acută (LMA) post-tratament, alopecie (căderea părului), greață, vărsături și extravazare (scurgeri de lichid din vasele de sânge).

Îmbunătățiți eficacitatea cu vitamina A, vitamina C, extract de semințe de struguri OPC, vitamina E, DHA (omega 3 ) , armurariu /milk thistle, vâsc. Genestien reduce legarea ADN-ului cu factorul nuclear NFκB.

Ceaiul verde 50 – 200 mg zilnic și quercitina 500 – 100 mg de 2 până la 3 ori pe zi, ajută medicamentul să se acumuleze în celulele canceroase, prin sistemul purtător de medicamente p-glicoproteină, protejand în același timp inima și alte țesuturi sănătoase.

Curcumina interacționează, de asemenea, cu sistemul p-glicoproteină, dar nu este bună cu toate medicamentele chimio.

Reduceți toxicitatea cu usturoi, seleniu, melatonină, proantocianidine din semințe de struguri, uleiuri omega 3, squalen, PSP coriolus, polifenoli EGCG de ceai verde și catehină.

Berberina reduce cardiomiopatia.

Adriamicina epuizează rezervele vitaminelor A, beta caroten, B2, B6, C, E și zinc, iar suplimentarea cu acestea va îmbunătăți siguranța și eficacitatea.

Antioxidanții din uleiul de măsline virgin par, de asemenea, de ajutor.

Vitamina B6 ca piridoxal-5-fosfat, reduce sindromul mână-picior (PPED).

Tratamentul prealabil cu vitamina E reduce căderea părului, îmbunătățind în același timp eficacitatea.

Inima poate fi susținută în continuare de taurină, carnitină, Crataegus oxycantha, Convallaria majus și Rhodiola rosea.

Nu amestecați cu N-acetil cisteină sau antioxidanți glutation, deoarece pot crește rezistența la medicamente.

Nu amestecați cu partenolide de plante sau glucozamină.

Cancerul de sân HER-2 pozitiv poate răspunde la chimioterapiile antraciclinice, inclusiv Doxorubicina, Epirubicina, Adriamicina, Daunorubicina, Idarubicina și Mitoxantrona.

Cu toate acestea, cazurile negative HER-2 nu răspund la antracicline și nu mai reprezintă standardul de îngrijire pentru acești pacienți.

Dexametazona

Potentul steroid gluco-corticoid Dexametazona este utilizat pe scară largă pentru a reduce edemul peri-tumoral în cancerele din creier. Poate produce psihoză, agitație, insomnie și alte simptome maniacale. Aceste probleme pot răspunde medicamentului anti-psihotic Seroquel sau medicamentului de somn sedativ și hipnotic Clonazepam. Pe măsură ce oamenii scad încet din Dex, susținem recuperarea glandei suprarenale.

Cortizolul poate fi moderat cu niacinamidă, complex B, Vit. C, rhodiola, triptofan, rădăcină de lemn dulce sau formule precum ITT Cortisol Manager și Zhi Bai Di Huang Wan.

CICLOFOSFAMIDĂ (CITOXAN)

CP sau Cytoxan este un agent de muștar legat de gazul de muștar utilizat în Primul Război Mondial, dar acum interzis ca armă – cu excepția împotriva cancerului. Ciclofosfamida poate provoca greață, chelie, sângerări în vezica urinară, leziuni ale măduvei osoase, activitate redusă a celulelor ucigașe naturale și risc crescut de răspândire metastazică a cancerului.

Creșteți eficacitatea cu vitamina A, beta caroten, vitamina C, vitamina E, coenzima Q-10, acidul folic și vitaminele din complexul B, quercitina, uleiurile omega 3 și sucul de aloe vera.

Reduceți toxicitatea cu ashwagandha, melatonină Co-enzima Q10, uleiuri omega 3, extract din semințe de struguri, magneziu, seleniu, extract de splină Polygera și multă apă.

Utilizați întotdeauna un extract de ciuperci, cum ar fi reishi, cordyceps, coriolus PSK sau AHCC.

Ginsenozidul din ginseng roșu reduce hemolizina, protejând celulele roșii din sânge.

Formula TCM Bu Zhong Yi Qi Wan reduce toxicitatea și îmbunătățește eficacitatea.

Formula TCM Yi Kang Lin este sinergică.

N-acetil cisteina și glutationul pot reduce atât toxicitatea, cât și eficacitatea.

Medicii italieni dau glutation intravenos cu cisplatină și ciclofosfamidă în cancerul ovarian, dar nu sunt încă mulțumit că aceasta este o idee strălucitoare.

Curcumina nu trebuie utilizată. Prin reducerea speciilor reactive de oxigen ROS și inhibarea JNK, poate reduce moartea celulelor canceroase prin apoptoză.

Nu administrați dicloroacetat DCA concomitent.

Herceptin

vizează factorul de creștere amplificat la pacienții care exprimă gena HER2 / neu insa poate deteriora inima destul de grav în unele cazuri.

Pentru leziunile cardiace luați fructe de pădure, paducel, Crataegus oxycantha, lacramioare și Cactus grandiflora, vitamina E și coenzima Q10 pentru a preveni sau corecta leziunile cardiace.

Adăug adesea remediul homeopat Naja tripudans 6C.

Această abordare a permis multor pacienți să se recupereze și să continue tratamentul, după ce leziunile cardiace au forțat oprirea terapiei cu Herceptin.

Îmbunătățiți eficacitatea cu quercitina și Aloe vera.

Emodina din Aloe vera și quercitina reduc expresia genei HER2 / neu, rădăcina problemei. De asemenea, susțineți această terapie cu ulei de măsline (acid oleic), ceai verde EGCG (inhibitor FASN), Polygonum și extracte de ciuperci Reishi Ganoderma lucidum.

Uleiul primrose sau uleiul de coacăz negru (contin acid gamma-linolenic GLA) inhibă proteina HER2 / neu mutantă, crescând răspunsul Herceptin de 30 până la 40 de ori în aceste cazuri.

Este important să se controleze factorul de creștere asemănător insulinei IGF-1, care interacționează puternic cu receptorul HER2 / neu și cu terapia cu Herceptin. Aceasta înseamnă trecerea pe o dieta cu conținut glicemic scazut.

Avastin (BEVACIZUMAB)

este un anticorp monoclonal care inhibă VEGF si interferează cu construcția vaselor de sânge ca parte a vindecării normale a rănilor. Avastin crește riscul de formare a cheagurilor, inclusiv atacuri de cord și accidente vasculare cerebrale. Rețineți că medicamentul poate provoca sângerări ale gingiilor, nasului sau tractului reproductiv feminin, hipertensiune arterială, perforație intestinală și proteinurie glomerulopatică. Există o creștere cu 0,8% a mortalității la cei tratați cu Avastin comparativ cu chimioterapia. 2,5% dintre pacienți pot prezenta riscul unui eveniment fatal

Nu combinați cu trifoi roșu, cum ar fi formula pe bază de plante Hoxsey.

Luati beta-glucani, cum ar fi Agaricus, Reishi sau AHCC. IVC poate ajuta. Protejați-va bacteriile intestinale cu probiotice, psyllium, uleiuri omega 3, dietă pe bază de plante.

Gemcitabina

este strâns legată de 5-FU. Gemcitabina inhibă fabricarea ADN-ului. De asemenea, reglează CYP 2C9. Acesta este unul dintre cele mai eficiente și relativ puțin toxice medicamente pentru chimioterapie și îl putem ajuta cu ușurință să facă și mai mult, cu mai puțin rău. Mulți pacienți sunt tratati medicament. Cu toate acestea, un procent mic de persoane va avea o variație genetică care le determină să metabolizeze acest pro-medicament într-o substanță chimică foarte nocivă și nu il pot tolera. Un deficit de citidină deaminază (CDA) este un bun predictor al toxicităților severe timpurii. Acestia pot suferi mielosupresie și rareori un sindrom hemolitic-uremic fatal. Capecitabina poate provoca ischemie cardiacă.

Reduceți rezistența tumorii cu inhibitori de NFκB precum Reishi, quercitină, uleiuri GLA, vitamine din complexul B, melatonină, alchilgliceroli, astragalus gotu kola, negrilica, extract de Ginkgo biloba.

Ceaiul verde EGCG poate îmbunătăți eficacitatea în timp ce reduce toxicitatea GI a capecitabinei, dar există argumente contrare acestei afirmații.

Protejați-va bacteriile intestinale luand probiotice, psyllium, uleiuri omega 3 și cu o dietă pe bază de plante.

Paw Paw poate fi sinergic.

Cu Xeloda, alias Capecitabina, unii dintre colegii mei vor prescrie 300 mg de 2-3 ori pe zi de vitamina B6 pentru a preveni sindromul mână-picior, dar au fost publicate unele studii negative cu privire la această abordare. 200 mg par sigure, dar 400 mg zilnic pot reduce eficacitatea.

Crema Mapisal – 10% uree plus uleiuri și antioxidanți – reduce riscul de sindrom mână-picior la jumătate.

Se spune că curcumina orală și IV crește eficacitatea acestei familii de medicamente 5-FU, dar pot declanșa sindromul mână-picior.

Nu consumati estradiol, soia sau legume care contin cumarine.

Nu luati suplimente de folati!.

Metotrexatul

este un agent antimetabolit sau anti-vitaminic care blochează utilizarea acidului folic vitaminic B, necesar pentru producerea acidului nucleic ADN și proteine. Se administrează uneori într-o doză fatală urmată de „salvarea leucovorinei”, care este acidul folinic de calciu. 1 din 100 de pacienți obișnuiau să moară din această procedură. MTX este toxic pentru rinichi și ficat. Provoacă greață, vărsături, diaree, răni la gură, piele inflamată, vedere încețoșată, amețeli și pierderea de celule imune adecvate din sânge.

Pentru siguranță, contracarați producția intensă de specii reactive de oxigen cu vitamina A, vitamina E și seleniu.

Îmbunătățiți eficiența cu extractul de milk thistle, rădăcina de lemn dulce și poligonum. L-glutamina crește absorbția MTX în tumori.

Nu combinați cu glutation, tangeretină sau cu doze mari de acid folic sau vitamina C orală. Evitați amestecul cu echinaceea, rădăcina de cohosh negru sau ierburile bogate în salicilat, cum ar fi afine, salcie și perisor.

Tamoxifen

Tamoxifenul este un anti-estrogen nesteroidian care se leagă de receptorii beta-estrogeni citoplasmatici ERβ și are alte efecte complexe asupra hormonilor. Oferă o reducere de aproximativ 50% a riscului de reapariție a cancerului de sân.

Nu crește supraviețuirea generală.

Recidivele după tamoxifen tind să fie mai letale.

Tamoxifenul poate provoca unele efecte secundare grave, deci este necesar un sprijin naturopatic integrativ pentru siguranță. Poate provoca un risc crescut de 3% de formare a cheagurilor de sânge, cum ar fi o tromboză venoasă profundă sau embolie pulmonară. Acest risc este cel mai pronunțat pentru persoanele obeze (indice de masă corporală ridicat). Crește riscul de cancer uterin cu aproximativ 1%. De asemenea, crește cu aproximativ 1% riscul de afectare a retinei, erupții cutanate, leucoree, depresie, leziuni hepatice și dureri tumorale crescute. Fii pregătit pentru bufeuri și subțierea părului. În prezența metastazelor osoase poate precipita hipercalcemia (excesul de calciu din sânge). Activitatea tamoxifenului poate fi redusă de anumite medicamente (de exemplu, inhibitori selectivi ai recaptării serotoninei [ISRS]), care sunt inhibitori puternici ai enzimei citocromului P450 Cyp2D6, care este implicată în activarea medicamentului. Effexor poate fi prescris pentru bufeuri.

Cred că este înțelept să alegeți opțiuni naturiste pentru dispoziție, cum ar fi 5-HTP.

Acupunctura reduce bufeurile bine, iar efectul persistă după tratament. Includeți acupoint LV-2. Unele surse se îngrijorează cu privire la combinarea dozei mici de naltrexonă și tamoxifen, dar nu pot intelege de ce.

Melatonina este extrem de sinergică, reduce riscurile și întărește blocajul hormonal.

Uleiul GLA (acid gamma linolenic) din uleiul de boragă sau evening primrose la 2,8 grame pe zi îmbunătățește eficacitatea prin reducerea expresiei receptorilor estrogenului.

Quercitina îmbunătățește eficacitatea prin creșterea biodisponibilității.

Vitamina E și seleniul în doze moderate vor îmbunătăți eficacitatea.

Vitamina A este deosebit de utilă, extinzând timpii de remisie și îmbunătățind ratele de răspuns.

Regulatorul de energie Coenzima Q-10 face ca Tamoxifenul să fie mai eficient prin creșterea expresiei genei supresoare tumorale a manganului super-oxid dismutază MnSOD.

Coenzima Q-10, vitamina B2 riboflavina și B3 ca niacină sau ca niacinamidă, reduce metilarea ADN-ului și induce enzimele de reparare a ADN-ului, sporind eficacitatea Tamoxifenului.

Un supliment multivitamine pe zi este o modalitate bună de a obține vitamina A, seleniu, vitamine B și vitamina E în echilibrul corect.

Este important să controlați factorul de creștere asemănător insulinei IGF-1, care interacționează puternic cu receptorii de estrogen și terapia cu tamoxifen. Aceasta înseamna adoptarea dietei cu indice glicemic redus.

Indolul-3-carbinol (I3C) sau analogul său diindolilmetan (DIM) sunt complementare în cazurile de cancer de sân ER + receptor estrogen pozitiv, deoarece suprimă activitatea receptorilor estrogeni printr-o cale de semnalizare diferită, crescând arestarea ciclului de creștere a celulelor canceroase.

Utilizarea alimentelor din soia cu Tamoxifen a fost o controversă, dar dovezile recente indică un grad ridicat de sinergie. Aportul ridicat de alimente din soia este asociat cu o reducere suplimentară cu 60% a riscului de apariție a cancerului de sân la femeile tratate cu tamoxifen.

Aportul ridicat este de peste 40 mg de izoflavone din soia zilnic. O țintă mai bună este de 60 până la 80 mg.

Nu utilizați suplimente de genesteină, utilizați doar surse de hrană.

Nu combinați Tamoxifen cu doze mari de vitamina D (peste 5.000 UI zilnic), flavenoizi precum tangeritina sau grapefruit, rădăcina de cohosh negru Cimicifuga racemosa, sunătoarea Hypericum perfoliatum sau florile de trifoi roșu Trifolium repens, inclusiv tonicul pe bază de plante Hoxsey.

Fumatul trebuie oprit, iar alcoolul trebuie minimizat.

Prevenirea metastazelor canceroase induse de chirurgie / operatie

Life Extension Magazine®

Emisiune: decembrie 2009

Într-un raport cutremurător, Life Extension® dezvăluie modul în care operatia/ chirurgia convențională face ca cancerul primar să se răspândească (metastaze). Un nou program este dezvăluit care prezintă pașii practice pe care pacienții îi pot face înainte de operație pentru a preveni reapariția cancerului și metastazarea.

De Steven Nemeroff, ND.

Prevenirea metastazelor canceroase induse de chirurgie

Articolul pe care urmează să-l citești este cutremurător. Oferă date copleșitoare și convingătoare că operația în sine este o cauză semnificativă a metastazelor.

Vestea bună este că au fost identificate o mare varietate de metode pentru a proteja împotriva recurenței și metastazelor induse chirurgical. Înarmat cu aceste cunoștințe, un pacient cu cancer poate urma pași simpli înainte de timp pentru a-și îmbunătăți dramatic șansele de vindecare Există atât de multe date convingătoare furnizate în articolul următor încât ar putea fi extinse într-o carte întreagă!

Ați crede că chirurgii de cancer ar descoperi acest lucru ei înșiși. La urma urmei, tot ce este discutat în capitolul următor se bazează pe ceea ce este publicat în literatura științifică revizuită de la egal la egal/ peer to peer. Din păcate, mentalitatea liniei de asamblare a medicilor convenționali duce prea des la aceste decizii importante. După cum veți citi, este esențial ca alegerile corecte să fie luate înainte de operație pentru a obține beneficii optime.

Dorința noastră sinceră este că capitolul următor va educa nu numai pacienții, ci și chirurgii lor într-un mod care va revoluționa modul în care sunt planificate și efectuate intervențiile chirurgicale în viitor. Dacă sunteți un pacient recent diagnosticat cu cancer, sugestiile făcute în acest articol sunt disponibile chiar acum pentru a reduce complicațiile dureroase și care pot pune viața în pericol, protejând în același timp împotriva metastazelor induse chirurgical și reapariției tumorii primare.

Chirurgia / operatia  Cancerului: Ce trebuie să știți înainte de timp

Înlăturarea chirurgicală a tumorii primare a fost piatra de temelie a tratamentului pentru marea majoritate a cazurilor de cancer. Motivul acestei abordări este simplu: dacă puteți scăpa de cancer, pur și simplu îndepărtându-l din corp, atunci se poate realiza o vindecare. Din păcate, această abordare nu ține cont de faptul că, după operație, cancerul se va metastaza frecvent (răspândit la diferite organe). Frecvent, recurența metastatică este mult mai gravă decât tumora inițială. De fapt, pentru multe tipuri de cancer, reapariția metastatică – și nu tumora primară – se dovedește a fi fatală. 1

Într-o ironie șocantă, un corp din ce în ce mai mare de dovezi științifice a dezvăluit că chirurgia cancerului poate crește riscul de metastaze.  Aceasta ar zbura în fața gândirii medicale convenționale, dar faptele sunt incontestabile.

Pentru a înțelege mai bine modul în care intervenția chirurgicală poate crește riscul de metastaze, să discutăm mai întâi procesul efectiv al metastazelor canceroase. O secvență complicată de evenimente trebuie să apară pentru ca cancerul să se răspândească în altă parte a corpului. 2 Celulele canceroase izolate care se desprind de tumora primară trebuie să rupă mai întâi țesutul conjunctiv care înconjoară imediat cancerul. Odată ce celula canceroasă s-a rupt de țesutul conjunctiv din jur, următorul pas este să intre într-un vas de sânge sau limfatic. Acest lucru este mai ușor spus decât făcut, deoarece intrarea într-un vas de sânge necesită celula canceroasă să secrete enzime care degradează membrana subsolului vasului de sânge. 3 Intrarea într-un vas de sânge este de o importanță vitală pentru celula cancerului metastatic aspirant, deoarece folosește fluxul sanguin ca autostradă pentru transportul către alte organe vitale ale corpului – cum ar fi ficatul, creierul sau plămânii – unde poate forma o noua tumoră mortală

Celulele canceroase îngrijesc circulă în capilare (vasul de sânge) înconjurat de globule roșii.
Celulele canceroase care circulă în capilare (vasul de sânge) înconjurat de globule roșii.

Acum, când celulele canceroase singulare au intrat în cele din urmă în fluxul sanguin, problemele sale abia au început. Călătoria în fluxul sanguin poate fi o călătorie periculoasă pentru celulele canceroase. Turbulența din sângele în mișcare rapidă poate deteriora și distruge celulele canceroase. Mai mult, celulele canceroase trebuie să evite detectarea și distrugerea din globulele albe care circulă în fluxul sanguin.

Pentru a-și finaliza călătoria, celula canceroasă trebuie să respecte mucoasa vasului de sânge, unde se degradează și iese din membrana subsolului vasului de sânge. Sarcina sa finală este de a împrăștia prin țesutul conjunctiv din jur pentru a ajunge la organul care este destinația sa finală. Acum, celula canceroasă se poate înmulți și forma o colonie în creștere, care servește ca temelie pentru un nou cancer metastatic. Timpul lucrează împotriva acestor celule canceroase solitare. Întreaga secvență de evenimente trebuie să se întâmple rapid, deoarece aceste celule au o durată de viață limitată. 1

Acum vedem că metastaza cancerului este un proces complicat și dificil. Plini de pericol, foarte puține celule canceroase independente supraviețuiesc acestei călătorii dificile. 2 Probabilitatea ca celulele canceroase să supraviețuiască acestei călătorii și să formeze metastaze noi poate fi crescută cu orice poate servi acest proces.

Într-un studiu inovator publicat în jurnalul medical Annals of Surgery în 2009, cercetătorii au raportat că chirurgia cancerului în sine poate crea un mediu în organism care scade mult obstacolele pentru metastaza cu care celulele canceroase trebuie să se confrunte în mod normal.

La fel de interesant este revelația că operatia/ chirurgia cancerului poate produce o cale alternativă de metastaze care ocolește barierele naturale. În timpul operației de cancer, îndepărtarea tumorii perturbă aproape întotdeauna integritatea structurală a tumorii și / sau vasele de sânge care alimentează tumora. Acest lucru poate duce la o dispersie neobstrucționată a celulelor canceroase în fluxul sanguin sau la semănarea acestor celule canceroase direct în piept sau abdomen. 4-7 Această „alternativă” indusă de chirurgie poate simplifica mult calea către metastaze.

Pentru a ilustra, un studiu publicat în British Journal of Cancer în 2001 a comparat supraviețuirea femeilor cu cancer de sân care și-au îndepărtat tumorile chirurgical, cu supraviețuirea femeilor cu cancer de sân care nu au avut o intervenție chirurgicală. După cum era de așteptat, concluziile au stabilit că operația a îmbunătățit substanțial supraviețuirea în primii ani.

Cu toate acestea, analiza ulterioară a datelor a determinat că femeile care au avut o intervenție chirurgicală au avut un ‘ varf ‘ în riscul de deces la opt ani, ceea ce nu a fost evident în grupul care nu a avut o intervenție chirurgicală.  În interpretarea lor a rezultatelor, autorii studiului au declarat: „O ipoteză rezonabilă pentru a explica modelele observate ale funcțiilor de pericol [riscul de deces prin cancer] este să presupunem că… eliminarea chirurgicala a tumorii primare poate duce la accelerarea bruscă a procesului metastatic. …

Un alt grup de cercetători care au comentat un studiu care examinează tratamentul chirurgical al cancerului de colon au fost mult mai îndrăzneți în concluziile lor: „Această constatare susține cu tărie faptul că operația modifică cursul natural al bolii prin alungirea speranței de viață în cea mai mare parte a populației de pacienți, dar de asemenea, prin scurtarea simultană a supraviețuirii într-un subset de pacienți mai mic. Astfel, atât probele experimentale, cât și cele clinice susțin că operația, deși reduce foarte mult masa tumorală și potențial curativă, în mod paradoxal, poate crește și dezvoltarea metastazelor ” 

Având în vedere aceste constatări tulburătoare, ce pot face persoanele supuse unei intervenții chirurgicale pentru cancerele lor pentru a se proteja de un risc crescut de metastaze? O strategie utilă ar fi examinarea tuturor mecanismelor prin care chirurgia promovează metastazarea și apoi crearea unui plan cuprinzător care să contracareze fiecare dintre aceste mecanisme.

CE TREBUIE SĂ ȘTIȚI: CHIRURGIA CANCERULUI
  • Ar trebui să ne cunoaștem: chirurgia cancerului

    Înlăturarea chirurgicală a cancerului oferă, de obicei, cea mai bună șansă de supraviețuire fără boală.

  • Un număr tot mai mare de dovezi sugerează că operația de cancer în sine poate crește riscul de metastază (răspândit în alte zone) prin numeroase mecanisme, inclusiv: creșterea aderenței celulelor canceroase, suprimarea funcției imunitare, promovarea angiogenezei și stimularea inflamației.
  • Deoarece boala metastatică este adesea mai mortală decât tumora inițială, este important să se utilizeze strategii de prevenire pentru a preveni metastaza cancerului.
  • Pașii pentru a preveni metastaza cancerului includ: combaterea aderenței celulelor canceroase, susținerea sănătății imunitare, sporirea supravegherii imunitare, inhibarea angiogenezei, minimizarea inflamației și alegerea chirurgilor și anesteziologilor care utilizează tehnici avansate care pot reduce riscul metastatic.
  • Anumiți nutrienți, medicamente, tipuri de anestezie și tehnici chirurgicale sunt asociate cu riscul redus de metastază.

Chirurgia crește aderența celulelor canceroase

Un mecanism prin care chirurgia crește riscul metastazelor este prin îmbunătățirea aderenței celulelor canceroase. Celulele canceroase care s-au desprins de tumora primară utilizează aderența pentru a le stimula capacitatea de a forma metastaze în organele îndepărtate. Aceste celule canceroase trebuie să se poată aglomera și să formeze colonii care se pot extinde și crește. Este puțin probabil ca o singură celulă canceroasă să formeze o tumoare metastatică, la fel cum este puțin probabil ca o persoană să formeze o comunitate înfloritoare. Celulele canceroase folosesc molecule de adeziune – cum ar fi galectina-3 – pentru a le facilita capacitatea de a se aglomera. Prezente pe suprafața celulelor canceroase, aceste molecule acționează ca velcro, permițând celulelor canceroase independente să se adere între ele. 10 celule canceroase care circulă în fluxul sanguin utilizează, de asemenea, molecule de aderență de suprafață de galectină-3 pentru a se fixa pe căptușirea vaselor de sânge. 11 Aderența celulelor tumorale circulante (CTC) la pereții vaselor de sânge este un pas esențial pentru procesul de metastază. La fel cum o persoană care alunecă pe un deal înghețat nu are nicio speranță de a se opri dacă nu se poate apuca de ceva, o celulă canceroasă care nu poate respecta peretele vaselor de sânge va continua să rătăcească prin fluxul de sânge incapabil să formeze metastaze. Imposibil să se lase pe peretele vasului de sânge, aceste celule tumorale care circulă devin ca „nave fără port” și nu sunt în stare să se andocheze. În cele din urmă, globulele albe care circulă în fluxul sanguin vor viza și distruge CTC. Dacă CTC se leagă cu succes de peretele vasului de sânge și își croiește drumul prin membrana subsolului, atunci vor folosi molecule de aderență galectin-3 pentru a adera la organ pentru a forma un nou cancer metastatic. 10

Combaterea aderenței celulelor canceroase

Din păcate, cercetările au arătat că operația cancerului crește aderența celulelor tumorale. Într-un experiment care a imitat condițiile chirurgicale, oamenii de știință au raportat că legarea celulelor canceroase la pereții vaselor de sânge a fost crescută cu 250%, comparativ cu celulele canceroase care nu sunt expuse la interventii chirurgicale. Prin urmare, este foarte important ca persoana supusă unei intervenții chirurgicale să ia măsuri care să contribuie la neutralizarea creșterii aderenței celulelor canceroase indusă de chirurgie. Din fericire, un supliment natural numit pectină citrică modificată (MCP) poate face acest lucru. Pectina citrică – un tip de fibră dietetică – nu este absorbită din intestin. Cu toate acestea, pectina citrică modificată a fost modificată astfel încât să poată fi absorbită în sânge și să-și exercite efectele anti-cancer. Mecanismul prin care pectina de citrice modificată inhibă aderența celulelor canceroase este prin legarea la moleculele de aderență de galectină-3 de pe suprafața celulelor canceroase, împiedicând astfel celulele canceroase să se lipească și să formeze un cluster. 13 Pectina citrică modificată poate, de asemenea, să inhibe celulele tumorale care circulă de la blocarea vaselor de sânge. Acest lucru a fost demonstrat printr-un experiment în care pectina citrică modificată a blocat aderarea galectinei-3 la garnitura vaselor de sânge cu un uimitor 95%. Pectina citrică modificată a scăzut în mod substanțial aderența celulelor canceroase de sân la pereții vaselor de sânge. 13

Combaterea aderenței celulelor canceroase

Cercetări impresionante au documentat puterea pectinei citrice modificate pentru a inhiba direct metastaza cancerului. Într-un studiu publicat în Jurnalul Institutului Național al Cancerului, pectina citrică modificată a fost administrată șobolanilor care au fost injectați cu celule canceroase de prostată, în timp ce șobolanii care nu primesc pectină citrică modificată au servit ca grup de control. Metastaza pulmonară a fost observată în 93% din grupul martor, în timp ce doar 50% din grupul de pectină citrică modificată a prezentat metastaze pulmonare. Și mai demn de remarcat a fost constatarea că gruparea de pectină citrică modificată a avut o reducere cu 89% a mărimii coloniilor metastatice, comparativ cu grupul martor. 14 Într-un experiment similar, șoarecii injectați cu celule canceroase de melanom care au fost alimentate cu pectină citrică modificată au prezentat o reducere mai mare de 90% a metastazelor pulmonare, comparativ cu grupul de control. 15

După aceste descoperiri interesante în cercetarea animalelor, pectina citrică modificată a fost apoi pusă la încercare la bărbații cu cancer de prostată. În acest studiu, 10 bărbați cu cancer recurent de prostată au primit pectină citrică modificată (14,4 g pe zi). După un an, s-a observat o îmbunătățire considerabilă a progresiei cancerului, determinată de o reducere a ritmului la care nivelul antigenului specific al prostatei (PSA) a crescut. 16 Aceasta a fost urmată de un studiu în care 49 de bărbați cu cancer de prostată de diferite tipuri au primit pectină citrică modificată pentru un ciclu de patru săptămâni. După două cicluri de tratament cu pectină citrică modificată, 22% dintre bărbați au prezentat o stabilizare a bolii sau îmbunătățirea calității vieții; 12% au avut boală stabilă mai mult de 24 de săptămâni. Autorii studiului au ajuns la concluzia că „MCP (pectină citrică modificată) pare să aibă impacturi pozitive, în special în ceea ce privește beneficiile clinice și calitatea vieții pentru pacienții cu tumoră solidă mult avansată” 17.

Vă rugăm să vă amintiți că acești subiecți ai studiului cancerului de prostată au suferit deja de boli avansate. S-ar părea mai logic dacă acești pacienți ar fi inițiat suplimentarea modificată cu pectină de citrice înainte de procedurile chirurgicale pentru a preveni stabilirea coloniilor metastatice, așa cum s-a făcut în studiile de laborator de succes.

Prevenirea supresiei imunitare indusă de chirurgie

În plus față de pectina citrică modificată, un medicament bine-cunoscut poate fi de asemenea un rol pivot în reducerea aderenței celulelor canceroase. Cimetidina – cunoscută în mod obișnuit ca Tagamet® – este un medicament folosit în mod istoric pentru ameliorarea arsurilor la stomac. Un corp în creștere de dovezi științifice a dezvăluit că cimetidina deține și o activitate puternică anti-cancer. Cimetidina inhibă aderența celulelor canceroase prin blocarea expresiei unei molecule adezive – numită E-selectină – pe suprafața celulelor care acoperă vasele de sânge. 15 celule canceroase se fixează pe E-selectina pentru a adera la captuseala vaselor de sânge. 18 Prin prevenirea expresiei E-selectinei, cimetidina limitează semnificativ capacitatea aderării celulelor canceroase la pereții vaselor de sânge. Acest efect este analog eliminării velcro din pereții vaselor de sânge, care ar permite, în mod normal, celulele tumorale circulante să se lege.

Efectele puternice anti-cancer ale Cimetidinei au fost afișate clar într-un raport publicat în Jurnalul Britanic al Cancerului în 2002. În acest studiu, 64 de pacienți cu cancer de colon au primit chimioterapie cu sau fără cimetidină (800 mg pe zi) timp de un an. Supraviețuirea de 10 ani pentru grupul cimetidinei a fost de aproape 90%. Acest lucru este în contrast puternic cu grupul de control, care a avut o supraviețuire de 10 ani de doar 49,8%. Remarcabil, pentru acei pacienți cu o formă mai agresivă de cancer de colon, supraviețuirea de 10 ani a fost de 85% la cei tratați cu cimetidină, comparativ cu un 23% neplăcut din grupul de control. 19 Autorii studiului au concluzionat: „Luate împreună, aceste rezultate au sugerat un mecanism care stă la baza efectului benefic al cimetidinei asupra pacienților cu cancer colorectal, probabil prin blocarea expresiei E-selectinei pe endoteliul vascular [căptușirea vaselor de sânge] și inhibarea adeziunea celulelor canceroase. Aceste rezultate au fost sustinute de un alt studiu realizat la pacientii cu cancer colorectal in care cimetidina administrata doar pentru sapte zile la momentul interventiei chirurgicale a crescut supravietuirea de trei ani de la 59% la 93%! 20

Aceste date oferă un caz convingător pentru pacienții cu cancer, cu cel puțin cinci zile înainte de operație, pentru a ingera cel puțin 14 grame de pectină citrică modificată și 800 mg de cimetidină zilnic. Acest regim de combinație poate fi urmat timp de un an sau mai mult pentru a reduce riscul metastatic.

Prevenirea supresiei imunitare indusă de chirurgie

Rolul esențial pe care îl are sistemul imunitar în combaterea cancerului nu poate fi supraevaluat. Deși există multe aspecte ale sistemului imunitar care intră în joc atunci când luptă împotriva cancerului, predomină rolul celulei ucigătoare naturale. Celulele killer naturale (NK) sunt un tip de celule albe din sânge însărcinate să caute și să distrugă celulele canceroase. Cercetările au arătat că celulele NK pot recunoaște și ucide spontan o varietate de celule canceroase. 21

Pentru a ilustra importanța activității celulelor NK în combaterea cancerului, un studiu publicat în revista Breast Cancer Research and tratament a examinat activitatea celulelor NK la femei la scurt timp după operația pentru cancerul de sân. Cercetătorii au raportat că nivelurile scăzute de activitate a celulelor NK au fost asociate cu un risc crescut de deces din cauza cancerului de sân. De fapt, reducerea activității celulelor NK a fost un predictor mai bun al supraviețuirii decât stadiul real al cancerului. Într-un alt studiu alarmant, persoanele cu activitate de celule NK reduse înainte de operația pentru cancer de colon au avut un risc crescut de 350% de metastaze în următoarele 31 de luni! 23

Probabilitatea unei metastaze induse de chirurgie impune ca sistemul imunitar să fie extrem de activ și vigilent în căutarea și distrugerea celulelor canceroase renegate în perioada perioperatorie (timpul imediat înainte și după operație). Tragic, numeroase studii au documentat că chirurgia cancerului are ca rezultat o reducere substanțială a activității celulelor NK. 6,7,24,25 Într-o investigație cu implicații nefavorabile , activitatea celulelor NK la femeile care au efectuat o intervenție chirurgicală pentru cancer de sân a fost redusă cu peste 50% în prima zi după operație. 24 Având în vedere aceste dovezi crescânde, un grup de cercetători au declarat: „Prin urmare, credem că la scurt timp după operație, chiar și disfuncția imunitară tranzitorie ar putea permite neoplasmelor [cancerului] să intre în următoarea etapă a dezvoltării și să formeze în final metastaze” 7.

Procedura chirurgicală în sine reduce activitatea NK. Acest efect de afectare a celulelor NK care apare imediat după operație nu s-a putut întâmpla într-un moment mai rău posibil. Activitatea celulelor NK se estompează atunci când este nevoie cel mai mult de a combate metastaza. Riscul crescut de metastază indus de chirurgie, combinat cu o reducere a activității celulelor NK poate avea consecințe dezastruoase pentru persoana supusă unei intervenții chirurgicale de cancer. Cu acest lucru, perioada perioperatorie prezintă o fereastră de oportunitate pentru consolidarea activă a funcției imunitare prin îmbunătățirea activității celulelor NK. Din fericire, numeroase intervenții nutraceutice, farmaceutice și medicale cunoscute pentru a îmbunătăți activitatea celulelor NK sunt disponibile persoanei care urmează o intervenție chirurgicală împotriva cancerului.

Un supliment natural proeminent care poate crește activitatea celulelor NK este PSK, (polizaharidă K legată de proteine) un extract special preparat din ciuperca Coriolus versicolor. PSK sa dovedit a spori activitatea celulelor NK în mai multe studii. 26-29 Capacitatea PSK de a spori activitatea celulelor NK ajută la explicarea motivului pentru care s-a demonstrat că îmbunătățește dramatic supraviețuirea la pacienții cu cancer. De exemplu, 225 de pacienți cu cancer pulmonar au primit radioterapie cu sau fără PSK (3 grame pe zi). Pentru cei cu cancer de stadiu 3 mai avansat, de peste trei ori mai mulți indivizi care au luat PSK au fost în viață după cinci ani (26%), comparativ cu cei care nu au luat PSK (8%). PSK a dublat supraviețuirea de cinci ani la acei indivizi cu boala din stadiul 1 sau 2 mai puțin avansată (39% vs.17%). 30

Un grup de pacienți cu cancer de colon au fost randomizați pentru a primi chimioterapie sau chimioterapie plus PSK, care a fost luat timp de doi ani. Grupul care a primit PSK a avut o supraviețuire excepțională de 10 ani de 82%. Din păcate, grupul care a primit chimioterapie singur a avut o supraviețuire de 10 ani de doar 51%. 31 Într-un studiu similar raportat în Jurnalul Britanic al Cancerului în 2004, pacienții cu cancer de colon au primit chimioterapie singura sau combinata cu PSK (3 grame pe zi) timp de doi ani. În grupul cu cancer de colon în stadiul 3 mai periculos, supraviețuirea de cinci ani a fost de 75% în grupul PSK. Aceasta comparativ cu o supraviețuire de cinci ani de doar 46% în grupul care a primit chimioterapie. 32 Cercetările au confirmat că PSK îmbunătățește, de asemenea, supraviețuirea în cancerele de sân, stomac, esofag și uter. 33-36

Alte nutraceutice care au fost documentate pentru a crește activitatea celulelor NK sunt usturoiul, glutamina, IP6 (inozitol hexafosfat), AHCC (compusul corelat cu hexos activ) și lactoferrina. Un experiment efectuat la șoareci cu cancer de sân a constatat că suplimentarea cu glutamină a dus la o scădere cu 40% a creșterii tumorii în pereche cu o creștere de 2,5 ori a activității celulelor NK. 40

Îmbunătățirea supravegherii imunitare cu vaccinuri contra cancerului

Oamenii de știință din Germania au explorat efectele extractului de vâsc asupra activității celulelor NK la 62 de pacienți supuși unei intervenții chirurgicale pentru cancer de colon. Participanții au fost randomizați pentru a primi o perfuzie intravenoasă de extract de vâsc imediat înainte să li se administreze anestezie generală sau li sa administrat anestezie generală. Măsurătorile activității celulelor NK au fost luate înainte și la 24 de ore de la operație. După cum era de așteptat, grupul care nu a primit vâsc a experimentat o reducere de 44% a activității celulelor NK la 24 de ore de la intervenția chirurgicală. Interesant, oamenii de știință au raportat că grupul care a primit vâsc nu a cunoscut o scădere semnificativă a activității celulelor NK după operație. Au continuat că „perfuzia perioperatorie de extracte de vâsc poate preveni o suprimare a activității celulelor NK la pacienții cu cancer” 42.

Produsele farmaceutice utilizate pentru creșterea activității celulelor NK includ factorul de stimulare a coloniilor interferon-alfa și granulocit-macrofag. S-a demonstrat că aceste medicamente previn supresia imunitară indusă de intervenție chirurgicală atunci când au fost administrate perioperator. 43,44 Un alt medicament stimulant imunitar care trebuie luat în considerare în mediul perioperator poate fi interleukina-2. 45

Cu cel puțin cinci zile înainte de intervenția chirurgicală, ar părea logic să instituie un program natural de îmbunătățire a celulelor killer (NK) care implică nutrienți precum PSK, lactoferină, glutamină și altele. Medicamente precum interleukina-2 și factorul de stimulare a coloniei granulocite-macrofage sunt aprobate în Statele Unite, dar asigurările de sănătate nu le acoperă de obicei în scopurile perioperatorii sugerate aici.

Îmbunătățirea supravegherii imunitare cu vaccinuri contra cancerului

O abordare medicală ilustrată pentru tratamentul cancerului implică utilizarea de vaccinuri împotriva cancerului. Conceptul este același cu utilizarea vaccinurilor pentru boli infecțioase, cu excepția faptului că vaccinurile tumorale vizează celulele canceroase în loc de virus. O altă caracteristică distinctivă a vaccinurilor tumorale este că, în timp ce vaccinurile virale sunt create dintr-un virus generic, vaccinurile tumorale sunt autologe, adică sunt produse din celulele canceroase proprii ale unei persoane, îndepărtate în timpul operației. Aceasta este o distincție critică, deoarece pot exista diferențe genetice considerabile între cancere. Acest vaccin împotriva cancerului extrem de individualizat amplifică foarte mult capacitatea sistemului imunitar de a identifica și viza orice celule de cancer reziduale prezente în organism. Vaccinurile contra cancerului oferă sistemului imunitar markeri de identificare specifici ai cancerului, care pot fi apoi folosiți pentru a susține un atac cu succes împotriva celulelor canceroase metastatice.

Vaccinurile împotriva cancerului autolog au fost studiate pe scară largă, rezultatele cele mai încurajatoare fiind notate în studiile clinice randomizate, controlate, incluzând peste 1.300 de pacienți cu cancer colorectal în care au fost administrate vaccinuri tumorale după operație. Aceste studii au raportat rate de recurență reduse și supraviețuire îmbunătățită. Spre deosebire de chimioterapia, care poate provoca efecte secundare severe și toxicitate, vaccinurile împotriva cancerului sunt o terapie blândă, cu o siguranță dovedită pe termen lung. 47

Într-un studiu reper raportat în 2003, 567 de persoane cu cancer de colon au fost randomizate pentru a primi operație singură sau chirurgie combinată cu vaccinuri derivate din propriile celule canceroase. Supraviețuirea mediană pentru grupul de vaccin contra cancerului a fost de peste 7 ani, comparativ cu supraviețuirea mediană de 4,5 ani doar pentru grupul care a primit chirurgie. Supraviețuirea de cinci ani a fost de 66,5% în grupul de vaccin contra cancerului, ceea ce a scăzut cu 45,6% supraviețuirea la cinci ani doar pentru grupul care a primit chirurgie. 48 Această diferență clară în supraviețuirea de cinci ani arată clar puterea vaccinurilor împotriva cancerului individualizate de a concentra foarte mult imunitatea propriei persoane de a viza și de a ataca celulele canceroase reziduale metastatice.

Celulele canceroase ale sânului.
Celulele canceroase ale sânului.

Chirurgia cancerului, angiogeneza și metastaza

Cancerele folosesc o strategie inteligentă în căutarea lor de a crește și prospera în interiorul corpului. Angiogeneza este procesul prin care se formează noi vase de sânge din vasele de sânge preexistente. Formarea de noi vase de sânge este un proces normal și necesar pentru creșterea și dezvoltarea copilăriei, precum și pentru vindecarea rănilor. Din păcate, cancerele deturnează acest proces altfel normal pentru a crește aportul de sânge la tumoare. Formarea de noi vase de sânge care furnizează tumora este o cerință absolută pentru metastazarea reușită, deoarece tumorile nu pot crește peste dimensiunea unui cap de pin (adică 1-2 mm) fără a-și extinde aportul de sânge. 49,50

Ar putea fi surprinzător să aflăm că prezența tumorii primare servește la inhibarea creșterii cancerului metastatic în altă parte a corpului. Tumora primară produce factori anti-angiogeni care restricționează creșterea metastazelor. 51-54 Acești factori anti-angiogeni inhibă formarea de noi vase de sânge în siturile potențiale ale metastazelor. Din păcate, eliminarea chirurgicală a cancerului primar are ca rezultat și eliminarea acestor factori anti-angiogeni, iar creșterea metastazelor nu mai este inhibată. Odată cu ridicarea acestor restricții, acum este mai ușor pentru site-urile mici de cancer metastatic să atragă noi vase de sânge care promovează creșterea lor. 55 Într-adevăr, preocupări importante pentru încurajarea cercetării îngrijirii și declararea „… eliminarea tumorii primare ar putea elimina sau proteja împotriva angiogenezei și, astfel, o treză micrometastază latentă [site-uri mici de cancer metastatic]” 7.

Ca și cum să pierdeți angiogene de tumori primare nu sunt suficiente pentru rezolvarea problemelor, dacă este necesară operațiunea pentru a crea o situație angiogenă. După operație, niveluri de factori care cresc angiogeneza – cunoscute și sub denumirea factorului de creare endotelială vasculară – sunt semnificativ crescute. Poate produce o formare mai mare de noi va avea o îngrijire mai mare poate oferi zonă de cancer metastatică. Un grup de oameni de știință și rezumat pentru cercetare este destul de bine când se poate afirma „după operatie, echilibrul angiogen al factorilor proveniți și antiangiogene este schimbat în favoarea angiogenezei pentru o facilități pentru vindecarea rănilor. Mai ales niveluri de factor de creare endotelială vasculară (VEGF) sunt crescute persistente.Poate fi posibil să beneficieze de recuperări tumorii și de formare bolii metastatice, dar, de asemenea, să conducă activitatea micrometastazelor în stare latentă. ” 2

Chirurgia cancerului

Având în vedere nevoia cancerului metastatică a unui mobilier în expansiune, inhibarea angiogenezei ar fi acordată o parte integrantă a unei strategii cuprinzătoare de combatere a unui metastazelor induse de chirurgie. În acest scop, este demonstrat pentru diferențierea nutrienților inhibați de VEGF. Printre acestea sunt numără izoflavonele de soia (genisteină), silibinina (o componentă a cardului de gât), crizina, galata de epigalocatechină (EGCG) din ceaiul verde și curcumina. 56-62

Într-un experiment, EGCG – constituentul activ al ceaiului verde – a fost administrat administrarea șoareci cu cancer de stomac. Rezultatele au demonstrat că EGCG a redus masa tumorii cu 60%, reducând în același timp concentrația vaselor de îngrijire a sănătății alimentează tumora cu 38%. Remarcabil, EGCG a scăzut expresia VEGF în celulele canceroase cu un uimitor 80%! Autorii studiului au concluzionat „EGCG inhibă creșterea cancerului gastric prin reducerea producției de VEGF și este angiogeneză și este un candidat promițător pentru tratamentul anti-angiogenic al cancerului gastric.” 56

În ceea ce privește evaluarea cercetărilor, este posibil să se efectueze efectele anti-angiogene ale curcuminei, cercetările din Școala Universității din Medicină din Emory și menționează că „Curcumina este un inhibitor direct asupra angiogenezei și, de asemenea, reglează diverse proteine ​​proangiogene precum factorul de creare endotelială vasculară. .. ”În plus, oamenii de știință au remarcat,„ Moleculele de adeziune celulare sunt reglate în angiogeneză activă, iar curcumina poate bloca acest efect, adăugând dimensiuni suplimentare eficiente antiangiogene pe curcuminei ”. În concluzie, ei au comentat că „efectul Curcuminului este prelucrat general asupra angiogenezei unui potențial compunere enormă pentru medicamente antiangiogene.” 44

Cu cinci zile înainte de operațiune, pacientul poate lua în considerare suplimentar cu un extract standardizat de ceai verde, curcumină, extract de genisteină de soia și nutriți pentru VEGF și, astfel, poate fi protejat și preveni angiogeneza.

Alegerea anesteziei chirurgicale poate influența metastaza

Abordarea medicală convențională a anesteziei chirurgicale a favorizează anestezia generală în timpul intervenției chirurgicale, urmărirea morfină intravenoasă după intervenția chirurgicală pentru controlul durerii. Cu toate acestea, abordarea convențională nu poate fi abordată optim pentru prevenirea metastazelor induse de chirurgie. Utilizarea morfinei imediat după operație poate pune probleme semnificative. Într-un moment în care funcțiile de îngrijire ale sistemului imunitar sunt deja suprimate, morfina slăbește și mai multă imunitar prin prime diminuarea activității celulelor NK. 63 anestezia chirurgicala a fost demonstrata ca slăbeste activitatea celulelor NK. 64Un studiu a descoperit că morfina a crescut angiogeneza și a stimula creșterea cancerului de sân la șoareci. Cercetări au ajuns la concluzia: „rezultatele obținute pot avea efecte clinice în favoarea morfinei și ar putea fi furnizate informații legate de cancer dependente de angiogeneză.” 65

Alegerea anesteziei chirurgicale poate influența metastaza

Având în vedere problemele inerente asociate cu acordarea de morfină și anestezie, cercetări și explorare alte abordări ale anesteziei chirurgicale și ale controlului durerilor. O abordare inedită este o anestezie generală convențională care poate combina cu anestezia regională, îngrijirea se referă la anestezie îngrijire afectează doar o anumită parte a corpului. Beneficiile obținute pot fi abordate de două ori ori: trebuie să fie anesteziei regionale care să reducă cantitatea de anestezie generală necesară în timpul funcționării, precum și cantitatea de morfină necesară pentru intervenția chirurgicală pentru controlul durerii. 55

Puteți aborda elegant un anesteziei chirurgicale și un control al durerilor valabile în studiile științifice. Într-un experiment, șoarecii canceroși au primit o intervenție chirurgicală cu anestezie generală sau combinați cu anestezie regională. Oamenii de știință au raportat despre adăugarea anesteziei regionale la anestezia generală „atenuează în mod semnificativ promovarea metastazelor prin chirurgie”. 66

Colegiul de Medicină al Universității de Stat din Pennsylvania și a comparat celulelor NK pacienților ce primesc anestezie generală sau regională pentru intervenție chirurgicală abdominală. Activitatea celulelor NK a scăzut substanțial în grupul anesteziei generale, în timp ce se poate pune celulelor NK în favoarea păstrării nivelului preoperator în grupul anestezie regională primară. 67 Bazându-se pe scurte concluzii încurajatoare, cercetări și apoi pot examina apoi daca anestezia regională poate afecta metastazarea care presupune o intervenție chirurgicală pentru cancerul de sân. Într-un studiu de pionierat, 50 de femei care se îngrijesc sau operează de cancer de sân cu anestezie generală combinată cu anestezie regională și au fost comparate cu 79 femei ce au primit anestezie generală în timpul operațiunii de cancer de sân, cu urmărirea morfinării pentru controlul durerii. Tipul de anestezie regională se poate folosi de un număr paravertebral, de îngrijire presupune o injecție anestezică locală în mediul nervos spinali între oasele vertebrale ale coloanei vertebrale. După o perioadă de urmărire a aproape trei ani, au fost observate diferențele dramatice dintre cele două grupuri. Doar 6% dintre femeile ce au  primit anestezie regională au prezentat recurenta, comparativ cu un risc de 24% reapariție metastatică în grupul de ce nu primit anestezii  locale. Altfel spus, femeile ce  au primit anestezie regională și generală au avut un risc scăzut cu 75% de cancer metastatic.A determinat cercetătorii să proclame ca anestezia regională pentru chirurgia cancerului de sân „reduce riscul semnificativ de reaparitie sau metastaze în primii ani de după intervenția chirurgicală.”55

Centrul Medical al Universității Chirurgie de la Duke și a analizat anestezia regională singură cu anestezia generală pentru îngrijirea femeilor și intervenția chirurgicală pentru cancerul de sân. Chirurgii au raportat că, în timp ce 39% din grupul de anestezie generală este necesar un medicament necesar pentru greață și vărsături, doar 20% din grupul regional de anestezie și care a avut nevoie de acest medicament. Narcotica a fost necesară pentru controlul durerilor după intervenția chirurgicală în 98% din grupul de anestezie generală, comparativ cu doar 25% din grupul regional de anestezie. Și 96% dintre îngrijirile pentru femei au primit anestezie regională și se întorc în fața unei operații, comparativ cu 76% dintre îngrijirile pentru femei și primesc anestezie generală.Chirurgii au ajuns la concluzia că anestezia regională „poate fi folosită pentru a efectua operațiuni majore pentru cancerul de sân cu complicații minime … Cel mai important, prin reducerea grețurilor, vărsăturilor și o durerii chirurgicale, blocul paravertebral [anestezie regională] funcționalități necesare Recuperarea operativă pentru pacienți pentru tratarea cancerului de sân, oferind astfel pacientului posibilitatea de a se întoarce acasă când mai devreme după operație. “68

Rezultatele unor studii și au o importanță importantă pentru cei care susțin o intervenție chirurgicală contra cancerului, după cum un grup de cercetări a anunțat cu entuziasm: „Întrucât tehnicile regionale [anestezie]… sunt disponibile pentru a fi implementate, sunt prea importante și nu putem oferi nici o mai mare măsură în anestezie. generală, ar fi să fie ușor pentru anestezisti să le punem în vedere, reducând astfel riscul reapariției bolii și metastazelor. ” 55

În cele din urmă, cei care au nevoie de morfină pentru controlul durerilor de operatie pot lua în considerare să solicite medicament lor un medicament numit tramadol. Spre deosebire de morfină, tramadolul nu suprima funcție imunitară. 69 Dimpotrivă, s-a demonstrat că tramadolul stimulează utilizarea celulelor NK. Într-un experiment, tramadolul a blocat formarea metastazelor pulmonare induse de intervenție chirurgicală șobolani. Tramadol a prevenire, de asemenea, suprimarea chirurgicală indusă de către celulelor NK. 

Imagine microscopică a carcinomului renal.
Imaginează-ți microscopică o carcinomului renal

Chirurgia mai puțin invazivă reduce riscul de metastaze

Chirurgia pune un stres fizic enorm asupra corpului. Există dovezi științifice considerabile care sustin ca pentru interventiile chirurgicale ce sunt foarte puțin invazive – și, prin urmare, mai puțin traumatice – există un risc mai mic de metastaze, în comparație cu chirurgia mai invazivă și traumatică. Chirurgia laparoscopică este un vârf de chirurgie minim invazivă, în îngrijirea operațiunii din abdomen, pelvis și alte regiuni se pot păstra incizii mici, în comparație cu inciziile mult mai mari, în chirurgie tradițională de „deschidere”.

Un studiu publicat în prestigioasa revistă medicală Lancet este comparata o intervenție chirurgicală deschisă  cu una laparoscopică pentru o îndepărtare a o parte din colon (colectomie) la pacienții cu cancer de colon. Spre deosebire de  grupă ce a primit intervenție chirurgicală tradițională deschisă, grupa de chirurgie laparoscopică a avut un risc scăzut cu 61% de reaparitie a cancerului, cu un risc scăzut de deces cu 62%. Chirurgii au ajuns la concluzia că colectomia laparoscopică este mai eficientă fata de colectomia deschisă pentru tratarea cancerului de colon, evaluată prin reapariția tumorii și supraviețuirea legată de cancer. 71O monitorizare pe termen lung a acestor pacienti  (în perioada mediană de 95 de luni) a raportat  scădere cu 56% a riscului de deces înregistrat din cauza cancerului de colon pentru chirurgie laparoscopică în comparație cu operația tradițională deschisă. 72 O altă comparație a chirurgiei laparoscopice cu chirurgie deschisă pentru cancerul de colon a raportato rată de supraviețuire de cinci ani de 64,1% pentru grupul laparoscopic și rată de supraviețuire de cinci ani de 58,5% pentru îngrijirea grupului a primit intervenție chirurgicală deschisă. 73

Chirurgia minimă invazivă a produs imbunatatirea substanțială în supraviețuirea celor cu cancer pulmonar. Chirurgie toracoscopică video-asistată (VATS), sau intervenție chirurgicală minim invazivă, comparativ cu chirurgie tradițională deschisă pentru îndepărtarea tumorilor pulmonare (lobectomie): Supraviețuirea a cinci ani a cancerului pulmonar a fost de 97% în grupul VATS. Acest lucru contrastează foarte mult cu 79% supraviețuire de cinci ani în grupul de chirurgie deschisa. 74

Comentarii despre utilizarea intervențiilor chirurgicale minim invazive pentru cancerul pulmonar,  chirurgii de la Centrul Medical Cedars-Sinai au declarat ca intervenția chirurgicală minim invazivă pentru cancerul pulmonar „… poate fi efectuata în regulă, cu avantaje dovedite față de toracotomie convențională [chirurgie toracică] pentru lobectomie: incizii mai mici, scăzute dureri postoperatorii, … scăderea pierderii de sânge, păstrarea mai bună a funcției pulmonare și venerarea anterioară a activării normale ... Dovezile din literatura de specialitate sunt cele mai îngrijite să demonstreze că VATS poate oferi o rată redusă de complicații și o mai bună supraviețuire. „ 75

ADMINISTRAREA CHIMIOTERAPIEI ȘI A RADIOTERAPIEI ÎNAINTE DE OPERAȚIE
Medicii din Școala de Medicină a Universității din Carolina de Nord și studiază posibilitatea de a combina radiații și chimimioterapiei înainte de intervenție chirurgicală pentru persoane cu cancer de esofag. Douăzeci și șase de pacienti  au efectuat DOAR  operatie , în timp ce 30 de pacienți au acordat radiații și chimioterapie urmată de intervenție chirurgicală. Grupul cu un tratament combinat a avut o supraviețuire de cinci ani de 39%, în timp ce grupul operație supraviețuire de cinci ani de doar 16%. 99

Un studiu publicat în New England Journal of Medicine în 2006 a  comparat  operatie monoterapie  cu tratament pentru chimio – administrarea înainte sau dupa operatie – relațiile cu cancerul de stomac sau esofagian. Supraviețuirea a cinci ani pentru grupul de îngrijire chirurgicală primară și chimioterapie un grad de 36%, comparativ cu supraviețuire de cinci ani de 23%  a grupului cu o chirurgie primară monoterapie. 100

Cercetarea susține, de asemenea, chimioterapii și radioterapii în timpul perioadei de operare critică. Într-un studiu, 544 de pacienți cu cancer de stomac au chimioterapie primara și radioterapie combinată pe scurt timp după operație. Comparație de supraviețuire cu un grup similar de 446 de pacienți cu cancer de stomac tratat doar cu intervenție chirurgicală. Chimioterapia postoperatorie și radiația postoperatorii au dus la  o creștere dramatică supraviețuirii. Grupul ce se tratează doar cu o intervenție chirurgicală care a avut o supraviețuire medie de doar 62,6 luni, comparativ cu media supraviețuire de 95,3 luni, grupul de îngrijire a radiațiilor și chimioterapiii primare postoperatorii . 101 Un studiu similar a demonstratat de asemenea, o supraviețuire importantă pentru a permite radiațiilor și chimioterapiei postoperatorii  comparative cu chirurgia monoterapie

Exista si legat de aceste terapii riscuri de metastazare si nu numai…demonstrate din ce in ce mai des in ultima vreme Întrucât decesul cauzat de cancer este cel mai frecvent rezultatul bolii metastatice, este crucial să se minimizeze această facilitare. ”55

Inflamatii si metastaze

Chirurgia cancerului a determinat sau produce o cantitate de substanțe chimice inflamatorii, cum ar fi interleukina-1 și interleukina-6. 76-78 de substanțe chimice sunt cunoscute pentru crearea unui ciclu de oxigenazei-2 (COX-2). COX-2, puternic inflamator, îmbină un rol esențial în promovarea creșterilor canceroase și metastazelor.

Acest lucru este evident intr-un articol ce apare în revista Cancer Research care a constatat la nivelurile de COX-2 în celulele canceroase canceroase sunt de 60 de ori mai mari decât în ​​celulele pancreatice normale. 79 Niveluri de COX-2 au fost de 150 de ori mai mari în celulele canceroase ale indivizilor cu cancer de cap și gât, comparativ cu țesutul normal al voluntarului sănătoși. 80 COX-2 alimentează creșterea cancerului prin stimularea formării de noi vază de îngrijire a sănătății alimentează tumora. 81,82 COX-2 creează aderența celulelor canceroase pe pereții vaselor de sânge, 83Puteți avea, de asemenea, capacitatea celulelor de a reduce metastaza. Experimentați șoareci și relevate pentru că celulele canceroase ale colonului ce exprimă niveluri ridicate de COX-2 metastazați liber la ficat, în timp ce celulele canceroase  ale colonului ce exprimă niveluri scăzute de COX-2 nu au metastazat la ficat. 83

Influența adversă a COX-2 asupra creșterii și evoluției cancerului a fost evidentă într-un studiu publicat în revista Clinical Cancer Research în 2004. Două sute optzeci și opt de persoane care au suferit o intervenție chirurgicală pentru cancer de colon și-au examinat tumorile pentru prezența COX -2. Rezultatele au fost alarmante – atunci când au fost controlați alți factori, grupul ale cărui cancere testate pozitiv pentru prezența COX-2 au avut un risc mai mare de deces cu 311% în comparație cu grupul ale cărui cancere nu au exprimat COX-2.84 Un studiu ulterior la plămâni pacienții cu cancer au descoperit că cei cu niveluri tumorale ridicate de COX-2 au avut o supraviețuire medie de numai 15 luni, în timp ce cei cu un nivel scăzut de tumori de COX-2 au avut o supraviețuire mediană de 40 de luni.85

Având în vedere aceste descoperiri, cercetătorii au început să investigheze efectele anti-cancer ale medicamentelor inhibitoare de COX-2. Deși inițial utilizat pentru afecțiuni inflamatorii, cum ar fi artrita, medicamentele inhibitoare de COX-2 s-au dovedit a deține o activitate anti-cancer puternică. De exemplu, 134 de pacienți cu cancer pulmonar avansat au fost tratați doar cu chimioterapie sau combinate cu Celebrex® (un inhibitor al COX-2)..

Poate cea mai impresionantă afișare a efectelor anti-metastazice ale medicamentelor inhibitoare de COX-2 a fost prezentată la conferința anuală a Societății Americane de Oncologie Clinică din 2008. În acest studiu, incidența metastazelor osoase la pacienții cu cancer de sân au luat un Inhibitorul COX-2 timp de cel puțin șase luni după diagnosticul cancerului de sân a fost comparat cu incidența metastazelor osoase la pacienții cu cancer de sân care nu au luat un inhibitor de COX-2. În mod remarcabil, cei care au fost tratați cu un inhibitor de COX-2 aveau aproape 80% mai puține șanse de a dezvolta metastaze osoase decât cei care nu au fost tratați cu un medicament inhibitor de COX-2.88

Antiinflamatoarele nesteroidiene (AINS), cum ar fi aspirina și ibuprofenul, sunt inhibitori ai COX. Utilizarea pe scară largă a AINS pentru durere și artrită a creat un mediu ideal în care să se examineze dacă aceste medicamente pot preveni cancerul. Studii la scară largă au documentat o reducere substanțială a riscului de cancer odată cu utilizarea AINS. O revizuire cuprinzătoare a literaturii științifice (91 de studii publicate) a raportat că utilizarea pe termen lung a AINS (în principal aspirină) a dus la reducerea riscului de 63% pentru cancerul de colon, 39% pentru cancerul de sân, 36% pentru cancerul pulmonar, 39% pentru cancer de prostată, 73% pentru cancerul esofagian, 62% pentru cancerul de stomac și 47% pentru cancerul ovarian. „Această revizuire oferă dovezi convingătoare că un aport regulat de AINS care … blocează COX-2 protejează împotriva dezvoltării multor tipuri de cancer”, au concluzionat autorii.89

Sunt cunoscute o serie de suplimente nutritive și pe bază de plante care inhibă COX-2. Printre acestea se numără curcumina, resveratrolul, vitamina E, izoflavonele de soia (genisteină), ceaiul verde (EGCG), quercetina, uleiul de pește, usturoiul, pestele și silimarina (ciulinul de lapte) .58,90-97

Oamenii de știință de la Memorial Sloan-Kettering Cancer Center din New York au creat o creștere indusă experimental a activității COX-2 în celulele sânului uman, care a fost complet prevenită prin resveratrol. Resveratrol a blocat producerea de COX-2 în celulă, precum și blocarea activității enzimei COX-2.98

Alegerea anesteziei chirurgicale poate influența metastaza

Concluzie
Un grup de experți remarcați în domeniul metastazelor induse de chirurgie au declarat că tratamentul cancerului „… necesită excizia chirurgicală a tumorii primare pentru a scuti pacientul de sarcina majoră a tumorii, care este principala sursă de mutare și metastazare a celulelor. Cu toate acestea, împreună cu beneficiile sale evidente, procedura chirurgicală a fost sugerată să implice pericole grave, deoarece eliberează celulele tumorale în circulație sau in limfa, promovează secreția factorilor angiogeni și de creștere și induce suprimarea IMC [funcție imunitară]. Aceste consecințe facilitează sinergic stabilirea de noi metastaze și dezvoltarea de micrometastaze preexistente. Întrucât decesul cauzat de cancer este cel mai frecvent rezultatul bolii metastatice, este crucial să se minimizeze această facilitare. ”55

Remarcând în continuare, ei au comentat că „Luate împreună, este evident că perioada perioperatorie prezintă multe riscuri; Cu toate acestea, este, de asemenea, momentul ideal pentru combaterea MRD [număr mic de celule canceroase rămase după operație] pentru a reduce recurența și metastazele viitoare. Astfel, acești oameni de știință cred că „… este esențial să folosești intervenții preventive în acest timp critic.” În plus , ei insistă ca, „în mod ideal, fiecare aspect problematic al intervenției chirurgicale să fie tratat atunci când pacienții oncologici sunt supuși rezecției [chirurgiei] pentru a reduce la minimum recidiva și răspândirea metastatică.” 55

Înarmată cu cunoștințele discutate în acest articol, persoana cu cancer poate profita de toate beneficiile pe care le are chirurgia cancerului

În cazul în care există o întrebare necesară despre informațiile despre informații despre articol, vă rugăm să ne punem la dispoziție un specialist în Extensia de Viață® la 1-866-864-3027.

Referințe
1. J Surg Oncol. 2006 iulie 1; 94 (1): 68-80.

2. Ann Surg. 2009 mai; 249 (5): 727-34.

3. Cancer Metastasis Rev. 2004 ian; 23 (1-2): 119-35.

4. Immun Behav Immun. 2003 Feb; 17 Supliment 1S27-S36.

5. Ann Surg. 2000 iul; 232 (1): 58-65.

6. Chirurgie. 1998 sept. 124 (3): 516-25.

7. Ann Surg Oncol. 2003 Oct; 10 (8): 972-92.

8. Br J Rac. 2001 17 august; 85 (4): 490-2.

9. J Surg Res. 2002 sept. 107 (1): 1-6.

10. Cancer Metastasis Rev. 1987; 6 (3): 433-52.

11. J Biol Chem. 2007 5 ianuarie; 282 (1): 773-81.

12. Int J Cancer. 2004 20 decembrie; 112 (6): 943-50.

13. J Natl Cancer Inst. 2002 18 decembrie; 94 (24): 1854-62.

14. J Natl Cancer Inst. 1995 1; 87 (5): 348-53.

15. J Natl Cancer Inst. 1992 18 mart; 84 (6): 438-42.

16. Cancerul de prostată Disostatice. 2003; 6 (4): 301-4.

17. Clin Med Oncol. 2007; 1: 73-80.

18. Cancer Res. 2008 1 iul; 68 (13): 5167-76.

19. Br J Cancer. 2002 21 ianuarie; 86 (2): 161-7.

20. Lancet. 1994 24 decembrie; 344 (8939-8940): 1768-9.

21. Știință. 1981 2 oct; 214 (4516): 24-30.

22. Tratamentul cu cancerul de sân. 2000 Apr; 60 (3): 227-34.

23. Int Surg. 1997 Apr; 82 (2): 190-3.

24. Br J Surg. August 1993; 80 (8): 1005-7.

25. Immun Behav Immun. 2007 mai; 21 (4): 395-408.

26. Oncol Rep. 2006 Apr; 15 (4): 861-8.

27. Anticancer Res. 2002 mai; 22 (3): 1737-54.

28. Imunol pentru cancer. 2001 iunie; 50 (4): 191-8.

29. Int J Clin Lab Res. 1999; 29 (4): 135-40.

30. Cancer Detect Prev. 1997; 21 (1): 71-7.

31. Cancer Biother Radiopharm. 2008 august; 23 (4): 461-7.

32. Br J Rac. 2004 8 martie; 90 (5): 1003-10.

33. Gan Nu Rinsho. 1986 Feb; 32 (2): 181-5.

34. Lancet. 1994 mai 7; 343 (8906): 1122-6.

35. Gan To Kagaku Ryoho. 1988 nov; 15 (11): 3143-51.

36. Rac. 1992 15 noiembrie; 70 (10): 2475-83.

37. J Nutr. 2006 mart; 136 (3 suplimente): 816S-820S.

38. Carcinogeneza. 1989 sept. 10 (9): 1595-8.

39. J Citronă Interferon Res. 2006 iulie; 26 (7): 489-99.

40. J Surg Res. 1996 iunie; 63 (1): 293-7.

41. J Hepatol. 2002 iulie; 37 (1): 78-86.

42. Forsch Komplementmed. 2007 Feb; 14 (1): 9-17.

43. Br J Surg. 2001 Apr; 88 (4): 539-44.

44. Adv Exp Med Biol. 2007; 595: 185-95.

45. Hepatogastroenterologie. 2002 Mar-Apr; 49 (44): 385-7.

46. ​​Ann Oncol. 2005 iunie; 16 (6): 847-62.

47. Adv Cancer Res. 2006; 95: 147-202.

48. World J Gastroenterol. 2003 mar; 9 (3): 495-8.

49. Ribatti D. Istoria cercetării asupra angiogenezei tumorale. Springer, 2009: 9.

50. Neuro Oncol. 2005 Apr; 7 (2): 106-21.

51. Rac J Eur. 2005 mar; 41 (4): 508-15.

52. Curr Mol Med. 2003 noiembrie; 3 (7): 643-51.

53. Ann Chir Plast Esthet. 2000 august; 45 (4): 485-93.

54. Presse Med. 1998 4-11 iul; 27 (24): 1221-4.

55. Dis de sân. 2006; 26: 99-114.

56. World J Gastroenterol. 2007 Feb 28; 13 (8): 1162-9.

57. Clin Hemorheol Microcirc. 2006; 34 (1-2): 109-15.

58. Gut. 2008 nov; 57 (11): 1509-17.

59. J Nutr Biochem. 2007 iunie; 18 (6): 408-17.

60. Rac. 2004 1 ianuarie; 100 (1): 201-10.

61. Planta Med. 2006 iunie; 72 (8): 708-14.

62. J Surg Res. 2003 iulie; 113 (1): 133-8.

63. Am J Ther. 2004 sept. 11 (5): 354-65.

64. Anesth Analg. 2003 nov; 97 (5): 1331-9.

65. Cancer Res. 2002 1 august; 62 (15): 4491-8.

66. Anestezie. 2001 iunie; 94 (6): 1066-73.

67. Am J Surg. 1996 ian; 171 (1): 68-72.

68. Ann Surg. 1998 Apr; 227 (4): 496-501.

69. J Huazhong Univ Sci Tehnolog Med Sci. 2006; 26 (4): 478-81.

70. J Neuroimmunol. 2002 august; 129 (1-2): 18-24.

71. Lancet. 2002 29 iunie; 359 (9325): 2224-9.

72. Ann Surg. 2008 iulie; 248 (1): 1-7.

73. Arcul Surg. 2008 sept. 143 (9): 832-9.

74. Ann Thorac Surg. 2000 nov; 70 (5): 1644-6.

75. Thorac Surg Clin. 2007 mai; 17 (2): 223-31.

76. Br J Surg. 1992 aug; 79 (8): 757-60.

77. Rectum Dis Colon. 2003 Feb; 46 (2): 147-55.

78. Citokine. 2003 Dec 21; 24 (6): 237-43.

79. Cancer Res. 1999 1 martie; 59 (5): 987-90.

80. Cancer Res. 1999 1 martie; 59 (5): 991-4.

81. Celulă. 1998 29 mai; 93 (5): 705-16.

82. Mol Cancer Ther. 2003 ian; 2 (1): 1-7.

83. Cancer Res. 2002 1 martie; 62 (5): 1567-72.

84. Clin Cancer Res. 2004 15 decembrie; 10 (24): 8465-71.

85. Int J Cancer. 2005 1 iulie; 115 (4): 545-55.

86. J Clin Oncol. 2008 20 februarie; 26 (6): 848-55.

87. Clin Cancer Res. 2006 Apr 1; 12 (7 Pt 1): 2172-7.

88. http://www.asco.org/ASCOv2/Meetings/Abstracts?&vmview=abst_detail_view&confID=55&abstractID=31561.

89. Oncol Rep. 2005 Apr; 13 (4): 559-83.

90. Mol Carcinog. 2006 mai; 45 (5): 309-19.

91. Ann NY Acad Sci. 1999; 889: 214-23.

92. J Biol Chem. 1998 21 august; 273 (34): 21875-82.

93. Carcinogeneza. 2007 Apr; 28 (4): 809-15.

94. Mutat Res. 2004 13 iul; 551 (1-2): 245-54.

95. Biochem Biophys Res Commun. 1996 24 septembrie; 226 (3): 810-8.

96. Prostaglandine Leucot Acizi grași esențiali. 1995 Dec; 53 (6): 397-400.

97. Biochemul celulelor Mol. 2008 iunie; 313 (1-2): 53-61.

98. J Biol Chem. 1998 21 august; 273 (34): 21875-82.

99. J Clin Oncol. 2008 1 mar; 26 (7): 1086-92.

100. N Engl J Med. 2006 iulie 6; 355 (1): 11-20.

101. Int J Radiat Oncol Biol Phys. 2005 1 dec; 63 (5): 1279-85.

102. N Engl J Med. 2001 6 septembrie; 345 (10): 725-30.

Utilizarea glucanilor și a proteoglucanilor ciupercilor medicinale în tratamentul cancerului.

Abstract

Imunoceuticele pot fi considerate substanțe cu eficacitate imunoterapeutică atunci când sunt administrate pe cale orală. Peste 50 de specii de ciuperci medicinale au dat potențial imunoceutic care prezintă activitate anticancer în vitro sau în modele animale și dintre acestea, șase au fost cercetate clinic  în cancerul uman. Toate sunt non-toxice și sunt foarte bine tolerate.

Lentinanul și schizofilanul au o activitate orală mică.

Compusul corelat cu hexos activ (AHCC) este slab definit, dar a arătat o promisiune clinică timpurie. 

Fracțiunea D Maitake are o dovadă limitată a eficacității clinice până în prezent, dar cercetările controlate sunt în desfășurare. 

Doi proteoglicani de la Coriolus versicolor – PSK (Polizaharidă-K) și PSP (Polizaharidă-Peptidă) au demonstrat cea mai mare promisiune.

În studiile japoneze începând cu 1970, PSK a extins semnificativ supraviețuirea la cinci ani sau mai mult în cancerele stomacului, colon-rect; esofag, nazofaringe și plămâni (tipuri de celule non-mici) și într-un subset de cancer de sân pozitiv HLA B40.PP a fost supus studiilor de faza II și faza III în China.

În studiile dublu-orb, PSP s-a prelungit semnificativ de cinci ani supraviețuirea în cancerul esofagian PSP a îmbunătățit în mod semnificativ calitatea vieții, a furnizat o ameliorare substanțială a durerii și îmbunătățirea statutului imunitar la 70-97 la sută dintre pacienții cu cancer de stomac, esofag, plămâni, ovar și col uterin. PSK și PSP au stimulat producția de celule imune , ameliorat simptomele chimioterapiei și îmbunătățirea infiltrării tumorii prin celulele T dendritice și citotoxice. terapia de scădere le face foarte potrivite pentru regimurile de gestionare a cancerului.

PMID: 
10696116
[Indexat pentru MEDLINE]

O revizuire cuprinzătoare a chimiei, surselor și biodisponibilității acizilor grași Omega-3

Abstract

Acizii grași Omega-3, unul dintre elementele cheie ale membranelor celulare, prezintă un interes deosebit pentru oamenii de știință de mai mulți ani. Cu toate acestea, este considerat doar un grup mic dintre cei mai importanți acizi grași polinesaturați omega-3. Această revizuire completă prezintă o secțiune transversală largă și relativ completă de cunoștințe despre acizii grași mononesaturați si polinesaturati omega-3, și o prezentare a modificărilor acestora. Acest lucru este important, deoarece toate aceste subgrupuri joacă, fără îndoială, un rol important în funcția organismelor. Unele omega-3 monosaturate sunt precursoare ale feromonelor la insecte. Polinesaturatele cu un lanț foarte lung se găsesc în mod obișnuit în sistemul nervos central și testiculele mamifere, în organismele cu bureți și sunt, de asemenea, agenți imunomodulatori. Numeroase modificări ale acizilor omega-3 sunt hormonii vegetali. Structura lor chimică, legarea chimică (în triacilgliceroli, fosfolipide și esteri etilici) și biodisponibilitatea au fost discutate pe scară largă, indicând o corelație între ultimele două. O atenție deosebită se acordă metodelor eficiente de suplimentare și este prezentată o listă detaliată a surselor de acizi omega-3, cu referire minuțioasă la alimentele disponibile în general. Sunt luate în considerare atât căile de administrare orală, cât și cele parenterale, iar transportul omega-3 prin bariera sânge-creier este menționat. Având în vedere diferite obiceiuri alimentare, se discută despre interacțiunile dintre aportul de acizi grași alimentari. Acizii Omega-3 sunt foarte susceptibili la oxidare, iar condițiile de depozitare duc adesea la o creștere dramatică a acestei expuneri. Prin urmare, efectul oxidării asupra biodisponibilității acestora este prezentat pe scurt.

1. Chimia acizilor grași Omega-3

Acizii grași Omega-3, numiți acizi grași n- 3 sau acizi grași ω-3 ( n -3 FA), sunt un grup eterogen de acizi grași cu o dublă legătură între a treia și a patra atomă de carbon de la capătul metilic (din ω − 1 atom de carbon). În general, distingem între ei acizii grași monoinsaturați (MUFA; o legătură dublă în lanțul de carbon) și acizii grași polinesaturați (PUFA; mai mult de o dublă legătură în lanțul de carbon – acestia ne intereseaza in cancer ). Acizii grași conjugați (CFA) sunt un subset de PUFA cu cel puțin o pereche de legături duble conjugate [ 1 ], adică legăturile duble nu sunt separate prin punți de metilen, ci o singură legătură. De asemenea, menționăm câteva exemple de acizi grași omega-3 modificați precum acizii grași hidroxi (HFAs), acizii grași oxo (acizii grași keto) și acidul gras hidroperoxi. Dintre acizii grași hidroxi, distingem acizii grași saturați sau nesaturați, constând dintr-un lanț de carbon lung, neramplat, cu o grupare carboxil la un capăt și una sau mai multe grupări hidroxi. Acizii grași oxo sau ceto sunt acizi grași care au atât o grupare carboxi, cât și o grupă cetonică sau aldehidică din moleculă. Acizii grași hidroperoxi, la rândul lor, poartă cel puțin o grupare hidroperoxi (-OOH) în moleculă. Unii autori găsesc termenii PUFAs cu lanț lung (LC) n -3 și acizi grași omega-3 identici în sens [ 2 ], care pot fi înșelători, deoarece „acizii grași omega-3” sunt un termen mai larg.

Am asumat ca toți acizii grași cu o dublă legătură la atomul de carbon ω-3 să fie acizi grași omega-3. Acizii grași Omega-3 prezintă izomerism cis – trans cu extensia sa la configurația E – Z [ 3 ]. Putem vorbi de izomerism geometric în cazul acizilor grași omega-3, deoarece doi atomi de carbon cu hibridizare sp2 conectați printr-o legătură dublă sunt legați de un atom de hidrogen și de un grup de atomi fiecare. Pentru a determina tipul de izomerie geometrică, la început alegem cei mai importanți doi substituenți – unul din stânga, al doilea din dreapta legăturii duble. În acizii grași, avem o singură grupă (de atomi) pe fiecare parte, deoarece cele două situri de legătură rămase ocupă un atom de hidrogen. În izomerul cis, aceste două grupuri sunt situate pe aceeași parte a planului de referință (planul care trece prin atomii conectați printr-o legătură dublă și perpendicular pe planul în care se află acești atomi și atomi direct asociați cu ei); în transizomer sunt în poziții contrare [ 4 ]. Sistemul E – Z este ceva mai detaliat. Plasarea reciprocă a substituenților este descrisă de regula Cahn-Ingold-Prelog (CIP). Cel mai important este substituentul al cărui atom se conectează direct la restul moleculei (direct cu atomul care formează legătura dublă) are un număr atomic mai mare (în cazul izotopilor, o masă atomică mai mare). Dacă în această poziție, în substituenții (pe partea dreaptă sau stângă a dublei legături), există atomi identici, atunci (pentru a alege un substituent de importanță mai mare), luăm în considerare atomii ulterior, alegând întotdeauna atomi cu cea mai mare atomică număr. Dacă un atom dat este conectat prin mai multe legături, legătura trebuie înlocuită cu numărul de legături unice adecvate pentru multiplicitatea sa – fiecare atom prezent la o legătură multiplă trebuie după transformare să aibă un număr corespunzător de legături unice (C = C = 2 × CC). Configurația „ E ” (de la entgegen, germană pentru „opus”) înseamnă că două grupuri cu prioritate CIP mai mare (una la stânga, a doua la dreapta de la legătura dublă) sunt pe laturile opuse ale dublei legături (în poziția sinperiplanar). Dacă acele grupuri se află pe aceeași parte a legăturii duble (în poziție antipiplanar), configurația este definită ca „ Z ” (de la zusammen, germană pentru „împreună”) [ 5 ]. Pentru simplitate, după mulți autori, am folosit termenii „ cis ” și „ Z” , precum și „ trans ” și „ E” în ​​mod interschimbabil. Izomerismul cis-trans al acizilor grași pare să joace un rol deosebit de important în conturarea activității lor chimice și biologice, un bun exemplu al acestora fiind diferitele proprietăți ale izomerilor conjugați ai acizilor grași [ 1 ].

Acizii grași care apar în mod natural au de obicei de la patru până la 28 de atomi de carbon. Cu toate acestea, multe dintre ele, în special cele găsite în creier, retină și spermatozoizi, au un lanț de carbon mai lung [ 6 , 7 , 8 ]. Acizii grași pot fi împărțiți, în funcție de lungimea lanțului de carbon, în patru grupe de bază:

  1. Acizii grași cu lanț scurt (SCFA), numiți uneori acizi grași volatili (VFA), conțin de la unu până la șase atomi de carbon (C1-6), formați ca urmare a fermentației carbohidraților de microbiota intestinală în tractul digestiv al mamiferelor. [ 9 ].

  2. Acizii grași cu lanț mediu (MCFA) au de la șapte până la 12 atomi de carbon (C7–12) [ 10 ]; conform altor surse, opt până la 14 atomi de carbon [ 11 ].

  3. Acizii grași cu lanț lung (LCFA) au de la 14 la 18 atomi de carbon (C14-18) și constituie majoritatea acizilor grași luați cu alimente (dietă) [ 12 ].

  4. Acizii grași cu catenă lungă (VLCFA) au coloane vertebrale care conțin mai mult de 20 de atomi de carbon (C> 20) [ 13 ] sau, după alți autori, nu mai puțin de 20 de atomi de carbon (C ≥ 20) [ 12 ] sau chiar mai mult de 22 atomi de carbon (C> 22) [ 14 , 15 , 16 ].

De asemenea, se pot distinge subgrupuri de acizi grași, cum ar fi acizii grași saturați cu catenă lungă (C ≥ 16) și acizii grași polinesaturați cu catenă lungă (LCPUFA / LC PUFAs; C ≥ 18). Deși acizii grași saturați cu lanț lung din dietă nu privesc în mod direct subiectul acestui articol, ei merită să fie distinși în clasificarea chimică generală datorită ușurinței de încorporare în țesutul adipos și, prin urmare, denumirea , semnificație dietetică specială [ 11 ]. Acizii grași cu nouă sau mai puțini atomi de carbon sunt în stare lichidă la temperatura camerei [ 10 ].

Cel mai important, dar mic grup de acizi grași pentru oameni sunt acizii grași esențiali (EFA), care sunt necesari pentru menținerea homeostaziei, nu pot fi sintetizați sau, mai degrabă, nu pot fi sintetizați suficient de către organism și trebuie să li se furnizeze alimente17 , 18 ]. Importanța acizilor grași în dieta animală a fost discutată de Osborne și Mendel [ 19 ] în 1920. În 1929 Burr și Burr [ 20 ] au dovedit în experimentele lor pe șobolani natura „esențială” a unor acizi grași. Unii autori consideră că toate PUFA-urile sunt acizi grași esențiali [ 21 ] și determină acidul linoleic (LA) și acidul alfa- linolenic (ALA) drept cele mai importante17 , 22 ], numindu-i „acizi grași esențiali părinți”23 , 24 ]. Alții au considerat numai acizii arahidoni și linoleici ca acizi grași esențiali datorită importanței lor pentru creșterea organismului și pentru menținerea integrității pielii [ 21 ]. Literatura de mamifere indică 23 de acizi ca fiind esențiali, în timp ce literatura acvatică citează doar două EFA-uri – EPA și DHA. Având în vedere importanța ARA, putem lua ARA, DHA și EPA ca fiind cele mai importante PUFA cu lanț lung la mamifere și pești25 ]. Unele animale le pot sintetiza folosind LA și ALA ca precursori25 , 26 ]. Cu toate acestea, acești precursori trebuie să fie disponibili în cantități suficiente25 ]. Gurr și Harwood [ 27 ] au detaliat „nutrienții esențiali” în contrast cu „metaboliții esențiali”. În lumina acestei presupuneri, „nutrienții esențiali” sunt precursorii „metaboliților esențiali” și nu pot fi sintetizați de organisme pentru care sunt „esențiali”. Cu toate acestea, „esențial” este un termen relativ – omul și șobolanii pot sintetiza LA și ALA de la 16: 2 n -6 și 16: 3 n -3 conținute în legumele verzi, adică în microalge, în condiții de disponibilitate definită a substratului28 , 29 , 30 , 31 ]. Având în vedere faptul că nu există date suficiente care să arate că orice PUFA individual este absolut necesar pe parcursul vieții, Cunnane a împărțit acizii grași esențiali în „condițional indispensabili” și „dispensabili condiționat” [ 32 , 33 , 34 ].

Cele mai importante date privind chimia și sursele de acizi grași omega-3 sunt incluse în tabelul 1 .

tabelul 1

Acizii grași Omega-3 – chimie și surse.

Nu Nume IUPAC Denumirea comună Scurt (formulă simplificată) Formulă moleculară Formula / Structura Greutate moleculară Surse [Ref.]
Acizii grași monosaturați (MUFA)
1 Acid (9 Z ) -decec-9-enoic Acid 9-lauroleic / acid lauroleic C12: 1 n -3 C12H22O2 Un fișier de îngrijire externă după ce vă imaginați, ilustrați etc. Numele obiectului este nutritiv-10-01662-i001.jpg 198.306 g / mol 0,08% din compoziția de acizi grași (total acizi grași liberi) din probe de brânză proaspătă și matură de brânză comercială (cu conținut complet de grăsimi) brânză tip manechin și 0,05% / 0,07% din aceleași probe de brânză (proaspete și mature), obținute din conținut scăzut de lapte gras / plin de grăsime, cu adăugare de 2 g ulei de avocado la 100 ml lapte [ 35 ]; 0,31% din acizii grași liberi din crema de zer bovin [ 36 ]
2 Acidul (9 E ) -decec-9-enoic C12: 1 n -3 C12H22O2 Îngrijirea externă a unui fișier conține imaginație, ilustrare etc. Numele obiectului este nutritiv-10-01662-i002.jpg 198.306 g / mol în acizii grași Peganum harmala (concentrație 0,31%) [ 37 ]
3 Acidul (11 Z ) -tradrad-11-enoic C14: 1 n -3 C14H26O2 Îngrijirea externă a unui fișier conține imaginație, ilustrare etc. Numele obiectului este nutritiv-10-01662-i003.jpg 226,36 g / mol un precursor al componentei feromonei sexuale în Ostrinia scapulalis [ 38 ]
4 Acidul (11 E ) -tetradec-11-enoic C14: 1 n -3 C14H26O2 Îngrijirea externă a unui fișier conține imaginație, ilustrare etc. Numele obiectului este nutritiv-10-01662-i004.jpg 226,36 g / mol 13,37% din uleiul esențial de frunze de Coriandrum sativum [ 39 ]; în Spodoptera littoralis [ 40 ]
5 Acidul (13 E / Z ) -hexadec-13-enoic C16: 1 n -3 C16H30O2 izomerism cis – trans nedefinit 254.414 g / mol în microalge — 1,39%, 3,12%, 0,23%, 1,33% din Dunaliella tertiolecta , Platimonas viridis , Nefrochloris salina și Phaeodactylum tricornutum , respectiv, acizi grași, de asemenea, prezenți în gonadele și larvele de stridii hrănite cu microalge menționate [ 41 ]
6 Acidul (13 E ) -hexadec-13-enoic C16: 1 n -3 C16H30O2 Un fișier de îngrijire externă după ce vă imaginați, ilustrați etc. Numele obiectului este nutritiv-10-01662-i005.jpg 254.414 g / mol în discurile de frunze Brassica napus – 3,35%, 1,06%, 1,19% din totalul acizilor grași PG (fosfatidilglicerol), PA (acid fosfatidic) și PC (fosfatidilcolină), respectiv, s-au găsit urme în fosfatidiletanolamină (PE) [ 42 ]; în molia Spodoptera littoralis [ 43 ]
7 Acidul (13 Z ) -hexadec-13-enoic C16: 1 n -3 C16H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i006.jpg 254.414 g / mol în microalga Heterosigma carterae [ 44 ]
8 (15 E / Z ) -octadec-15-enoic acid C18: 1 n -3 C18H34O2 izomerism cis – trans nedefinit 282,468 g / mol detectat în carne de porc (4,2 mg / 100 g acizi grași din șuncă proaspătă de porc adult, 4,8 mg / 100 g acizi grași din pânza de porc a adultului de porc) [ 45 ])
9 (15 Z ) -octadec-15-enoic acid C18: 1 n -3 C18H34O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i007.jpg 282,468 g / mol detectat în carne de vită (0,217% (pentru eșantioanele de vită alimentate cu iarbă) și 0,241% (pentru carnea de vită convențională) din masa totală de acizi grași) [ 46 ], lapte de vaci (0,146–0,56 g / 100 g de acizi grași totali, în funcție de dietă aplicată) și unt [ 47 ], și în sânge uman (abundență relativă pentru bărbați sănătoși – 0,04%) [ 48 ] și lapte uman (0,01–0,06% din acizii grași totali ai laptelui uman tranzițional și matur din cinci regiuni din China [ 49 ], 0,02–0,29% din greutatea acizilor grași din probele de lapte uman colectate de la femeile din Statele Unite {concetrația medie pentru ambii izomeri ( cis și trans ) – 0,06%} [ 50 ])
10 (15 E ) -octadec-15-enoic acid C18: 1 n -3 C18H34O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i008.jpg 282,468 g / mol detectat în laptele de vacă (0,102–0,34 g / 100 g de acizi grași totali, în funcție de dieta aplicată) și unt [ 47 ], 0–0,15% din greutatea acizilor grași din probele de lapte uman colectate de la femei din Statele Unite ( concetrarea medie pentru izomerii ambelor ( cis și trans ) – 0,06%) [ 50 ]
ACIDI GRASI POLIUNSATURATI (PUFA)
1 (11 Z , 13 Z ) -acid hexadeca-11,13-dienoic C16: 1 n -3 C16H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i009.jpg 252,398 g / mol în extractele glandei ( feromone) din viermele de portocală buric, Amyelois transitella [ 51 ]
2 Acid (7 Z , 10 Z , 13 Z ) -hexadeca-7,10,13-trienoic acid roughanic C16: 3 n -3 C16H26O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i010.jpg 250,382 g / mol ca ester metilic: 0,11–0,12% din uleiul de pește de pește european, 0,34–0,41% din uleiul obișnuit (în zonă (%)) [ 52 ]; 3, 1,1, 0,9, 6,6, 0,4, 4,1, 0,5, 0,5, 0,3, 0,1, 11,8% din varză chineză, varză albă, savuroasă, varză, varză roșie, varză de bruselă, conopidă, conopidă, suedeă, salată de varză, pătrunjel gras masa acidă [ 53 ] – denumirile sistematice au fost plasate pe linia „ a -acid linolenic”; în frunzele multor specii de conifere, majoritatea în Larix leptolepus și Taxus baccata – 4,8% și 5,8% din acizii grași ai vieții, respectiv [ 54 ]
3 (4 Z , 7 Z , 10 Z , 13 Z ) -hexadeca-4,7,10,13-acid tetraenoic C16: 4 n -3 C16H24O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i011.jpg 248.366 g / mol sub formă de 4,7,10,13-hexadecatenoenoat de metil: 0,09–0,1% din uleiul de shad Pontic, 0,08–0,16% din uleiul de pește european de wels, 0,11–0,56% din uleiul sumbru comun [ 52 ]
4 (8 Z , 11 Z , 14 Z ) -acid heptadeca-8,11,14-trienoic acid norlinolenic C17: 3 n -3 C17H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i012.jpg 264,409 g / mol în Salvia nilotica —0,4% din esteri mixți și 2,3% din fracția IV (% prin cromatografie lichidă cu gaz) [ 55 ]
5 (9 Z , 12 Z , 15 Z ) -octadeca-9,12,15-acid trienoic acidul α- linolenic C18: 3 n -3 C18H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i013.jpg 278.436 g / mol 0,2% din chimen negru ( Nigella sativa ) ulei din semințe acizi grași [ 56 ]; 8% din uleiul de semințe Cardiospermum halicabum total de acizi grași [ 57 ]; ca esteri metilici: 1,67% din acizii grași ai țesutului muscular Labeo rohita , 1,39% din acizii grași din țesutul muscular Cirrhinus mrigata , 1,29% din acizii grași din țesutul muscular Catla [ 58 ]; în produsele sărate de icre de pește: 0,7% din Ikura (somon), 0,4% din Tarako (pollock), 0,7% din Tobiko (pește zburător), 0,4% din totalul lipidelor Kazunoko (hering) [ 59 ]; 1,6–1,9% din ouăle de somon fracția totală de fosfolipide, 1-3,6% din ouăle de somon fracție totală de triacilglicerol [ 60 ]; 1,1% din sardina sălbatică ( Sardina pilchardus ) acizi grași totali ai mușchiului (1% din acizii grași din totalul mușchiului de sardină captiv), 0,7% din acizii grași totale din ficatul sălbatic / captiv [ 61 ]; 0,61–0,83% pentru uleiurile cu balena fină, 0,13–0,34% pentru uleiurile sigilante [ 62 ]; 0,5% din uleiul de ton [ 63 ]; 0,5% din triacilgliceroli musculare Epinephelus fasciatus , 0,1% din E. fasciatus PE și 0,1–0,2% din E. fasciatus PC, 0,1–0,5% din triacilglicerolii E. retouti , 0–0,1% din E. retouti PE și 0,1% din PC retouti E. [ 64 ]; 16,4 g / 100 g semințe de chia măcinate [ 65 ]; 21% din extractul de n-hexan din părțile aeriene Senna italica [ 66 ]; 40% din Chamaecyparis lawsoniana și 50% din Fokienia hodginsii totală acizi grași [ 67 ]; 64,04% din acizii grași din uleiul de semințe de chia ( Salvia hispanica ) [ 68 ]; 0,25 g / 100 g de esteri metilici ai acizilor grași ai grăsimii din lapte de la ovine, 2,57 g / 100 g din esteri metilici ai acizilor grași din grăsimi din lapte provenite din diete hrănite cu ovine cu suplimente de in extrudate (12% semințe de in în materie uscată) [ 69 ] ; 59,5, 57, 46,4, 50, 39,8, 58,7, 48,9, 41,9, 50,8, 54,6, 41,7, 10, 6, 8,5, 5,9% din varza chineză ( Brassica chinensis ), varză albă ( Brassica oleracea ), savoy ( Brassica oleracea var sabauda ), kale ( Brassica oleracea convar. acephala var. sabellica ), varză roșie ( Brassica oleracea var. capitata ), varză de brushete ( Brassica oleracea var. gemmifera ), conopidă ( Brassica oleracea convar. botrytis var. botrytis ), kohlrabi ( bothertis ). Brassica oleracea convar. Acephala var. Gongylodes ), suedeza ( Brassica napus var. Napobrassica ), salată de varză ( Lactuca sativa var. Capitata ), pătrunjel ( Petroselinum crispum ssp. Crispum ), salsif negru ( Scorzonera hispanica ), morcov ( Daucus carota ssp sativus ), pătrunjel cu rădăcină de napi ( Petroselinum crispum ssp. tuberosum ), fenicul Florență ( Foeniculum vulgare var. azoricum ), respectiv a masei de acizi grași; 8.7, 9.7, 11.5, 8.3, 10.2, 11.2, 9.3, 11, 12.3% din varză chineză, varză albă, savuroasă, varză, varză roșie, varză de Bruxelles, conopidă, cohrabil, suedeză, sarmalitate neagră, salată de varză, morcov, pătrunjel , Masa acizilor grași din semințe de florenă, respectiv [ 53 ]; în Trichosanthes kirilowii (33,77-38,66% din uleiurile din semințe) [ 70 ]; în Linum usitatissimum (în funcție de genotipul pe care îl conține de la 1,1 până la 65,2% din acizii grași totali din semințe) [ 71 ]; în paprika Capsicum annuum (29,93% din acizii grași pericarp proaspeți la soiul Jaranda și 30,27% în soiul Jariza) [ 72 ]
6 (9 E , 12 E , 15 E ) -octadeca-9,12,15-acid trienoic acid linolenelaidic / acid elaidolinolenic C18: 3 n -3 C18H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i014.jpg 278.436 g / mol la speciile de salvie turcească – Salvia virgata , Salvia potentillifolia , Salvia recognita , Salvia tomentosa se ridică la 0,4, 0,7, 1,1 și 1,4% din acizii grași din semințe, respectiv [ 73 ]; 0,03% din acizii grași din uleiul din semințe de tutun [ 74 ]
7 (9 Z , 11 E , 15 Z ) -octadeca-9,11,15-acid trienoic acidul rumelenic C18: 3 n -3 C18H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i015.jpg 278.436 g / mol în probe musculare de la miei hrăniți cu semințe de in [ 75 ]; 0,03 g / 100 g de esteri metilici ai acizilor grași din grăsimi din lapte de la ovine, 0,52 g / 100 g din esteri metilici ai acizilor grași din grăsimi din lapte provenite din diete hrănite cu oaie extrasă (12% semințe de in în materie uscată) [ 69 ]
8 (9 Z , 11 E , 15 E ) -octadeca-9,11,15-acid trienoic C18: 3 n -3 C18H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i016.jpg 278.436 g / mol 0,01 g / 100 g de esteri metilici ai acizilor grași din grăsimi din lapte de la ovine, 0,21 g / 100 g din esteri metilici ai acizilor grași din grăsimi din lapte provenite din diete hrănite cu oaie extrasă (12% semințe de in în materie uscată) [ 69 ]
9 (5 Z , 9 Z , 12 Z , 15 Z ) -octadeca-5,9,12,15-acid tetraenoic Acid coniferonic C18: 4 n -3 C18H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i017.jpg 276,42 g / mol găsit în multe specii de conifere: 0,05% din semințele de Abies fraseri acizi grași totali, 0,03% din A. nordmanniana ssp. acizi grași total din semințe de nordmanniana , 0,05% din acizii grași din semințele de A. numidica , 0,06% din acizii grași din semințele A. procedra , 0,05% din semințele de Tsuga chinensis acizi grași total, 0,09% din semințele de la Tsuga heterophylla acizi grași, 1,78% acizilor grași din semințele Pseudolarix amabilis [ 76 ]; 2% din Chamaecyparis lawsoniana și 2,8% din semințele de Fokienia hodginsii au acizi grași totale [ 67 ]; 11% din acizii grași din frunze Abies vejarii Martínez [ 77 ]
10 (6 Z , 9 Z , 12Z, 15 Z ) -octadeca-6,9,12,15-acid tetraenoic acid stearidonic (SDA) / acid moroctic C18: 4 n -3 C18H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i018.jpg 276,42 g / mol în produsele sărate de icre de pește: 0,8% din Ikura (somon), 0,8% din Tarako (polion), 0,4% din Tobiko (pește zburător), 0,4% din totalul lipidelor Kazunoko (hering) [ 59 ]; 2,3% din sardina sălbatică ( Sardina pilchardus ) acizi grași totali ai mușchiului (1,5% din acizii grași total ai mușchiului de sardină captivi), 0,7% din acizii grași din ficatul captivant / 0,6% din sardina captivă [ 61 ]; ca ester metilic: 0,57–0,76% din uleiul de barbă comun, 1,52-2,04% din uleiul de shad Pontic, 0,2–0,35% din uleiul de pește european pentru wels, 0,28–0,59% din uleiul sumbru comun [ 52 ]; 0,41–0,71% pentru uleiurile cu balena fină, 0,79–1,09% pentru uleiurile sigilate (în greutate la sută) [ 62 ]; 0–0.9% din triacilglicerolii musculari Epinephelus retouti [ 64 ]; cantități medii de esteri metilici ai acidului gras total: 4,73% pentru Primulaceae , 4,99% pentru Boraginaceae , 0,36% pentru Hippophae rhamnoides , 0,77% pentru Cannabis sativa [ 78 ]; în Ribes nigrum și uleiuri de pește [ 77 ]; 14% și 16,2% din Echium humil ssp. semințe de picnicanthum acizi grași, în funcție de locație [ 79 ]
11 (all- E / Z ) -octadeca-9,11,13,15-acid tetraenoic acid parinaric C18: 4 n -3 C18H28O2 izomerism cis – trans nedefinit 276,42 g / mol 11,34% din extractul de metanol de Spirogyra rizoide [ 80 ]
12 (9 Z , 11 E , 13 E , 15 Z ) -octadeca-9,11,13,15-acid tetraenoic acid α -parinaric (acid cis -parinaric) C18: 4 n -3 C18H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i019.jpg 276,42 g / mol 62% din estinii metilici ai uleiului de semințe de Parinarium laurinum [ 81 ]; 53,5% din uleiul de semințe de Parinarium laurinum acizi grași [ 66 ]; 4% din uleiul de semințe de Parinarium macrophyllum [ 82 ]; în Impatiens edgeworthii (48% din totalul acizilor grași) [ 83 ]; în Impatiens glandulifera (42,5% din uleiul Impatiens ) [ 84 ]; în uleiul de semințe din Sebastiana brasiliensis (21,4, 32,5 și 35,1 suprafață de vârf% din eșantioane din Parcul Național Turvo, regiunea Santana da Boa Vista și, respectiv, regiunea Cacapava do Sul) [ 85 ]; 30% din uleiul de semințe de balsamina Impatiens [ 86 ]; în Chrysobalanus icaco (10% din esteri metilici ai uleiului de semințe) [ 81 ]; ulei de primăvară de seară ( Oenothera biennis ) (3,5 × 10 −5 mol / L) [ 87 ]; în ulei de Borage dezbrăcat ( Borago officinalis ) (1,6 × 10 −4 mol / L) [ 82 ]
13 (9 E , 11 E , 13 E , 15 E ) -octadeca-9,11,13,15-acid tetraenoic acid trans -parinaric (acid β -parinaric) C18: 4 n -3 C18H28O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i020.jpg 276,42 g / mol „Natural” [ 88 ]; în Impatiens spp. 89 ]
14 (9 Z , 15 Z ) -octadeca-9,15-acid dienoic Acidul maniferic C18: 2 n -3 C18H32O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i021.jpg 280,452 g / mol 3.1–5.4% din acizii grași din pulpa fructelor de mango, 1% din coaja totală de acizi grași de mango ( Mangifera indica L.) [ 90 ]; la probele musculare de la miei hrăniți cu semințe de in [ 75 ]
15 (all- E / Z ) -octadeca-11,15-acid dienoic C18: 2 n -3 C18H32O2 izomerism cis – trans nedefinit 280,452 g / mol în albia de vită și de miel – 11 E , 15 E ; 11 Z ( E ), 15 E ( Z ); Izomeri 11 Z , 15 Z [ 91 ]; Izomerul 11 E , 15 Z la probele musculare de la miei hrăniți cu ulei de in [ 75 ]
16 (12 Z , 15 Z ) -octadeca-12,15-acid dienoic C18: 2 n -3 C18H32O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i022.jpg 280,452 g / mol la probele musculare de la miei hrăniți cu semințe de in [ 75 ]
17 (all- E / Z ) -octadeca-10,15-acid dienoic C18: 2 n -3 C18H32O2 izomerism cis – trans nedefinit 280,452 g / mol în albia de vită și de miel – 10 Z , 15 Z ; Izomeri 10Z ( E ), 15 E ( Z ) [ 92 ]
18 (11 Z , 14 Z , 17 Z ) -icosa-11,14,17-acid trienoic acid eicosatrienoic (ETE) / acid homo- alfa- linolenic 20: 3 n -3 C20H34O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i023.jpg 306,49 g / mol În semințele Sterculia urens (2,96% din totalul lipidelor) [ 91 ]; în uleiul de semințe Hibiscus sabdariffa (0,2% din acizii grași totali) [ 93 ]; 2,22–6,59 mg / g de greutate uscată Platymonas subcordiformis și 24 până la 42,04 mg / g de greutate uscată Porphyridium cruentum [ 94 ]; 3,97 g / kg unitate de soia [ 95 ]; 6,78–8,73% din totalul acizilor grași din uleiul de sâmbure de la Torreya Grandis [ 96 ]; 31,44% din ulei din semințe de Pittosporum undulatum acizi grași total [ 97 ]; 8,5% din totalul lipidelor neutre și 15,5% din acizii grași liberi din semințele de pluta Phellodendron lavalei [ 98 ]; 0,49 g / 100 g de ulei din semințe Pinus halepensis acizi grași total [ 99 ]; 0,2% din chimen negru ( Nigella sativa ) ulei din semințe acizi grași [ 56 ]; 0,01–0,1% pentru uleiurile cu balena fină, <0,01-0,03% pentru uleiurile sigilate (în greutate la sută) [ 62 ]; 3,3% din lipidele de semințe Ephedra gerardiana și 2,2% din uleiul de semințe de Cimicifuga racemosa [ 100 ]; 0,15% și 0,16% din total lipide ISA Brown și Arucana gălbenuș de ou, respectiv [ 101 ]; 0,1, 0,2, 0,1, 0,2, 0,2, 0,2, 0,1% din varză albă, kale, varză roșie, varză de Bruxelles, conopidă, salată de varză, masă de acizi grași pătrunjel; 0,1, 0,1, 0,1, 0,2, 0,1, 0,2, urme, 0,1, 0,1% din varză chineză, varză albă, savuroasă, calză, varză roșie, varză de Bruxelles, conopidă, kohlrabi, masă de acid gras din semințe de sudură [ 53 ] – denumiri sistematice au fost plasate în linia „acidul α- linolenic”
19 (8 Z , 11 Z , 14 Z , 17 Z ) -icosa-8,11,14,17-acid tetraenoic acid eicosatetraenoic (ETA) C20: 4 n -3 C20H32O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i024.jpg 304,474 g / mol în produsele sărate din icre de pește: 2,1% din Ikura (somon), 0,6% din Tarako (polion), 0,5% din Tobiko (pește zburător), 0,4% din totalul lipidelor Kazunoko (hering) [ 59 ]; 2,9-3,8% din ouăle de somon fracție totală de triacilglicerol [ 48 ]; sub formă de 8,11,14,17-eicosatetraenoat de metil: 0,19–0,24% din uleiul de barbă comun, 0,82–1,44% din uleiul de shad Pontic, 0,34–1% din uleiul de pește catifel european, 0,17–0,35% din uleiul sumbru comun [ 52 ]; 0,35–0,78% pentru uleiurile cu balena fină, 0,07–0,26% pentru uleiurile sigilate (în greutate la sută) [ 62 ]; 0,4–0,8% din triacilglicerolele musculare Epinephelus retouti [ 64 ]; 0,06% din lipidele de semințe Agathis robusta [ 67 ]; în lipide ale ficatului bovin [ 102 ]; în uleiurile de corp pentru hering ( Clupea harrengus ), macrou ( Scomber scombus ) și capelină ( Mallotus villosus ) în cantități de 5, 15 și 4 mg / g de acizi grași, respectiv, în uleiul de menhaden ( Brevoortia spp.) și uleiul indian de sardină ( Sardinella longiceps ) —19 și respectiv 6 mg / g de acizi grași [ 103 ]
20 (5 Z , 11 Z , 14 Z , 17 Z ) -icosa-5,11,14,17-acid tetraenoic acidul juniperonic C20: 4 n -3 C20H32O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i025.jpg 304,474 g / mol 8,9% în greutate din uleiul de semințe Biota orientalis [ 104 ]; 0,12–0,57% din Sargassum spp. acizi grași totale [ 105 ]; 1% din uleiul de semințe de Caltha palustris [ 106 ]; în multe specii de conifere, majoritatea în Gnetum gnemon , Chaemaecyparis thyoides , Cephalotaxus sinensis , Taxus cuspidata , Pseudolarix amabilis , Araucaria angustifolia , Agathis australis , Zamia furfuracea —12,9, 7,7, 6,8, 6,8, 6,3, 6,3, 6,1, 6,1 acizi grași, respectiv [ 54 , 77 ]
21 (5 Z , 8 Z , 11 Z , 14 Z , 17 Z ) -icosa-5,8,11,14,17-acid pentaenoic acid eicosapentaenoic (EPA) / acid timnodonic C20: 5 n -3 C20H30O2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i026.jpg 302,458 g / mol 13% din compoziția uleiului esențial Undaria pinnatifida [ 107 ]; 3,05 g / 100 g (ca ester metilic: 3,15% din acizii grași) țesut muscular de Labeo rohita , 2,51 g / 100 g (ca ester metilic: 2,51% din acizii grași) țesut muscular al Cirrhinus mrigata , 3,15 g / 100 g ( ca ester metilic: 3,05% din acizii grași) țesutul muscular al Catla catla [ 58 ]; în produsele sărate de icre de pește: 13,6% din Ikura (somon), 18,8% din Tarako (polonez), 7% din Tobiko (pește zburător), 15% din totalul lipidelor Kazunoko (hering) [ 59 ]; 8,7-10,6% din ouăle de somon fracție totală de fosfolipide, 8,3-10,3% din ouăle de somon fracție totală de triacilglicerol [ 60 ]; 13,6% din sardina sălbatică ( Sardina pilchardus ) acizi grași totali ai mușchiului (9,2% din acizii grași din mușchiul sardinei captive), 6,5% din acizii grași din ficatul captivant / 7,2% din sardina captivă [ 61 ]; ca ester metilic: 2,32-3,41% din uleiul de barbă comun, 2,57-3,8% din uleiul de shad Pontic, 2,41–6,1% din uleiul de pește de pește european, 0,51–1,36% din uleiul obișnuit [ 52 ]; 1,82–3,72% pentru uleiurile cu balena fină, 6,37–8,12% pentru uleiurile sigilate (în greutate la sută) [ 62 ]; 1,8-3,5% din triacilglicerolii musculari Variola louti [ 64 ]; 2% din Rhododendron sochadzeae lasă acizi grași (în extract de hexan) [ 108 ]
22 (6 Z , 9 Z , 12 Z , 15 Z , 18 Z ) -enicoza-6,9,12,15,18-acid pentaenoic acid heneicosapentaenoic (HPA) C21: 5 n -3 21 H 32 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i027.jpg 316,485 g / mol as methyl 6,9,12,15,18-heneicosapentaenoate: 0.06–0.12% of common barbel oil, 0.07–0.08% of Pontic shad oil, 0.09% of European wels catfish oil [ 52 ]; 0.2–0.4% of diatom Skeletonema costatum total fatty acids, 0.1–0.2% of copepods Calanus and Centropages sp. total fatty acids, <0.1% of copepods Temora longicornia total fatty acids, 0.2–0.7% of euphausid Meganyctiphanes norvegica total fatty acids, 0.1–1.1% of euphausid Euphausia sp. total fatty acids, 0.1–0.3% of herring oil Clupea harengus total fatty acids, 0.19% of sturgeon oil Acipenser oxyrhynchus total fatty acids, 0.2–0.6% of mackerel oil Scomber scrombrus total fatty acids, 0.1–0.9% of fin whale ( Balaenopterus physalus ) blubber total fatty acids, 0.2% of dolphin ( Tursiops truncatus ) milk total fatty acids [ 109 ]
23 (13 Z ,16 Z ,19 Z )-docosa-13,16,19-trienoic acid docosatrienoic acid (DTrE) C22:3 n -3 22 H 38 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i028.jpg 334.544 g/mol in Lepidium sativium seed oil (47.66% of total fatty acids) [ 110 ]; trace amount in weed seed oil, largely charlock [ 111 ]; in salami-type sausage made of Baltic herring fillets, pork and lard (from < 0.2 to 0.3% during ripening) [ 112 ]; in shade dried neem ( Azadirachta indica ) flower powder present to an extent of 5.7% in the total lipid [ 113 ]; in eggs (2.92–3.23%), embryos (3.28–3.76%) and larvae (0–3.65%) of Oncorhynchus mykiss (from 0 to 3.76% of total fatty acids) [ 114 ]; in muscle tissue and liver of Diplodus vulgaris (0.8–11.6% of total fatty acids) [ 115 ]
24 (7 Z ,10 Z ,13 Z ,16 Z ,19 Z )-docosa-7,10,13,16,19-pentaenoic acid docosapentaenoic acid (DPA)/clupanodonic acid C22:5 n -3 22 H 34 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i029.jpg 330.512 g/mol as methyl esters: 1.45% of Labeo rohita muscle tissue fatty acids, 1.86% of Cirrhinus mrigata muscle tissue fatty acids, 1.09% of Catla catla muscle tissue fatty acids [ 58 ]; in salted products of fish roe: 5.6% of Ikura (salmon), 1.0% of Tarako (pollock), 2.8% of Tobiko (flyingfish), 1.3% of Kazunoko (herring) total lipids [ 59 ]; 6.3–8.1% of salmon eggs total phospholipid fraction, 4.9–6% of salmon eggs total triacylglicerol fraction [ 60 ]; 1.6% of wild sardine ( Sardina pilchardus ) muscle total fatty acids (2% of captive sardine muscle total fatty acids), 2.7% of wild/2.4% of captive sardine liver total fatty acids [ 61 ]; as methyl ester: 0.6–1.15% of common barbel oil, 0.44–0.83% of Pontic shad oil, 1.04–2.82% of European wels catfish oil, 0.06–0.23% of common bleak oil [ 52 ]; 1.07–2.28% for finwhale oils, 2.64–4.74% for seal oils (in weight per cent) [ 62 ]; 1.34% of tuna oil [ 51 ]; 1.9–3.3% of Variola louti muscle triacylglycerols [ 64 ]; 13.8/16.7% of wether/eve (lamb) raw meat fatty acids [ 116 ]; 0.07% and 1.6% of Hormosira banksii and Dictyota dichomota total fatty acids, respectively [ 117 ]
25 (4 Z ,7 Z ,10 Z ,13 Z ,16 Z ,19 Z )-docosa-4,7,10,13,16,19-hexaenoic acid docosahexaenoic acid (DHA)/cervonic acid C22:6 n -3 22 H 32 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i030.jpg 328.496 g/mol 15.44 g/100 g (as methyl ester: 17.98% of fatty acids) muscle tissue of Labeo rohita , 18.07 g/100 g (as methyl ester: 8.07% of fatty acids) muscle tissue of Cirrhinus mrigata , 17.98 g/100 g (as methyl ester: 15.4% of fatty acids) muscle tissue of Catla catla [ 58 ]; in salted products of fish roe: 17.4% of Ikura (salmon), 22.2% of Tarako (pollock), 27.9% of Tobiko (flyingfish), 22.6% of Kazunoko (herring) total lipids [ 59 ]; 26–29.2% of salmon eggs total phospholipid fraction, 12.5–15.3% of salmon eggs total triacylglicerol fraction [ 60 ]; 14.8% of wild sardine ( Sardina pilchardus ) muscle total fatty acids (13.4% of captive sardine muscle total fatty acids), 12.8% of wild/17.1% of captive sardine liver total fatty acids [ 61 ]; as methyl ester: 1.36–2.5% of common barbel oil, 4.15–6.47% of Pontic shad oil, 1.44–3.83% of European wels catfish oil, 0.13–0.42% of common bleak oil [ 52 ]; 2.74–6.23% for finwhale oils, 5.14–8.22% for seal oils (in weight per cent) [ 62 ]; 14.8–19.4% of Epinephelus fasciatus musccle triacylglycerols [ 64 ]
26 (12 Z ,15 Z ,18 Z ,21 Z )- tetracosa-12,15,18,21-tetraenoic acid C24:4 n -3 24 H 40 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i031.jpg 360.582 g/mol 1.3% of Baltic herring ( Clupea harengus ) total fatty acids [ 118 ]
27 (9 Z ,12 Z ,15 Z ,18 Z ,21 Z )-tetracosa-9,12,15,18,21-pentaenoic acid C24:5 n -3 24 H 38 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i032.jpg 358.566 g/mol 1.4% of Baltic herring total fatty acids [ 118 ]
28 (6 Z ,9 Z ,12 Z ,15 Z ,18 Z ,21 Z )-tetracosa-6,9,12,15,18,21-hexaenoic acid nisinic acid C24:6 n -3 24 H 36 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i033.jpg 356.55 g/mol 0.9% of Baltic herring total fatty acids [ 118 ]
29 (11 Z ,14 Z ,17 Z ,20 Z ,23 Z )-hexacosa-11,14,17,20,23-pentaenoic acid C26:5 n -3 26 H 42 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i034.jpg 386.62 g/mol 0.5% of of Baltic herring total fatty acids [ 118 ]
30 (8 Z ,11 Z ,14 Z ,17 Z ,20 Z ,23 Z )-hexacosa-8,11,14,17,20,23-hexaenoic acid C26:6 n -3 26 H 40 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i035.jpg 384.604 g/mol 0.7% of Baltic herring total fatty acids [ 118 ]
31 (15 Z ,18 Z ,21 Z ,24 Z ,27 Z )-triaconta-15,18,21,24,27-pentaenoic acid C30:5 n -3 30 H 50 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i036.jpg 442.728 g/mol as a methyl ester: 7% of Cliona celata total methyl esters [ 119 ]
32 (19 Z ,22 Z ,25 Z ,28 Z ,31 Z )-tetratriaconta-19,22,25,28,31-pentaenoic acid C34:5 n -3 34 H 58 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i037.jpg 498.836 g/mol 12.4% of the phospholipid fatty acids from Petrosia pellasarca [ 120 ]
33 (23 Z ,34 Z )-heptatriaconta-23,34-dienoic acid C37:2 n -3 37 H 70 O 2 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i038.jpg 546.965 g/mol in a CHCl3 extract of Iranian Rosa x damascena ( Rosaceae ) [ 121 ]
VERY LONG-CHAIN FATTY ACIDS WITH AN UNDEFINED POSITION OF DOUBLE BONDS
34 C24:4 n -3 24 H 40 O 2 360.582 g/mol in ram and bull spermatozoa [ 7 ]
35 C24:5 n -3 24 H 38 O 2 358.566 g/mol in bovine retina [ 8 ]; in ram spermatozoa [ 7 ]
36 C24:6 n -3 24 H 36 O 2 356.55 g/mol in bovine retina [ 8 ]; in ram spermatozoa [ 7 ]
37 C26:4 n -3 26 H 44 O 2 388.636 g/mol in ram spermatozoa [ 7 ]
38 C26:5 n -3 26 H 42 O 2 386.62 g/mol in ram spermatozoa [ 7 ]
39 C26:5 n -3 26 H 42 O 2 386.62 g/mol in bovine retina [ 8 ]
40 C26:6 n -3 26 H 40 O 2 384.604 g/mol in ram spermatozoa [ 7 ]
41 C26:6 n -3 26 H 40 O 2 384.604 g/mol in bovine retina [ 8 ]
42 C28:5 n -3 28 H 46 O 2 414.674 g/mol in bovine retina [ 8 ]; in ram and bull spermatozoa [ 7 ]
43 C28:6 n -3 28 H 44 O 2 412.658 g/mol in bovine retina [ 8 ]; in ram and bull spermatozoa [ 7 ]
44 C30:5 n -3 30 H 50 O 2 442.728 g/mol in bovine retina [ 8 ]; in ram and bull spermatozoa [ 7 ]
45 C30:6 n -3 30 H 48 O 2 440.712 g/mol in bovine retina [ 8 ]; in ram and bull spermatozoa [ 7 ]
46 C32:5 n -3 32 H 54 O 2 470.782 g/mol in bovine retina [ 8 ]
47 C32:6 n -3 32 H 52 O 2 468.766 g/mol in bovine retina [ 8 ]—main component of VLC-PUFA-PC of bovine retina [ 122 ]; in bull spermatozoa [ 7 ]
48 C32:7 n -3 32 H 50 O 2 466.75 g/mol in ram and bull spermatozoa [ 7 ]
49 C34:5 n -3 34 H 58 O 2 498.836 g/mol in bovine retina [ 8 ]
50 C34:6 n -3 34 H 56 O 2 496.82 g/mol in bovine retina [ 8 ]—main component of VLC-PUFA-PC of bovine retina [ 122 ]; in ram and bull spermatozoa [ 7 ]
51 C36:5 n -3 36 H 62 O 2 526.89 g/mol in bovine retina [ 8 ]
52 C36:6 n -3 36 H 60 O 2 524.874 g/mol in bovine retina [ 8 ]
53 C36:6 n -3 36 H 60 O 2 524.874 g/mol in normal human brain [ 122 ]
MODIFICATIONS OF OMEGA-3 FATTY ACIDS
1 (8 Z )-5-oxo-11-hydroxyundec-8-enoic acid 11-O-glucoside 5-oxo, 11-OH, 11-O-Glu-C11:1 n -3 17 H 28 O 10 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i039.jpg 392.40 g/mol in Youngia japonica [ 123 ]
2 (9 Z )-12-oxododec-9-enoic acid 12-oxo-C12:1 n -3 12 H 20 O 3 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i040.jpg 212.289 g/mol present in many plants in large quantities, inter alia, in mature soybeans [ 124 , 125 ]
3 (9 Z ) -12-hydroxydodec-9-enoic acid HDA 12-OH-C12:1 n -3 12 H 22 O 3 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i041.jpg 214.305 g/mol widespread among plants [ 126 , 127 , 128 ]
4 (9 Z ,11 E ,15 Z )-13-hydroperoxyoctadeca-9,11,15-trienoic acid 13-LnHPO 13-hydroperoxy-C18:3 n -3 18 H 30 O 4 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i042.jpg 310.43 g/mol in apple and tomato fruits [ 129 ]
5 (9 Z ,11 E ,13 E ,15 Z )-4-oxooctadeca-9,11,13,15-tetraenoic acid 4-oxo-C18:4 n -3 18 H 26 O 3 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i043.jpg 290.403 g/mol as a methyl ester—18% of Chrysobalanus icaco seed oil [ 81 ]
6 (9 Z ,12 Z ,15 Z )-2-hydroxyoctadeca-9,12,15-trienoic acid 2-Hydroxy-linolenic acid/α-hydroxylinolenic acid 2-OH-C18:3 n -3 18 H 30 O 3 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i044.jpg 294.435 g/mol 5.4% of Salvia nilotica seed oil [ 55 ]
7 (9 Z ,12R,15 Z )-12-hydroxyoctadeca-9,15-dienoic acid densipolic acid 12-OH-C18:2 n -3 18 H 32 O 3 An external file that holds a picture, illustration, etc.
Object name is nutrients-10-01662-i045.jpg 296.451 g/mol 2.1% of the seed oil of Lesquerella auriculata (this fatty acid is a major component of Lesquerella species seed oils from southeastern regions of the US) [ 130 ]; the largest average content in the seeds of the eastern US species: L. perforata , L. stonensis , L. densipila , L. lyrata , and L. lescuria —over 40% of total fatty acids [ 131 ]; in cv Linola 989 Linum usitatissimum (low linolenic flax) seeds at levels of 0.2 to 1% [ 132 ]
8 (11 Z ,17 Z )-14-hydroxyicosa-11,17-dienoic acid auricolic acid 14-OH-C20:2 n -3 20 H 36 O 3 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i046.jpg 324.505 g/mol 32% of the seed oil of Lesquerella auriculata [ 130 ]; the largest average content in the seeds of L. auriculata and L. densiflora —over 30% of total fatty acids [ 131 ]
9 (2 E ,6 E ,10 Z )-7-ethyl-3,ll-dimethyl-2,6,10-tridecatrienoic acid (also as a methyl ester) 3,11-diMe,7-Et-C13:3 n -3 17 H 28 O 2 Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este nutrient-10-01662-i047.jpg 264.41 g/mol transformat în hormonul juvenil la masculi Hyalophora cecropia [ 133 ]

2. Surse de acizi grași Omega-3

În anii 2003-2008, persoanele din SUA au consumat, cu alimente, în medie 0,17 g / zi (aport mediu 0,11 g / zi) de acizi grași omega-3 cu catenă lungă (DHA, EPA și EPA echivalenți (5% din conversie) de ALA, 33% din conversia SDA)), adică mai mică decât 0,5 g / zi recomandată. Printre persoanele care consumă acizi grași omega-3 în grupul de mai jos sau la 15a percentilă a consumului total de omega-3 FA, cea mai importantă sursă de acizi omega-3 au fost produsele din cereale (36%), în timp ce în grupul de mai sus sau la Al 85-lea procent, sursa dominantă a fost peștele (pește și amestecuri; 71% – în contrast cu grupul cu consum redus, unde consumul de pește a fost de 1%). În ambele grupuri, aportul de semințe și nuci a fost scăzut, iar legumele au fost consumate la 9%, respectiv 2% [ 134]. După cum se poate observa cu ușurință, ponderea acizilor grași omega-3 din dietă este cea mai afectată de aprovizionarea cu pește, deoarece sunt sursa principală de EPA și DHA pentru oameni135 ]. Acest lucru se datorează faptului că alimentele multor pești sunt alge bogate în EPA și DHA și alte organisme care consumă alge, precum peștele sau nevertebratele marine [ 136 , 137 ]. Microalge joacă un rol cheie în producția primară de PUFA și sunt principala sursă a acestora în apa de mare. Nevertebratele marine sunt, de asemenea, o sursă importantă și de bază de PUFA omega-3 datorită capacității lor de a sintetiza unele dintre ele de novo, de exemplu, ostra Crassostrea gigas poate produce EPA și DHA consumând microalge care nu conțin ambele [ 137]. Fructele de mare conțin numeroși acizi omega-3 valoroși. Cu toate acestea, consumul lor frecvent expune corpul uman la efectul neurotoxic al mercurului de metil, care este în special dăunător pentru dezvoltarea sistemului nervos central al fătului138 ]. Prin urmare, este recomandabil să căutați alte surse ale acestor acizi grași și să le includeți într-o dietă echilibrată.

EPA apare în cantități mari în hering (15% din totalul lipidelor) [ 59 ], sardină sălbatică (13,6% din FA totală musculară) [ 61 ] și polie (18,8%)59 ]. La plante, este destul de rar. Trebuie menționată Undaria pinnatifida (13% din compoziția uleiului esențial) [ 107 ] și Rhododendron sochadzeae (2% din extractul de hexan FA din frunze) [ 108 ].

Principalele surse de DHA sunt peștele zburător, heringul, polionul și icrele de somon (27,9%, 22,6%, 22,2% și, respectiv, 17,4% din totalul lipidelor)59 ], Cirrhinus mrigata (18,07 g / 100 g FA țesut muscular), și Catla catla (17,98 g / 100 g FA țesut muscular) [ 58 ]. Este de remarcat prezența acestui acid în jackalberry (4,65 g FA la 100 g ulei Diospyros mespiliformis ) [ 139 ].

Așa cum am menționat mai sus, atât EPA, cât și DHA sunt, de asemenea, sintetizate din ALA folosind enzime – desatuze și elongaze [ 17 , 22 , 26 , 134 ], deși la om acest proces este insuficient – rata de conversie este de 10-14% pentru bărbați și femei, respectiv [ 136 , 140 ]. Potrivit altor autori, ALA este transformat în EPA cu un randament de 0,2 la 21% (la bărbați adulți 8%) și DHA de la zero la 9% (la femei mai mult de 9%)141 ]. DHA poate fi, de asemenea, un substrat pentru crearea de EPA și invers (eficiența de conversie a EPA în DHA este <0,1% la bărbații adulți) [ 141 , 142 ]. Mai mult, ALA este și un precursor al DPA [143 ].

Acidul α- linolenic (ALA) este comun la plantele superioare și la alge [ 22 ]. Surse bogate de ALA includ, de asemeneaLinum usitatissimum -INul (în funcție de genotipul pe care îl conține de la 1,1 până la 65,2% din acizii grași totali din semințe) [ 71 ], chia Salvia hispanica (64,04% din acizii grași din uleiul din semințe și 16,4 g / 100 g semințe de chia)65 , 68 ], Trichosanthes kirilowii (33,77–38,66% din uleiurile din semințe) [ 70 ], paprika Capsicum annuum -ardei iute (29,93% din acizii grași pericarp proaspeți din soiul Jaranda și 30,27% din soiul Jariza) [ 72], și multe altele. Conținutul de ALA la pește este mic, de exemplu 1,1% în sardinele sălbatice ( Sardina pilchardus ) total de FA musculare [ 61 ].

Acidul 8 ( Z ), 11 ( Z ), 14 ( Z ) -Heptadecatrienoic, numit și acid norlinolenic, a fost identificat în Salvia nilotica [0,4% din esteri mixți și 2,3% din fracția IV (% prin cromatografie lichidă cu gaz)] [ 55 ].

(All trans ) -9,12,15-Acidul octadecatrienoic (acid linolenelaidic) este prezent în speciile de salvie turcească, iar greutatea la sută din semințele FA de Salvia virgata , Salvia potentillifolia , Salvia recognita , Salvia tomentosa se ridică la 0,4, 0,7, 1.1, respectiv 1,4% [ 73 ]. Nicotiana tabacum (tutunul )conține, de asemenea, acid linolenelaidic, dar într-o cantitate mică, care este de 0,03% din uleiuri de semințe de tutun FA. [ 74 ]

Acidul (9 Z , 12 Z , 15 Z ) -2-Hidroxyoctadeca-9,12,15-trienoic (acid 2-hidroxilinolenic, acid alfa- hidroxilinolenic) este un acid hidroxi puțin cunoscut găsit în Salvia nilotica (5,4% din Salvia nilotica ulei de semințe) [ 55 ].

(11 Z , 14 Z , 17 Z ) -Icosa-11,14,17-acid trienoic (acid eicosatrienoic), numit uneori acid homo- alfa -linolenic, apare rar în surse animale – gălbenușul de ou conține acest acid în cantitate din doar 0,15 – 0,16% din totalul lipidelor [ 101 ]. Mult mai mult s-au găsit în uleiul de sâmbure de la Torreya grandis (6,78–8,73% din totalul FA) [ 96 ] și din semințele de plută Phellodendron lavalei [15,5% din acizii grași liberi (FFA)] [ 98 ], dar cea mai mare cantitate este conținută în Pittosporum undulatum ulei de semințe (31,44% din totalul FA) [ 97 ].

Derivații apropiați ai acidului alfa-linolenic sunt doi acizi incluși în grupul de acizi polienoici minori [ 75 ]. Acidul rumelenic ( cis -9, trans -11, cis -15-octadecatrienoic acid) este format prin izomerizarea acidului alfa- linolenic, în timp ce acidul cis -9, trans- 11, trans -15-octadecatrienoic este izomerul acidului rumelenic . Ambii acizi se găsesc la rumegători, de exemplu în laptele de oaie [ 69 , 75 ].

Acidul docosapentaenoic (DPA; (7 Z , 10 Z , 13 Z , 16 Z , 19 Z ) -docosa-7,10,13,16,19-acid pentaenoic), denumit în mod tradițional acid clupanodonic, arată similaritate structurală cu EPA, dar are încă doi atomi de carbon din lanț. Cantități semnificative sunt prezente în carne (13,8 / 16,7% din FA, din carne crudă cu miere / oaie) [ 116 ], icre de pește (5,5% din totalul lipidelor de rapiță de somon [ 59 ], uleiuri de pește (1,04-2,82% din piei europene) ulei de pește) [ 52 ], ulei de focă (2,64-4,74%) [ 62 ] și mușchi de pește (1,6% din sardina sălbatică ( Sardina pilchardus ) acizi grași totali ai mușchiului) [ 61]]. DPA apare sporadic în alge, cum ar fi Hormosira bancsii și Dictyota dichomota (0,07% și, respectiv, 1,6% din FA total) [ 117 ].

Acidul stearidonic (SDA; acid moroctic) este comun la plante și pești. Varza de somon conține o porție SDA mică (0,8% din totalul lipidelor) [ 59 ]; puțin mai mult în sardina sălbatică (2,3% din FA totală musculară) [ 61 ]. SDA apare în multe plante, dar în cantități mici, cu excepția plantelor din familiile Primulaceae și Boraginaceae, unde poate fi găsită în concentrații relative mari (cantități medii de 4,73 și 4,99% din semințe, respectiv esteri de metil FA). Semințele de hipopha rhamnoides (Elaeagnaceae) conțin doar 0,36% SDA [ 78 ]. De remarcat este în special Echium humile ssp. pycnanthum , în care semințele au conținut de SDA estimat la până la 16,2% din numărul total de FA [ 79 ].

(7 Z , 10 Z , 13 Z ) -Hexadeca-7,10,13-acidul trienoic (acid roughanic) apare în multe plante și în uleiurile de pește, dar de obicei în cantități mici. Ca rezultat al reacțiilor catalizate de lipoxigenaze, acesta este transformat în metaboliți oxigenati, cum ar fi 7-, 8-, 10-, 11-, 13-, 14-hidroperoxizi și hidro-hidroxid bis-alilic 9. Cu toate acestea, derivații hidroxi ai acidului roughan sunt de asemenea prezenți la plantele bogate în acid alfa-linolenic și nu în acid rouganic, inclusiv răsadurile de soia și mazăre [ 144 ].

Acizii grași monoinsaturați Omega-3 sunt un grup mic, deși cu un rol incontestabil în natură – unii precum acidul ( Z ) -11-tetradecenoic, acidul ( E ) -11-tetradecenoic și (10 E , 13 Z ) -10, Acidul 13-heksadecadienoic sunt precursori ai feromonelor la insecte [ 38 ]. Așa cum sunt conținute în sursele alimentare disponibile în general, este de remarcat în special 13 acid hexadecenoic Z , 15 Z -octadecenoic acid, 9 E -dodecenoic acid și 11 E- acid tetradecenoic . 15 acid Z- docadecenoic, găsit în carnea de vită [ 46 ], carnea de porc [ 45 ], laptele de vacă și untul [47 ], și laptele uman matur, este relativ frecvent [ 49 , 50 ]. 11 E- acid tetradecenoic apare în Coriandrum sativum , al cărui ulei esențial de frunze conține 13,37% din acest acid [ 39 ].

Acizii grași conjugați necesită încă cercetări detaliate, deoarece unii dintre ei (acid linoleic conjugat) au activitate antitumorală și o serie de proprietăți care oferă beneficii în lupta împotriva hipertensiunii arteriale, obezității și diabetului zaharat [ 1 , 145 ]. Acizii grași omega-3 conjugați, importanți din punct de vedere al disponibilității lor în alimente, sunt acidul alfa și beta -parinaric. Trans Acid -parinaric, de asemenea , numit beta acidul -parinaric [ 88 ], are toate legăturile din trans configurația. În cazul acidului cis -parinaric (acid alfa -parinaric [ 146]) Cu toate acestea, numele este oarecum înșelător, deoarece izomerismul său poate fi descris ca cis-trans-trans-cis [ 147 ]. Acidul parinaric, datorită capacității sale naturale de fluorescență și sensibilitate ridicată la radicalii liberi, este utilizat (ca acid cis -parinaric) ca indicator al peroxidării lipidelor în membranele celulare [ 148 , 149 , 150 , 151 , 152 , 153 , 154 ] și (ca acid trans -parinaric) pentru a evalua efectul schimbării temperaturii asupra membranelor celulare [ 88 , 155]. Unele organisme sunt capabile să transforme acizii grași neconjugate în omologi conjugate [ 156 ]. Pe lângă acidul parinaric tetraenoic, în plante se găsesc în principal acizi trienoici conjugați cu 18 și 17 atomi de carbon. Cele acetilenice și dienoice pot avea un număr diferit de punți de metilen [ 157 ]. Semințele de parinarium laurinum sunt cele mai bogate din surse de acid alfa-parinaric (62% din esterii de metil ulei din semințe) [ 81 ].

Acizii grași cu lanț lung (VLCFA; C> 22) joacă multe roluri importante în organism, inclusiv modularea funcțiilor neutrofilelor. În timp ce activitatea lor scade odată cu creșterea lungimii lanțului de carbon, ei rămân activatori de producție de superoxizi eficienți în neutrofile, mult mai buni decât N -formilmetionil-leucil-fenilalanină (FMLP) [ 15 ]. VLCFAs au, de asemenea, capacitatea de a regla activitatea PKC [ 16 ]. Totuși, acest lucru necesită încă cercetări suplimentare, în special in vivo. Locația lor predispusă în corp este de asemenea interesantă – se găsesc în cantități mari în creierul uman [ 7 , 122 , 158 , 159 ], retina bovină [ 8 ,122 ], berbec, taur, mistreț și spermatozoizi umani [ 7 , 14 ], precum și în testiculele de șobolan [ 160 ], culturi de spermatide și spermatocite de șoarece [ 161 ] și cultură de celule endoteliale vasculare umane [ 162 ]. Acizii VLC n -3 FA s-au găsit în fosfatidilcolinele dipolinsaturate ale retinei bovine și sfingomielina spermatozoizilor de berbec, precum și în spermatozoizii taur [ 7 , 8 , 14 ]. În creierul uman normal s-a constatat și prezența acizilor hexaenoici VLC n -3 (36: 6), dar în cantități mai mici decât acizii grași omega-6 [ 122]. Acidul Tetratriaconta-19,22,25,28,31-pentaenoic (34: 5) a fost descris în Sponge Marine ( Petrosia pellasarca ) [ 120 ].

Există numeroase modificări ale acizilor grași omega-3, iar mulți dintre ei joacă rolul hormonilor sau compușilor produși în situații stresante la plante. Menționăm doar câteva exemple care apar în surse alimentare. Cele mai importante par a fi menționat anterior , acidul 2-hydroxylinolenic și doi acizi hidroxi apar în plantele din genul Lesquerella- densipolic și auricolic acidul [ 130 , 163 , 164 , 165 , 166 ]. Unul dintre ele, acidul densipolic, a fost găsit în Linum usitatissimum [ 132]. Un alt exemplu este acidul (9Z) -12-hidroxi-9-dodecenoic (HDA), care este unul dintre principalele produse ale căii de lipoxigenază, răspândită printre plante [ 126 , 127 , 128 ]. În plus, acizii grași oxo sunt prevalenți în lumea plantelor. De exemplu, acidul 12-oxo- cis -9-dodecenoic este unul dintre produsele de reacție catalizate de hidroperoxidul liaz al acidului gras, prezent în multe plante, în cantități mari, printre altele, în soia matură [ 124 , 125 ]. Tabelul 1 prezintă acizii aparținând tuturor grupurilor discutate mai sus.

3. Biodisponibilitate

Biodisponibilitatea este un termen relativ, care se poate referi atât la viteza de absorbție, cât și la cantitatea de substanță absorbită. Viteza poate fi înțeleasă ca viteza cu care substanța este absorbită din tractul gastro-intestinal și ajunge în sistemul portal. Absorbția substanței are loc în tractul gastro-intestinal doar într-o anumită măsură, în funcție de mulți factori. Gradul de absorbție și viteza transportului de substanțe la circulația portalului descrie biodisponibilitatea în sens mai restrâns. În mod tradițional, biodisponibilitatea poate fi considerată și într-un context mai larg, ținând cont de cantitatea de substanță care ajunge la circulația sistemică sau locul destinului (activității) fiziologice [ 167]. Această abordare mai largă este deosebit de importantă când se ia în considerare efectul proceselor metabolice și excreția asupra transportului substanțelor din circulația portalului. Nu toată substanța absorbită ajunge în circulația sistemică sau în compartimentul țesutului în concordanță cu destinația fiziologică. Această diferență de cantitate este foarte importantă din punct de vedere al farmacocineticii și al planificării dietei.

Acizii grași pot fi prezenți în organism sub formă de acizi grași liberi, legați de glicerol, pentru a forma triacilglicerol (TG), diacilglicerol (DAG) sau monoacilglicerol (MAG) sau pentru a forma o compoziție de fosfolipide ale membranei. În moleculele TG care apar în mod natural, LC PUFA ocupă a doua poziție [ 167 ]. În fosfolipidele membranelor celulare, ultima poziție este concurată de EPA și DHA cu acid arahidonic și, dacă este necesar, sunt eliberate de enzima fosfolipază A2 și sunt utilizate pentru sinteza eicosanoidelor [ 136 ]. În caz contrar, în creierul uman, VLCFAs (C34-38) sunt atașate de scheletul glicerinei (partea glicerolă), care în fosfolipide sunt situate în poziția sn -1 [ 122 ].

În uleiurile de pește și pește, PUFA-uri LC omega-3 se găsesc în principal ca triacilgliceride și acizi grași liberi [ 167 , 168 ]. În uleiul de Krill, fosfolipidele sunt, de asemenea, o fracțiune importantă a acestor acizi grași (30-65% din EPA și DHA), în principal fosfatidilcolina167 , 169 , 170 , 171 ]. EPA și DHA reprezintă aproximativ 18% și, respectiv, 12% din conținutul de uleiuri de pește care apar în mod natural [ 167]. Cu toate acestea, datorită procesului de transesterificare, amestecurile de ulei conțin adesea mult mai mult atât EPA, cât și DHA. Acest procedeu este legat de înlocuirea coloanei vertebrale glicerol îndepărtate cu etanol, ceea ce duce la formarea etilesterilor (EE), care pot fi apoi transformați în TG reesterificat (rTG) -etanolul este îndepărtat enzimatic, rezultând acizi grași liberi eliberat, apoi atașat de enzime înapoi la coloana vertebrală a glicerolului [ 167 , 168 ]. Un exemplu de medicament în care conținutul de EPA (DHA) este crescut ca urmare a transesterificării este Lovaza [ 168 , 172]. O altă metodă de creștere a conținutului de EPA și DHA a fost utilizată în Epanova. Glicerolul este îndepărtat și înlocuit cu un atom de hidrogen, care, în combinație cu acidul gras eliberat, formează un acid carboxilic. Etilesterii (din care este compus Lovaza) necesită hidroliza legăturii esterice prin lipaza pancreatică înainte de a elibera acizii grași liberi care pot fi absorbiți în intestinul subțire. Această etapă nu este necesară de acizii carboxilici. Interesant este că, de asemenea, EPA și DHA-EE sunt absorbite neschimbate. Cu toate acestea, această formă reprezintă <1% din totalul de EPA și DHA în circulație după ingerarea acizilor omega-3 EE [ 168 ].

În rTG, PUFA LC ocupă nu mai ales poziția sn -2 (care are loc în TG natural), dar poate fi legat (simultan) în poziția sn -1 sau sn -3 cu o paradigmitate egală. Particulele rTG conțin frecvent două PUFA LC – atunci probabilitatea legării EPA și DHA în poziția sn -1 sau sn -3 este mai mare decât în ​​poziția sn -2 [ 167 ]. Conform lui Schuchardt, [ 167 ] legarea LC omega-3 PUFA la glicerol în poziția sn -1/3 facilitează hidroliza lipazei legăturii, crescând astfel biodisponibilitatea. Potrivit lui Dyerberg, [ 173] prezența MAG și DAG în amestecurile rTG crește absorbția PUFAs LC în intestin datorită formării mai ușoare a micelelor. La rândul său, Bandarra [ 174 ], pe baza rezultatelor cercetărilor sale asupra hamsterilor, dovedește că localizarea DHA în poziția sn -2 crește absorbția acestui acid în intestin și încorporarea acestuia în țesuturi. Cu toate acestea, o anumită limitare a studiului lui Bandarra este că autorul a folosit un ulei de pește disponibil comercial, care este cunoscut doar ca fiind bogat în DHA, cu un situs de legare nespecificat cu coloana vertebrală a glicerinei – nu știm ce parte a DHA este asociată în poziții în afară de sn -2.

3.1. Metode de măsurare a biodisponibilității acizilor grași Omega-3

Putem măsura concentrația de FA omega-3 în plasmă, ser, celule sanguine și limfă. Conținutul de FA în plasmă reflectă aportul de acizi grași pe termen scurt până la mediu, în timp ce concentrația de acizi grași din celulele sanguine este de obicei un bun indicator al biodisponibilității pe termen lung [ 167 , 175 ]. În ceea ce privește acizii grași omega-3 cu catenă lungă, este posibil să se măsoare mulți markeri care indică prezența DHA într-o formă specifică, dar numai unul (nivelul de EPA fosfolipid în plasmă) care este util pentru determinarea nivelul EPA [ 167 , 176]. Desigur, EPA-ul eritrocit este un indicator slab dependent de doză al substituției PUFAs LC omega-3 la niveluri dietetice normale, cu toate acestea (suma), EPA-eritrocit și concentrația DHA pare să fie, după cum se menționează mai jos, un indicator relativ bun de lungă -biodisponibilitate la termen și reflectă, de asemenea, conținutul de LC omega-3 PUFA în țesuturile fără sânge [ 167 , 177 ]. În studiul lui Browning, [ 177 ] EPA + DHA-PC (în cazul modificărilor bruște ale aportului) și celulele plachetare / mononucleare EPA + DHA (în cazul evaluării consumului pe termen lung) au fost considerate biomarkeri care reprezintă cel mai bine aportul de pește cu conținut ridicat de grăsimi într-o populație tipică din Marea Britanie (1-4 porții pe săptămână).

3.2. Legare chimică

Biodisponibilitatea acizilor grași omega-3 poate fi exprimată și prin calcularea diferitor coeficienți, dintre care cel mai important par a fi indicele omega-3, C max și AUC t (suprafață sub curba (concentrație-timp)), modificarea care este aria incrementală sub curbă (iAUC t ) [ 169 ].

Indicele omega-3 este definit ca fiind proporția din suma conținutului de EPA și DHA în conținutul total de acid gras din eritrocit (membrană eritrocitară) și este exprimat în procente [ 167 , 178 , 179 ]. Este un bun indicator al biodisponibilității pe termen lung (din ultimele 80-120 de zile [ 179 ]) datorită duratei de viață îndelungată a eritrocitelor și a numărului mare al acestora în sânge. Conținutul plasmatic de EPA și DHA, precum și de mulți alți acizi grași, se corelează slab sau nu se corelează deloc cu nivelul acestor acizi din membrana eritrocitară [ 179]. Indicele omega-3 este, de asemenea, un bun indicator al încorporarii acizilor grași în țesuturi și acest lucru se aplică nu numai țesuturilor gastrointestinale, ci și miocardului, ficatului și rinichilor [ 167 , 180 ]. S-a stabilit că furnizarea de acizi grași omega-3 cu catenă lungă la nivelul de 1 g / d poate duce la o creștere a indexului omega-3 cu două puncte procentuale în opt săptămâni [ 181 ]. Indicele omega-3 este influențat de mai mulți factori, precum fumatul, activitatea fizică (a cărei intensitate scade indicele omega-3) și genele [ 178 ].

Nivelurile maxime de EPA și DHA în plasmă (C max ) pot fi determinate la cinci-nouă ore după administrare, în timp ce nivelurile persistente de EPA și DHA în plasmă sunt atinse în două săptămâni de la suplimentarea zilnică. Timpul de înjumătățire plasmatică al EPA și DHA după administrarea repetată este de 37 de ore, respectiv de 48 de ore [ 170 ].

Biodisponibilitatea acizilor grași omega-3 variază în funcție de tipul de legare chimică (structura lipidelor) și poate fi clasificată după cum urmează: PL> rTG> TG> FFA> EE [ 167 , 178 , 179 , 182 , 183 ]. Atât EE, cât și rTG nu sunt componente naturale ale uleiurilor alimentare, dar sunt create în procesul de modificare chimică a acestora, care se numește transesterificare. Ca urmare, se pot obține uleiuri puternic concentrate care conțin până la 90% din EPA și DHA [ 167 ]. Ordinea ierarhică prezentată mai sus nu reflectă realitatea în măsura în care unii autori și-ar dori. În procesul lor, Kohler et al. [ 178] a demonstrat că biodisponibilitatea EPA și DHA sub formă de fosfolipide nu trebuie să fie mai mare decât biodisponibilitatea acestor acizi sub formă de trigliceride – biodisponibilitatea EPA și DHA în făina de krill a fost comparabilă cu biodisponibilitatea lor în uleiul de pește, în ciuda conținutului de grăsimi total ușor mai ridicat în masa de krill. Yurko-Mauro și colab. [ 184 ] au obținut rezultate similare – uleiul de krill conținând aproape 44% din fosfolipide a arătat biodisponibilitate similară cu biodisponibilitatea uleiului de pește, atât sub formă de trigliceride, cât și de esteri etilici. Aceasta indică ponderea (mare) a factorilor non-chimici de legare (și conținut total de grăsimi) în conturarea biodisponibilității acizilor grași omega-3 [ 169 , 178 , 185]. O explicație poate fi observația Nordoy, Referință [ 186 ], care a observat o absorbție la fel de bună a acizilor grași omega-3 (incluzând EPA și DHA) sub formă de TG și EE dacă sunt administrați ca o componentă a uleiului de pește în echivalent. sume. Atât uleiul de krill, cât și într-o măsură mai mică, făina de krill și uleiul de pește, care sunt bogate în grăsimi.

Cu toate acestea, multe studii susțin că uleiul de krill, în special atunci când este foarte bogat în fosfolipide, este caracterizat printr-o biodisponibilitate extrem de ridicată, semnificativ mai mare decât uleiul de pește bogat în trigliceride170 , 187 , 188 , 189]. Aceștia găsesc și o explicație de înțeles. Între PUFA-ul omega-3 legat de fosfolipide și cele legate de trigliceride, există o oarecare diferență asociată cu predestinarea la un tip specific de transport de sânge și metabolism în ficat. DHA-TG este atribuit în mod preferențial LDL-PL, în timp ce DHA-PL este atribuit în mod preferențial HDL-PL. S-a constatat, de asemenea, că PUFA omega-3, inclusiv DHA, sub forma asociată cu fosfolipidele, sunt mai intens încorporate în țesuturi. Acest lucru se datorează probabil disponibilității mai bune a acizilor LC n -3 PUFA-PL conținute în uleiul de krill decât cei prezenți în uleiul de pește LC n -3 PUFA-TG pentru căile de oxidație ale ficatului [ 189 ]. Uleiul de krill inhibă lipogeneza de novo, dar îmbunătățește oxidarea grasă170 ].

3.3. Transportul creierului

Acizii omega-3 sunt încorporați în membrana celulară a multor organe și țesuturi, mai ales a inimii, a țesutului nervos și a retinei [ 167 ]. Suplimentarea orală cu PUFA omega-3 crește conținutul acestor acizi în lichidul cefalorahidian [ 190]. Trecerea eficientă a barierei sânge-creier necesită, totuși, particule purtătoare – în cazul DHA, este vorba de 1-lizo, 2-docosahexaenoyl-glicerofoscocolină (LysoPC-DHA), ceea ce crește transportul DHA intracerebral de până la 10 ori. Este o particulă specifică creierului și nu facilitează transportul DHA la inimă, ficat sau rinichi, deși sunt necesare studii detaliate la om. Transportatorii (care transportă DHA la creier) cu proprietăți potențial mai bune sunt sintetizați, un exemplu fiind obținerea de AceDoPC (1-acetil, 2-docosahexaenoil-glicerofosfocolină) [ 191 ].

3.4. Administrare parentală

Majoritatea studiilor, în special cele bazate pe oameni, care servesc la determinarea biodisponibilității acizilor omega-3, se aplică la administrarea lor orală. Este dificil să se valideze complet administrarea parenterală de acizi grași omega-3 în raport cu populația sănătoasă, deoarece această metodă de aprovizionare este rezervată în principal pacienților care urmează terapie intensivă, atât adulți cât și prunci prematur [ 142 , 192 , 193 ]. În plus, este de remarcat faptul că administrarea parenterală a amestecurilor pe bază de ulei de pește poate duce la deteriorarea biochimică a ficatului și chiar la progresia fibrozei în acest organ194 ].

Al-Taan și colab. [ 195] a efectuat un studiu pe 20 de pacienți care așteaptă eliminarea chirurgicală a metastazelor colorectale din cancerul hepatic. Acești indivizi au avut teste normale ale funcției hepatice și niveluri plasmatice ale lipidelor în intervalul de referință. Scopul studiului a fost de a evalua conținutul de acizi grași din fosfatidilcolină și eritrocite plasmatice în timpul și după perfuzia intravenoasă de emulsie de ulei. Fosfatidilcolina (PC) este principalul fosfolipid care poate fi găsit în circulație (sânge) și eritrocit (membrană) în timpul și la scurt timp după perfuzia intravenoasă a emulsiei de ulei. Administrarea parenterală a emulsiei lipidelor DHA și EPA a permis o creștere rapidă și semnificativă a nivelului lor de sânge (EPA / DHA în PC-ul plasmatic și EPA în eritrocite). Cu toate acestea, nivelurile EPA au revenit la valorile inițiale la cinci-12 zile de la sfârșitul perfuziei. Nu numai Al-Taan,dar și Browning [177 ], a sugerat o cifră de afaceri mai rapidă a EPA decât DHA în celule și, astfel, acest efect are loc atât cu administrarea orală, cât și intravenoasă, cu un timp de administrare diferit. Faptul unei infuzii relativ scurte de emulsie de ulei este, de asemenea, semnificativ.

3.5. Efect de matrice și emulsificare

Mulți autori subliniază rolul cheie al conținutului de grăsime din alimente în absorbția acizilor omega-3 („efectul matricei” [ 167 , 179 ]) și sugerează necesitatea introducerii unei recomandări pentru consumul formulărilor care conțin acizi grași omega-3 cu alimente bogate în grăsimi [ 167 , 178 , 196 ]. Schuchardt subliniază lipsa efectului cardioprotector preconizat în populația germană care suplimentează omega-3 PUFA în timpul micului dejun, din cauza micului dejun tipic german relativ scăzut de grăsimi [ 167 ]. În mod similar, societatea americană are obiceiul de a mânca un mic dejun cu conținut scăzut de grăsimi, care în cazul lor conține doar 16% din grăsimea consumată în timpul zilei [ 197]. În plus, conținutul de grăsime din alimente este uneori invers proporțional cu cantitatea de acizi grași omega-3 pe care îi conține. De exemplu, plantele cu conținut ridicat de grăsimi pot avea câțiva acizi grași omega-3 – Entandrophragma angolense – o sursă potențială de alimente cu beneficii pentru sănătate are o grăsime estimată la 59,43% din greutatea proaspătă. Cu toate acestea, 33,29% în greutate din uleiul de semințe de Entandrophragma conține acid oleic și doar 0,2% în greutate este acid alfa- linolenic [ 139 , 198 ]. Pe de altă parte, Chia conține ulei în cantitate de 27 g la 100 g semințe, din care 64,04% este ALA și doar 14,98% sunt acizi grași saturați68]. Soia conține puțin mai puțin grăsime. Cu toate acestea, conținutul ridicat de acid linoleic și raportul nefavorabil omega-6 / omega-3 îl fac un aliment cu o valoare îndoielnică pentru sănătate, mai ales că s-a demonstrat că este posibilă inducerea obezității la șoarecii cu ulei de soia [ 95 , 139 , 199 ].

Grăsimea conținută în dietă stimulează pancreasul să secrete enzime digerare a grăsimilor și vezica biliară pentru a elimina bila care conține săruri biliare, care emulsionează grăsimile și activează lipaza pancreatică [ 196 ]. Cu toate acestea, se recomandă persoanelor cu risc cardiovascular ridicat să reducă aportul de grăsime animală. Pe de altă parte, înlocuirea grăsimii animale cu grăsime vegetală nu este neapărat o soluție bună, ținând cont de obiceiurile alimentare, de supraponderale omniprezent și de multe ori conținut scăzut de acizi grași omega-3 la plantele bogate în grăsimi. Aceste persoane beneficiază de realizările nanotehnologiei, printre care Cavazos-Garduno [ 200] menționează nanoparticule, nanosfere, nanocapsule, nanoparticule lipide solide (SLN), sisteme de eliberare de medicamente autoemulsionante (SEDDS) și nanoemulsii, care îmbunătățesc semnificativ absorbția acizilor grași într-un mediu cu conținut scăzut de grăsimi. Cercetările indică faptul că particulele mai mici de 0,2 micrometri sunt absorbite mai bine.

Sistemul de eliberare auto-microemulsifiantă (SMEDS) conține LC n -3 FA-EE și o serie de compuși care sunt emulsificați în stomac, fără a fi nevoie de o masă bogată în grăsimi [ 196 ]. Se știe de mulți ani că acizii omega-3 emulsionati se caracterizează printr-o biodisponibilitate la fel de bună în medii sărace și cu grăsimi ridicate [ 196 , 201 ]. Analiza Qin [ 196 ] indică faptul că absorbția DHA + EPA EE conținută în preparatele SMEDS este de 6 ori mai mare decât DHA + EPA EE. Pentru a confirma eficacitatea tehnologiei SMEDS, sunt necesare studii pe termen lung pentru a analiza procesul de înglobare a acizilor grași menționați mai sus în structura membranelor celulare, în special a eritrocitelor.

Beneficiile emulsificării au fost descrise și de Puri, [ 138 ]. A folosit sisteme similare de eliberare de medicamente auto-nanoemulsifiante (SNEDDS).

Absorbția etilesterilor de acizi grași omega-3 poate fi, de asemenea, îmbunătățită prin utilizarea Advanced Technologies Lipid (ALT). ALT este, potrivit producătorului, un sistem lipofil special, care, indiferent de furnizarea de alimente și conținutul de grăsimi al acestora, crește biodisponibilitatea compușilor pe bază de lipide, inclusiv esteri etilici ai acizilor grași omega-3, generând formarea spontană a micelelor . Un exemplu de preparat echipat cu această componentă este SC401 (etilesterii DHA și EPA + Advanced Lipid Technologies). În furnizarea de alimente cu conținut scăzut de grăsimi, aportul de SC401 a fost asociat cu valori semnificativ mai mari care demonstrează biodisponibilitatea DHA și EPA decât Lovaza (aproape 2 ori C max și AUC de 3 ori mai mare (0-ultima) ).

Acizii grași liberi sunt un alt exemplu de formulă bine absorbită cu un conținut scăzut de grăsimi în dietă. Biodisponibilitatea Epanova în condiții de alimentare cu conținut scăzut de grăsimi este mult mai mare decât în ​​cazul Lovaza (AUC (0-t)) pentru Epanova este de patru ori mai mare decât pentru Lovaza), care, la rândul său, consumat cu alimente bogate în grăsimi, are biodisponibilitate similară în cea acceptată de SC401 în condițiile unei alimentări reduse [ 201 ].

Vegetarienii și veganii vor putea utiliza, de asemenea, tehnica de emulsionare în conformitate cu propriul lor stil de viață, deoarece rezultatele ultimelor cercetări indică posibilitatea utilizării proteinelor vegetale din mazăre, linte și fasole faba ca emulgatori [ 202 ]. Mai mult, nanoemulsiile ulei în apă sunt construite folosind uleiuri vegetariene (alge și ulei de in)202 , 203 ].

O metodă foarte comună de încorporare a nanoemulsiei în alimente este transformarea acesteia, cel mai adesea sub formă de pulbere, folosind microcapsulare [ 204 ]. Microcapsularea stabilizează amestecul de ulei, îl protejează împotriva oxidării și elimină diferența de fază prezentă adesea atunci când este amestecată cu alimente [ 181 ]. Microcapsularea uleiului de pește crește biodisponibilitatea PUFA omega-3 până la o valoare foarte apropiată de biodisponibilitatea acestor acizi în mesele bogate în ulei de pește sub formă lichidă [ 205 ]. Emulsificarea crește biodisponibilitatea PUFA-urilor de LC omega-3 prin creșterea eficienței încorporarii în lipoproteine ​​bogate în triacilinglicerie [ 206]. Emulgatorii modifică, de asemenea, expresia genelor responsabile de transportul acizilor grași în enterocite [ 143 ]. Emulsificarea (preemulsificare) crește absorbția PUFA-urilor LC, inclusiv DHA, EPA și ALA, dar nu are efect asupra absorbției acizilor grași care au o lungime mai scurtă a lanțului și mai puține legături nesaturate [ 143 , 207 , 208 ].

Desigur, emulsificarea crește nu numai biodisponibilitatea acizilor omega-3 din sânge, ci și a limfei. Emulgatorii folosiți în alimente fac parte din acest mecanism. De exemplu, lecitina de soia adăugată la uleiul de semințe de in crește numărul și dimensiunea de chilomicroni bogate în ALA produse de enterocite. Cu toate acestea, un alt emulsionant, cazeinat de sodiu, reduce semnificativ absorbția ALA în intestin. Acest lucru este probabil legat de efectul asupra expresiei genei FABP2, care este implicată în transportul acizilor grași în enterocite. S-a remarcat că prezența lecitinei de soia în emulsie a fost însoțită de o expresie ridicată a acestei gene, în timp ce utilizarea cazeinatului de sodiu a fost asociată cu o scădere a expresiei genice FABP2 [ 143]. Acest proces necesită o cercetare atentă asupra oamenilor, deoarece este probabil ca efectul emulgatorilor asupra expresiei genice să fie luat în considerare în timpul producției de alimente, mai ales atunci când ne așteptăm la un efect specific de vindecare.

4. Interacțiuni între acizii grași polinesaturați cu lanț lung

Acidul linoleic (LA), care este acidul gras omega-6, concurează cu ALA pentru enzimele care transformă acidul alfa- linolenic în EPA, DPA și DHA. LA este (în mod similar acidului arahidonic), printre altele, precursorul eicozanoizilor, în timp ce DHA, DPA și EPA pot fi transformate în agenți antiinflamatori. [ 25 , 26 , 209 ]. Modificările furnizării de PUFA omega-6 afectează concentrația plasmatică a acizilor grași omega-3. Acest lucru se aplică atât acizilor grași omega-3 neesterificați, cât și celor asociați cu fosfolipide, trigliceride și esteri colesterilici. Taha și colab. [ 209] a arătat că reducerea alimentării cu PUFA omega-6 timp de 12 săptămâni crește concentrația de PUFA omega-3 în plasmă. În plus, creșterea simultană a furnizării de PUFA omega-3 timp de o duzină de săptămâni ridică în continuare concentrația acestor acizi în plasmă și scade nivelul acidului arahidonic. O interacțiune importantă a PUFA-urilor omega-6 cu omega-3 PUFA-urilor o reprezintă producția de tromboxani și leucotriene non-native [ 170 ]. Acest lucru rezultă probabil, printre altele, din concurența substratului pentru centrul catalitic al desaturazelor și elongazelor, precum și din reducerea producției de acid arahidonic cu un aport suficient de ridicat de n- 3 PUFA.

Pe baza analizei critice a lui Wood, [ 185 ], se poate concluziona că o creștere a nivelului de EPA și, de asemenea, într-un anumit grad de DHA, poate fi obținută probabil prin reducerea furnizării de acid linoleic și / sau creșterea aportului de acid alfa- linolenic deși amploarea schimbării este mică. Se sugerează menținerea raportului dintre consumul omega-6 / omega-3 în intervalul 1/5 până la 1/10 și, în mod ideal, ca în societatea japoneză, de la 1/2 la 1/4 [ 141 , 210 ]. La rândul său, pentru mamele care alăptează, acest raport nu trebuie să depășească 10211 ]. Între timp, dietele societăților occidentale se caracterizează printr-un avantaj clar al furnizării de acizi grași omega-6 și raportul dintre n -6 /n -3 modelarea în intervalul 15/1 până la 16,7 / 1 [ 212 ]. Discuția despre raportul preferat de consum de acizi grași omega-6 și omega-3 se desfășoară de mulți ani și încă nu a produs rezultate convingătoare. Cercetătorii se întreabă de legitimitatea revenirii la o „dietă ancestrală”, care este atribuită consumului echilibrat al ambelor grupuri de acizi grași la nivelul 1: 1 [ 213 , 214 , 215 , 216]. De asemenea, se acordă atenție anumitor beneficii pentru sănătate, care pot rezulta dintr-un raport strict definit de omega-6 la omega-3, astfel cum este exemplificat prin efectul benefic postulat al raportului 4: 1 asupra funcționării sistemului nervos sau reducerea proliferării celulelor tumorale la pacienții cu cancer colorectal cu care s-au hrănit singuri, păstrând raportul 2,5: 1 în dietă212 , 217 , 218 , 219 ]. Autorii de mai sus indică dorința de a consuma de până la patru ori mai mulți acizi grași omega-6 decât omega-3, iar această valoare depinde de boala luată în considerare. Indiferent de simptomele sau lipsa acestora, majoritatea cercetătorilor postulați nu au depășit aporturile omega6 / omega-3 la 10 [ 211 , 213]. Având în vedere obiceiurile alimentare ale societăților din multe țări puternic dezvoltate, un anumit compromis pare a fi recomandările actuale pentru consumul de acizi grași omega-6 și omega-3, care conturează indicele omega-6 / omega-3 în intervalul de la 7: 1 la 11: 1 [ 220 ].

Kohler și colab. [ 178 ] a studiat biodisponibilitatea DHA și EPA adăugate sub formă de esteri etilici la cârnați cu conținut similar de ALA. Atât indicele Omega-3, cât și procentul de EPA și DHA în eritrocite au crescut semnificativ mai mult în grupul verum decât în ​​grupul control (placebo), în care au rămas aproape neschimbate. Conținutul DPA a crescut în mod similar în ambele grupuri. Absența unei creșteri semnificative a EPA și DHA în grupul de control, în ciuda suplimentării ALA la ambele grupuri, nu este surprinzător, deoarece ALA este convertit în EPA și DHA într-o măsură foarte mică [ 136 , 140 , 141]. Diferența creșterii nivelurilor de EPA, DHA și DPA în grupul de control se poate datora eficienței de conversie diferite a ALA în acizii menționați, deși acesta nu este singurul motiv, deoarece acești acizi pot fi, de asemenea, convertiți în fiecare alte. Interesant este că nivelul ALA a crescut ușor în grupul martor ( p = 0,038), în timp ce în grupul de tratament a scăzut ușor ( p = 0,141). În ciuda diferenței mici în aceste niveluri de ALA și a lipsei de semnificație statistică a scăderii ALA în grupul de tratament, explicația diferențelor mari ale nivelurilor de ALA după suplimentarea între participanții necesită o cercetare atentă asupra interacțiunilor metabolice ale acizilor grași omega-3 individuali.

5. Oxidarea lipidelor

PUFAs LC omega-3 sunt sensibile la oxidare [ 206 , 221 ]. Unele studii raportează un nivel crescut de lipide peroxidate în capsulele de ulei de pește și, deoarece consumul lor regulat poate afecta sănătatea, trebuie luată în considerare această problemă [ 206 ]. Unul dintre modurile de a proteja acizii omega-3 împotriva oxidării este microcapsularea uleiurilor folosind coacervate complexe WPI-GA și microcapsule uscate prin pulverizare [ 221 ]. Una dintre metodele alternative mai puțin costisitoare este gelarea ionică folosind mucus Salvia hispanica în combinație cu alginat de sodiu și calciu [ 222 ]. Efectul oxidării asupra biodisponibilității acizilor grași omega-3 nu este clar. Conform lui Staprans și Naruszewicz [223 , 224 ], consumul de uleiuri vegetale peroxidate crește numărul de lipide peroxidate în chilomicroni. Ottestad [ 206 ], pe de altă parte, raportează că consumul de ulei de ficat de cod oxidat nu are efect asupra încorporarii de PUFA omega-3 în lipoproteine ​​bogate în triacilgliceride.

6. Concluzii

În ultimii ani, au fost înregistrate progrese semnificative în cercetarea privind biodisponibilitatea acizilor grași omega-3. Cunoaștem din ce în ce mai mult sursele lor și înțelegem mai bine importanța structurii lor chimice și a formei de suplimentare. Oamenii consumă acizi grași omega-3 în principal cu pește și, într-o măsură mai mică, cu produse din cereale și carne. Unele dintre ele, însă, nu apar în produsele menționate mai sus, sau prezența lor este neexplorată. În plus, conținutul de acizi individuali din plante depinde de locul apariției lor, iar la animale de tipul dietei. În ciuda disponibilității ridicate a fructelor de mare, care sunt bogate în numeroși acizi omega-3,autorii recunosc nevoia de a căuta în mod constant noi surse de acizi grași omega-3, datorită riscului de expunere excesivă la mercur metil și la alți compuși toxici prezenți în zonele de pescuit. În plus, unii acizi, cum ar fi acidul coniferonic sau juniperonic, apar mai ales în plante care nu sunt utilizate pe scară largă în consum sau sunt chiar otrăvitoare, dar pot fi utilizate în industria farmaceutică și în chimia medicamentelor. Acest lucru este important din cauza numeroaselor motive pentru a găsi acizi grași omega-3 și derivații acestora, substanțe active valoroase care pot fi importante în dezvoltarea de noi medicamente și regimuri terapeutice. Opiniile despre biodisponibilitatea acizilor grași omega-3 sunt împărțite. Unii cred că acizii legați de fosfolipide sunt mai bine absorbiți,precum și mai intens încorporate în țesuturi decât cele asociate sub formă de trigliceride, datorită specificului transportului de sânge și o mai bună accesibilitate a căilor de beta-oxidare. Alții, însă, sunt de părere că factorii care nu au legătură cu tipul de legătură chimică joacă un rol esențial, iar conținutul de grăsime din alimente este decisiv. În plus, efectele promițătoare par să rezulte din utilizarea sistemelor lipofile speciale și a emulsiilor nano (micro). Cu toate acestea, ar trebui să se țină seama de tipul de emulgator utilizat, deoarece unele influențează expresia genei implicate în transportul acizilor grași în enterocite în diferite moduri. Acizii grași se afectează reciproc asupra metabolismului organismului, care este de importanță dietetică. Majoritatea cercetătorilor recomandă consumul de acizi grași omega-6 de câteva ori mai mare decât cel de omega-3. Acizi grasi omega-3,la fel ca toți acizii grași, sunt foarte sensibili la oxidare. Există metode care perturbă acest proces și pot fi utilizate la producerea suplimentelor, dar semnificația procesului în sine pentru biodisponibilitate nu este clară.

Se speră că citirea recenziei de mai sus încurajează oamenii de știință să efectueze cercetări suplimentare, ceea ce va risipi aceste și multe alte îndoieli.

Abrevieri

Următoarele abrevieri sunt utilizate în acest manuscris:

13-LnHPO (9 Z , 11 E , 15 Z ) -13-Acid hidroperoxioctadeca-9,11,15-trienoic
ALA acidul alfa- linoleic
ALT Tehnologii avansate de lipide
ARA Acidul arahidonic
ASCt Zona sub curba (concentrare-timp)
CFA Acidul gras conjugat
max Concentrație maximă
DAG diacilglicerol
DHA (4 Z , 7 Z , 10 Z , 13 Z , 16 Z , 19 Z ) -Docosa-4,7,10,13,16,19-acid hexaenoic (acid cervonic)
DPA (7 Z , 10 Z , 13 Z , 16 Z , 19 Z ) -Docosa-7,10,13,16,19-acid pentaenoic (acid clupanodonic)
DTrE (13 Z , 16 Z , 19 Z ) -Docosa-13,16,19-acid trienoic
EE Esteri etilici
EFA Acid gras gras esential
EPA (5 Z , 8 Z , 11 Z , 14 Z , 17 Z ) -Icosa-5,8,11,14,17-acid pentaenoic (acid timnodonic)
ETA (8 Z , 11 Z , 14 Z , 17 Z ) -Icosa-8,11,14,17-acid tetraenoic
ETE (11 Z , 14 Z , 17 Z ) -Icosa-11,14,17-acid trienoic (acid homo- alfa- linolenic)
FA Acid gras
FFA Acid gras gras
FMLP N -Formilmetionil-leucil-fenilalanină
HDA Acidul (9 Z ) -12-Hidroxidodec-9-enoic
HDL Lipoproteină de densitate mare
HFA Acidul gras hidroxi
HPA (6 Z , 9 Z , 12 Z , 15 Z , 18 Z ) -Henicosa-6,9,12,15,18-acid pentaenoic
iAUCt Aria incrementală sub curba (concentrație-timp)
LA Acid linoleic
LC Lanț lung
LDL Lipoproteină cu densitate mică
MAG monoacylglycerol
MCFA Acidul gras cu lanț mediu
MUFA Acidul gras monoinsaturat
PA Acid fosfatidic
PC fosfatidilcolină
PE fosfatidiletanolamină
PG fosfatidilglicerol
PKC Proteina kinazei C
PL fosfolipidele
PUFA Acid gras gras polinesaturat
RTG TG reesterificat
SC401 Etilesteri DHA și EPA + Advanced Lipid Technologies
AGLS Acid gras cu lanț scurt
SDA Acidul stearidonic
SEDDS Sistem de eliberare de medicamente auto-emulsionante
SLN Nanoparticule lipide solide
SMEDS Sistem de livrare auto-microemulsificant
SNEDDS Sistem de eliberare de medicamente auto-nanoemulsifiante
TG Triacilglicerol (triacilglicerid, triglicerid)
VFA Acidul gras volatil
VLCFA Acide grași cu lanț lung
WPI-GA Izolat proteic din zer arabic (complex)
Logo-ul substanțelor nutritive

Link to Publisher's site
Nutrienți . 2018 nov; 10 (11): 1662.
Publicat online 2018 nov 4. doi: 10.3390 / nu10111662
PMCID: PMC6267444
PMID: 30400360

Finanțarea

Această cercetare nu a primit nicio finanțare externă

Conflicte de interes

Autorii declară niciun conflict de interese, financiar sau de altă natură.

Referințe

1. Nagao K., Yanagita T. Acizii grași conjugați în alimente și beneficiile lor pentru sănătate. J. Biosci. Bioeng. 2005; 100 : 152-157. doi: 10.1263 / jbb.100.152. PubMed ] [ CrossRef ] Google Scholar ]
2. Scorletti E., acizii grași Byrne CD Omega-3, metabolismul lipidelor hepatice și boli hepatice grase nonalcoolice. Annu. Rev. Nutr. 2013; 33 : 231–248. doi: 10.1146 / annurev-nutr-071812-161230. PubMed ] [ CrossRef ] Google Scholar ]
3. Chatgilialoglu C., Ferreri C., Melchiorre M., Sansone A., Torreggiani A. Izomerism geometric lipidic: De la chimie la biologie și diagnostic. Chem. Rev. 2014; 114 : 255–284. doi: 10.1021 / cr4002287. PubMed ] [ CrossRef ] Google Scholar ]
4. IUPAC. Compendiu de terminologie chimică – „Cartea de aur”. A 2-a ed. Blackwell Publicatii stiintifice; Oxford, Marea Britanie: 1997. [(accesat la 10 decembrie 2017)]. izomeri cis – trans . Disponibil online: http://goldbook.iupac.org/html/C/C01093.html . Academic Google ]
5. IUPAC. Compendiu de terminologie chimică – „Cartea de aur”. A 2-a ed. Blackwell Publicatii stiintifice; Oxford, Marea Britanie: 1997. [(accesat la 10 decembrie 2017)]. E, Z Disponibil online: http://goldbook.iupac.org/html/E/E01882.html . Academic Google ]
6. IUPAC. Compendiu de terminologie chimică – „Cartea de aur”. A 2-a ed. Blackwell Publicatii stiintifice; Oxford, Marea Britanie: 1997. [(accesat la 10 decembrie 2017)]. Acizi grași. Disponibil online: http://goldbook.iupac.org/html/F/F02330.html . Academic Google ]
7. Poulos A., Sharp P., Johnson D., White I., Fellenberg A. Apariția acizilor grași polienoici cu mai mult de 22 de atomi de carbon în spermatozoizii de mamifere. Biochem. J. 1986; 240 : 891–895. doi: 10.1042 / bj2400891. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
8. Aveldaño MI, Sprecher H. Acizi grași polienoici cu lanț foarte lung (C24 până la C36) din seriile n-3 și n-6 din fosfatidilcolinele dipolinsaturate de la retina bovină. J. Biol. Chem. 1987; 262 : 1180–1186. PubMed ] Google Scholar ]
9. Rombeau JL, Kripke SA, Settle RG Producție de acizi grași cu lanț scurt, absorbție, metabolism și efecte intestinale. În: Kritchevsky D., Bonfield C., Anderson JW, editori. Fibre dietetice. Chimie, fiziologie și efecte asupra sănătății. Prima ediție Springer; New York, NY, SUA: 1990. p. 317–337. Academic Google ]
10. Schönfeld P., Wojtczak L. Acizii grași cu lanț scurt și mediu în metabolismul energetic: perspectiva celulară. J. Lipid Res. 2016; 57 : 943–954. doi: 10.1194 / jlr.R067629. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
11. Beermann C., Jelinek J., Reinecker T., Hauenschild A., Boehm G., Klör HU Efecte pe termen scurt ale acizilor grași cu lanț mediu de dietă și a acizilor grași polinesaturați cu lanț lung n-3 asupra metabolismului gras al sănătății voluntari. Sănătatea lipidelor Dis. 2003; 2 : 10. doi: 10.1186 / 1476-511X-2-10. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
12. Braverman N., Eichler F. Tulburări peroxisomale și boli neurologice. În: Squire LR, editor. Enciclopedia Neuroștiinței. Volumul 7. Presă academică; Oxford, Marea Britanie: 2009. p. 579–588. Academic Google ]
13. Sassa T., Kihara A. Metabolismul acizilor grași cu catenă lungă: gene și fiziopatologie. Biomol. Ther. (Seul) 2014; 22 : 83–92. doi: 10.4062 / biomolther.2014.017. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
14. Poulos A., Johnson DW, Beckman K., White IG, Easton C. Apariția unor specii moleculare neobișnuite de sfingomielină care conțin acizi grași polienoici cu 28-34 de carbon în spermatozoizii de berbec. Biochem. J. 1987; 248 : 961–964. doi: 10.1042 / bj2480961. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
15. Hardy SJ, Ferrante A., Poulos A., Robinson BS, Johnson DW, Murray AW Efectul acizilor grași exogeni cu mai mult de 22 de atomi de carbon (acizi grași cu lanț foarte lung) asupra producției de superoxizi de către neutrofile umane. J. Immunol. 1994; 153 : 1754–1761. PubMed ] Google Scholar ]
16. Hardy SJ, Ferrante A., Robinson BS, Johnson DW, Poulos A., Clark KJ, Murray AW Activarea in vitro a proteinei kinazei C a șobolanului de acizi grași cu catenă lungă. J. Neurochem. 1994; 62 : 1546–1551. doi: 10.1046 / j.1471-4159.1994.62041546.x. PubMed ] [ CrossRef ] Google Scholar ]
17. Singh M. Acizi grași esențiali, DHA și creierul uman. Indianul J. Pediatr. 2005; 72 : 239–242. doi: 10.1007 / BF02859265. PubMed ] [ CrossRef ] Google Scholar ]
18. Arts MT, Ackman RG, Holub BJ „Acizi grași esențiali” în ecosistemele acvatice: o legătură crucială între dietă și sănătatea umană și evoluție. Poate sa. J. Pește. Aquat. Sci. 2001; 58 : 122–137. doi: 10.1139 / f00-224. CrossRef ] Google Scholar ]
19. Osborne TB, Mendel LB Creștere pe dietele sărace în grăsimi adevărate. J. Biol. Chem. 1920; 45 : 145–152. Academic Google ]
20. Burr GO, Burr MM O nouă boală cu deficiență produsă prin excluderea rigidă a grăsimilor din dietă. J. Biol. Chem. 1929; 82 : 345–367. doi: 10.1111 / j.1753-4887.1973.tb06008.x. PubMed ] [ CrossRef ] Google Scholar ]
21. Holman RT Acizi grași esențiali. Nutr. Rev. 1958; 16 : 33–35. doi: 10.1111 / j.1753-4887.1958.tb00660.x. PubMed ] [ CrossRef ] Google Scholar ]
22. Das U. Acizi grași esențiali – biochimie, fiziologie și semnificație clinică. În: Das U., editor. Bazele moleculare ale sănătății și bolilor. Prima ediție Springer; Dordrecht, Olanda: 2011. p. 101–151. Academic Google ]
23. Semba RD Acizii grași esențiali și dezvoltarea vizuală la sugari. În: Semba RD, editor. Nutriție și sănătate: Manual de nutriție și oftalmologie. Prima ediție Humana Press; Totowa, NJ, SUA: 2007. p. 415–441. Academic Google ]
24. van Goor SA, Dijck-Brouwer DAJ, Muskiet FAJ Relații cu acizi grași polinesaturați cu lanț lung-mamă-copil: implicații pentru dietă și comportament. În: Preedy VR, Watson RR, Martin CR, editori. Manual de comportament, alimente și nutriție. Prima ediție Volumul 2. Springer; New York, NY, SUA: 2011. p. 1139–1156. Academic Google ]
25. Parrish CC Acizi grași esențiali din pânzele alimentare alimentare acvatice. În: Arts MT, Brett MT, Kainz M., editori. Lipide în ecosistemele acvatice. Prima ediție Springer; New York, NY, SUA: 2009. p. 309-326. Academic Google ]
26. Nakamura MT, Nara TY Sinteza de acizi grași esențiali și reglarea sa la mamifere. Prostaglandine Leukot. Essent. Gras. Acizi. 2003; 68 : 145–150. doi: 10.1016 / S0952-3278 (02) 00264-8. PubMed ] [ CrossRef ] Google Scholar ]
27. Gurr MI, Harwood JL Biochimia lipidelor. O introducere. A 4-a ed. Chapman și Hall; Londra, Marea Britanie: 1991. p. 406. Google Scholar ]
28. Cunnane SC, Likhodii SS 13 C spectroscopie RMN și gaz cromatograf cu combustie izotopilor spectrometrie de masă raportul: aplicații complementare în monitorizarea metabolismul 13 acizi grași polinesaturați C marcați. Poate sa. J. Physiol. Pharmacol. 1996; 74 : 761–768. doi: 10.1139 / y96-071. PubMed ] [ CrossRef ] Google Scholar ]
29. Dunstan GA, Volkman JK, Jeffrey SW, Barrett SM Compoziția biochimică a microalgei din clasele de algă verde Chlorophyceae și Prasinophyceae . 2. clase lipide și acizi grași. J. Exp. Mar Biol. Ecol. 1992; 16 : 115–134. doi: 10.1016 / 0022-0981 (92) 90193-E. CrossRef ] Google Scholar ]
30. Viso CA, Marty J.-C. Acizii grași din 28 de microalge marine. Phytochemistry. 1993; 34 : 1521–1533. doi: 10.1016 / S0031-9422 (00) 90839-2. CrossRef ] Google Scholar ]
31. Nanton DA, Castell JD Efectele acizilor grași din dietă asupra compoziției de acizi grași a copepodului harpacticoid , Tisbe sp., Pentru utilizare ca aliment viu pentru larvele de pește marin. Acvacultură. 1998; 163 : 251–261. doi: 10.1016 / S0044-8486 (98) 00236-1. CrossRef ] Google Scholar ]
32. Cunnane SC Societatea canadiană de științe nutriționale 1995 Conferința premiului pentru cercetători tineri Studii recente privind sinteza, β-oxidarea și deficiența de linoleat și α-linolenat: Acizii grași esențiali sunt mai des numiți acizi grași indispensabili sau dispensabili condiționat? Poate sa. J. Physiol. Pharmacol. 1996; 74 : 629–639. doi: 10.1139 / y96-089. PubMed ] [ CrossRef ] Google Scholar ]
33. Cunnane SC Natura condițională a necesității dietetice pentru un poliunsturat: O propunere de reclasificare a acizilor grași esențiali ca acizi grași „indispensabili din punct de vedere condiționat” sau „condiționabili”. Br. J. Nutr. 2000; 84 : 803–812. doi: 10.1017 / S0007114500002415. PubMed ] [ CrossRef ]