Rezultatele căutări pentru: beck

Intarirea Sistemului Imunitar-Electromedical Bob Beck

Dr. Bob Beck, PhD ( în fizică) a conceput o combinatie de alternative bazate pe un  un dispozitiv electromedical simplu care curăță sângele complet de microbi http://www.bobbeck.com/

Inițial conceput ca un remediu pentru SIDA, s-a dovedit a fi si un remediu pentru cancer și (cazuri foarte avansate de cancer)!

Protocolul(combinatia) Bob Beck este un protocol oarecum ieftin, conceput pentru a intari sistemul imunitar prin uciderea microbilor din sistemul sanguin si limfatic (atentie, acesta este un proces lent)http://www.bobbeckprotocol.com/

Poate fi poate solutia optima pret/performanata cand vine vorba de intarirea sistemului imunitar.Desi exista si modalitati electromedicale mai eficiente in timp acestea sunt mai scumpe, iar intarirea prin tratamente nutritionale poate fi mai lenta.

Sistemul imunitar creează două molecule cheie: interleukina si interferon.  Aceste molecule sunt numite neuropeptide sau proteine nervoase.

Continuă lectura

Clorochina și hidroxiclorochina pentru terapia cancerului

Abstract

Macroautofagia (denumită aici autofagie) este un mecanism foarte conservat pentru degradarea lizozomală a componentelor citoplasmatice. Autofagia este esențială pentru menținerea homeostaziei intracelulare, atât în ​​condițiile de bază, cât și în contextul răspunsurilor adaptive la stres. În conformitate cu această noțiune, defectele aparatului autofagic au fost asociate etiologic cu diferite tulburări umane, inclusiv afecțiuni infecțioase, inflamatorii și neoplazice. Odată ce tumorile sunt stabilite, cu toate acestea, autofagia susține supraviețuirea celulelor maligne, reprezentând astfel o țintă atrăgătoare pentru proiectarea de noi regimuri anticanceroase. În consecință, s-a demonstrat că inhibitorii autofagiei, inclusiv clorochina și hidroxiclorochina, mediază efecte antineoplazice substanțiale în modelele preclinice,mai ales atunci când este combinat cu intervenții chimioterapice sau radioterapeutice. Cu toate acestea, profilul farmacologic al clorochinei și hidroxiclorochinei pare să implice alte mecanisme decât inhibarea autofagiei. Aici, discutăm rolul dual al autofagiei în oncogeneză și progresia tumorii și rezumăm rezultatele sau proiectarea studiilor clinice finalizate recent sau inițiate pentru a evalua activitatea terapeutică a derivaților de clorochină la pacienții cu cancer.și rezuma rezultatele sau proiectarea studiilor clinice finalizate recent sau inițiate pentru a evalua activitatea terapeutică a derivaților de clorochină la pacienții cu cancer.și rezuma rezultatele sau proiectarea studiilor clinice finalizate recent sau inițiate pentru a evalua activitatea terapeutică a derivaților de clorochină la pacienții cu cancer.Cuvinte cheie: autofagozomi, bafilomicină A1, beclin 1, lizozomi, mTOR, proteazomMergi la:

Introducere

Termenul de autofagie (din greaca veche, αυτο / auto = „self” + ϕαγos, ϕαγϵĩν / phagein = „a mânca”; adică self-eating) se referă cumulativ la un grup de mecanisme catabolice implicate în menținerea homeostaziei celulare și tisulare în toate eucariotele. Autofagia joacă un rol esențial în multiple procese fiziologice, inclusiv dezvoltarea, diferențierea, creșterea normală și imunitatea. – 3 În conformitate cu această noțiune, defecte ale călăului și mecanismele de reglare ale autofagiei au fost implicate în etiologia unui grup de tulburări relevante clinic, inclusiv boli infecțioase, neurodegenerative și neoplazice. – 6

Celulele mamiferelor sunt dotate cu cel puțin 3 căi autofagice distincte: macroautofagia, microautofagia și autofagia mediată de chaperonă. 8 Macroautofagia (denumită aici autofagie, din motive de simplitate) este un mecanism foarte conservat, responsabil pentru degradarea lizozomală a componentelor citoplasmatice, inclusiv agenții patogeni invadatori, agregatele de proteine ​​citotoxice și organele deteriorate. 8 Autofagia se bazează pe o veziculă dublă cu membrană, cunoscută sub numele de autofagozom. 9 Autofagozomii sunt generați în citoplasmă din organele precursoare cunoscute sub numele de fagofori, care învelesc progresiv materialul care urmează să fie degradat și – la închidere – fuzionează cu lizozomii. 11 Aceasta activează pompele H + pentru a reduce pH-ul lumenului lizozomal și, prin urmare, dezlănțuie activitatea catabolică a hidrolazelor lizozomale. Produsele degradării încărcăturii autofagice ajung în cele din urmă la citosol prin permeaze lizozomale, devenind astfel disponibile pentru reutilizare în circuitele metabolice biosintetice. 12 O descriere detaliată a mașinilor autofagice și a regulatoarelor sale depășește în mare măsură domeniul de aplicare al prezentului Trial Watch și poate fi găsit în Ref. 13 – 18

Deși inițial se credea că autofagozomii absorb materialul citoplasmatic într-un mod relativ neselectiv, un număr tot mai mare de dovezi au relevat existența unor căi autofagice foarte specializate care recunosc selectiv substraturile lor. Ca exemplu independent, sa demonstrat că mitofagia elimină în mod specific mitocondriile inutile sau deteriorate, funcționând astfel ca un mecanism cheie de control al calității. 19 – 21

Pe lângă funcționarea pentru conservarea homeostaziei celulare în condiții fiziologice, autofagia răspunde la o mare varietate de perturbații, inclusiv lipsa nutrienților și a factorului de creștere, hipoxia, invazia patogenilor și expunerea la agenți citotoxici. 22 În acest cadru, autofagia, în general, orchestrează un răspuns adaptiv la nivel celular care urmărește (1) eliminarea fizică a stimulului inițiator (atunci când este posibil), (2) gestionarea efectelor sale citotoxice și (3) restabilirea homeostaziei celulare . Astfel, autofagia constituie cel mai adesea un răspuns citoprotector care permite celulelor să se adapteze la condiții stresante. 23 24 Cu toate acestea, într-un număr limitat de scenarii, inclusiv dezvoltarea Caenorhabditis elegans 25și celulele Drosophila melanogaster , 26 – 28 , precum și expunerea celulelor canceroase la stimuli specifici, 29 – 32 autofagia pare să medieze (cel puțin parțial) moartea celulară. Numai în astfel de situații, adică atunci când inhibarea farmacologică sau genetică a mașinilor autofagice întârzie (mai degrabă decât accelerează) moartea celulară, termenul „moarte celulară autofagică” ar trebui folosit pentru a indica un subrutină specifică de moarte celulară. 24 33 34

Pe linia seriei Trial Watch publicată lunar în OncoImmunology, 35 – 38 aici rezumăm rolul dublu al autofagiei în oncogeneză și progresia tumorii și discutăm studii clinice recente care investighează utilizarea clorochinei (CQ), a hidroxiclorochinei (HCQ) la bolnavii de cancer. Important, deși acești agenți au fost testați inițial în scenarii oncologice datorită capacității lor de a inhiba autofagia, este acum clar că efectele lor terapeutice implică alte mecanisme. 39 – 41Mergi la:

Autofagie și cancer

Un număr mare de dovezi sugerează că relația dintre autofagie și cancer este complexă. 42 43 Pe de o parte, autofagia pare să inhibe transformarea malignă, reflectând capacitatea sa de a limita acumularea de entități potențial oncogene precum mitocondriile depolarizate (care supraproduc specii de oxigen reactiv potențial genotoxice, ROS). Pe de altă parte, autofagia sprijină progresia și diseminarea metastatică a tumorilor stabilite, crescând capacitatea celulelor maligne de a face față condițiilor micro-ambientale adverse, cum ar fi privarea de nutrienți și hipoxia (doi numitori comuni ai tumorilor solide cu creștere rapidă).

Autofagie în oncogeneză

Mai multe manipulări genetice distincte care compromit (cel puțin într-o oarecare măsură) competența mașinilor autofagice s-au dovedit a crește tendința animalelor de laborator de a dezvolta leziuni neoplazice, fie ele spontane, determinate genetic sau induse chimic. Acest lucru se aplică pierderii monoalelice a Beclin 1 ( Becn1 ), codificând o subunitate cheie a complexului de fosfoinozidă-3-kinază (PI3K) de clasa III care controlează formarea și alungirea autofagosomilor; 44 45 la absența întregului corp al 4C legată de autofagie, cisteina peptidază ( Atg4c) , care codifică o protează implicată într-unul dintre sistemele de conjugare necesare pentru autofagie; 46 ștergerea specifică a întregului corp sau a țesutuluiAtg5 și Atg7 , codificând două dintre componentele implicate în celălalt dintre astfel de sisteme de conjugare; 47 – 50 , precum și la ablația întregului corp a sequestozomului 1 ( SQSTM1 ), codificând un adaptor autofagic cel mai cunoscut sub numele de p62. 51 Aparent în contradicție cu aceste date, ablația bobinei 1 induse de RB1 ( Rb1cc1 ), care codifică o componentă a mașinii autofagice cunoscută și sub numele de FIP200, a fost raportată că inhibă dezvoltarea carcinoamelor mamare la șoarecii care exprimă poliom antigen T mijlociu sub controlul virusului tumorii mamare de șoarece repetarea terminală lungă. 52 În mod similar, pierderea monoallelic de Becn1S-a demonstrat că limitează tumorigenezele mamare determinate de partenerul și localizatorul BRCA2 (PALB2). 53 Cu toate acestea, rămâne de stabilit dacă astfel de efecte depind cu adevărat de autofagie, mai degrabă decât de a reflecta modificări indirecte ale sistemului proteinei tumorale p53 (TP53, cel mai cunoscut sub numele de p53). 54 55 FIP200 este într-adevăr cunoscut că influențează stabilitatea p53, iar efectele oncogene ale Becn1 +/− s-au pierdut într-un fundal nul Trp53 condiționat . 53 56 57

Demonstrând în continuare funcțiile oncosuppresive ale autofagiei, deleția monoalelică a BECN1 a fost detectată într-o fracțiune mare (mai mult de 40%) din carcinoamele mamare, ovariene și de prostată umane, 58 59 , în timp ce mutațiile ATG5 și ATG12 au fost documentate în o proporție de neoplasme colorectale. 60 Pe o linie similară, nivelurile de expresie ale ATG5 și BECN1 sunt modificate în diferite tipuri de cancer, 61 – 70determinându-i pe unii să speculeze că competența mașinilor autofagice poate prezice înclinația unui țesut specific de a suferi transformări maligne. Cu toate acestea, lipsesc datele clinice neechivoce în sprijinul acestei ipoteze.

De remarcat, mai multe proteine ​​onco-supresoare de bună-credință, cum ar fi fosfataza și tensin omologul (PTEN) și serina / treonina kinaza 11 (STK11, cel mai cunoscut sub numele de LKB1) stimulează autofagia, în timp ce căile oncogene multiple o inhibă. 43 De exemplu, acest lucru se aplică hiperactivării cascadei de transducție a semnalului PI3K-AKT1, 71 – 75 mutațiilor care fac ca receptorul factorului de creștere epidermic (EGFR) să fie activ constitutiv 76 , precum și supraexprimării anti-apoptotice Bcl-2 membrii familiei, cum ar fi celula B CLL / limfom 2 (BCL2) în sine și BCL2-like 1 (BCL2L1, cel mai cunoscut sub numele de BCL-X L ). 43 77

Ipoteza actuală este că suprimarea autofagiei ar promova oncogeneza prin (1) modificarea metabolismului bioenergetic și favorizarea stabilirii stresului oxidativ, două procese strict interdependente care rezultă din rotirea mitocondrială afectată; 42 78 – 80 (2) încurajarea instabilității genomice, cel puțin parțial ca o consecință a stresului oxidativ; 81 – 83 ) (3) afectarea senescenței induse de oncogen, un mecanism care blochează permanent proliferarea celulelor maligne, permițând în același timp eliminarea lor de către sistemul imunitar; 68 84 – 87și (4) favorizarea acumulării de agregate proteice care conțin p62, care furnizează semnale oncogene la activarea factorului nuclear al factorului de transcripție, eritroid 2 asemănător 2 (NFE2L2, cel mai cunoscut sub numele de NRF2). 88 89 În cele din urmă, autofagia pare să fie implicată în mod critic în moartea celulelor imunogene, un tip particular de apoptoză care este asociat cu elicitarea unui răspuns imun adaptiv. 37 90 91 Astfel, celulele maligne cu deficit de autofagie sunt mai puțin predispuse decât omologii lor competenți în autofagie pentru a fi recunoscute și eliminate de sistemul imunitar 92o situație care afectează atât oncogeneza, cât și progresia tumorii (vezi mai jos). Pe o linie similară, datele recente indică faptul că ablația Atg5 accelerează oncogeneza condusă de KRAS , favorizând în același timp infiltrarea tumorii de către celulele T reglatoare CD4 + CD25 + FOXP3 + imunosupresoare . 48 Defectele aparatului autofagic ar putea, prin urmare, să promoveze oncogeneza nu numai prin afectarea capacității celulelor de a face față stimulilor potențial tumorigenici, ci și prin compromiterea căilor oncosuppresive care sunt mediate de microambientul tumoral.

Autofagie în progresia tumorii

Acum este clar că leziunile neoplazice stabilite beneficiază de conservarea (sau reactivarea) funcțiilor autofagice. Chiar și în absența terapiei, într-adevăr, tumorile maligne hematologice și (mai ales așa) solide sunt expuse unor condiții micro-ambientale nefavorabile, inclusiv o disponibilitate limitată de nutrienți și concentrații scăzute de oxigen. În conformitate cu această noțiune, celulele canceroase din regiunile tumorale slab vascularizate, hipoxice conțin cantități crescute de autofagozomi, permițându-le să facă față rezervelor limitate de oxigen. 93 Mai mult, mai multe linii celulare obținute din cancerele stabilite nu numai că se caracterizează prin niveluri crescute de autofagie în condițiile de bază, dar par, de asemenea, că necesită un flux autofagic crescut pentru menținerea funcțiilor metabolice și proliferarea. 8094 95 Aceste observații indică faptul că celulele canceroase se bazează pe autofagie (cel puțin într-o oarecare măsură) pentru a face față sarcinii metabolice și oxidative impuse de fenotipul malign.

Dovezile acumulatoare confirmă noțiunea că autofagia promovează progresia cancerelor stabilite. În primul rând, reglarea descendentă a Atg5 induce necroză centrală extinsă la xenogrefele Tsc2 – / – , în timp ce pierderea heterozigotă a Becn1 limitează dezvoltarea tumorilor renale macroscopice la șoarecii Tsc2 +/− . 96 În al doilea rând, ștergerea specifică a țesutului Atg5 sau Atg7 arestează progresia hepatomelor benigne către carcinoame hepatocelulare (HCC), 47 de leziuni pancreatice conduse de KRAS G12D către adenocarcinoame ductale pancreatice evident maligne, 50 precum și deKRAS G12D – sau BRAF V600E eoliane adenoamelor pulmonare la adenocarcinoame pulmonare, 48 , uneori, devierea la formarea oncocytomas relativ benigne. 49 97 Aparent, spre deosebire de aceste observații, sa demonstrat că o variantă fosforimetică a tirozinei BECN1 favorizează creșterea, progresia și rezistența la terapie a xenogrefelor cu carcinom pulmonar cu celule mici (NSCLC) care exprimă EGFR activ constitutiv, efect care a fost corelat cu o scădere a fluxului autofagic. 76Cu toate acestea, este dificil să se determine în ce măsură acest lucru provine din inhibarea autofagiei, spre deosebire de disponibilitatea crescută a proteinelor antiapoptotice asemănătoare BCL2 cauzate de fosforilarea BECN1. 75 98

Opinia actuală este că autofagia facilitează progresia neoplasmelor stabilite prin (1) favorizarea adaptării acestora la condiții microenvironmentale adverse, inclusiv disponibilitate limitată de nutrienți și hipoxie; (2) păstrarea funcțiilor mitocondriale, atât deoarece controlează calitatea rețelei mitocondriale, cât și asigură substraturi metabolice pentru metabolismul mitocondrial; și (3) limitarea acumulării de entități potențial citotoxice, cum ar fi ROS, care se acumulează în celulele maligne datorită atât modificărilor intracelulare, cât și extracelulare.Mergi la:

Derivați CQ în terapia cancerului

Studii preclinice și clinice

Noțiunea că celulele neoplazice de origine histologică diversă necesită o mașinărie autofagică competentă pentru a prolifera activ 53 80 97 99 – 101, în ciuda condițiilor micro-ambientale nefavorabile, fie ele endogene 102 103 sau provocate de terapie, 74 104 – 116 are a făcut din această cale catabolică o țintă atractivă pentru dezvoltarea de agenți antineoplazici noi. 42 117 – 119Astfel, de-a lungul ultimului deceniu, au fost concepute și evaluate abordări distincte bazate pe inhibarea autofagiei (in vitro și in vivo) pentru capacitatea lor de (1) să mediază efecte terapeutice ca intervenții independente sau (2) să stimuleze activitatea antineoplazică a chimioterapice convenționale sau vizate. În aceste studii, autofagia a fost dezactivată fie genetic, prin eliminarea genelor relevante pentru autofagie sau prin eliminarea produselor lor, 93 106 120 – 126 sau farmacologic, prin administrarea (1) agenților lizosomotropi, inclusiv CQ, HCQ, Lys0569 și monensina, toate acestea inhibă fuziunea autofagozomilor cu lizozomii și degradarea acestora; 74 112 ,115 120 127 – 132 (2) inhibitori ai clasei III PI3K, cum ar fi 3-metiladenină, wortmannin, LY294002 și pirviniu; 109 122 126 130 133 – 137 (3) inhibitorul ATPazei de tip V bafilomicină A1, care inhibă acidificarea lizozomală și, prin urmare, degradarea autofagozomilor; 121 125 138 (4) spautin-1, care promovează degradarea BECN1 dependentă de ubiquitinare. 139 – 142S-a demonstrat că toate aceste intervenții exercită efecte anticanceroase sau stimulează activitatea regimurilor antineoplazice convenționale. Cu toate acestea, efectele antineoplazice ale CQ și HCQ provin în mare parte din modularea căilor, altele decât autofagia. 39 – 41 Acești agenți lizozomotropi sunt într-adevăr foarte eficienți în inducerea permeabilizării membranei lizozomale, inițind astfel calea mitocondrială a apoptozei. 39 143 Mai mult, CQ s-a arătat recent că vizează celulele stem canceroase prin inhibarea semnalizării Janus kinaza 2 (JAK2). 144 Motivele precise pentru care celulele neoplazice par a fi mai sensibile la CQ și HCQ decât omologii lor netransformați rămân totuși să fie elucidate.

Potențialul terapeutic al CQ, care a fost utilizat pe scară largă (și este în prezent aprobat de Administrația SUA pentru Alimente și Medicamente, FDA) pentru tratamentul profilactic al malariei (sursa http://www.fda.gov ), a fost investigat într-un studiu clinic dublu-orb care a implicat 30 de pacienți cu glioblastom multiform ( NCT00224978 ). 127În acest context (un studiu clinic de fază III), pacienții eligibili cu glioblastom confirmat chirurgical au fost randomizați pentru a primi chimioterapie convențională și radioterapie plus placebo sau 150 mg / zi CQ per os. De remarcat, deși studiul a fost insuficient de puternic pentru a detecta o diferență statistică în rata de supraviețuire a brațelor studiului, pacienții care au primit CQ au prezentat o supraviețuire îmbunătățită pe termen mediu în comparație cu omologii lor de control. 127 CQ a fost, de asemenea, evaluat pentru capacitatea sa de a spori activitatea terapeutică a radioterapiei cerebrale întregi (WBRT) la 20 de pacienți care au metastaze intracraniene de diferite derivații histologice ( NCT01894633 ). 145În contextul acestui studiu clinic de fază II cu cohortă unică, terapia CQ (250 mg / zi per os) a fost inițiată cu 1 înainte de WBRT, iar obiectivul primar a fost răspunsul radiologic. La cinci luni după WBRT, 16 pacienți au putut fi evaluați, dintre care: 2 au manifestat un răspuns complet, 13 un răspuns parțial și 1 stabilizare a bolii. Nu s-au înregistrat toxicități de grad 3/4 legate de tratament, iar supraviețuirea globală medie a fost de 8,9 luni. 145 Întrucât un astfel de control ridicat al bolii intracraniene justifică o investigație suplimentară, această paradigmă clinică rămâne în curs de investigare (vezi mai jos).

Siguranța și activitatea antineoplazică a HCQ, un derivat CQ aprobat de FDA din SUA ca medicament antimalaric, precum și pentru gestionarea lupusului eritematos (cronic, discoid sau sistemic) și a artritei reumatoide acute sau cronice (sursa http: // www. fda.gov ), a fost recent evaluat la 20 de pacienți cu cancer pancreatic metastatic care nu au răspuns la tratamentele convenționale ( NCT01273805 ). 146 În acest cadru (un studiu clinic de fază II), pacienții au primit 400 (n = 10) sau 600 (n = 10) mg HCQ de două ori pe zi ca un singur agent terapeutic. Deși acest regim a fost bine tolerat (doar 2 pacienți au dezvoltat efecte secundare de grad 3/4 legate de tratament), doar 2 persoane (10%) nu au prezentat progresia bolii la 2 luni după inițierea HCQ.146 HCQ a fost, de asemenea, investigat ca un mijloc de a spori profilul terapeutic al erlotinib (un inhibitor chimic al EGFR aprobat de FDA) 147 – 150 la 27 de subiecți cu NSCLC avansat ( NCT01026844 ). 114 În acest studiu de fază I cu două brațe, 8 pacienți au fost tratați doar cu HCQ, în timp ce 19 au primit HCQ plus erlotinib. Un singur pacient a prezentat un răspuns parțial la erlotinib plus HCQ, dar nu au fost documentate toxicități care să limiteze doza legate de HCQ, iar autorii au recomandat utilizarea 1000 mg / zi HCQ în combinație cu 150 mg / zi erlotinib pentru un studiu ulterior de faza II . 114

În total, aceste observații preclinice și clinice sugerează că CQ și HCQ nu pot media beneficii terapeutice semnificative ca intervenții independente, dar pot exacerba efectele agenților anticancer convenționali.

Studii clinice în curs

Când acest test de verificare a fost redactat (mai 2014), surse oficiale au enumerat 39 de studii clinice în desfășurare lansate după 2007, 1 ianuarie pentru a investiga siguranța și potențialul terapeutic al derivaților CQ, fie ca intervenții terapeutice independente, fie ca parte a regimurilor chimioterapeutice combinatorii, la pacienții cu cancer ( http://www.clinicaltrials.gov/ ) (tabelul 1). Dintre aceste studii, 8 implică CQ și 31 HCQ. De remarcat, acesta din urmă este, în general, preferat primului datorită profilului său de toleranță și toxicitate. 151 152Tabelul 1. Studiile clinice lansate recent pentru a evalua siguranța și eficacitatea derivaților CQ la pacienții cu cancer *

AgentIndicațiistareFazăNoteRef.
CQMetastaze cerebraleRecrutareIICombinat cu
creierul întreg
NCT01727531
Carcinom mamarRecrutareEuCombinat cu otrăvuri microtubulareNCT01446016
I / IICa agent unicNCT01023477
Mielom
multiplu
RecrutareIICombinat cu bortezomib
și ciclofosfamidă
NCT01438177
Carcinom pancreaticRecrutareEuCombinat cu gemcitabinăNCT01777477
SCLCRecrutareEuCombinat cu RT,
cisplatină și etopozid
NCT00969306
Încă nu recruteziEuCombinat cu RTNCT01575782
Tumori solide avansateÎncă nu recruteziEuCombinat cu carboplatină
și gemcitabină
NCT02071537
HCQMetastaze osoaseRecrutareEuCombinat cu RTNCT01417403
CMLNecunoscutIICombinat cu imatinibNCT01227135
Carcinom colorectalRecrutareI / IICombinat cu bevacizumab și
chimioterapie pe bază de oxaliplatină
NCT01206530
IICombinat cu bevacizumab,
capecitabină și oxaliplatină
NCT01006369
GBMNecunoscutI / IICombinat cu temozolomidă și RTNCT00486603
GliomaRecrutareIICombinat cu RTNCT01602588
HCCRecrutareI / IICombinat cu TACENCT02013778
Mielom
multiplu
RecrutareEuCombinat cu ciclofosfamidă, dexametazonă și rapamicinăNCT01689987
NecunoscutI / IICombinat cu bortezomibNCT00568880
NSCLCActiv,
fără recrutare
I / IICombinat cu bevacizumab,
carboplatină și paclitaxel
NCT00933803
Activ,
fără recrutare
IICombinat cu erlotinibNCT00977470
RecrutareI / IICombinat cu gefitinibNCT00809237
IICombinat cu bevacizumab,
carboplatină și paclitaxel
NCT01649947
MelanomRecrutareEuCombinat cu vemurafenibNCT01897116
Carcinom pancreaticActiv, fără recrutareI / IICombinat cu gemcitabinăNCT01128296
Activ, fără recrutareIICombinat cu abraxan
și gemcitabină
NCT01978184
RecruitingI/IICombined with gemcitabineNCT01506973
IICombined with capecitabine and RTNCT01494155
Prostate
carcinoma
Active, not recruitingIIAs single agentNCT00726596
RecruitingIICombined with abiraterone and ABT-263NCT01828476
Renal cell
carcinoma
RecruitingIAs single agentNCT01144169
I/IICombined with everolimusNCT01510119
Combined with IL-2NCT01550367
Soft tissue
sarcoma
RecruitingIICombined with rapamycinNCT01842594
Advanced solid tumorsActive, not recruitingICombined with sunitinibNCT00813423
RecruitingICombined with vorinostatNCT01023737
Combined with rapamycin or vorinostatNCT01266057
Combined with MK2206NCT01480154
Combined with sorafenibNCT01634893
UnknownICombined with temozolomideNCT00714181
Combined with temsirolimusNCT00909831

Deschideți într-o fereastră separată

Abrevieri: LMC, leucemie mieloidă cronică; CQ, clorochină; HCQ, hidroxiclorochină; GBM, glioblastom multiform; HCC, carcinom hepatocelular; IL-2, interleukină-2; NSCLC, carcinom pulmonar cu celule mici; RT, radioterapie; SCLC, carcinom pulmonar cu celule mici; TACE, chemoembolizare transarterială. * între 2007, 1 ianuarie și data depunerii.

Siguranța și activitatea antineoplazică a derivaților CQ ca intervenții chimioterapeutice independente sunt evaluate (1) la subiecții cu carcinom ductal mamar in situ, care primesc CQ per os timp de 1 lună înainte de excizia chirurgicală a tumorii ( NCT01023477 ); (2) la pacienții cu cancer de prostată, care sunt tratați cu HCQ la creșterea nivelului circulant al antigenului specific prostatei (PSA) ( NCT00726596 ); și (3) la persoanele cu carcinom cu celule renale primare (RCC), care primesc HCQ pe cale orală timp de 14 zile înainte de operație ( NCT01144169 ).

În marea majoritate a studiilor clinice în curs, derivații CQ sunt administrați în combinație cu schemele convenționale de chimioterapie, radio sau imunoterapeutice. În special, siguranța și eficacitatea CQ sunt testate: (1) la subiecți cu carcinom mamar avansat sau metastatic rezistent la chimioterapie bazată pe antraciclină, 37 90 91 care primesc CQ în combinație cu otrăvuri microtubulare din familia taxan sau epotilonă 153 – 155 ( NCT01446016 ); (2) la pacienții cu carcinom pulmonar cu celule mici în stadiul IV, care sunt tratați cu CQ în combinație cu radioterapia convențională 156 157 ( NCT01575782) și / sau regimuri chimioterapeutice care dăunează ADN-ului, inclusiv cisplatină-etopozidă în doză standard 158 – 161 (NCT0969306); (3) la subiecții cu mielom multiplu, care primesc CQ în combinație cu ciclofosfamidă, un agent alchilant imunogen, 162 163 și bortezomib ( NCT01438177 ); (4) la pacienții cu cancer pancreatic, care primesc CQ în combinație cu gemcitabina chimioterapeutică imunostimulatoare 164 165 ( NCT01777477 ); (5) la pacienții cu tumori solide avansate, care primesc CQ împreună cu gemcitabină și carboplatină (un agent care dăunează ADN-ului derivat din cisplatină) 166 ( NCT02071537); și (6) la subiecții care au metastaze cerebrale din diferite neoplasme, care primesc un curs scurt de CQ în combinație cu WBRT ( NCT01727531 ).

Mai mult, HCQ este investigat ca mijloace de îmbunătățire a profilului terapeutic al (1) gemcitabinei neoadjuvante și / sau a particulelor legate de proteinele paclitaxel (Abraxane ® ), la persoanele afectate de carcinom pancreatic avansat ( NCT01506973 ; NCT01128296 ; NCT01978184 ); (2) agentul alchilant temozolomidă, 167 – 169 la pacienții cu tumori solide metastatice sau nerezecabile ( NCT00714181 ); (3) radioterapie, la pacienții cu gliom de grad înalt ( NCT01602588 ) sau care au metastaze osoase de derivare histologică diversă ( NCT01417403); (4) temozomolidă și radioterapie, la persoanele cu glioblastom multiform nou diagnosticat ( NCT00486603 ); (5) capecitabină (un antimetabolit utilizat în prezent pentru tratamentul mai multor neoplasme) 170 plus radioterapie, la pacienții cu cancer pancreatic rezecabil ( NCT01494155 ); (6) capecitabină, oxaliplatină (un derivat de cisplatină aprobat de FDA), 171 172 și bevacizumab (un anticorp monoclonal specific pentru factorul de creștere endotelial vascular, VEGF), 38 173 – 175 la subiecții cu carcinom colorectal metastatic ( NCT01006369); (7) paclitaxel (o otravă microtubulară aprobată de FDA din familia taxanilor), carboplatină și bevacizumab, la pacienții cu NSCLC (NCT00933803; NCT01649947 ), (8) un regim chimioterapeutic pe bază de oxaliplatină combinat cu bevacizumab, la persoanele afectate de carcinom colorectal ( NCT01206530 ); (9) chemoembolizare transarterială (TACE), 176 177 la pacienții cu HCC nerezecabil ( NCT02013778 ); (10) inhibitorul AKT1 MK2206, 178 la pacienții afectați de tumori maligne solide avansate ( NCT01480154 ); (11) rapamicină și / sau vorinostat, la subiecți cu sarcoame refractare ale țesuturilor moi ( NCT01842594 ) sau alte tumori solide ( NCT01023737NCT01266057 ); (12) temsirolimus (un derivat de rapamicină aprobat de FDA care exercită, de asemenea, efecte antineoplazice prin inhibarea țintei mecaniciste a rapamicinei, MTOR), 179 la pacienții cu tumori metastatice solide care nu au răspuns la regimurile terapeutice convenționale ( NCT00909831 ); (13) everolimus (încă o altă moleculă asemănătoare rapamicinei licențiată de FDA din SUA), la persoanele cu CCR avansat ( NCT01510119 ); (14) sirolimus, ciclofosfamidă și dexametazonă, la pacienții cu mielom multiplu recidivant sau refractar ( NCT01689987 ); (15) erlotinib sau gefitinib (un inhibitor chimic al EGFR autorizat în prezent de FDA din SUA), 148 180 la pacienții cu NSCLC (NCT00809237 ; NCT00977470 ); (16) imatinib (un inhibitor aprobat de FDA sau BCR-ABL, KIT și receptorul factorului de creștere derivat din trombocite β), 181 182 la persoanele cu leucemie mieloidă cronică ( NCT01227135 ); (17) sorafenib sau sunitinib (doi inhibitori multi-kinazici aprobați în prezent de FDA din SUA pentru tratamentul diferitelor tumori solide), 183 – 188 la pacienții cu tumori solide refractare și / sau recidivante ( NCT00813423 ; NCT01634893 ); (18) bortezomib, la subiecți cu mielom multiplu refractar și / sau recidivant ( NCT00568880 ); (19) vemurafenib (un inhibitor al BRAF mutant aprobat de FDA), 189la pacienții cu melanom ( NCT01897116 ); (20) ABT-263 (un inhibitor experimental al membrilor familiei anti-apoptotice Bcl-2) 143 190 191 și abirateronă (un antiandrogen aprobat de FDA), 192 la indivizi cu cancer de prostată metastatic rezistent la castrare ( NCT01828476 ); și (21) interleukina-2 (o citokină imunostimulatoare aprobată în prezent de FDA SUA și alte agenții de reglementare pentru tratamentul formelor metastatice de melanom și RCC), 193 194 la pacienții cu RCC metastatic ( NCT01550367 ).Mergi la:

Concluzii finale

Dovezile acumulate sugerează că inhibarea autofagiei poate constitui un mijloc eficient de îmbunătățire a profilului terapeutic al schemelor anticancerigene chimioterapie, radio și imunoterapeutice. Cu toate acestea, autofagia nu numai că susține supraviețuirea neoplasmului stabilit expus terapiei, ci joacă, de asemenea, un rol cheie în menținerea homeostaziei intracelulare în țesuturile sănătoase (funcționând de facto ca mecanism oncosuppresiv), 42 43 și este necesară pentru obținerea răspunsuri imune înnăscute și adaptative. 195Aceasta implică faptul că inhibarea întregului corp al autofagiei poate, cel puțin teoretic, favoriza insurgența neoplasmelor legate de tratament, precum și a altor tulburări (de exemplu, boli infecțioase, afecțiuni neurodegenerative) și poate promova un anumit grad de imunosupresie. Mai mult, marea majoritate a inhibitorilor de autofagie care au fost investigați până acum în studiile clinice, în special CQ și HCQ, influențează procesele lizozomale (și posibil non-lizozomale), altele decât autofagia. 39 – 41 Într-adevăr, activitatea terapeutică a HQ și HCQ pare să provină în principal din modularea mecanismelor care nu au legătură cu autofagia. În cele din urmă, autofagia pare să promoveze, mai degrabă decât să antagonizeze, activitatea terapeutică a agenților antineoplazici specifici. 76 196– 200Prin urmare, administrarea concomitentă a inhibitorilor de autofagie poate reduce, mai degrabă decât crește, potențialul citostatic / citotoxic al unei fracțiuni de substanțe chimice utilizate în prezent în terapia anticancerigenă. Luate împreună, aceste noțiuni sugerează că modularea autofagiei poate constitui un mijloc puternic de a obține efecte antineoplazice superioare, totuși ar trebui implementată cu prudență. Studiile viitoare vor trebui să elucideze dacă și cum poate fi modulată autofagia într-o manieră restricționată de țesut sau celulă, care este compatibilă cu aplicațiile clinice, precum și dacă există biomarkeri care prezic înclinația anumitor subseturi de pacienți cu cancer la regulatorii autofagiei. Aceste descoperiri, precum și identificarea compușilor care reglează autofagia într-un mod foarte specific vor lărgi cu siguranță utilitatea clinică a acestei paradigme terapeutice.Mergi la:

Glosar

Abrevieri:

BCL2CLL cu celule B / limfom 2
BECN1Beclin 1
CQclorochină
EGFRreceptorul factorului de creștere epidermic
FDAAdministrația pentru alimente și medicamente
HCCcarcinom hepatocelular
HCQhidroxiclorochină
NSCLCcarcinom pulmonar cu celule mici
PI3Kfosfoinozidă-3-kinază
RCCcarcinom cu celule renale
ROSspecii reactive de oxigen
WBRTradioterapie cerebrală întreagă

Mergi la:

Note

10.4161 / mco.29911Mergi la:

Dezvăluirea potențialelor conflicte de interese

Nu au fost dezvăluite potențiale conflicte de interese.Mergi la:

Mulțumiri

Autorii sunt susținuți de Comisia Europeană (ArtForce); Agence National de la Recherche (ANR); „Associazione Italiana per the Ricerca sul Cancro (AIRC);”. Ligue Nationale contre le Cancer; Fondation pour la Recherche Médicale (FRM); Institutul Național al Cancerului (INCa); Association pour la Recherche sur le Cancer (ARC), LabEx Immuno-Oncologie; Fondation de France; Fondation Bettencourt-Schueller; Catedra AXA pentru cercetare în longevitate; Cancéropôle Ile-de-France, Paris Alliance of Cancer Research Institutes (PACRI) și Cancer Research for Personalized Medicine (CARPEM).Mergi la:

Referințe

1. Choi AM, Ryter SW, Levine B.. Autofagia în sănătatea și bolile umane . N Engl J Med 2013; 368 : 651 – 62; http://dx.doi.org/10.1056/NEJMra1205406; PMID: 23406030 [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Mizushima N, Komatsu M.. Autofagie: renovarea celulelor și a țesuturilor . Cell 2011; 147 : 728 – 41; http://dx.doi.org/10.1016/j.cell.2011.10.026; PMID: 22078875 [ PubMed ] [ CrossRef ] [ Google Scholar ]3. Mizushima N, Levine B, Cuervo AM, Klionsky DJ. . Autofagia combate boala prin auto-digestie celulară . Natura 2008; 451 : 1069 – 75; http://dx.doi.org/10.1038/nature06639; PMID: 18305538 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Levine B, Kroemer G.. Autofagia în patogeneza bolii . Cell 2008; 132 : 27 – 42; http://dx.doi.org/10.1016/j.cell.2007.12.018; PMID: 18191218 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Nixon RA. . Rolul autofagiei în boala neurodegenerativă . Nat Med 2013; 19 : 983 – 97; http://dx.doi.org/10.1038/nm.3232; PMID: 23921753 [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Rubinsztein DC, Mariño G, Kroemer G.. Autofagie și îmbătrânire . Cell 2011; 146 : 682 – 95; http://dx.doi.org/10.1016/j.cell.2011.07.030; PMID: 21884931 [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Mijaljica D, Prescott M, Devenish RJ. . Microautofagia în celulele de mamifere: revizuirea unei enigme de 40 de ani . Autofagie 2011; 7 : 673 – 82; http://dx.doi.org/10.4161/auto.7.7.14733; PMID: 21646866 [ PubMed ] [ CrossRef ] [ Google Scholar ]8. Yang Z, DJ Klionsky. . Autofagia mamiferelor: mașini moleculare de bază și reglare a semnalizării . Curr Opin Cell Biol 2010; 22 : 124 – 31; http://dx.doi.org/10.1016/j.ceb.2009.11.014; PMID: 20034776 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Lamb CA, Yoshimori T, Tooze SA. . Autofagozomul: origini necunoscute, complex de biogeneză . Nat Rev Mol Cell Biol 2013; 14 : 759 – 74; http://dx.doi.org/10.1038/nrm3696; PMID: 24201109 [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Hamasaki M, Furuta N, Matsuda A, Nezu A, Yamamoto A, Fujita N, Oomori H, Noda T, Haraguchi T, Hiraoka Y și colab. . . Autofagozomii se formează pe site-urile de contact ale ER-mitocondriilor . Natura 2013; 495 : 389 – 93; http://dx.doi.org/10.1038/nature11910; PMID: 23455425 [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Hayashi-Nishino M, Fujita N, Noda T, Yamaguchi A, Yoshimori T, Yamamoto A. Un subdomeniu al reticulului endoplasmatic formează un leagăn pentru formarea autofagozomilor . Nat Cell Biol 2009; 11 : 1433 – 7; http://dx.doi.org/10.1038/ncb1991; PMID: 19898463 [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Kuma A, Mizushima N.. Rolul fiziologic al autofagiei ca sistem de reciclare intracelulară: cu accent pe metabolismul nutrienților . Semin Cell Dev Biol 2010; 21 : 683 – 90; http://dx.doi.org/10.1016/j.semcdb.2010.03.002; PMID: 20223289 [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Mariño G, Niso-Santano M, Baehrecke EH, Kroemer G. Autoconsumul: interacțiunea dintre autofagie și apoptoză . Nat Rev Mol Cell Biol 2014; 15 : 81 – 94; http://dx.doi.org/10.1038/nrm3735; PMID: 24401948 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Kraft C, Martens S.. Mecanisme și reglarea formării autofagozomilor . Curr Opin Cell Biol 2012; 24 : 496 – 501; http://dx.doi.org/10.1016/j.ceb.2012.05.001; PMID: 22664348 [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Codogno P, Mehrpour M, Proikas-Cezanne T.. Autofagie canonică și necanonică: variații pe o temă comună a auto-alimentației? . Nat Rev Mol Cell Biol 2012; 13 : 7 – 12; PMID: 22166994 [ PubMed ] [ Google Scholar ]16. Mizushima N, Yoshimori T, Ohsumi Y.. Rolul proteinelor Atg în formarea autofagozomilor . Annu Rev Cell Dev Biol 2011; 27 : 107 – 32; http://dx.doi.org/10.1146/annurev-cellbio-092910-154005; PMID: 21801009 [ PubMed ] [ CrossRef ] [ Google Scholar ]17. Ravikumar B, Sarkar S, Davies JE, Futter M, Garcia-Arencibia M, Green-Thompson ZW, Jimenez-Sanchez M, Korolchuk VI, Lichtenberg M, Luo S și colab. . . Reglarea autofagiei mamiferelor în fiziologie și fiziopatologie . Physiol Rev 2010; 90 : 1383 – 435; http://dx.doi.org/10.1152/physrev.00030.2009; PMID: 20959619 [ PubMed ] [ CrossRef ] [ Google Scholar ]18. He C, Klionsky DJ. . Mecanisme de reglare și căi de semnalizare a autofagiei . Annu Rev Genet 2009; 43 : 67 – 93; http://dx.doi.org/10.1146/annurev-genet-102808-114910; PMID: 19653858 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]19. Green DR, Levine B.. A fi sau a nu fi? Cum autofagia selectivă și moartea celulară guvernează soarta celulei . Celula 2014; 157 : 65 – 75; http://dx.doi.org/10.1016/j.cell.2014.02.049; PMID: 24679527 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]20. Youle RJ, Narendra DP. . Mecanismele mitofagiei . Nat Rev Mol Cell Biol 2011; 12 : 9 – 14; http://dx.doi.org/10.1038/nrm3028; PMID: 21179058 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Green DR, Galluzzi L, Kroemer G.. Mitocondriile și axa morții autofagie-inflamație-celulă în îmbătrânirea organismului . Știință 2011; 333 : 1109 – 12; http://dx.doi.org/10.1126/science.1201940; PMID: 21868666 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kroemer G, Mariño G, Levine B.. Autofagia și răspunsul integrat la stres . Mol Cell 2010; 40 : 280 – 93; http://dx.doi.org/10.1016/j.molcel.2010.09.023; PMID: 20965422 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Boya P, González-Polo RA, Casares N, Perfettini JL, Dessen P, Larochette N, Métivier D, Meley D, Souquere S, Yoshimori T, și colab. . . Inhibarea macroautofagiei declanșează apoptoza . Mol Cell Biol 2005; 25 : 1025 – 40; http://dx.doi.org/10.1128/MCB.25.3.1025-1040.2005; PMID: 15657430 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Galluzzi L, Vitale I, Abrams JM, Alnemri ES, Baehrecke EH, Blagosklonny MV, Dawson TM, Dawson VL, El-Deiry WS, Fulda S și colab. . . Definiții moleculare ale subrutinelor de moarte celulară: recomandări ale Comitetului de nomenclatură pentru moartea celulară 2012 . Cell Death Differ 2012; 19 : 107 – 20; http://dx.doi.org/10.1038/cdd.2011.96; PMID: 21760595 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Erdélyi P, Borsos E, Takács-Vellai K, Kovács T, Kovács AL, Sigmond T, Hargitai B, Pásztor L, Sengupta T, Dengg M, și colab. . . Roluri comune de dezvoltare și control transcripțional al autofagiei și apoptozei la Caenorhabditis elegans . J Cell Sci 2011; 124 : 1510 – 8; http://dx.doi.org/10.1242/jcs.080192; PMID: 21502138 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Berry DL, Baehrecke EH. . Arestarea creșterii și autofagia sunt necesare pentru degradarea celulelor glandei salivare în Drosophila . Celula 2007; 131 : 1137 – 48; http://dx.doi.org/10.1016/j.cell.2007.10.048; PMID: 18083103 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Denton D, Shravage B, Simin R, Mills K, Berry DL, Baehrecke EH, Kumar S.. Autofagia, nu apoptoza, este esențială pentru moartea celulelor intestinului mediu în Drosophila . Curr Biol 2009; 19 : 1741 – 6; http://dx.doi.org/10.1016/j.cub.2009.08.042; PMID: 19818615 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Nezis IP, Shravage BV, Sagona AP, Lamark T, Bjørkøy G, Johansen T, Rusten TE, Brech A, Baehrecke EH, Stenmark H.. Degradarea autofagică a dBruce controlează fragmentarea ADN-ului în celulele asistente în timpul oogenezei târzii a Drosophila melanogaster . J Cell Biol 2010; 190 : 523 – 31; http://dx.doi.org/10.1083/jcb.201002035; PMID: 20713604 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Grandér D, Kharaziha P, Laane E, Pokrovskaja K, Panaretakis T.. Autofagia ca principal mijloc de citotoxicitate de către glucocorticoizi în tumorile maligne hematologice . Autofagie 2009; 5 : 1198 – 200; http://dx.doi.org/10.4161/auto.5.8.10122; PMID: 19855186 [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Laane E, Tamm KP, Buentke E, Ito K, Kharaziha P, Oscarsson J, Corcoran M, Björklund AC, Hultenby K, Lundin J, și colab. . . Moartea celulară indusă de dexametazonă în leucemia limfoidă este mediată prin inițierea autofagiei . Cell Death Differ 2009; 16 : 1018 – 29; http://dx.doi.org/10.1038/cdd.2009.46; PMID: 19390558 [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Lamy L, Ngo VN, Emre NC, Shaffer AL 3rd, Yang Y, Tian E, Nair V, Kruhlak MJ, Zingone A, Landgren O, și colab. . . Controlul morții celulelor autofagice de către caspaza-10 în mielomul multiplu . Cancer Cell 2013; 23 : 435 – 49; http://dx.doi.org/10.1016/j.ccr.2013.02.017; PMID: 23541952 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Liu Y, Shoji-Kawata S, Sumpter RM Jr., Wei Y, Ginet V, Zhang L, Posner B, Tran KA, Green DR, Xavier RJ și colab. . . Autozele sunt o formă de moarte celulară reglementată de Na +, K + -ATPază declanșată de peptidele care induc autofagia, de foame și de hipoxie-ischemie . Proc Natl Acad Sci SUA 2013; 110 : 20364 – 71; http://dx.doi.org/10.1073/pnas.1319661110; PMID: 24277826 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Denton D, Nicolson S, Kumar S.. Moartea celulară prin autofagie: fapte și artefacte aparente . Cell Death Differ 2012; 19 : 87 – 95; http://dx.doi.org/10.1038/cdd.2011.146; PMID: 22052193 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kroemer G, Levine B.. Moartea celulelor autofagice: povestea unui nume greșit . Nat Rev Mol Cell Biol 2008; 9 : 1004 – 10; http://dx.doi.org/10.1038/nrm2529; PMID: 18971948 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Aranda F, Vacchelli E, Eggermont A, Galon J, Fridman WH, Zitvogel L, Kroemer G, Galluzzi L.. Trial Watch: anticorpi imunostimulatori monoclonali în terapia cancerului . Oncoimunologie 2014; 3 : e27297; http://dx.doi.org/10.4161/onci.27297; PMID: 24701370 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Aranda F, Vacchelli E, Eggermont A, Galon J, Sautès-Fridman C, Tartour E, Zitvogel L, Kroemer G, Galluzzi L.. Trial Watch: Vaccinuri peptidice în terapia cancerului . Oncoimunologie 2013; 2 : e26621; http://dx.doi.org/10.4161/onci.26621; PMID: 24498550 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Vacchelli E, Aranda F, Eggermont A, Galon J, Sautès-Fridman C, Cremer I, Zitvogel L, Kroemer G, Galluzzi L.. Trial Watch: chimioterapie cu inductori imunogeni ai morții celulare . Oncoimunologie 2014; 3 : e27878; http://dx.doi.org/10.4161/onci.27878; PMID: 24800173 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Vacchelli E, Aranda F, Eggermont A, Galon J, Sautès-Fridman C, Zitvogel L, Kroemer G, Galluzzi L.. Trial Watch: anticorpi monoclonali care vizează tumorile în terapia cancerului . Oncoimunologie 2014; 3 : e27048; http://dx.doi.org/10.4161/onci.27048; PMID: 24605265 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Boya P, Gonzalez-Polo RA, Poncet D, Andreau K, Vieira HL, Roumier T, Perfettini JL, Kroemer G.. Permeabilizarea membranei mitocondriale este o etapă critică a apoptozei inițiate de lizozomi indusă de hidroxiclorochină . Oncogene 2003; 22 : 3927 – 36; http://dx.doi.org/10.1038/sj.onc.1206622; PMID: 12813466 [ PubMed ] [ CrossRef ] [ Google Scholar ]40. Maycotte P, Aryal S, Cummings CT, Thorburn J, Morgan MJ, Thorburn A.. Clorochina sensibilizează celulele canceroase la sân la chimioterapie independent de autofagie . Autofagie 2012; 8 : 200 – 12; http://dx.doi.org/10.4161/auto.8.2.18554; PMID: 22252008 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]41. Rubinsztein DC, Codogno P, Levine B.. Modularea autofagiei ca potențială țintă terapeutică pentru diverse boli . Nat Rev Drug Discov 2012; 11 : 709 – 30; http://dx.doi.org/10.1038/nrd3802; PMID: 22935804 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]42. White E. Deconvoluția rolului dependent de context pentru autofagia în cancer . Nat Rev Cancer 2012; 12 : 401 – 10; http://dx.doi.org/10.1038/nrc3262; PMID: 22534666 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Morselli E, Galluzzi L, Kepp O, Mariño G, Michaud M, Vitale I, Maiuri MC, Kroemer G.. Funcțiile oncosuppresive ale autofagiei . Antioxid Redox Signal 2011; 14 : 2251 – 69; http://dx.doi.org/10.1089/ars.2010.3478; PMID: 20712403 [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Qu X, Yu J, Bhagat G, Furuya N, Hibshoosh H, Troxel A, Rosen J, Eskelinen EL, Mizushima N, Ohsumi Y și colab. . . Promovarea tumorigenezei prin perturbarea heterozigotă a genei autofagiei beclin 1 . J Clin Invest 2003; 112 : 1809 – 20; http://dx.doi.org/10.1172/JCI20039; PMID: 14638851 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Yue Z, Jin S, Yang C, Levine AJ, Heintz N.. Beclin 1, o genă autofagică esențială pentru dezvoltarea embrionară timpurie, este un supresor tumoral haploinsuficient . Proc Natl Acad Sci SUA 2003; 100 : 15077 – 82; http://dx.doi.org/10.1073/pnas.2436255100; PMID: 14657337 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]46. Mariño G, Salvador-Montoliu N, Fueyo A, Knecht E, Mizushima N, López-Otín C. Modificări ale autofagiei specifice țesuturilor și creșterea tumorigenezei la șoareci deficienți în Atg4C / autofagin-3 . J Biol Chem 2007; 282 : 18573 – 83; http://dx.doi.org/10.1074/jbc.M701194200; PMID: 17442669 [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Takamura A, Komatsu M, Hara T, Sakamoto A, Kishi C, Waguri S, Eishi Y, Hino O, Tanaka K, Mizushima N. Șoarecii cu deficit de autofagie dezvoltă multiple tumori hepatice . Genes Dev 2011; 25 : 795 – 800; http://dx.doi.org/10.1101/gad.2016211; PMID: 21498569 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]48. Rao S, Tortola L, Perlot T, Wirnsberger G, Novatchkova M, Nitsch R, Sykacek P, Frank L, Schramek D, Komnenovic V și colab. . . Un rol dublu pentru autofagie într-un model murin de cancer pulmonar . Nat Commun 2014; 5 : 3056; http://dx.doi.org/10.1038/ncomms4056; PMID: 24445999 [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Guo JY, Karsli-Uzunbas G, Mathew R, Aisner SC, Kamphorst JJ, Strohecker AM, Chen G, Price S, Lu W, Teng X și colab. . . Autofagia suprimă progresia tumorilor pulmonare induse de K-ras la oncocitoame și menține homeostazia lipidelor . Genes Dev 2013; 27 : 1447 – 61; http://dx.doi.org/10.1101/gad.219642.113; PMID: 23824538 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rosenfeldt MT, O’Prey J, Morton JP, Nixon C, MacKay G, Mrowinska A, Au A, Rai TS, Zheng L, Ridgway R și colab. . . Starea p53 determină rolul autofagiei în dezvoltarea tumorii pancreatice . Natura 2013; 504 : 296 – 300; http://dx.doi.org/10.1038/nature12865; PMID: 24305049 [ PubMed ] [ CrossRef ] [ Google Scholar ]51. Duran A, Linares JF, Galvez AS, Wikenheiser K, Flores JM, Diaz-Meco MT, Moscat J.. Adaptorul de semnalizare p62 este un important mediator NF-kappaB în tumorigeneză . Cancer Cell 2008; 13 : 343 – 54; http://dx.doi.org/10.1016/j.ccr.2008.02.001; PMID: 18394557 [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Wei H, Wei S, Gan B, Peng X, Zou W, Guan JL. . Suprimarea autofagiei prin deleția FIP200 inhibă tumorogeneza mamară . Genes Dev 2011; 25 : 1510 – 27; http://dx.doi.org/10.1101/gad.2051011; PMID: 21764854 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Huo Y, Cai H, Teplova I, Bowman-Colin C, Chen G, Price S, Barnard N, Ganesan S, Karantza V, White E și colab. . . Autofagia se opune barierei tumorale mediate de p53 pentru a facilita tumorigeneză într-un model de cancer de sân ereditar asociat cu PALB2 . Cancer Discov 2013; 3 : 894 – 907; http://dx.doi.org/10.1158/2159-8290.CD-13-0011; PMID: 23650262 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]54. Ganley IG, Lam H, Wang J, Ding X, Chen S, Jiang X. Complexul ULK1.ATG13.FIP200 mediază semnalizarea mTOR și este esențial pentru autofagie . J Biol Chem 2009; 284 : 12297 – 305; http://dx.doi.org/10.1074/jbc.M900573200; PMID: 19258318 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Jung CH, Jun CB, Ro SH, Kim YM, Otto NM, Cao J, Kundu M, Kim DH. . Complexele ULK-Atg13-FIP200 mediază semnalizarea mTOR către mașinile de autofagie . Mol Biol Cell 2009; 20 : 1992 – 2003; http://dx.doi.org/10.1091/mbc.E08-12-1249; PMID: 19225151 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Morselli E, Shen S, Ruckenstuhl C, Bauer MA, Mariño G, Galluzzi L, Criollo A, Michaud M, Maiuri MC, Chano T, și colab. . . p53 inhibă autofagia prin interacțiunea cu ortologul uman al drojdiei Atg17, RB1CC1 / FIP200 . Ciclul celular 2011; 10 : 2763 – 9; http://dx.doi.org/10.4161/cc.10.16.16868; PMID: 21775823 [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Melkoumian ZK, Peng X, Gan B, Wu X, Guan JL. . Mecanismul reglării ciclului celular de către FIP200 în celulele cancerului de sân uman . Cancer Res 2005; 65 : 6676 – 84; http://dx.doi.org/10.1158/0008-5472.CAN-04-4142; PMID: 16061648 [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Aita VM, Liang XH, Murty VV, Pincus DL, Yu W, Cayanis E, Kalachikov S, Gilliam TC, Levine B. Clonarea și organizarea genomică a beclinului 1, o genă candidată supresoare tumorale pe cromozomul 17q21 . Genomică 1999; 59 : 59 – 65; http://dx.doi.org/10.1006/geno.1999.5851; PMID: 10395800 [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Liang XH, Jackson S, Seaman M, Brown K, Kempkes B, Hibshoosh H, Levine B. Inducerea autofagiei și inhibarea tumorigenezei de către beclin 1 . Natura 1999; 402 : 672 – 6; http://dx.doi.org/10.1038/45257; PMID: 10604474 [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Kang MR, Kim MS, Oh JE, Kim YR, Song SY, Kim SS, Ahn CH, Yoo NJ, Lee SH. . Mutații în cadru ale genelor asociate autofagiei ATG2B, ATG5, ATG9B și ATG12 în cancerele gastrice și colorectale cu instabilitate microsatelit . J Pathol 2009; 217 : 702 – 6; http://dx.doi.org/10.1002/path.2509; PMID: 19197948 [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Li BX, Li CY, Peng RQ, Wu XJ, Wang HY, Wan DS, Zhu XF, Zhang XS. . Expresia beclinului 1 este asociată cu prognostic favorabil în cancerele de colon în stadiul IIIB . Autofagie 2009; 5 : 303 – 6; http://dx.doi.org/10.4161/auto.5.3.7491; PMID: 19066461 [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Chen Y, Lu Y, Lu C, Zhang L. Expresia Beclin-1 este un predictor al rezultatului clinic la pacienții cu carcinom cu celule scuamoase esofagiene și corelată cu expresia factorului hipoxia inductibil (HIF) -1alfa . Pathol Oncol Res 2009; 15 : 487 – 93; http://dx.doi.org/10.1007/s12253-008-9143-8; PMID: 19130303 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]63. Kim HS, Lee SH, Do SI, Lim SJ, Park YK, Kim YW. . Corelația clinicopatologică a expresiei beclin-1 în adenocarcinomul ductal pancreatic . Pathol Res Practice 2011; 207 : 247 – 52; http://dx.doi.org/10.1016/j.prp.2011.02.007; PMID: 21420796 [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Jiang ZF, Shao LJ, Wang WM, Yan XB, Liu RY. . Scăderea expresiei Beclin-1 și LC3 în cancerul pulmonar uman . Mol Biol Rep 2012; 39 : 259 – 67; http://dx.doi.org/10.1007/s11033-011-0734-1; PMID: 21556768 [ PubMed ] [ CrossRef ] [ Google Scholar ]65. Ding ZB, Shi YH, Zhou J, Qiu SJ, Xu Y, Dai Z, Shi GM, Wang XY, Ke AW, Wu B și colab. . . Asocierea defectului autofagic cu un fenotip malign și prognostic slab al carcinomului hepatocelular . Cancer Res 2008; 68 : 9167 – 75; http://dx.doi.org/10.1158/0008-5472.CAN-08-1573; PMID: 19010888 [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Pirtoli L, Cevenini G, Tini P, Vannini M, Oliveri G, Marsili S, Mourmouras V, Rubino G, Miracco C.. Rolul prognostic al expresiei proteinei Beclin 1 în glioamele de grad înalt . Autofagie 2009; 5 : 930 – 6; http://dx.doi.org/10.4161/auto.5.7.9227; PMID: 19556884 [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Huang JJ, Zhu YJ, Lin TY, Jiang WQ, Huang HQ, Li ZM. . Expresia Beclin 1 prezice rezultate clinice favorabile la pacienții cu limfom difuz cu celule B mari tratați cu R-CHOP . Hum Pathol 2011; 42 : 1459 – 66; http://dx.doi.org/10.1016/j.humpath.2010.12.014; PMID: 21450329 [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Liu H, He Z, von Rütte T, Yousefi S, Hunger RE, Simon HU. . Reglarea descendentă a proteinei 5 asociate cu autofagia (ATG5) contribuie la patogeneza melanomului cutanat în stadiu incipient . Sci Transl Med 2013; 5 : ra123; http://dx.doi.org/10.1126/scitranslmed.3005864; PMID: 24027027 [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Wan XB, Fan XJ, Chen MY, Xiang J, Huang PY, Guo L, Wu XY, Xu J, Long ZJ, Zhao Y și colab. . . Expresia crescută a Beclin 1 este corelată cu HIF-1alpha în prezicerea unui prognostic slab al carcinomului nazofaringian . Autofagie 2010; 6 : 395 – 404; http://dx.doi.org/10.4161/auto.6.3.11303; PMID: 20150769 [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Kim MS, Song SY, Lee JY, Yoo NJ, Lee SH. . Analize expresionale și mutaționale ale genei ATG5 în cancerele de prostată . APMIS 2011; 119 : 802-7; http://dx.doi.org/10.1111/j.1600-0463.2011.02812.x; PMID: 21995634 [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Degtyarev M, De Mazière A, Orr C, Lin J, Lee BB, Tien JY, Prior WW, van Dijk S, Wu H, Gray DC și colab. . . Inhibarea Akt promovează autofagia și sensibilizează tumorile PTEN-nule la agenții lizozomotropi . J Cell Biol 2008; 183 : 101 – 16; http://dx.doi.org/10.1083/jcb.200801099; PMID: 18838554 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]72. Fan QW, Cheng C, Hackett C, Feldman M, Houseman BT, Nicolaides T, Haas-Kogan D, James CD, Oakes SA, Debnath J, și colab. . . Akt și autofagia cooperează pentru a promova supraviețuirea gliomului rezistent la medicamente . Sci Signal 2010; 3 : ra81; http://dx.doi.org/10.1126/scisignal.2001017; PMID: 21062993 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Lamoureux F, Thomas C, Crafter C, Kumano M, Zhang F, Davies BR, Gleave ME, Zoubeidi A.. Autofagia blocată utilizând agenți lizozomotropi sensibilizează celulele tumorale de prostată rezistente la noul inhibitor Akt AZD5363 . Clin Cancer Res 2013; 19 : 833 – 44; http://dx.doi.org/10.1158/1078-0432.CCR-12-3114; PMID: 23258740 [ PubMed ] [ CrossRef ] [ Google Scholar ]74. Firat E, Weyerbrock A, Gaedicke S, Grosu AL, Niedermann G.. Combinațiile de inhibitori ai căii clorochină sau clorochină-PI3K / Akt promovează puternic moartea celulară indusă de iradiere γ în celulele de gliom asemănătoare stemului primar . PLoS One 2012; 7 : e47357; http://dx.doi.org/10.1371/journal.pone.0047357; PMID: 23091617 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Yuan TL, Cantley LC. . Modificări ale căii PI3K în cancer: variații pe o temă . Oncogene 2008; 27 : 5497 – 510; http://dx.doi.org/10.1038/onc.2008.245; PMID: 18794884 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Wei Y, Zou Z, Becker N, Anderson M, Sumpter R, Xiao G, Kinch L, Koduru P, Christudass CS, Veltri RW și colab. . . Fosforilarea Beclin 1 mediată de EGFR în suprimarea autofagiei, progresia tumorii și chimiorezistența tumorii . Celula 2013; 154 : 1269 – 84; http://dx.doi.org/10.1016/j.cell.2013.08.015; PMID: 24034250 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Maiuri MC, Tasdemir E, Criollo A, Morselli E, Vicencio JM, Carnuccio R, Kroemer G. Controlul autofagiei de către oncogene și gene supresoare tumorale . Cell Death Differ 2009; 16 : 87 – 93; http://dx.doi.org/10.1038/cdd.2008.131; PMID: 18806760 [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Galluzzi L, Kepp O, Vander Heiden MG, Kroemer G.. Tinte metabolice pentru terapia cancerului . Nat Rev Drug Discov 2013; 12 : 829 – 46; http://dx.doi.org/10.1038/nrd4145; PMID: 24113830 [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Karantza-Wadsworth V, Patel S, Kravchuk O, Chen G, Mathew R, Jin S, White E. Autofagia atenuează stresul metabolic și deteriorarea genomului în tumorigeneză mamară . Genes Dev 2007; 21 : 1621 – 35; http://dx.doi.org/10.1101/gad.1565707; PMID: 17606641 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Yang S, Wang X, Contino G, Liesa M, Sahin E, Ying H, Bause A, Li Y, Stommel JM, Dell’antonio G, și colab. . . Cancerele pancreatice necesită autofagie pentru creșterea tumorii . Genes Dev 2011; 25 : 717 – 29; http://dx.doi.org/10.1101/gad.2016111; PMID: 21406549 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Mathew R, Kongara S, Beaudoin B, Karp CM, Bray K, Degenhardt K, Chen G, Jin S, White E. Autofagia suprimă progresia tumorii prin limitarea instabilității cromozomiale . Genes Dev 2007; 21 : 1367 – 81; http://dx.doi.org/10.1101/gad.1545107; PMID: 17510285 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Xie R, Wang F, McKeehan WL, Liu L. Autofagia îmbunătățită de MAP1S asociată cu microtubuli și mitocondriuni suprimă instabilitatea genomului și hepatocarcinogeneza . Cancer Res 2011; 71 : 7537 – 46; http://dx.doi.org/10.1158/0008-5472.CAN-11-2170; PMID: 22037873 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]83. Rello-Varona S, Lissa D, Shen S, Niso-Santano M, Senovilla L, Mariño G, Vitale I, Jemaá M, Harper F, Pierron G și colab. . . Îndepărtarea autofagică a micronuclei . Ciclul celular 2012; 11 : 170 – 6; http://dx.doi.org/10.4161/cc.11.1.18564; PMID: 22185757 [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Iannello A, Thompson TW, Ardolino M, Lowe SW, Raulet DH. . Producția de chimiokine dependente de p53 de către celulele tumorale senescente susține eliminarea tumorii dependente de NKG2D de către celulele ucigașe naturale . J Exp Med 2013; 210 : 2057 – 69; http://dx.doi.org/10.1084/jem.20130783; PMID: 24043758 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Xue W, Zender L, Miething C, Dickins RA, Hernando E, Krizhanovsky V, Cordon-Cardo C, Lowe SW. . Senescența și eliminarea tumorii sunt declanșate de restaurarea p53 în carcinoamele hepatice murine . Natura 2007; 445 : 656 – 60; http://dx.doi.org/10.1038/nature05529; PMID: 17251933 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Iannello A, Raulet DH. . Imunosupravegherea celulelor canceroase senescente de către celulele ucigașe naturale . Oncoimunologie 2014; 3 : e27616; http://dx.doi.org/10.4161/onci.27616; PMID: 24800169 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF, Tavaré S, Arakawa S, Shimizu S, Watt FM și colab. . . Autofagia mediază tranziția mitotică a senescenței . Genes Dev 2009; 23 : 798 – 803; http://dx.doi.org/10.1101/gad.519709; PMID: 19279323 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]88. Jain A, Lamark T, Sjøttem E, Larsen KB, Awuh JA, Øvervatn A, McMahon M, Hayes JD, Johansen T. p62 / SQSTM1 este o genă țintă pentru factorul de transcripție NRF2 și creează o buclă de feedback pozitiv prin inducerea transcripției genei bazată pe elemente de răspuns antioxidant . J Biol Chem 2010; 285 : 22576 – 91; http://dx.doi.org/10.1074/jbc.M110.118976; PMID: 20452972 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]89. Inami Y, Waguri S, Sakamoto A, Kouno T, Nakada K, Hino O, Watanabe S, Ando J, Iwadate M, Yamamoto M, și colab. . . Activarea persistentă a Nrf2 prin p62 în celulele carcinomului hepatocelular . J Cell Biol 2011; 193 : 275 – 84; http://dx.doi.org/10.1083/jcb.201102031; PMID: 21482715 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]90. Vacchelli E, Senovilla L, Eggermont A, Fridman WH, Galon J, Zitvogel L, Kroemer G, Galluzzi L. Ceas de probă: chimioterapie cu inducători ai morții celulare imunogene . Oncoimunologie 2013; 2 : e23510; http://dx.doi.org/10.4161/onci.23510; PMID: 23687621 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Kroemer G, Galluzzi L, Kepp O, Zitvogel L. Moartea celulelor imunogene în terapia cancerului . Annu Rev Immunol 2013; 31 : 51 – 72; http://dx.doi.org/10.1146/annurev-immunol-032712-100008; PMID: 23157435 [ PubMed ] [ CrossRef ] [ Google Scholar ]92. Michaud M, Martins I, Sukkurwala AQ, Adjemian S, Ma Y, Pellegatti P, Shen S, Kepp O, Scoazec M, Mignot G și colab. . . Răspunsurile imune anticanceroase dependente de autofagie induse de agenții chimioterapeutici la șoareci . Știință 2011; 334 : 1573-7; http://dx.doi.org/10.1126/science.1208347; PMID: 22174255 [ PubMed ] [ CrossRef ] [ Google Scholar ]93. Degenhardt K, Mathew R, Beaudoin B, Bray K, Anderson D, Chen G, Mukherjee C, Shi Y, Gélinas C, Fan Y și colab. . . Autofagia promovează supraviețuirea celulelor tumorale și restricționează necroza, inflamația și tumorigeneză . Cancer Cell 2006; 10 : 51 – 64; http://dx.doi.org/10.1016/j.ccr.2006.06.001; PMID: 16843265 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]94. Guo JY, Chen HY, Mathew R, Fan J, Strohecker AM, Karsli-Uzunbas G, Kamphorst JJ, Chen G, Lemons JM, Karantza V și colab. . . Ras activat necesită autofagie pentru a menține metabolismul oxidativ și tumorigeneză . Genes Dev 2011; 25 : 460 – 70; http://dx.doi.org/10.1101/gad.2016311; PMID: 21317241 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]95. Wang Y, Wang XD, Lapi E, Sullivan A, Jia W, He YW, Ratnayaka I, Zhong S, Goldin RD, Goemans CG și colab. . . Activitatea autofagică dictează răspunsul celular la RAS oncogen . Proc Natl Acad Sci SUA 2012; 109 : 13325 – 30; http://dx.doi.org/10.1073/pnas.1120193109; PMID: 22847423 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]96. Parkhitko A, Myachina F, Morrison TA, Hindi KM, Auricchio N, Karbowniczek M, Wu JJ, Finkel T, Kwiatkowski DJ, Yu JJ și colab. . . Tumorigeneză în complexul de scleroză tuberoasă este autofagie și p62 / sequestozom 1 (SQSTM1) – dependentă . Proc Natl Acad Sci SUA 2011; 108 : 12455 – 60; http://dx.doi.org/10.1073/pnas.1104361108; PMID: 21746920 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]97. Chen S, Guan JL. . Roluri de promovare a tumorii și -presive ale autofagiei în același model de șoarece al cancerului pulmonar condus de BrafV600E . Cancer Discov 2013; 3 : 1225-7; http://dx.doi.org/10.1158/2159-8290.CD-13-0664; PMID: 24203955 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]98. Chen N, Karantza-Wadsworth V.. Rolul și reglarea autofagiei în cancer . Biochim Biophys Acta 2009; 1793 : 1516 – 23; http://dx.doi.org/10.1016/j.bbamcr.2008.12.013; PMID: 19167434 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]99. Mancias JD, Kimmelman AC. . Țintirea dependenței de autofagie în cancer . Oncotarget 2011; 2 : 1302 – 6; PMID: 22185891 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]100. Guo JY, Xia B, White E. Promovarea tumorii mediată de autofagie . Celula 2013; 155 : 1216 – 9; http://dx.doi.org/10.1016/j.cell.2013.11.019; PMID: 24315093 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]101. Ma XH, Piao SF, Dey S, McAfee Q, Karakousis G, Villanueva J, Hart LS, Levi S, Hu J, Zhang G, și colab. . . Țintirea autofagiei induse de stres ER depășește rezistența inhibitorilor BRAF în melanom . J Clin Invest 2014; 124 : 1406 – 17; http://dx.doi.org/10.1172/JCI70454; PMID: 24569374 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]102. Bellot G, Garcia-Medina R, Gounon P, Chiche J, Roux D, Pouysségur J, Mazure NM. . Autofagia indusă de hipoxie este mediată prin inducerea factorului inductibil de hipoxie a BNIP3 și BNIP3L prin domeniile lor BH3 . Mol Cell Biol 2009; 29 : 2570 – 81; http://dx.doi.org/10.1128/MCB.00166-09; PMID: 19273585 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]103. Wilkinson S, O’Prey J, Fricker M, Ryan KM. . Macroautofagia selectivă a hipoxiei și supraviețuirea celulară semnalate de activitatea PDGFR autocrină . Genes Dev 2009; 23 : 1283 – 8; http://dx.doi.org/10.1101/gad.521709; PMID: 19487569 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]104. Zhuang W, Qin Z, Liang Z. Rolul autofagiei în sensibilizarea celulelor de gliom maligne la radioterapie . Acta Biochim Biophys Sin (Shanghai) 2009; 41 : 341 – 51; http://dx.doi.org/10.1093/abbs/gmp028; PMID: 19430698 [ PubMed ] [ CrossRef ] [ Google Scholar ]105. Lomonaco SL, Finniss S, Xiang C, Decarvalho A, Umansky F, Kalkanis SN, Mikkelsen T, Brodie C.. Inducerea autofagiei prin radiații gamma contribuie la radiorezistența celulelor stem ale gliomului . Int J Cancer 2009; 125 : 717 – 22; http://dx.doi.org/10.1002/ijc.24402; PMID: 19431142 [ PubMed ] [ CrossRef ] [ Google Scholar ]106. Sun WL, Chen J, Wang YP, Zheng H. Autofagia protejează celulele cancerului de sân de apoptoza indusă de epirubicină și facilitează dezvoltarea rezistenței la epirubicină . Autofagie 2011; 7 : 1035 – 44; http://dx.doi.org/10.4161/auto.7.9.16521; PMID: 21646864 [ PubMed ] [ CrossRef ] [ Google Scholar ]107. Mukubou H, Tsujimura T, Sasaki R, Ku Y.. Rolul autofagiei în tratamentul cancerului pancreatic cu gemcitabină și radiații ionizante . Int J Oncol 2010; 37 : 821 – 8; PMID: 20811703 [ PubMed ] [ Google Scholar ]108. Li J, Hou N, Faried A, Tsutsumi S, Kuwano H.. Inhibarea autofagiei mărește chimioterapia cu 5-fluorouracil în cancerul de colon uman in vitro și in vivo . Eur J Cancer 2010; 46 : 1900 – 9; http://dx.doi.org/10.1016/j.ejca.2010.02.021; PMID: 20231086 [ PubMed ] [ CrossRef ] [ Google Scholar ]109. Liu D, Yang Y, Liu Q, Wang J. Inhibarea autofagiei de către 3-MA potențează apoptoza indusă de cisplatină în celulele carcinomului cu celule scuamoase esofagiene . Med Oncol 2011; 28 : 105 – 11; http://dx.doi.org/10.1007/s12032-009-9397-3; PMID: 20041317 [ PubMed ] [ CrossRef ] [ Google Scholar ]110. Ding ZB, Hui B, Shi YH, Zhou J, Peng YF, Gu CY, Yang H, Shi GM, Ke AW, Wang XY și colab. . . Activarea autofagiei în carcinomul hepatocelular contribuie la toleranța oxaliplatinei prin modularea speciilor reactive de oxigen . Clin Cancer Res 2011; 17 : 6229 – 38; http://dx.doi.org/10.1158/1078-0432.CCR-11-0816; PMID: 21825039 [ PubMed ] [ CrossRef ] [ Google Scholar ]111. Josset E, Burckel H, Noël G, Bischoff P. Inhibitorul mTOR RAD001 potențează moartea celulelor autofagice indusă de temozolomidă într-o linie celulară de glioblastom . Anticancer Res 2013; 33 : 1845 – 51; PMID: 23645729 [ PubMed ] [ Google Scholar ]112. Selvakumaran M, Amaravadi RK, Vasilevskaya IA, O’Dwyer PJ. . Inhibarea autofagiei sensibilizează celulele cancerului de colon la terapia antiangiogenă și citotoxică . Clin Cancer Res 2013; 19 : 2995 – 3007; http://dx.doi.org/10.1158/1078-0432.CCR-12-1542; PMID: 23461901 [ PubMed ] [ CrossRef ] [ Google Scholar ]113. Han W, Pan H, Chen Y, Sun J, Wang Y, Li J, Ge W, Feng L, Lin X, Wang X și colab. . . Inhibitorii tirozin kinazei EGFR activează autofagia ca răspuns citoprotector în celulele cancerului pulmonar uman . PLoS One 2011; 6 : e18691; http://dx.doi.org/10.1371/journal.pone.0018691; PMID: 21655094 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]114. Goldberg SB, Supko JG, Neal JW, Muzikansky A, Digumarthy S, Fidias P, Temel JS, Heist RS, Shaw AT, McCarthy PO și colab. . . Un studiu de fază I a erlotinibului și hidroxiclorochinei în cancerul pulmonar avansat cu celule mici . J Thorac Oncol 2012; 7 : 1602 – 8; http://dx.doi.org/10.1097/JTO.0b013e318262de4a; PMID: 22878749 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]115. Carew JS, Medina EC, Esquivel JA 2nd, Mahalingam D, Swords R, Kelly K, Zhang H, Huang P, Mita AC, Mita MM, și colab. . . Inhibarea autofagiei mărește apoptoza indusă de vorinostat prin acumularea de proteine ​​ubiquitinate . J Cell Mol Med 2010; 14 : 2448 – 59; http://dx.doi.org/10.1111/j.1582-4934.2009.00832.x; PMID: 19583815 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]116. Xie X, EP alb, Mehnert JM. . Coordonarea autofagiei și inhibarea căii mTOR îmbunătățește moartea celulară în melanom . PLoS One 2013; 8 : e55096; http://dx.doi.org/10.1371/journal.pone.0055096; PMID: 23383069 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]117. Maycotte P, Thorburn A.. Autofagie și terapie împotriva cancerului . Cancer Biol Ther 2011; 11 : 127 – 37; http://dx.doi.org/10.4161/cbt.11.2.14627; PMID: 21178393 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]118. Janku F, DJ McConkey, Hong DS, Kurzrock R.. Autofagia ca țintă pentru terapia anticancerigenă . Nat Rev Clin Oncol 2011; 8 : 528 – 39; http://dx.doi.org/10.1038/nrclinonc.2011.71; PMID: 21587219 [ PubMed ] [ CrossRef ] [ Google Scholar ]119. Lorin S, Hamaï A, Mehrpour M, Codogno P.. Reglarea autofagiei și rolul său în cancer . Semin Cancer Biol 2013; 23 : 361 – 79; http://dx.doi.org/10.1016/j.semcancer.2013.06.007; PMID: 23811268 [ PubMed ] [ CrossRef ] [ Google Scholar ]120. Katayama M, Kawaguchi T, Berger MS, Pieper RO. . Autofagia indusă de agentul dăunător al ADN produce o creștere citoprotectoră a adenozin trifosfatului în celulele maligne ale gliomului . Cell Death Differ 2007; 14 : 548 – 58; http://dx.doi.org/10.1038/sj.cdd.4402030; PMID: 16946731 [ PubMed ] [ CrossRef ] [ Google Scholar ]121. Amaravadi RK, Yu D, Lum JJ, Bui T, Christophorou MA, Evan GI, Thomas-Tikhonenko A, Thompson CB. . Inhibarea autofagiei îmbunătățește apoptoza indusă de terapie într-un model de limfom indus de Myc . J Clin Invest 2007; 117 : 326 – 36; http://dx.doi.org/10.1172/JCI28833; PMID: 17235397 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]122. Abedin MJ, Wang D, McDonnell MA, Lehmann U, Kelekar A.. Autofagia întârzie moartea apoptotică în celulele cancerului de sân în urma deteriorării ADN-ului . Cell Death Differ 2007; 14 : 500 – 10; http://dx.doi.org/10.1038/sj.cdd.4402039; PMID: 16990848 [ PubMed ] [ CrossRef ] [ Google Scholar ]123. Qadir MA, Kwok B, Dragowska WH, To KH, Le D, Bally MB, Gorski SM. . Inhibarea macroautofagiei sensibilizează celulele canceroase de sân rezistente la tamoxifen și îmbunătățește depolarizarea mitocondrială . Cancerul de sân Res Treat 2008; 112 : 389 – 403; http://dx.doi.org/10.1007/s10549-007-9873-4; PMID: 18172760 [ PubMed ] [ CrossRef ] [ Google Scholar ]124. Yang PM, Liu YL, Lin YC, Shun CT, Wu MS, Chen CC. . Inhibarea autofagiei îmbunătățește efectele anticancerigene ale atorvastatinei în afecțiunile maligne digestive . Cancer Res 2010; 70 : 7699 – 709; http://dx.doi.org/10.1158/0008-5472.CAN-10-1626; PMID: 20876807 [ PubMed ] [ CrossRef ] [ Google Scholar ]125. Zou Z, Yuan Z, Zhang Q, Long Z, Chen J, Tang Z, Zhu Y, Chen S, Xu J, Yan M și colab. . . Autofagia indusă de inhibiție a Aurorei kinazei declanșează rezistența la medicamente în celulele cancerului mamar . Autofagie 2012; 8 : 1798 – 810; http://dx.doi.org/10.4161/auto.22110; PMID: 23026799 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]126. Pan X, Zhang X, Sun H, Zhang J, Yan M, Zhang H.. Inhibarea autofagiei promovează apoptoza indusă de 5-fluorouraci prin stimularea formării ROS în celulele A549 ale cancerului pulmonar non-celule mici umane . PLoS One 2013; 8 : e56679; http://dx.doi.org/10.1371/journal.pone.0056679; PMID: 23441212 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]127. Sotelo J, Briceño E, López-González MA. . Adăugarea clorochinei la tratamentul convențional pentru glioblastom multiform: un studiu randomizat, dublu-orb, controlat cu placebo . Ann Intern Med 2006; 144 : 337 – 43; http://dx.doi.org/10.7326/0003-4819-144-5-200603070-00008; PMID: 16520474 [ PubMed ] [ CrossRef ] [ Google Scholar ]128. Sasaki K, Tsuno NH, Sunami E, Tsurita G, Kawai K, Okaji Y, Nishikawa T, Shuno Y, Hongo K, Hiyoshi M, și colab. . . Clorochina potențează efectul anticancer al 5-fluorouracilului asupra celulelor canceroase ale colonului . BMC Cancer 2010; 10 : 370; http://dx.doi.org/10.1186/1471-2407-10-370; PMID: 20630104 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]129. McAfee Q, Zhang Z, Samanta A, Levi SM, Ma XH, Piao S, Lynch JP, Uehara T, Sepulveda AR, Davis LE, și colab. . . Inhibitorul de autofagie Lys05 are activitate antitumorală cu un singur agent și reproduce fenotipul unei deficiențe genetice de autofagie . Proc Natl Acad Sci SUA 2012; 109 : 8253 – 8; http://dx.doi.org/10.1073/pnas.1118193109; PMID: 22566612 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]130. O’Donovan TR, O’Sullivan GC, McKenna SL. . Inducerea autofagiei de către celulele canceroase esofagiene rezistente la medicamente promovează supraviețuirea și recuperarea lor după tratamentul cu chimioterapie . Autofagie 2011; 7 : 509 – 24; http://dx.doi.org/10.4161/auto.7.5.15066; PMID: 21325880 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]131. Shi YH, Ding ZB, Zhou J, Hui B, Shi GM, Ke AW, Wang XY, Dai Z, Peng YF, Gu CY și colab. . . Țintirea autofagiei sporește letalitatea sorafenibului pentru carcinomul hepatocelular prin apoptoza ER legată de stres . Autofagie 2011; 7 : 1159 – 72; http://dx.doi.org/10.4161/auto.7.10.16818; PMID: 21691147 [ PubMed ] [ CrossRef ] [ Google Scholar ]132. Xu CX, Zhao L, Yue P, Fang G, Tao H, Owonikoko TK, Ramalingam SS, Khuri FR, Sun SY. . Creșterea activității anticanceroase a NVP-BEZ235 împotriva celulelor cancerului pulmonar uman prin blocarea autofagiei . Cancer Biol Ther 2011; 12 : 549 – 55; http://dx.doi.org/10.4161/cbt.12.6.16397; PMID: 21738008 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]133. Li J, Hou N, Faried A, Tsutsumi S, Takeuchi T, Kuwano H.. Inhibarea autofagiei de către 3-MA îmbunătățește efectul apoptozei induse de 5-FU în celulele cancerului de colon . Ann Surg Oncol 2009; 16 : 761 – 71; http://dx.doi.org/10.1245/s10434-008-0260-0; PMID: 19116755 [ PubMed ] [ CrossRef ] [ Google Scholar ]134. Leng S, Hao Y, Du D, Xie S, Hong L, Gu H, Zhu X, Zhang J, Fan D, Kung HF. . Acidul ursolic favorizează moartea celulelor canceroase prin inducerea autofagiei dependente de Atg5 . Int J Cancer 2013; 133 : 2781 – 90; PMID: 23737395 [ PubMed ] [ Google Scholar ]135. Chen YS, Song HX, Lu Y, Li X, Chen T, Zhang Y, Xue JX, Liu H, Kan B, Yang G și colab. . . Inhibarea autofagiei contribuie la sensibilizarea la radiații a celulelor carcinomului scuamos esofagian . Dis Esophagus 2011; 24 : 437 – 43; http://dx.doi.org/10.1111/j.1442-2050.2010.01156.x; PMID: 21166739 [ PubMed ] [ CrossRef ] [ Google Scholar ]136. Liu F, Liu D, Yang Y, Zhao S.. Efectul inhibiției autofagiei asupra apoptozei induse de chimioterapie în celulele cancerului pulmonar A549 . Oncol Lett 2013; 5 : 1261 – 5; PMID: 23599776 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]137. Deng L, Lei Y, Liu R, Li J, Yuan K, Li Y, Chen Y, Liu Y, Lu Y, Edwards CK 3rd, și colab. . . Pirviniul vizează dependența de autofagie pentru a promova moartea celulelor canceroase . Cell Death Dis 2013; 4 : e614; http://dx.doi.org/10.1038/cddis.2013.142; PMID: 23640456 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]138. Cerniglia GJ, Karar J, Tyagi S, Christofidou-Solomidou M, Rengan R, Koumenis C, Maity A. Inhibarea autofagiei ca strategie de creștere a radiosensibilizării prin dubla fosfatidilinozitol 3-kinază / țintă mamiferă a inhibitorului de rapamicină NVP-BEZ235 . Mol Pharmacol 2012; 82 : 1230 – 40; http://dx.doi.org/10.1124/mol.112.080408; PMID: 22989521 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]139. Shao S, Li S, Qin Y, Wang X, Yang Y, Bai H, Zhou L, Zhao C, Wang C. Spautin-1, un nou inhibitor al autofagiei, îmbunătățește apoptoza indusă de imatinib în leucemia mieloidă cronică . Int J Oncol 2014; 44 : 1661 – 8; PMID: 24585095 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]140. Vakifahmetoglu-Norberg H, Kim M, Xia HG, Iwanicki MP, Ofengeim D, Coloff JL, Pan L, Ince TA, Kroemer G, Brugge JS și colab. . . Autofagia mediată de chaperonă degradează mutantul p53 . Genes Dev 2013; 27 : 1718 – 30; http://dx.doi.org/10.1101/gad.220897.113; PMID: 23913924 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]141. Mateo R, Nagamine CM, Spagnolo J, Méndez E, Rahe M, Gale M Jr., Yuan J, Kirkegaard K.. Inhibarea autofagiei celulare deranjează maturizarea virionului dengue . J Virol 2013; 87 : 1312 – 21; http://dx.doi.org/10.1128/JVI.02177-12; PMID: 23175363 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]142. Liu J, Xia H, Kim M, Xu L, Li Y, Zhang L, Cai Y, Norberg HV, Zhang T, Furuya T și colab. . . Beclin1 controlează nivelurile de p53 prin reglarea activității de deubiquitinare a USP10 și USP13 . Cell 2011; 147 : 223 – 34; http://dx.doi.org/10.1016/j.cell.2011.08.037; PMID: 21962518 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]143. Galluzzi L, Kepp O, Kroemer G.. Mitocondriile: regulatori principali ai semnalizării pericolelor . Nat Rev Mol Cell Biol 2012; 13 : 780 – 8; http://dx.doi.org/10.1038/nrm3479; PMID: 23175281 [ PubMed ] [ CrossRef ] [ Google Scholar ]144. Choi DS, Blanco E, Kim YS, Rodriguez AA, Zhao H, Huang TH, Chen CL, Jin G, Landis MD, Burey LA, și colab. . . Clorochina elimină celulele stem canceroase prin dereglarea Jak2 și DNMT1 . Celule stem 2014; Următorul http://dx.doi.org/10.1002/stem.1746; PMID: 24809620 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]145. Eldredge HB, Denittis A, Duhadaway JB, Chernick M, Metz R, Prendergast GC. Radioterapie cerebrală integrală simultană și clorochină cu curs scurt la pacienții cu metastaze cerebrale: un studiu pilot. J Radiat Oncol 2013; 2. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]146. Wolpin BM, Rubinson DA, Wang X, Chan JA, Cleary JM, Enzinger PC, Fuchs CS, McCleary NJ, Meyerhardt JA, Ng K, și colab. . . Faza II și studiu farmacodinamic al inhibiției autofagiei utilizând hidroxiclorochină la pacienții cu adenocarcinom pancreatic metastatic . Oncolog 2014; 19 : 637 – 8; http://dx.doi.org/10.1634/theoncologist.2014-0086; PMID: 24821822 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]147. Boehrer S, Adès L, Braun T, Galluzzi L, Grosjean J, Fabre C, Le Roux G, Gardin C, Martin A, de Botton S, și colab. . . Erlotinib prezintă efecte antineoplazice off-target în LMA și SMD: un studiu preclinic . Blood 2008; 111 : 2170 – 80; http://dx.doi.org/10.1182/blood-2007-07-100362; PMID: 17925489 [ PubMed ] [ CrossRef ] [ Google Scholar ]148. Ciardiello F, Tortora G.. Antagoniștii EGFR în tratamentul cancerului . N Engl J Med 2008; 358 : 1160 – 74; http://dx.doi.org/10.1056/NEJMra0707704; PMID: 18337605 [ PubMed ] [ CrossRef ] [ Google Scholar ]149. Mendelsohn J, Baselga J.. Familia receptorilor EGF ca ținte pentru terapia cancerului . Oncogene 2000; 19 : 6550 – 65; http://dx.doi.org/10.1038/sj.onc.1204082; PMID: 11426640 [ PubMed ] [ CrossRef ] [ Google Scholar ]150. Shepherd FA, Rodrigues Pereira J, Ciuleanu T, Tan EH, Hirsh V, Thongprasert S, Campos D, Maoleekoonpiroj S, Smylie M, Martins R, și colab. , Institutul Național al Cancerului din Canada Grupul de studii clinice. . Erlotinib în cancerul pulmonar non-cu celule mici tratat anterior . N Engl J Med 2005; 353 : 123 – 32; http://dx.doi.org/10.1056/NEJMoa050753; PMID: 16014882 [ PubMed ] [ CrossRef ] [ Google Scholar ]151. Ruiz-Irastorza G, Ramos-Casals M, Brito-Zeron P, Khamashta MA. . Eficacitatea clinică și efectele secundare ale antimalaricelor în lupusul eritematos sistemic: o revizuire sistematică . Ann Rheum Dis 2010; 69 : 20 – 8; http://dx.doi.org/10.1136/ard.2008.101766; PMID: 19103632 [ PubMed ] [ CrossRef ] [ Google Scholar ]152. Gunja N, Roberts D, McCoubrie D, Lamberth P, Jan A, Simes DC, Hackett P, Buckley NA. . Supraviețuirea după supradozaj masiv de hidroxiclorochină . Anaesth Intensive Care 2009; 37 : 130 – 3; PMID: 19157361 [ PubMed ] [ Google Scholar ]153. Hoffmann J, Vitale I, Buchmann B, Galluzzi L, Schwede W, Senovilla L, Skuballa W, Vivet S, Lichtner RB, Vicencio JM, și colab. . . Farmacocinetica și farmacodinamica celulare îmbunătățite stau la baza activității largi anticancerigene a sagopilonei . Cancer Res 2008; 68 : 5301 – 8; http://dx.doi.org/10.1158/0008-5472.CAN-08-0237; PMID: 18593931 [ PubMed ] [ CrossRef ] [ Google Scholar ]154. Doménech E, Malumbres M.. Terapii care vizează mitoza: un ghid de depanare . Curr Opin Pharmacol 2013; 13 : 519 – 28; http://dx.doi.org/10.1016/j.coph.2013.03.011; PMID: 23583638 [ PubMed ] [ CrossRef ] [ Google Scholar ]155. Jordan MA, Wilson L.. Microtubulii ca țintă pentru medicamentele împotriva cancerului . Nat Rev Cancer 2004; 4 : 253 – 65; http://dx.doi.org/10.1038/nrc1317; PMID: 15057285 [ PubMed ] [ CrossRef ] [ Google Scholar ]156. Galluzzi L, Kepp O, Kroemer G.. Moartea celulelor imunogene în radioterapie . Oncoimunologie 2013; 2 : e26536; http://dx.doi.org/10.4161/onci.26536; PMID: 24404424 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]157. Vacchelli E, Vitale I, Tartour E, Eggermont A, Sautès-Fridman C, Galon J, Zitvogel L, Kroemer G, Galluzzi L. Trial Watch: radioimunoterapie anticanceroasă . Oncoimunologie 2013; 2 : e25595; http://dx.doi.org/10.4161/onci.25595; PMID: 24319634 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]158. Galluzzi L, Senovilla L, Vitale I, Michels J, Martins I, Kepp O, Castedo M, Kroemer G. Mecanisme moleculare de rezistență la cisplatină . Oncogene 2012; 31 : 1869 – 83; http://dx.doi.org/10.1038/onc.2011.384; PMID: 21892204 [ PubMed ] [ CrossRef ] [ Google Scholar ]159. Galluzzi L, Vitale I, Michels J, Brenner C, Szabadkai G, Harel-Bellan A, Castedo M, Kroemer G. Biologia sistemelor de rezistență la cisplatină: trecut, prezent și viitor . Cell Death Dis 2014; 5 : e1257; http://dx.doi.org/10.1038/cddis.2013.428; PMID: 24874729 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]160. Basu B, Yap TA, Molife LR, de Bono JS. . Direcționarea răspunsului la deteriorarea ADN-ului în oncologie: perspective trecute, prezente și viitoare . Curr Opin Oncol 2012; 24 : 316 – 24; http://dx.doi.org/10.1097/CCO.0b013e32835280c6; PMID: 22476188 [ PubMed ] [ CrossRef ] [ Google Scholar ]161. Lord CJ, Ashworth A.. Răspunsul la deteriorarea ADN și terapia împotriva cancerului . Natura 2012; 481 : 287 – 94; http://dx.doi.org/10.1038/nature10760; PMID: 22258607 [ PubMed ] [ CrossRef ] [ Google Scholar ]162. Walter S, Weinschenk T, Reinhardt C, Singh-Jasuja H.. Ciclofosfamida cu doză unică se sinergizează cu răspunsurile imune la vaccinul IMA901 pentru cancerul cu celule renale . Oncoimunologie 2013; 2 : e22246; http://dx.doi.org/10.4161/onci.22246; PMID: 23482454 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]163. Malvicini M, Alaniz L, Bayo J, Garcia M, Piccioni F, Fiore E, Atorrasagasti C, Aquino JB, Matar P, Mazzolini G. O singură doză mică de ciclofosfamidă combinată cu terapia genică interleukină-12 este superioară unui program metronomic în inducerea imunității împotriva carcinomului colorectal la șoareci . Oncoimunologie 2012; 1 : 1038 – 47; http://dx.doi.org/10.4161/onci.20684; PMID: 23170252 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]164. Zitvogel L, Galluzzi L, Smyth MJ, Kroemer G.. Mecanismul de acțiune al terapiilor anticanceroase convenționale și țintite: restabilirea imunosupravegherii . Imunitate 2013; 39 : 74 – 88; http://dx.doi.org/10.1016/j.immuni.2013.06.014; PMID: 23890065 [ PubMed ] [ CrossRef ] [ Google Scholar ]165. Galluzzi L, Senovilla L, Zitvogel L, Kroemer G. Aliatul secret: imunostimularea de către medicamentele împotriva cancerului . Nat Rev Drug Discov 2012; 11 : 215 – 33; http://dx.doi.org/10.1038/nrd3626; PMID: 22301798 [ PubMed ] [ CrossRef ] [ Google Scholar ]166. Ciccia A, Elledge SJ. . Răspunsul deteriorarea ADN – ului: făcându – l în condiții de siguranță să se joace cu cuțite . Mol Cell 2010; 40 : 179 – 204; http://dx.doi.org/10.1016/j.molcel.2010.09.019; PMID: 20965415 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]167. Danson SJ, Middleton MR. . Temozolomidă: un nou agent de alchilare orală . Expert Rev Anticancer Ther 2001; 1 : 13 – 9; http://dx.doi.org/10.1586/14737140.1.1.13; PMID: 12113120 [ PubMed ] [ CrossRef ] [ Google Scholar ]168. Margison GP, ​​Santibáñez Koref MF, Povey AC. . Mecanisme de carcinogenitate / chimioterapie de către O6-metilguanină . Mutagenesis 2002; 17 : 483 – 7; http://dx.doi.org/10.1093/mutage/17.6.483; PMID: 12435845 [ PubMed ] [ CrossRef ] [ Google Scholar ]169. Michels J, Vitale I, Galluzzi L, Adam J, Olaussen KA, Kepp O, Senovilla L, Talhaoui I, Guegan J, Enot DP, și colab. . . Rezistența la cisplatină asociată cu hiperactivarea PARP . Cancer Res 2013; 73 : 2271 – 80; http://dx.doi.org/10.1158/0008-5472.CAN-12-3000; PMID: 23554447 [ PubMed ] [ CrossRef ] [ Google Scholar ]170. Walko CM, Lindley C.. Capecitabina: o recenzie . Clin Ther 2005; 27 : 23 – 44; http://dx.doi.org/10.1016/j.clinthera.2005.01.005; PMID: 15763604 [ PubMed ] [ CrossRef ] [ Google Scholar ]171. Culy CR, Clemett D, Wiseman LR. . Oxaliplatină. O revizuire a proprietăților sale farmacologice și a eficacității clinice în cancerul colorectal metastatic și a potențialului său în alte tumori maligne . Droguri 2000; 60 : 895 – 924; http://dx.doi.org/10.2165/00003495-200060040-00005; PMID: 11085200 [ PubMed ] [ CrossRef ] [ Google Scholar ]172. Raymond E, Faivre S, Chaney S, Woynarowski J, Cvitkovic E. Farmacologia celulară și moleculară a oxaliplatinei . Mol Cancer Ther 2002; 1 : 227 – 35; PMID: 12467217 [ PubMed ] [ Google Scholar ]173. Vacchelli E, Eggermont A, Galon J, Sautès-Fridman C, Zitvogel L, Kroemer G, Galluzzi L.. Ceas de încercare: anticorpi monoclonali în terapia cancerului . Oncoimunologie 2013; 2 : e22789; http://dx.doi.org/10.4161/onci.22789; PMID: 23482847 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]174. Muhsin M, Graham J, Kirkpatrick P.. Bevacizumab . Nat Rev Drug Discov 2004; 3 : 995 – 6; http://dx.doi.org/10.1038/nrd1601; PMID: 15645606 [ PubMed ] [ CrossRef ] [ Google Scholar ]175. Ferrara N, Hillan KJ, Gerber HP, Novotny W.. Descoperirea și dezvoltarea bevacizumab, un anticorp anti-VEGF pentru tratarea cancerului . Nat Rev Drug Discov 2004; 3 : 391 – 400; http://dx.doi.org/10.1038/nrd1381; PMID: 15136787 [ PubMed ] [ CrossRef ] [ Google Scholar ]176. Giunchedi P, Maestri M, Gavini E, Dionigi P, Rassu G.. Chimiembolizarea transarterială a carcinomului hepatocelular. Agenți și medicamente: o privire de ansamblu. Partea 1 . Expert Opin Drug Deliv 2013; 10 : 679 – 90; http://dx.doi.org/10.1517/17425247.2013.770733; PMID: 23406440 [ PubMed ] [ CrossRef ] [ Google Scholar ]177. Kerr SH, Kerr DJ. . Tratamente noi pentru cancerul hepatocelular . Cancer Lett 2009; 286 : 114 – 20; http://dx.doi.org/10.1016/j.canlet.2009.07.001; PMID: 19664880 [ PubMed ] [ CrossRef ] [ Google Scholar ]178. Pal SK, Reckamp K, Yu H, Figlin RA. . Inhibitori Akt în dezvoltarea clinică pentru tratamentul cancerului . Expert Opin Investig Drugs 2010; 19 : 1355 – 66; http://dx.doi.org/10.1517/13543784.2010.520701; PMID: 20846000 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]179. Faivre S, Kroemer G, Raymond E.. Dezvoltarea actuală a inhibitorilor mTOR ca agenți anticanceroși . Nat Rev Drug Discov 2006; 5 : 671 – 88; http://dx.doi.org/10.1038/nrd2062; PMID: 16883305 [ PubMed ] [ CrossRef ] [ Google Scholar ]180. de La Motte Rouge T, Galluzzi L, Olaussen KA, Zermati Y, Tasdemir E, Robert T, Ripoche H, Lazar V, Dessen P, Harper F, și colab. . . Un nou inhibitor al receptorului factorului de creștere epidermică promovează apoptoza în celulele cancerului pulmonar cu celule mici, rezistente la erlotinib . Cancer Res 2007; 67 : 6253 – 62; http://dx.doi.org/10.1158/0008-5472.CAN-07-0538; PMID: 17616683 [ PubMed ] [ CrossRef ] [ Google Scholar ]181. Capdeville R, Buchdunger E, Zimmermann J, Matter A. Glivec (STI571, imatinib), un medicament anticancerigen dezvoltat rațional . Nat Rev Drug Discov 2002; 1 : 493 – 502; http://dx.doi.org/10.1038/nrd839; PMID: 12120256 [ PubMed ] [ CrossRef ] [ Google Scholar ]182. Ostman A, Heldin CH. . Receptorii PDGF ca ținte în tratamentul tumorii . Adv Cancer Res 2007; 97 : 247 – 74; http://dx.doi.org/10.1016/S0065-230X(06)97011-0; PMID: 17419949 [ PubMed ] [ CrossRef ] [ Google Scholar ]183. Kharaziha P, De Raeve H, Fristedt C, Li Q, Gruber A, Johnsson P, Kokaraki G, Panzar M, Laane E, Osterborg A și colab. . . Sorafenib are o activitate antitumorală puternică împotriva mielomului multiplu in vitro, ex vivo și in vivo în modelul de șoarece 5T33MM . Cancer Res 2012; 72 : 5348 – 62; http://dx.doi.org/10.1158/0008-5472.CAN-12-0658; PMID: 22952216 [ PubMed ] [ CrossRef ] [ Google Scholar ]184. Kharaziha P, Rodriguez P, Li Q, Rundqvist H, Björklund AC, Augsten M, Ullén A, Egevad L, Wiklund P, Nilsson S și colab. . . Direcționarea cascadelor de semnalizare distincte și a fibroblastelor asociate cancerului definesc eficacitatea Sorafenib împotriva celulelor canceroase de prostată . Cell Death Dis 2012; 3 : e262; http://dx.doi.org/10.1038/cddis.2012.1; PMID: 22278289 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]185. Abrams TJ, Murray LJ, Pesenti E, Holway VW, Colombo T, Lee LB, Cherrington JM, Pryer NK. . Evaluarea preclinică a inhibitorului tirozin kinazei SU11248 ca agent unic și în combinație cu agenți terapeutici „standard de îngrijire” pentru tratamentul cancerului de sân . Mol Cancer Ther 2003; 2 : 1011 – 21; PMID: 14578466 [ PubMed ] [ Google Scholar ]186. Chang YS, Adnane J, Trail PA, Levy J, Henderson A, Xue D, Bortolon E, Ichetovkin M, Chen C, McNabola A și colab. . . Sorafenib (BAY 43-9006) inhibă creșterea și vascularizarea tumorii și induce apoptoza tumorii și hipoxia la modelele de xenogrefă RCC . Cancer Chemother Pharmacol 2007; 59 : 561 – 74; http://dx.doi.org/10.1007/s00280-006-0393-4; PMID: 17160391 [ PubMed ] [ CrossRef ] [ Google Scholar ]187. O’Farrell AM, Abrams TJ, Yuen HA, Ngai TJ, Louie SG, Yee KW, Wong LM, Hong W, Lee LB, Town A și colab. . . SU11248 este un nou inhibitor al tirozin kinazei FLT3 cu activitate puternică in vitro și in vivo . Blood 2003; 101 : 3597 – 605; http://dx.doi.org/10.1182/blood-2002-07-2307; PMID: 12531805 [ PubMed ] [ CrossRef ] [ Google Scholar ]188. Wilhelm SM, Carter C, Tang L, Wilkie D, McNabola A, Rong H, Chen C, Zhang X, Vincent P, McHugh M și colab. . . BAY 43-9006 prezintă activitate antitumorală orală cu spectru larg și vizează calea RAF / MEK / ERK și receptorii tirozin kinaze implicate în progresia tumorii și angiogeneza . Cancer Res 2004; 64 : 7099 – 109; http://dx.doi.org/10.1158/0008-5472.CAN-04-1443; PMID: 15466206 [ PubMed ] [ CrossRef ] [ Google Scholar ]189. Tsai J, Lee JT, Wang W, Zhang J, Cho H, Mamo S, Bremer R, Gillette S, Kong J, Haass NK, și colab. . . Descoperirea unui inhibitor selectiv al kinazei B-Raf oncogene cu activitate antimelanom puternică . Proc Natl Acad Sci SUA 2008; 105 : 3041 – 6; http://dx.doi.org/10.1073/pnas.0711741105; PMID: 18287029 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]190. Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, Johnson EF, Marsh KC, Mitten MJ, Nimmer P, și colab. . . ABT-263: un inhibitor al familiei Bcl-2 puternic și biodisponibil oral . Cancer Res 2008; 68 : 3421 – 8; http://dx.doi.org/10.1158/0008-5472.CAN-07-5836; PMID: 18451170 [ PubMed ] [ CrossRef ] [ Google Scholar ]191. van Delft MF, Wei AH, Mason KD, Vandenberg CJ, Chen L, Czabotar PE, Willis SN, Scott CL, Day CL, Cory S și colab. . . ABH-737 mimetic BH3 vizează proteinele selective Bcl-2 și induce eficient apoptoza prin Bak / Bax dacă Mcl-1 este neutralizat . Cancer Cell 2006; 10 : 389 – 99; http://dx.doi.org/10.1016/j.ccr.2006.08.027; PMID: 17097561 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]192. Reid AH, Attard G, Barrie E, de Bono JS. . Inhibarea CYP17 ca strategie hormonală pentru cancerul de prostată . Nat Clin Pract Urol 2008; 5 : 610 – 20; http://dx.doi.org/10.1038/ncpuro1237; PMID: 18985049 [ PubMed ] [ CrossRef ] [ Google Scholar ]193. Vacchelli E, Eggermont A, Fridman WH, Galon J, Zitvogel L, Kroemer G, Galluzzi L.. Trial Watch: Citokine imunostimulatoare . Oncoimunologie 2013; 2 : e24850; http://dx.doi.org/10.4161/onci.24850; PMID: 24073369 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]194. Vacchelli E, Aranda F, Obrist F, Eggermont A, Galon J, Cremer I, și colab. . . Trial Watch: Citokine imunostimulatoare în terapia cancerului . OncoImmunology 2014; 3 : e29030; http://dx.doi.org/10.4161/onci.29030 %5B Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]195. Ma Y, Galluzzi L, Zitvogel L, Kroemer G. Autofagie și răspunsuri imune celulare . Imunitate 2013; 39 : 211 – 27; http://dx.doi.org/10.1016/j.immuni.2013.07.017; PMID: 23973220 [ PubMed ] [ CrossRef ] [ Google Scholar ]196. Bareford MD, Park MA, Yacoub A, Hamed HA, Tang Y, Cruickshanks N, Eulitt P, Hubbard N, Tye G, Burow ME, și colab. . . Sorafenib îmbunătățește citotoxicitatea pemetrexed printr-un mecanism dependent de autofagie în celulele canceroase . Cancer Res 2011; 71 : 4955 – 67; http://dx.doi.org/10.1158/0008-5472.CAN-11-0898; PMID: 21622715 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]197. Elgendy M, Sheridan C, Brumatti G, Martin SJ. . Expresia oncogenă a Noxa și Beclin-1 indusă de Ras promovează moartea celulelor autofagice și limitează supraviețuirea clonogenă . Mol Cell 2011; 42 : 23 – 35; http://dx.doi.org/10.1016/j.molcel.2011.02.009; PMID: 21353614 [ PubMed ] [ CrossRef ] [ Google Scholar ]198. Gump JM, Staskiewicz L, Morgan MJ, Bamberg A, Riches DW, Thorburn A. Variația autofagiei într-o populație de celule determină soarta celulei prin degradarea selectivă a Fap-1 . Nat Cell Biol 2014; 16 : 47 – 54; http://dx.doi.org/10.1038/ncb2886; PMID: 24316673 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]199. Kohli L, Kaza N, Coric T, Byer SJ, Brossier NM, Klocke BJ, Bjornsti MA, Carroll SL, Roth KA. . 4-Hidroxitamoxifenul induce moartea autofagică prin degradarea K-Ras . Cancer Res 2013; 73 : 4395 – 405; http://dx.doi.org/10.1158/0008-5472.CAN-12-3765; PMID: 23722551 [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]200. Voss V, Senft C, Lang V, Ronellenfitsch MW, Steinbach JP, Seifert V, Kögel D. Inhibitorul pan-Bcl-2 (-) – gossypol declanșează moartea celulelor autofagice în gliomul malign . Mol Cancer Res 2010; 8 : 1002 – 16; http://dx.doi.org/10.1158/1541-7786.MCR-09-0562; PMID: 20587533 [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Oncologia Moleculară și Celulară sunt furnizate aici, prin amabilitatea lui Taylor și Francis

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4905171/

Efectele suplimentării genisteinei asupra metilării ADN la nivelul genomului și a expresiei genice la pacienții cu cancer de prostată localizat

Birdal Bilir , 1, 5 Nitya V. Sharma , Jeongseok Lee , Bato Hammarstrom , 2, 7 Aud Svindland , 3, 4 Omer Kucuk , 5, 6 și Carlos S. Moreno 1, 6

Genisteina [4 ‘, 5,7-trihidroxiizoflavonă sau 5,7-dihidroxi-3- (4-hidroxifenil) cromen-4-onă] este o formă de agliconă izoflavonoidă, derivată din plante, genistină (un glicozid) (Nayeem et. al., 2019 [ 16 ]; Sansai și colab., 2020 [ 20 ]). Genisteina se găsește în principal în plantele leguminoase, în special în soia împreună cu alte izoflavone importante, daidzeina și gliciteina (Kalaiselvan și colab., 2010 [ 12 ]). Alte surse de genisteină includ fasole, naut, legume, fructe, nuci, alimente pe bază de soia și suplimente de genisteină. De asemenea, s-a raportat că boabele de soia nefermentate conțin mai multă genisteină decât cele fermentate (Kuligowski și colab., 2017 [ 13 ]; Li și Zhang, 2017 [ 14]]). În plus, genisteina poate fi sintetizată prin introducerea genei IFS (gena izoflavonei sintază) în celulele de drojdie și liniile de orez, ceea ce duce la un conținut crescut de genisteină în orez (până la 30 de ori) (Spagnuolo și colab., 2015 [ 23 ]) .

1 Departamentul de patologie și medicină de laborator, Universitatea Emory, Atlanta, GA, SUA2 Departamentul de Urologie, Institutul de Cercetare a Cancerului, Spitalul Universitar Oslo3 Departamentul de Medicină Clinică, Universitatea din Oslo4 Departamentul de Patologie, Spitalul Universitar Oslo, Oslo, Norvegia5 Departamentul de hematologie și oncologie medicală6 Winship Cancer Institute, Emory University, Atlanta, GA, SUACorespondență cu: Dr. Carlos S. Moreno, Departamentul de patologie și medicină de laborator, Winship Cancer Institute, Emory University, Whitehead Research Building, camera 105J, 615 Michael Street, Atlanta, GA 30322, SUA, E-mail: ude.yrome@oneromcAdresa actuală: Departamentul de Medicină de Mediu și de Muncă, Spitalul Universitar Oslo, Oslo, NorvegiaAcest articol a fost citat de alte articole din PMC.Mergi la:

Abstract

Studiile epidemiologice au arătat că compușii dietetici au efecte semnificative asupra carcinogenezei prostatei. Dintre agenții dietetici, genisteina, izoflavona majoră din soia, prezintă un interes deosebit, deoarece consumul ridicat de produse din soia a fost asociat cu o incidență scăzută a cancerului de prostată, sugerând un rol preventiv al genisteinei în cancerul de prostată. În ciuda numeroaselor studii pentru a înțelege efectele genisteinei asupra cancerului de prostată, mecanismele de acțiune nu au fost pe deplin elucidate. Am investigat diferențele dintre nivelurile de metilare și expresie genică ale specimenelor de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie folosind Illumina HumanMethylation450 și Illumina HumanHT-12 v4 Expression BeadChip Microarrays Prezentul studiu a fost un studiu randomizat, controlat cu placebo,studiu clinic dublu-orb pe pacienți norvegieni care au primit zilnic 30 mg genisteină sau capsule placebo timp de 3-6 săptămâni înainte de prostatectomie. Modificările exprimării genei au fost validate prin PCR cantitativă (qPCR). Metilarea genomului întreg și profilarea expresiei au identificat site-uri metilate diferențial și au exprimat gene între grupurile placebo și genisteină. Genele reglementate diferențial au fost implicate în procesele de dezvoltare, markerii celulelor stem, proliferarea și reglarea transcripțională. Analiza îmbogățirii a sugerat reducerea generală a activității MYC și creșterea activității PTEN la pacienții tratați cu genisteină. Aceste descoperiri evidențiază efectele genisteinei asupra modificărilor globale în expresia genelor în cancerul de prostată și efectele sale asupra căilor moleculare implicate în tumorigeneză de prostată.Cuvinte cheie: genisteină, cancer de prostată, metilare ADN, expresie geneticăMergi la:

Introducere

Cancerul de prostată este cea mai frecvent diagnosticată afecțiune malignă și a doua cauză principală de deces prin cancer în rândul bărbaților din Statele Unite. Se estimează că aproximativ 180.890 de cazuri noi de cancer de prostată și 26.120 de decese cauzate de cancer de prostată au avut loc în SUA în 2016 ( 1 ). Factorii de risc comuni pentru cancerul de prostată sunt vârsta, rasa / etnia, geografia, istoricul familial și stilul de viață ( 2 ). În funcție de gravitatea bolii, opțiunile actuale de tratament pentru cancerul de prostată includ terapii unice sau o combinație de terapii, cum ar fi supravegherea activă, chirurgia, radioterapia, chimioterapia, terapia hormonală sau vaccinurile ( 3). Deși aceste intervenții au îmbunătățit semnificativ calitatea vieții pacienților și ratele globale de supraviețuire, tratamentul eficient al cancerului de prostată este încă limitat datorită provocărilor majore, cum ar fi eterogenitatea genetică, recurența tumorii (~ 30% din cazuri) și rezistența la medicamente chimioterapeutice convenționale ( 4 – 6 ). Prin urmare, este crucial să se dezvolte noi strategii preventive și terapeutice care au potențialul de a îmbunătăți rezultatele pentru pacienții cu cancer de prostată.

Studiile epidemiologice au arătat că există o diferență semnificativă în ratele de incidență și mortalitate ale cancerului de prostată între diferite țări, cu cele mai ridicate rate în SUA și țările europene și cele mai mici rate în țările asiatice, cum ar fi Japonia și China ( 7 , 8 ). Această variabilitate largă a ratelor de cancer de prostată între țări sugerează că mai mulți factori, inclusiv diferențele genetice, epigenetice și de mediu, joacă un rol cheie în etiologia bolii. În special, s-a demonstrat că imigranții asiatici din SUA au o incidență crescută a cancerului de prostată în comparație cu acei indivizi cu același background genetic care trăiesc în Asia, indicând faptul că factorii de mediu, în special dieta, sunt factorii determinanți majori ai incidenței cancerului de prostată (9 ). Una dintre diferențele dietetice remarcabile dintre țările asiatice și cele occidentale este cantitatea de consum de alimente pe bază de soia. Populațiile asiatice consumă cantități mari de alimente din soia, care sunt bogate în izoflavone (~ 2 g de izoflavone pe kg de soia proaspătă) ( 10 ). S-a demonstrat că concentrațiile plasmatice și de lichide prostatice ale izoflavonelor la bărbații asiatici sunt de 10 până la 100 de ori mai mari decât cele la bărbații occidentali, cu niveluri deosebit de ridicate ale genisteinei de izoflavonă ( 11 , 12 ). Un număr tot mai mare de studii bazate pe populație a demonstrat că aportul ridicat de izoflavone din soia este asociat cu un risc redus cu 25-30% de cancer de prostată ( 13 , 14 ).

Fiind principala izoflavonă biologic activă în dieta soia, genisteina a fost investigată pe larg pentru potențialul său chimiopreventiv în diferite tipuri de cancer, inclusiv în cancerul de prostată. Aportul zilnic mediu de genisteină la populațiile asiatice sa dovedit a fi de 20-80 mg, în timp ce este de 1-3 mg în SUA, susținând efectele protectoare ale genisteinei împotriva cancerului de prostată la bărbații asiatici ( 15 ). Genistein atinge concentrațiile plasmatice de 1-5 u , M 6-8 ore după ingestia de dieta bogata soia ( 11 , 16 ). Timpul de înjumătățire plasmatică al genisteinei a fost raportat la 7,9 ore la adulți. În plus, concentrațiile de izoflavone totale din soia din țesutul prostatei s-au arătat de ~ 6 ori mai mari decât nivelurile serice de izoflavone ( 17). Studiile de siguranță și farmacocinetice ale izoflavonelor din soia au demonstrat că s-a observat o toxicitate clinică minimă la subiecții sănătoși administrați cu izoflavone din soia purificate la doze care depășesc aporturile alimentare normale ( 18 ).

Datorită similarității sale structurale cu hormonul steroid 17β-estradiol, se leaga genisteina la receptorii de estrogen, ER-α și ER-β, cu o afinitate mai mare pentru ER-β, și acționează ca un modulator naturale selectiv al receptorului de estrogen ( 16 , 19 , 20 ). Genisteina își exercită efectele inhibitoare asupra celulelor canceroase de prostată prin reglarea în sus a expresiei ER-β, care are roluri anti-proliferative și pro-apoptotice în celulele prostatei ( 21 , 22 ). În plus față de activitățile sale estrogenice, genisteina reglează căile mediate de receptorul androgen (AR) în cancerul de prostată ( 23 , 24 ). De remarcat, s-a arătat că efectul inhibitor al genisteinei asupra expresiei AR este mediat și de ER-β (25 ). Mai multe alte mecanisme moleculare care stau la baza efectelor preventive ale genisteinei asupra cancerului de prostată includ inhibarea proliferării celulare prin inducerea opririi ciclului celular G1 și / sau G2 / M ( 26 – 28 ), angiogeneză ( 29 , 30 ) și metastază ( 31 – 33 ) și inducerea apoptozei ( 34 , 35 ). Genisteina își exercită efectele pleiotrope în contextul cancerului de prostată prin modularea mai multor căi de transducție a semnalului celular, cum ar fi IGF-1 ( 36 ), TGF-β ( 37 ), Wnt / β-catenină ( 36 ), NF-κB ( 38 ) , AKT și MAPK ( 39) semnalizare. Această modulare ar putea fi legată direct de receptorii nucleari sau modificarea stării de fosforilare a proteinelor de transducție a semnalului. În plus, genisteina inhibă activitățile tirozin kinazei ( 40 ) și prezintă proprietăți antioxidante ( 41 , 42 ) în celulele prostatei. Swami și colab. ( 43 ) au demonstrat că genisteina reduce progresia cancerului de prostată prin inhibarea sintezei și activității prostaglandinelor. De asemenea, sa raportat că genisteina are posibile efecte asupra deteriorării și reparării ADN-ului în celulele canceroase de prostată ( 42 ). Mai mult, genisteina inhibă metilarea ADN-ului ( 44 – 48 ) și modificările histonice ( 47 ,48 ) și reglează miARN ( 49 – 52 ) în cancerul de prostată. Este de interes că genisteina sa dovedit a spori eficacitatea radioterapiei și a chimioterapiei ( 53 , 54 ).

Deși au fost efectuate numeroase studii in vitro și in vivo pentru a înțelege efectele protectoare ale genisteinei împotriva cancerului de prostată, demonstrate prin studii epidemiologice, mecanismele moleculare care guvernează modul în care genisteina afectează patogeneza cancerului de prostată rămân în continuare evazive. Este de remarcat faptul că o provocare majoră este variabilitatea largă a efectelor genisteinei în funcție de doză, de forma de administrare sau de momentul și durata expunerii ( 55). În ciuda bogăției de studii efectuate pe linii celulare umane și modele animale, doar câteva studii clinice prospective randomizate au fost efectuate pentru a examina efectele moleculare ale genisteinei asupra cancerului de prostată. În studiul de față, după cunoștințele noastre pentru prima dată, am investigat efectele intervenției genisteinei asupra metilării globale și a modelelor de expresie genică la pacienții cu cancer de prostată localizat și am identificat ținte noi care sunt modulate diferențial prin suplimentarea cu genisteină, oferind alte perspective mecaniciste asupra efectelor genisteinei asupra carcinogenezei prostatei.Mergi la:

Materiale și metode

Subiecte

Probele de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie ( 56 ) au fost analizate pentru modificări globale în metilarea ADN și expresia genelor. Participanții au fost recrutați din ambulatoriul de la Departamentul de Urologie, Spitalul Universitar Oslo, Oslo, Norvegia în perioada aprilie 2007 – august 2008. Studiul a fost aprobat de Agenția Norvegiană pentru Medicamente, Comitetul Regional de Etică, Ombudsmanul pentru confidențialitate și Prostate Biobank la Spitalul Universitar Oslo, Aker.

Profilarea metilării la nivelul genomului

ADN-ul total a fost izolat din țesuturile de prostată înghețate folosind kitul DNeasy Blood and Tissue (Qiagen, Valencia, CA, SUA) conform instrucțiunilor producătorului. ADN-ul a fost supus nucleului de genomică integrată Emory pentru analiza metilării ADN-ului folosind Illumina HumanMethylation450 BeadChip Microarrays. Datele de metilare sunt disponibile pe GEO (numărul de acces GSE84749 ).

Profilarea expresiei la nivel de genom

ARN-ul total a fost extras din țesuturile de prostată înghețate folosind kitul de izolare miVNA mirVana (Life Technologies, Grand Island, NY, SUA), urmat de curățarea ARN folosind kitul RNeasy Mini (Qiagen). ARN-ul total a fost trimis la nucleul de genomică integrat Emory pentru analiza expresiei genice utilizând Illumina HumanHT-12 v4 Expression BeadChip Microarray. Datele despre microarray sunt disponibile pe GEO (numărul de acces GSE84748 ).

Analiza PCR cantitativă (qPCR)

ARN a fost transcris invers în ADNc folosind kitul de sinteză ADNc iScript (Bio-Rad Laboratories, Hercules, CA, SUA). Grundurile au fost proiectate folosind instrumentul Primer3. Secvențele primerilor sunt enumerate înTabelul I. qPCR a fost efectuat folosind iQ SYBR-Green Supermix (Bio-Rad Laboratories) pe un iCycler Bio-Rad conform protocoalelor producătorului. Gena β-actină umană, care s-a dovedit a fi o genă validă de referință pentru normalizarea qPCR în probe de țesut uman de cancer de prostată, a fost utilizată ca control intern în prezentul studiu ( 57 ). Ca calibrator s-a folosit o probă normală de țesut prostatic. Modificările relative ale datelor de exprimare a genei au fost analizate prin metoda 2 −ΔΔCT . S-au efectuat triplicate pentru fiecare probă. Datele sunt prezentate ca medie ± deviație standard.

Tabelul I

Secvențe ale primerilor utilizați în analiza PCR cantitativă.

Numele primarSecvență primară (5 ′ → 3 ′)
CKS2-FPTTAGTCTCCGGCGAGTTGTTG
CKS2-RPCATAACATGCCGGTACTCGT
JAG1-FPAGTCGTGCATGCTCCAATCG
JAG1-RPCCCCACACACACTTGGCTC
NOTCH3-FPGATGTGGACGAGTGTGCTGG
NOTCH3-RPCAGGCATGGGTTGGGGTC
MMP26-FPGGACTTTGTTGAGGGCTATTTCCA
MMP26-RPGGAGGTGTCGGACCCATCAG
HIF1A-FPCACCACAGGACAGTACAGGAT
HIF1A-RPCGTGCTGAATAATACCACTCACA
CDK6-FPGCTGACCAGCAGTACGAATG
CDK6-RPGCACACATCAAACAACCTGACC
CD24-FPCGCGGACTTTTCTTTTGGGG
CD24-RPACTGGAATAAATCTGCGTGGGT
AMACR-FPCCGTTCTGTGCTATGGTCCTG
AMACR-RPAGCCTTGGATTTTCCCGCTG
MYC-FPCCTACCCTCTCAACGACAGC
MYC-RPTTGTTCCTCCTCAGAGTCGC
SPP1-FPCAAACGCCGACCAAGGAAAA
SPP1-RPGGCCACAGCATCTGGGTATT
NEU1-FPCGCAGCTATGATGCCTGTGA
NEU1-RPGGTCAGGTTCACTCGGAACTC
ADCY4-FPCCTGGGACCAGGTGTCCTAT
ADCY4-RPCAAGATACAGCCCGAGGACC
β-actină-FPCACAGAGCCTCGCCTTTGCC
β-actină-RPTGACCCATGCCCACCATCAC

Analiza qPCR.

Analiza datelor

Analiza expresiei genice a fost efectuată utilizând modulul GenePattern ComparativeMarkerSelection ( 58 ) comparând tumorile tratate cu genisteină cu tumorile tratate cu placebo. Datele Illumina Microarray au fost filtrate pentru a include gene care au fost detectate (P <0,05) în cel puțin un grup experimental pentru a rezulta într-un set de date de 15918 gene pentru analiză. Modulul de selecție a markerului comparativ al GenePattern a fost utilizat pentru a calcula testele t-Student ale celor două fețe între grupuri cu 10.000 permutări pentru a calcula ratele de descoperire false. Sămânța aleatorie utilizată a fost 779948241. Clusterul ierarhic a fost realizat utilizând software-ul Cluster ( 59 ) și Java TreeView ( 60 ). Analiza microarray de metilare a fost efectuată în R utilizând modulul CpGassoc în Bioconductor ( 61). Datele de la sondele de 450K au fost filtrate la cele în care valoarea β maximă – minimă a fost> 0,2 pentru a rezulta sonde de 160K pentru analiza diferențială a metilării. CpGassoc a fost utilizat pentru a identifica 162 de sonde semnificative care au fost metilate diferențial. Trei sonde au fost metilate diferențial între probele tumorale tratate cu genisteină și probele tumorale tratate cu placebo, trei sonde au fost semnificative între probele tumorale tratate cu genisteină și probele normale și 156 au fost semnificativ diferite între probele tumorale tratate cu placebo și probele normale.

analize statistice

Testul U Mann-Whitney (cu două cozi) a fost utilizat pentru a determina diferențe semnificative între două grupuri de date. P <0,05 a fost considerat semnificativ statistic.Mergi la:

Rezultate

Caracteristici clinicopatologice

Am analizat probe de țesut prostatic dintr-un studiu anterior, care a fost un studiu clinic randomizat, controlat placebo, dublu-orb, de fază 2, pe pacienți norvegieni cu cancer de prostată localizat care au primit 30 mg genisteină sintetică sau capsule placebo zilnic timp de 3-6 săptămâni înainte de radical prostatectomie ( 56 ). Caracteristicile clinice și patologice ale cazurilor au fost descrise anterior ( 56 ). Disponibilitatea țesutului înghețat a limitat dimensiunea eșantionului în acest studiu și am investigat metilarea ADN și nivelurile de expresie genică a probelor de tumori de prostată de la 10 pacienți care au primit genisteină și 10 pacienți care au primit placebo. Au fost de asemenea analizate patru probe adiacente de țesut normal de prostată. Datele clinice pentru cei 20 de pacienți analizați aici sunt furnizate înTabelul II. Nu au existat diferențe semnificative statistic în ceea ce privește vârsta, nivelurile PSA serice și scorul Gleason între cele două grupuri de tratament.

Tabelul II

Date clinice pentru cei 20 de pacienți analizați în prezentul studiu.

TratamentID-ul pacientuluiGleasonSuma GleasonEtapăVârstăPSA
Genisteină (n = 10)13 + 4726812.0
73 + 4726810.9
83 + 362596.2
103 + 473a615.1
133 + 362587.6
144 + 373a648.5
174 + 482616.1
183 + 362576.0
193 + 362637.8
203 + 472687.9
Media (SD)6,7 (0,7)62,7 (4,2)7,8 (2,2)
Placebo (n = 10)243 + 362616.4
253 + 362574.2
263 + 473a689.9
274 + 482699.2
304 + 372555.1
333 + 362566.4
343 + 362637.6
353 + 473a605.7
383 + 472629.9
393 + 362667.0
Media (SD)6,6 (0,7)61,7 (4,9)7.1 (2.0)

Metilare diferențială în țesutul tratat cu genisteină în comparație cu țesutul tratat cu placebo

Profilurile de metilare a ADN-ului la nivelul genomului unui total de 24 de probe de prostată din țesuturi tumorale sau normale au fost generate folosind trusa Illumina HumanMethylation450 BeadChip. Starea de metilare a fiecărei probe a fost analizată pentru 485.577 de situri, acoperind 21.231 de gene. Am comparat profilurile de metilare ale probelor de tumori tratate cu genisteină cu cazurile tratate cu placebo. În general, modificările de metilare au fost modeste și nu a existat o genă metilată semnificativ diferențiat după corecție pentru testarea ipotezelor multiple. Cu toate acestea, valorile P necorectate au indicat faptul că RBM28 și CYTSBgenele au fost demetilate în probe tumorale tratate cu genisteină comparativ cu probele tratate cu placebo. Lipsa semnificației statistice s-a datorat probabil numărului mic de probe analizate în acest studiu. Am observat 156 de sonde cu metilare crescută semnificativ în țesuturile tumorale tratate cu placebo față de țesuturile normale care nu au fost semnificative între țesuturile tumorale tratate cu genisteină și țesuturile normale, sugerând că genisteina ar putea avea unele efecte de demetilare (disponibile la cerere). Aceste 156 de sonde corespundeau a cel puțin 92 de gene separate, inclusiv ADCY4 , ALOX12 , HAAO , LRRC4 , NEU1 , RAPGEFL1 și WNT7B (Tabelul III).

Tabelul III

Lista a 156 de sonde metilate diferențial (92 de gene).

ID țintăNumele geneiValoarea P (GT vs. PT)Valoarea P (GT vs. N)Valoarea P (PT vs. N)
cg00353923LRRC4; SND1nsns0,000214451
cg00420348EFCAB4Ansns0,000247793
cg00459232CD9nsns0,000270319
cg00494665nsns0,000274219
cg00506168PDXKnsns0,000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0,000393857
cg01228355CORINnsns0,000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0,000942104
cg01561916HAAOnsns0,00015216
cg01684881FZD2nsns0,000472597
cg01856645DMGDH; BHMT2nsns0,000876054
cg02072400nsns3.73E-05
cg02131967ASnsns0,000468338
cg02215070AKR1B1nsns0,000607743
cg02493798ALOX12nsns0,000106934
cg02534363NBEAL2nsns0,000263128
cg02659920EPS8L2nsns0,000563556
cg02665650ANKS1Ansns0,000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0,000993538
cg03119308RBM280,000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0,000320776
cg03452174RAB34nsns0,000820466
cg03456213C9orf3nsns0,000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0,000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

Deschideți într-o fereastră separată

GT, tumoare tratată cu genisteină; PT, tumoare tratată cu placebo; N, normal; NS, nu semnificativ.

Profilul expresiei genei se modifică după tratamentul cu genisteină

Pentru a identifica efectele moleculare ale genisteinei asupra nivelurilor de ARNm în cancerul de prostată, am comparat profilurile de expresie genică ale tumorilor tratate cu genisteină cu probele tratate cu placebo. Din nou, nu au existat probe exprimate diferențial care să rămână semnificative statistic după corecție pentru testarea ipotezelor multiple. Cu toate acestea, au existat 628 de sonde care au atins valori P semnificative nominal (disponibile la cerere). Gruparea ierarhică a acestui set de date a arătat o segregare puternică a pacienților cu și fără tratament cu genisteină (Fig. 1). Genele cu valori P semnificative nominal au inclus gene NOTCH3 , JAG1 , CKS2 , HIF1A , CDK6 , MYC , CD24 , AMACR , MMP26 și SPP1 (Tabelul IV). NEU1 și ADCY4 nu au atins semnificație nominală , dar a avut o tendință spre semnificație, și integrarea datelor de metilare cu nivelurile de expresie expresia genelor pereche de profile de date indicate au scăzut stare de metilare și crescute de ADCY4 si NEU1 gene in cazurile tratate genisteina.figura 1

Profilarea expresiei întregului genom al probelor de tumori tratate cu placebo sau genisteină. Gruparea ierarhică a modificărilor în expresia genelor pentru acele gene cu un P <0,05 nominal între probele genistein-tumorale și probele placebo-tumorale.

Tabelul IV

Gene cu expresie diferențială a genelor analizate prin qPCR.

Simbol genicExpresia genelor se schimbă
MicroarrayqPCR
CKS2−2,02−2,50
NOTCH31,722.08
HIF1A−1,63−1,80
CDK6−2,87−1,57
JAG11,916.00
NEU1 a1,771,50
ADCY4 a1,671,60
C-UL MEU−1,57−2.30
CD24−2,02−2,64
AMACR−1,95−2.14
MMPP26−2,78−2,84
SPP1−2,36−3.09

Modificările de pliuri sunt genisteină-tumoră / placebo-tumorăo stare de metilare a ADN-ului este corelată cu expresia genelor în NEU1 și ADCY4. qPCR, PCR cantitativă.

Validarea datelor microarray

Am investigat nivelurile de expresie a 12 gene selectate (Tabelul IV) în toate cele 24 de eșantioane analizate prin microarrays folosind qPCR și au observat că datele microarray au fost corelate cu rezultatele qPCR (Fig. 2). Creșterea nivelurilor de expresie qPCR ale genelor NOTCH3 și JAG1 în tumorile tratate cu genisteină comparativ cu tumorile tratate cu placebo au fost semnificative statistic prin testul U Mann-Whitney.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este IJO-51-01-0223-g01.jpg

Deschideți într-o fereastră separatăFigura 2

Analiza qPCR a nivelurilor de expresie a 12 gene din grupurile placebo și genisteină. Modificările de expresie ale genelor selectate din datele microarray au fost validate folosind qPCR. Datele sunt prezentate ca modificări ale pliurilor în raport cu probele de control. qPCR, PCR cantitativă.

Analiza îmbogățirii

Am efectuat analize de îmbogățire a genei pe cele 628 de sonde semnificative nominal care au fost exprimate diferențial între probele de genisteină și placebo (Tabelul V) folosind Analiza căii de ingeniozitate ( 62 ) și baza de cunoștințe DAVID ( 63). Valoarea P indică distribuția hipergeometrică Valorile P ale suprapunerii pentru seturile de gene și categoriile funcționale. FDR indică o rată de descoperire falsă, corectate valorile P ale suprapunerii. Scorul z de activare este o indicație a consistenței membrilor în sus și în jos reglementați ai unui set de gene, cum ar fi o funcție biologică (tabelul de sus) sau țintele unui regulator în amonte (tabelul de mijloc). Scorurile de activare z> 2 sau <−2 sunt semnificative statistic pentru consistența activării sau inhibării. Moleculele indică numărul de molecule din setul de 628 de sonde analizate care se suprapun cu o anumită categorie. Rețeaua mecanistică indică numărul total de gene țintă ale unui regulator în amonte, iar numărul de gene suprapuse este indicat între paranteze. Am observat îmbogățirea termenilor asociați cu angiogeneza, apoptoza, tranziția epitelială la mezenchimală,progresia tumorii și legarea PDGF. Analiza potențialelor regulatoare din amonte prin analiza IPA a sugerat că PTEN și PDGF au fost activate, în timp ce MYC, β-estradiol, receptorul glucocorticoid NR3C1 și interferon-γ au fost reprimate ca răspuns la tratamentul cu genisteină.

Tabelul V

Analiza îmbogățirii a 628 de sonde semnificative nominal exprimate diferențial între grupurile de genisteină și placebo.

AnalizăValoarea PActivare scor zNumărul de moleculeFuncţie
IPA5.92E-080,77318Progresia tumorii
IPA4.88E-071,01355Neoplasm abdominal
IPA1.09E-061.92728Diferențierea liniilor celulare tumorale
IPA1.34E-06−1.01719Tranziția epitelial-mezenchimală
IPA7.46E-062.41222Tumora neuroendocrină
IPA7.98E-052.05428Necroza tumorii
AnalizăValoarea P a suprapuneriiActivare scor zRețea mecanicistăRegulator în amonte
IPA3.85E-08−0,692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0,832144 (13)IFNG
IPA2.17E-061,608141 (16)PTEN
IPA4.59E-06−2.995133 (13)C-UL MEU
AnalizăFDRActivare scor zNumărul de moleculeTermen
DAVID7.90E-04N / A17GO: 0005840 ribozom
DAVID1.19E-02N / A34mitocondrie
DAVID2.00E-02N / A16GO: 0001568 dezvoltarea vaselor de sânge
DAVID1.77E-02N / A10GO: 0019838 legarea factorului de creștere
DAVID3.52E-02N / A7GO: 0008629 inducerea apoptozei prin semnale intracelulare
DAVID3.16E-02N / A4GO: 0048407 legarea factorului de creștere derivat din trombocite

Deschideți într-o fereastră separatăMergi la:

Discuţie

Din câte știm, prezentul studiu este primul care evidențiază efectele genisteinei asupra modificărilor globale ale metilării ADN și ale expresiei genice la pacienți dintr-un studiu clinic de genisteină în cancerul de prostată. Analiza integrativă a metilării genomului întreg și profilarea expresiei au identificat un număr de situri candidate metilate diferențial și au exprimat site-uri între grupurile placebo și genisteină. Cu toate acestea, diferențele dintre grupurile placebo și grupurile cu genisteină nu au fost semnificative statistic după corecție pentru testarea multiplelor ipoteze, posibil datorită numărului mic de cazuri din acest studiu. Deși modificările induse de genisteină nu sunt semnificative, aceste rezultate pot ajuta la elucidarea mecanismelor moleculare care stau la baza activităților genisteinei în cancerul de prostată.Matricile de metilare a ADN-ului la nivel de genom au arătat că un număr de gene, inclusivRBM28 și CYTSB , păreau a fi demetilate în probele tumorale tratate cu genisteină, comparativ cu probele din grupul placebo. Cu toate acestea, nu am observat modificări ale nivelurilor de expresie ale acestor gene. Printre genele exprimate diferențial identificate prin analiza microarray s-au numărat CKS2 , NOTCH3 , HIF1A , CDK6 , JAG1 , NEU1 , ADCY4 , MYC , CD24 , AMACR , MMP26 și SPP1. Datele microarray au fost confirmate prin analiza qPCR a acestor gene. Alte gene cu semnificație nominală prin microarray, dar care nu au fost testate de qPCR au inclus ZNF639 , CRIM1 , PGC și USP54 (disponibil la cerere).

Este interesant de remarcat faptul că statutul de metilare ADN – ul a fost corelat invers cu expresia genelor pentru NEU1 si ADCY4 gene, care a scazut de metilare și expresia crescută a ARNm în grupul genisteina comparativ cu grupul placebo. Descoperirea noastră care arată potențialul genisteinei pentru demetilarea ADN-ului este în concordanță cu datele raportate anterior care sugerează că genisteina acționează ca un inhibitor al DNMT, provocând astfel demetilarea insulelor CpG în promotorii genelor. De exemplu, s-a demonstrat că genisteina reactivează genele supresoare tumorale cu tăcere hipermetilată, inclusiv p16INK4a , receptorul de acid retinoic β ( RARβ ) și O 6-metilguanină metiltransferază ( MGMT), în celulele canceroase de prostată și esofag ( 46 ). Mai mult, genisteina a fost implicată în demetilarea promotorului WNT5a în celulele cancerului de colon ( 64 ). Una dintre genele care s-au dovedit a fi demetilate de genisteină în studiul de față este ADCY4, care este un membru al familiei adenilat ciclaselor, enzimele legate de membrană care catalizează formarea adenozinei monofosfat ciclic mesager secundar (AMPc) ( 65 ). În concordanță cu constatările noastre, s-a demonstrat recent că ADCY4 este un marker de metilare a ADN-ului care reprezintă evenimente epigenetice timpurii în tumorigeneză de prostată, susținând ipoteza noastră că genisteina poate inversa modelul metilării ADN-ului în ADCY4 în cancerul de prostată ( 66).). Cealaltă genă care a fost modulată prin intervenția genisteinei în prezentul studiu a fost NEU1, care este o sialidază lizozomală implicată în catabolismul glicoconjugatului și semnalizarea celulară, inclusiv răspunsurile imune și transducția semnalului mediată de receptorul elastinei ( 67 ). De fapt, NEU1 este esențial pentru desialilarea integrinei β4 și inhibarea FAK, ducând la suprimarea metastazelor hepatice în cancerul de colon ( 68 ). Kato și colab. ( 69 ) au raportat că supraexprimarea NEU1 a dus la suprimarea metastazelor pulmonare în melanom. În plus, suprimarea NEU1 de către miR-125b sa dovedit a promova migrația, invazia și metastaza în cancerele gastrice ( 70). Cu toate acestea, NEU1 poate avea, de asemenea, efecte pro-metastatice în cazurile de cancer pancreatic și ovarian ( 71 ) și, prin urmare, nu este pe deplin clar care ar putea fi impactul general al nivelurilor crescute de NEU1 în cancerul de prostată. Prin urmare, este important să se examineze modificările expresiei NEU1 la nivelul proteinelor și sunt necesare studii moleculare și celulare pentru a evalua consecințele funcționale ale modificărilor induse de reglarea ascendentă a NEU1 în celulele cancerului de prostată.

Dintre genele exprimate diferențial care au fost validate de qPCR, doar expresia mARN-urilor NOTCH3 și JAG1 au fost semnificativ mai mari în grupul cu genisteină comparativ cu grupul placebo de qPCR. Pe baza constatărilor noastre la nivel de ARNm, fără nici o confirmare la nivel proteic sau funcțional, ar fi speculativ să sugerăm că semnalizarea Notch poate juca un rol în mecanismul de acțiune al genisteinei asupra cancerului de prostată. NOTCH3 este important pentru EMT indus de TGFβ în cancerul de prostată ( 72 ) și este indus de hipoxie și contribuie la progresia cancerului de prostată ( 73 ). Ligandul Notch JAG1 este, de asemenea, asociat cu cancer de prostată mai agresiv ( 74 , 75 ), EMT și angiogeneză (76 ). Cu toate acestea, un rol de supresie tumorală a semnalizării Notch a fost raportat și în diferențierea neuroendocrină indusă de hipoxie a celulelor canceroase de prostată, precum și în alte tipuri de cancer, inclusiv cancerul vezicii urinare, tumorile maligne hematologice, gliomul, carcinomul tiroidian și cancerul pulmonar ( 77 – 82 ), indicând posibilitatea ca expresia crescută a NOTCH3 / JAG1 prin tratamentul cu genisteină să îmbunătățească rezultatele prin funcția sa de supresoare tumorală. Datele noastre sugerează că studii suplimentare pentru a delimita efectul genisteinei asupra căii de semnalizare Notch în cancerul de prostată pot fi justificate.

Analizele de îmbogățire a modificărilor ARNm induse de genisteină au indicat faptul că modificările subtile ale expresiei genice observate între probele de genisteină și placebo sunt în concordanță cu multe efecte raportate anterior ale genisteinei pe căile tumorale critice, inclusiv PTEN, PDGF, MYC, β-estradiol, receptor glucocorticoid și interferon- y ( 41 , 83 – 89 ). Genisteina pare să promoveze activitatea PTEN și inhibă activitatea MYC, în concordanță cu utilitatea sa potențială în îmbunătățirea rezultatelor în cancerul de prostată.

Pe scurt, rezultatele noastre indică faptul că intervenția genisteinei induce modularea mai multor gene, inclusiv NOTCH3 , JAG1 , ADCY4 și NEU1, sugerând că aceste gene pot avea potențialul de a fi ținte moleculare noi ale genisteinei în cancerul de prostată. Aceste gene sunt implicate în multe procese biologice critice, inclusiv ciclul celular, angiogeneza, răspunsul imun celular și transducția semnalului intracelular, oferind o perspectivă suplimentară asupra multiplelor căi moleculare implicate în tumorigeneză de prostată. Cu toate acestea, sunt necesare studii mecaniciste suplimentare pentru a investiga efectele genisteinei asupra reglării expresiei acestor gene la nivelul proteinelor și funcțiilor celulare. Aceste descoperiri pot contribui apoi la proiectarea de noi strategii pentru prevenirea și tratamentul cancerului de prostată. O avertisment al studiilor de profilare a expresiei genice este incapacitatea identificării mecanismelor de acțiune care sunt modulate la nivel post-transcripțional,sugerând posibilitatea ca genisteina să modifice procese celulare suplimentare. Un alt punct care trebuie făcut este momentul și durata expunerii la genisteină. Studiile de control al cazurilor au demonstrat că consumul ridicat de soia la începutul vieții (în timpul copilăriei și / sau adolescenței) este asociat cu o reducere de 25-60% a riscului de cancer mamar (90 , 91 ). În mod similar, aportul ridicat de soia la pubertate, perioada în care prostata suferă o creștere indusă de androgen, ar putea fi mai eficientă în prevenirea cancerului de prostată. O limitare a prezentului studiu este numărul mic de probe de pacienți. Alte studii clinice controlate randomizate de mari dimensiuni ar oferi rezultate mai definitive ale efectelor genisteinei asupra țesuturilor prostatei pacientului.Mergi la:

Mulțumiri

Prezentul studiu a fost susținut parțial de nucleul de genomică integrat Emory (EIGC), care este subvenționat de Grantul de asistență al Centrului de Cancer NCI P30CA138292 și de Școala de Medicină a Universității Emory și este una dintre facilitățile de bază integrate Emory. Acesta a fost susținut în continuare de un Premiu de Cercetare a Soia din cadrul Programului de Cercetare în Sănătate al Soia al United Soybean Board.Mergi la:

Referințe

1. Siegel RL, Miller KD, Jemal A. Statistici despre cancer, 2016. CA Cancer J Clin. 2016; 66 : 7–30. doi: 10.3322 / caac.21332. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Fapte și cifre despre cancerul de prostată 2016. American Cancer Society Inc; Atlanta, GA: 2016. [ Google Scholar ]3. Dunn MW, Kazer MW. Prezentare generală a cancerului de prostată. Semin Oncol Nurs. 2011; 27 : 241-250. doi: 10.1016 / j.soncn.2011.07.002. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Sartor AO. Progresia cancerului de prostată metastatic rezistent la castrate: impactul intervenției terapeutice în spațiul post-docetaxel. J Hematol Oncol. 2011; 4 : 18. doi: 10.1186 / 1756-8722-4-18. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W, III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, și colab. American Cancer Society ghiduri de îngrijire pentru supraviețuirea cancerului de prostată. CA Cancer J Clin. 2014; 64 : 225–249. doi: 10.3322 / caac.21234. [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, și colab. Sarcina de modificare a numărului de copii prezice recăderea cancerului de prostată. Proc Natl Acad Sci SUA. 2014; 111 : 11139–11144. doi: 10.1073 / pnas.1411446111. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Ferlay J, Bray F, Pisani P, Parkin DM. Globocan 2000: Incidența, mortalitatea și prevalența cancerului la nivel mondial. Presa IARC; Lyon: 2001. [ Google Scholar ]8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Statistici globale privind cancerul. CA Cancer J Clin. 2011; 61 : 69–90. doi: 10.3322 / caac.20107. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Kimura T. East întâlnește vestul: Diferențe etnice în epidemiologia cancerului de prostată între asiatici de est și caucazieni. Cancerul Chin J. 2012; 31 : 421-429. doi: 10.5732 / cjc.011.10324. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Reinli K, Block G. Conținutul de fitoestrogen din alimente – un compendiu al valorilor literaturii. Cancerul Nutr. 1996; 26 : 123–148. doi: 10.1080 / 01635589609514470. [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Adlercreutz H, Markkanen H, Watanabe S. Concentrații plasmatice de fitoestrogeni la bărbații japonezi. Lancet. 1993; 342 : 1209–1210. doi: 10.1016 / 0140-6736 (93) 92188-Y. [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S, Griffiths K. Lignans și izoflavonoizi în plasmă și lichid prostatic la bărbați: eșantioane din Portugalia, Hong Kong , și Regatul Unit. Prostata. 1997; 32 : 122–128. doi: 10.1002 / (SICI) 1097-0045 (19970701) 32: 2 <122 :: AID-PROS7> 3.0.CO; 2-O. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hwang YW, Kim SY, Jee SH, Kim YN, Nam CM. Consumul de alimente din soia și riscul de cancer de prostată: o meta-analiză a studiilor observaționale. Cancerul Nutr. 2009; 61 : 598-606. doi: 10.1080 / 01635580902825639. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Van Poppel H, Tombal B. Chimioprevenția cancerului de prostată cu substanțe nutritive și suplimente. Cancer Manag Res. 2011; 3 : 91–100. doi: 10.2147 / CMAR.S18503. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Barnes S, Peterson TG, Coward L. Justificare pentru utilizarea matricelor de soia care conțin genisteină în studiile de chemoprevenție pentru cancerul de sân și de prostată. J Cell Biochem (Suppl) 1995; S22 : 181–187. doi: 10.1002 / jcb.240590823. [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, și colab. Analiza farmacocinetică și farmacodinamică de fază I a izoflavonelor de soia neconjugate administrate persoanelor cu cancer. Biomarkeri de epidemiol pentru cancer Prev. 2003; 12 : 1213–1221. [ PubMed ] [ Google Scholar ]17. CD Gardner, Oelrich B, Liu JP, Feldman D, Franke AA, Brooks JD. Concentrațiile de izoflavonă din soia prostatică depășesc nivelurile serice după suplimentarea dietei. Prostata. 2009; 69 : 719–726. doi: 10.1002 / pros.20922. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA și colab. Siguranța și farmacocinetica izoflavonelor purificate din soia: Administrare cu doză unică la femeile aflate în postmenopauză. Sunt J Clin Nutr. 2002; 76 : 1126–1137. [ PubMed ] [ Google Scholar ]19. Yildiz F. Fitoestrogeni în alimente funcționale. CRC Press; Boca Raton, FL: 2005. https://doi.org/10.1201/9781420027594 . [ CrossRef ] [ Google Scholar ]20. Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M, Masamune Y. Interacțiunea fitoestrogenilor cu receptorii de estrogen alfa și beta. Biol Pharm Bull. 2001; 24 : 351–356. doi: 10.1248 / bpb.24.351. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Chang WY, Prins GS. Receptorul de estrogen-beta: Implicații pentru glanda prostatică. Prostata. 1999; 40 : 115–124. doi: 10.1002 / (SICI) 1097-0045 (19990701) 40: 2 <115 :: AID-PROS7> 3.0.CO; 2-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP, Gupta G. Mecanisme sinergice chimioprotectoare ale fitoestrogenilor dietetici într-o combinație selectă împotriva cancerului de prostată. J Nutr Biochem. 2011; 22 : 723–731. doi: 10.1016 / j.jnutbio.2010.06.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Wang J, Eltoum IE, Lamartiniere CA. Chimioprevenția genisteinei a cancerului de prostată la șoarecii TRAMP. J Cancer. 2007; 6 : 3. doi: 10.1186 / 1477-3163-6-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Davis JN, Kucuk O, Sarkar FH. Expresia antigenului specific prostatei este reglată transcripțional de genisteină în celulele cancerului de prostată. Mol Carcinog. 2002; 34 : 91–101. doi: 10.1002 / mc.10053. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Reglarea receptorilor de androgen prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgen este mediată de receptorul de estrogen beta. Eur Urol. 2004; 45 : 245–251. doi: 10.1016 / j.eururo.2003.09.001. discuție 251. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S, Hursting SD. Doza mică de genisteină induce inhibitori de kinază dependenți de ciclină și oprirea ciclului celular G (1) în celulele cancerului de prostată uman. Mol Carcinog. 2000; 29 : 92–102. doi: 10.1002 / 1098-2744 (200010) 29: 2 <92 :: AID-MC6> 3.0.CO; 2-Q. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Reglarea în sus a p21WAF1 indusă de genisteină, reglarea în jos a ciclinei B și inducerea apoptozei în celulele canceroase de prostată. Cancerul Nutr. 1998; 32 : 123–131. doi: 10.1080 / 01635589809514730. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH, Hillman GG. Genisteina inhibă activarea NF-kappaB indusă de radiații în celulele canceroase de prostată, promovând apoptoza și oprirea ciclului celular G2 / M. Cancer BMC. 2006; 6 : 107. doi: 10.1186 / 1471-2407-6-107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Li Y, Sarkar FH. Reglarea descendentă a invaziei și a genelor legate de angiogeneză identificate prin analiza microarray cDNA a celulelor canceroase de prostată PC3 tratate cu genisteină. Cancer Lett. 2002; 186 : 157–164. doi: 10.1016 / S0304-3835 (02) 00349-X. [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Guo Y, Wang S, Hoot DR, Clinton SK. Suprimarea interacțiunilor autocrine și paracrine mediate de VEGF între celulele cancerului de prostată și celulele endoteliale vasculare de către izoflavonele din soia. J Nutr Biochem. 2007; 18 : 408–417. doi: 10.1016 / j.jnutbio.2006.08.006. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Reglarea expresiei genelor și inhibarea metastazei osoase experimentale a cancerului de prostată de către genisteina dietetică. Neoplazie. 2004; 6 : 354–363. doi: 10.1593 / neo.03478. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY, He DL. Un nou efect anticanceros al genisteinei: inversarea tranziției mezenchimale epiteliale în celulele canceroase de prostată. Acta Pharmacol Sin. 2008; 29 : 1060–1068. doi: 10.1111 / j.1745-7254.2008.00831.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Kumi-Diaka JK, Hassanhi M, Merchant K, Horman V. Influența genisteinei izoflavonei pe expresia matricei metaloproteinazei-2 în celulele cancerului de prostată. J Med Food. 2006; 9 : 491–497. doi: 10.1089 / jmf.2006.9.491. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kazi A, Daniel KG, Smith DM, Kumar NB, Dou QP. Inhibarea activității proteazomului, un mecanism nou asociat cu capacitatea genisteinei de inducere a apoptozei celulare tumorale. Biochem Pharmacol. 2003; 66 : 965–976. doi: 10.1016 / S0006-2952 (03) 00414-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Kumi-Diaka J, Sanderson NA, Sala A. Rolul mediator al proteazei caspase-3 în mecanismul intracelular al apoptozei induse de genisteină în liniile celulare de carcinom prostatic uman, DU145 și LNCaP. Biol Cell. 2000; 92 : 595-604. doi: 10.1016 / S0248-4900 (00) 01109-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Lee J, Ju J, Park S, Hong SJ, Yoon S. Inhibarea semnalizării IGF-1 de către genisteină: Modularea expresiei E-cadherinei și reglarea descendentă a semnalizării β-cateninei în celulele cu cancer de prostată PC-3 hormon refractare. Cancerul Nutr. 2012; 64 : 153–162. doi: 10.1080 / 01635581.2012.630161. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Xu L, Bergan RC. Genisteina inhibă activarea matricei metaloproteinazei tip 2 și invazia celulelor cancerului de prostată prin blocarea factorului de creștere transformant activarea mediată de beta a căii proteinei kinazei 2-27-kDa proteinei șocului termic activat prin mitogen-activat kinază 2-27-kDa. Mol Pharmacol. 2006; 70 : 869–877. doi: 10.1124 / mol.106.023861. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Davis JN, Kucuk O, Sarkar FH. Genisteina inhibă activarea NF-kappaB în celulele canceroase de prostată. Cancerul Nutr. 1999; 35 : 167–174. doi: 10.1207 / S15327914NC352_11. [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Li Y, Sarkar FH. Inhibarea activării factorului nuclear kappaB în celulele PC3 de către genisteină este mediată prin calea de semnalizare Akt. Clin Cancer Res. 2002; 8 : 2369–2377. [ PubMed ] [ Google Scholar ]40. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y. Genistein, un inhibitor specific al protein kinazelor specifice tirozinei. J Biol Chem. 1987; 262 : 5592–5595. [ PubMed ] [ Google Scholar ]41. Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS, Ha J. Efectele antioxidante ale genisteinei sunt asociate cu activarea proteinei kinazei activate de AMP și inducerea PTEN în celulele canceroase de prostată . J Med Food. 2010; 13 : 815–820. doi: 10.1089 / jmf.2009.1359. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Raschke M, Rowland IR, Magee PJ, Pool-Zobel BL. Genisteina protejează celulele prostatei împotriva deteriorării ADN-ului induse de peroxidul de hidrogen și induce expresia genelor implicate în apărarea împotriva stresului oxidativ. Carcinogeneză. 2006; 27 : 2322–2330. doi: 10.1093 / carcin / bgl082. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM, Feldman D. Inhibarea sintezei și acțiunilor prostaglandinelor de către genisteină în celulele canceroase de prostată umane și de izoflavone din soia la pacienții cu cancer de prostată. Int J Rac. 2009; 124 : 2050–2059. doi: 10.1002 / ijc.24161. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L, Bernard-Gallon D. Metilarea ADN și fitoestrogeni din soia: Studiu cantitativ în liniile celulare umane de cancer de prostată DU-145 și PC-3. Epigenomica. 2011; 3 : 795–803. doi: 10.2217 / epi.11.103. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L și colab. Fitoestrogenii din soia modifică metilarea ADN a promotorului GSTP1, RASSF1A, EPH2 și BRCA1 în celulele cancerului de prostată. În Vivo. 2010; 24 : 393–400. [ PubMed ] [ Google Scholar ]46. Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang C. Inversarea hipermetilării și reactivării a 16 gene INK4a , RARbeta și MGMT de către genisteină și alte izoflavone din soia. Clin Cancer Res. 2005; 11 : 7033–7041. doi: 10.1158 / 1078-0432.CCR-05-0406. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV, Dahiya R. cancer de prostată. Cancer. 2010; 116 : 66–76. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M, Dahiya R. Acetilarea histonei mediată de genisteină și demetilarea activează genele supresoare tumorale din celulele cancerului de prostată. Int J Rac. 2008; 123 : 552-560. doi: 10.1002 / ijc.23590. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Li Y, Kong D, Ahmad A, Bao B, Dyson G, Sarkar FH. Dereglarea epigenetică a miR-29a și miR-1256 de către izoflavonă contribuie la inhibarea creșterii și invaziei celulelor canceroase de prostată. Epigenetica. 2012; 7 : 940–949. doi: 10.4161 / epi.21236. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ, Bernard-Gallon DJ. miARN exprimate diferențial în liniile celulare de cancer de prostată după tratamentul cu soia. În Vivo. 2011; 25 : 917–921. [ PubMed ] [ Google Scholar ]51. Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y, Dahiya R. MicroRNAs 221/222 și reglarea mediată de genisteină a genei supresoare tumorale ARHI în cancerul de prostată. Cancer Prev Res (Phila) 2011; 4 : 76–86. doi: 10.1158 / 1940-6207.CAPR-10-0167. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, ​​Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I și colab. Genisteina reglează în sus microRNA-574-3p supresor tumoral în cancerul de prostată. Plus unu. 2013; 8 : e58929. doi: 10.1371 / journal.pone.0058929. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J, Sarkar FH. Genisteina potențează efectul radiației asupra celulelor carcinomului de prostată. Clin Cancer Res. 2001; 7 : 382–390. [ PubMed ] [ Google Scholar ]54. Li Y, Kucuk O, Hussain M, Abrams J, Cher ML, Sarkar FH. Activitățile antitumorale și antimetastatice ale docetaxelului sunt îmbunătățite de genisteină prin reglarea osteoprotegerinei / receptorului activator al factorului nuclear-kappaB (RANK) / ligand RANK / semnalizarea MMP-9 în cancerul de prostată. Cancer Res. 2006; 66 : 4816–4825. doi: 10.1158 / 0008-5472.CAN-05-3752. [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, și colab. Genisteina și cancerul: starea actuală, provocările și direcțiile viitoare. Adv Nutr. 2015; 6 : 408–419. doi: 10.3945 / an.114.008052. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Katoh M. Rețea de WNT și alte cascade de semnalizare de reglementare în celule stem pluripotente și celule stem canceroase. Curr Pharm Biotechnol. 2011; 12 : 160–170. doi: 10.2174 / 138920111794295710. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV. Atât beta-actina, cât și GAPDH sunt gene de referință utile pentru normalizarea RT-PCR cantitativă în probe de țesut uman FFPE de cancer de prostată. Prostata. 2008; 68 : 1555–1560. doi: 10.1002 / pros.20815. [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006; 38 : 500-501. doi: 10.1038 / ng0506-500. [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci SUA. 1998; 95 : 14863–14868. doi: 10.1073 / pnas.95.25.14863. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Saldanha AJ. Java Treeview – vizualizare extensibilă a datelor micro-matrice. Bioinformatică. 2004; 20 : 3246–3248. doi: 10.1093 / bioinformatics / bth349. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Barfield RT, Kilaru V, Smith AK, Conneely KN. CpGassoc: O funcție R pentru analiza datelor despre microarray de metilare a ADN-ului. Bioinformatică. 2012; 28 : 1280–1281. doi: 10.1093 / bioinformatics / bts124. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Qiagen’s Ingenuity Pathway Analysishttp://www.qiagen.com/ingenuity .63. Dennis G, Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Baza de date pentru adnotare, vizualizare și descoperire integrată. Genomul Biol. 2003; 4 : 3. doi: 10.1186 / gb-2003-4-5-p3. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Wang Z, Chen H. Genisteinul crește expresia genelor prin demetilarea promotorului WNT5a în linia celulară de cancer de colon SW1116. Anticancer Res. 2010; 30 : 4537–4545. [ PubMed ] [ Google Scholar ]65. Gao BN, Gilman AG. Clonarea și exprimarea unei adenilil ciclaze distribuite pe scară largă (tip IV). Proc Natl Acad Sci SUA. 1991; 88 : 10178-10182. doi: 10.1073 / pnas.88.22.10178. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG, Freije D. Un panou de markeri de metilare a ADN-ului dezvăluie metilare extinsă în nucleele biopsiei prostatei histologice benigne de la pacienții cu cancer. Biomark Res. 2014; 2 : 25. doi: 10.1186 / s40364-014-0025-9. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Monti E, Bonten E, D’Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R, Tettamanti G. Sialidases in vertebrates: O familie de enzime adaptate pentru mai multe funcții celulare. Adv Carbohydr Chem Biochem. 2010; 64 : 403–479. doi: 10.1016 / S0065-2318 (10) 64007-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H, Miyagi T. Contribuția sialidazei NEU1 la suprimarea metastazelor celulelor canceroase ale colonului uman prin desialilarea integrinei beta4. Oncogene. 2009; 28 : 1218–1229. doi: 10.1038 / onc.2008.471. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S, Miyagi T. Supraexprimarea sialidazei de tip lizozomal conduce la suprimarea metastazelor asociate cu reversia fenotipului malign în celulele melanomului B16 murin. Int J Rac. 2001; 92 : 797–804. doi: 10.1002 / ijc.1268. [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W, Che X. MicroRNA-125b promovează invazia și metastaza cancerului gastric prin vizarea STARD13 și NEU1. Tumora Biol. 2016; 37 : 12141–12151. doi: 10.1007 / s13277-016-5094-y. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Haxho F, Neufeld RJ, Szewczuk MR. Neuraminidază-1: O țintă terapeutică nouă în tumorigeneză în mai multe etape. Oncotarget. 2016; 7 : 40860–40881. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H, Zhou Y. Notch3 este important pentru tranziția epitelial-mezenchimală indusă de TGF-β în osul cancerului pulmonar cu celule mici. metastază prin reglarea ZEB-1. Cancer Gene Ther. 2014; 21 : 364–372. doi: 10.1038 / cgt.2014.39. [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, și colab. Notch3 este activat de hipoxia cronică și contribuie la progresia cancerului de prostată uman. Int J Rac. 2013; 133 : 2577–2586. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, și colab. Corelarea Sprouty1 și Jagged1 cu celule agresive de cancer de prostată cu diferite sensibilități la privarea de androgen. J Cell Biochem. 2014; 115 : 1505-1515. doi: 10.1002 / jcb.24805. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A, Trindade A. Dinamica semnalizării crestăturii în prostata adultă sănătoasă și în dezvoltarea tumorilor de prostată. Prostata. 2016; 76 : 80–96. doi: 10.1002 / pros.23102. [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH, Duarte A. Endotelial Jagged1 promovează creșterea tumorilor solide atât prin funcții pro-angiogenice, cât și prin funcții angiocrine. Oncotarget. 2015; 6 : 24404–24423. doi: 10.18632 / oncotarget.4380. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, și colab. Semnalizarea prin crestături modulează diferențierea neuroendocrină indusă de hipoxie a celulelor cancerului de prostată uman. Mol Cancer Res. 2012; 10 : 230–238. doi: 10.1158 / 1541-7786.MCR-11-0296. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A, Klinakis A. Un nou rol de supresor tumoral pentru calea Notch în cancerul de vezică urinară. Nat Med. 2014; 20 : 1199–1205. doi: 10.1038 / nm.3678. [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Hernandez Tejada FN, Galvez Silva JR, Zweidler-McKay PA. Provocarea vizării crestăturii în tumorile maligne hematologice. Front Pediatr. 2014; 2 : 54. doi: 10.3389 / fped.2014.00054. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, și colab. O funcție de supresie tumorală pentru semnalizarea Notch în subtipurile tumorale din creier anterior. Celula cancerului. 2015; 28 : 730–742. doi: 10.1016 / j.ccell.2015.10.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB și colab. Rolul supresorului tumorii al Notch3 în carcinomul tiroidian medular, dezvăluit prin inducție genetică și farmacologică. Mol Cancer Ther. 2015; 14 : 499–512. doi: 10.1158 / 1535-7163.MCT-14-0073. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Semnalizarea prin crestături induce oprirea ciclului celular în celulele cu cancer pulmonar cu celule mici. Cancer Res. 2001; 61 : 3200–3205. [ PubMed ] [ Google Scholar ]83. Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX, Yang YM. Genisteina induce arestarea G2 / M în celulele canceroase gastrice prin creșterea expresiei PTEN supresoare tumorale. Cancerul Nutr. 2013; 65 : 1034–1041. doi: 10.1080 / 01635581.2013.810290. [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY, Chow NH. Romanul vizează anti-angiogeneza genisteinei pe celulele canceroase umane. Biochem Pharmacol. 2005; 69 : 307-318. doi: 10.1016 / j.bcp.2004.09.025. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Jagadeesh S, Kyo S, Banerjee PP. Genisteina reprimă activitatea telomerazei prin intermediul mecanismelor transcripționale și posttranslaționale în celulele canceroase de prostată umane. Cancer Res. 2006; 66 : 2107-2115. doi: 10.1158 / 0008-5472.CAN-05-2494. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genisteina crește expresia beta a receptorilor de estrogen în cancerul de prostată prin reducerea metilării sale promotor. J Steroid Biochem Mol Biol. 2015; 152 : 62-75. doi: 10.1016 / j.jsbmb.2015.04.018. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Whirledge S, Senbanjo LT, Cidlowski JA. Genisteina perturbă semnalizarea receptorilor glucocorticoizi în celulele Ishikawa endometriale uterine umane. Perspectiva sănătății Environ. 2015; 123 : 80-87. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]88. Bhamre S, Sahoo D, Tibshirani R, Dill DL, Brooks JD. Modificări ale expresiei genetice induse de genisteină în linia celulară de cancer de prostată LNCaP. Open Prostate Cancer J. 2010; 3 : 86–98. doi: 10.2174 / 1876822901003010086. [ CrossRef ] [ Google Scholar ]89. Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A, Vakili MA. Genisteina induce un efect imunomodulator de protecție la un model de șoarece de cancer de col uterin. Iran J Immunol. 2012; 9 : 119–127. [ PubMed ] [ Google Scholar ]90. Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN, Ziegler RG. Consumul de soia în copilărie și riscul de cancer mamar la femeile asiatice americane Biomarkeri de epidemiol pentru cancer Prev. 2009; 18 : 1050–1059. doi: 10.1158 / 1055-9965.EPI-08-0405. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W. Consumul de alimente din soia pentru adolescenți și adulți și riscul de cancer mamar: Rezultate din Studiul de sănătate al femeilor din Shanghai . Sunt J Clin Nutr. 2009; 89 : 1920–1926. doi: 10.3945 / ajcn.2008.27361. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Oncologie sunt furnizate aici prin amabilitatea Spandidos Publications

Relațiile la nivel de țară ale aportului uman de alimente de origine animală și vegetală și băuturi alcoolice cu cancerul și speranta de viață

Abstract

Context: Cantitatea, calitatea și tipul (de exemplu, animale și legume) de alimente umane au fost corelate cu sănătatea umană, deși cu unele rezultate contradictorii sau neutre. Ne-am propus să facem lumină asupra acestei asociații prin utilizarea datelor integrate la nivel de țară.

Metode: Am corelat compozițiile elementare (azot (N) și fosfor (P)) și stoichiometriile (raporturile N: P), trăsăturile moleculare (proteine) și energetice (kilocalorii) ale alimentelor de origine animală (terestră sau acvatică) și vegetale și băuturi alcoolice cu prevalență de cancer și mortalitate și speranță de viață (LE) la naștere la nivel de țară. Am folosit bazele de date oficiale ale Organizației Națiunilor Unite (ONU), Organizației Națiunilor Unite pentru Alimentație și Agricultură (FAO), Organizației pentru Cooperare și Dezvoltare Economică (OECD), Banca Mondială, Organizația Mondială a Sănătății (OMS), SUA Departamentul Agriculturii, Departamentul Sănătății din SUA și Eurobarometru, luând în considerare, de asemenea, alte variabile posibil implicate, cum ar fi venitul, vârsta medie sau indicele de dezvoltare umană din fiecare țară. Rezultate: Aporturile pe cap de locuitor de N, P, proteine ​​și aportul total de la animale terestre și, în special, de alcool au fost asociate semnificativ și pozitiv cu prevalența și mortalitatea din cancerele totale, de colon, plămâni, sân și prostată. În contrast, aporturile ridicate pe cap de locuitor de N, P, N: P vegetale, proteine ​​și aportul total de plante au prezentat relații negative cu prevalența și mortalitatea cancerului. Cu toate acestea, un LE ridicat la naștere, în special în țările subdezvoltate, a fost mai puternic corelat cu un aport mai mare de alimente, independent de originea animală sau vegetală, decât cu alte variabileprecum venitul mai mare sau indicele dezvoltării umane.

Concluzii: Astfel, analizele noastre au dat patru concluzii în general consistente.

În primul rând, aportul excesiv de hrană din animale terestre, în special nivelurile de proteine, N și P, este asociat cu o prevalență mai mare a cancerului, în timp ce aportul echivalent din legume este asociat cu o prevalență mai mică.

În al doilea rând, nu s-a găsit nicio relație consistentă pentru raportul N: P alimentar și prevalența cancerului. În al treilea rând, consumul de băuturi alcoolice se corelează cu prevalența și mortalitatea prin neoplasme maligne.

În al patrulea rând, în țările subdezvoltate, reducerea foametei are un impact pozitiv mai mare asupra sănătății și LE decât o dietă mai sănătoasă.

1. Introducere

Dieta umană, aportul și proporțiile de alimente din diferite surse au fost întotdeauna asociate cu sănătatea umană [ 1 , 2 ]. Mai multe studii epidemiologice din ultimii 20-30 de ani care au urmat cohortelor și au analizat bazele de date ale spitalelor au investigat asocierea sursei de hrană (animale sau legume, tipuri distincte de carne sau metode de gătit) și a constituenților moleculari (de exemplu, proteine ​​și grăsimi) cu riscurile diferitelor tipuri de cancer (de exemplu, [ 3 , 4 , 5]). Rezultatele acestor studii nu sunt întotdeauna consistente, împiedicând concluziile definitive și demonstrând necesitatea unor analize mai profunde a datelor din studii epidemiologice în care relațiile dintre diferite surse de dietă și riscurile de cancer pot fi slabe și / sau confundate cu alte variabile însoțitoare [ 6 , 7 , 8 ]. Cu toate acestea, există un consens cu privire la faptul că mai multe tipuri de alimente sunt asociate cu mai multe tipuri de cancer. Dintre tipurile de alimente, cele mai frecvent citate de organismele internaționale privind evaluarea riscului de cancer, cum ar fi Agenția Internațională pentru Cercetarea Cancerului [ 9 , 10 ], includ băuturi alcoolice, cafea, ceai, carne și carne roșie.

Majoritatea studiilor au detectat legături semnificative între diferite diete și unele tipuri de cancer ([ 3 , 4 , 5 , 11 , 12 ], printre altele). De exemplu, majoritatea studiilor au descoperit o legătură pozitivă între aportul ridicat de hrană din animale și cancer colon și colorectal [ 3 , 4 , 13 ], prostata [ 14 ], vezica urinară [ 11 ], sânul [ 15 , 16 ] și cap / gât [ 12] Riscul asociat pentru carne este chiar mai mare atunci când carnea a fost gătită la temperaturi ridicate, deoarece gătitul cărnii la temperaturi ridicate poate genera agenți cancerigeni, cum ar fi aminele heterociclice14 , 17 ]. Aceste legături ale cancerului cu alimentele de origine animală sunt deosebit de puternice pentru carnea procesată3 ]. Această asociere puternică cu carnea procesată a fost atribuită substanțelor precum nitriții adăugați în timpul procesării industriale17 ]. Unele studii epidemiologice au fost susținute de studii de laborator care leagă efectul agenților cancerigeni de concentrațiile acestora în carnea roșie, cum ar fi formele libere și legate de glicozide ale acidului sialic non-uman și ale acidului N-glicolilneuraminic [ 18].]. Cu toate acestea, unele studii nu au găsit relații între alimentele de origine animală și alte tipuri de cancer, cum ar fi cancerul ovarian (de exemplu, Schulz și colab., 2007 [ 19 ]). Alte rapoarte au descoperit o asociere pozitivă între aportul de ouă și cancerul de sân la femeile cu vârsta peste 55 de ani [ 20 ] și între aportul total de proteine ​​(indiferent de sursă) și riscul de cancer de prostată21 ]. Relația dintre consumul de animale acvatice și riscul de cancer este mai puțin clară. Unele studii au observat un risc redus de reapariție a cancerului de prostată dacă aportul de carne roșie a fost cel puțin parțial substituit cu pește sau păsări de curte4]]. Unele studii, totuși, nu au găsit relații între nivelul de aport al animalelor marine și unele tipuri de cancer, cum ar fi cancerele de cap / gât (de exemplu, Perloy și colab., 2017 [ 12 ]).

Dimpotrivă, un aport mai mare de legume proaspete, neprelucrate a fost frecvent asociat cu riscuri mai scăzute ale unor tipuri de cancer precum cancerul de sân [ 15 , 22 ] și colorectal [ 23 , 24 ] și, în general, de tipul de cancer al tractului digestiv [ 25 ]. Unele studii in vitro au constatat că unii compuși din unele legume, cum ar fi izotiocianați (sulforafan, glucorafanină) și flavonoide (antocianidine, flavone, flavone) protejează împotriva riscului de carcinogeneză [ 23 , 26 , 27 ], în concordanță cu aceste studii.

O asociere pozitivă între consumul de băuturi alcoolice și riscul anumitor tipuri de cancer a fost, de asemenea, stabilită pe scară largă 28 , 29 ]. O analiză a meta-analizei rapoartelor epidemiologice publicate în literatura științifică a arătat că, consumul moderat (până la două băuturi standard pe zi) de băuturi alcoolice crește riscul de cancer de cavitate bucală, esofag, stomac, colon, ficat, rect, laringe, pancreas, sân , și neoplasmele maligne ale ovarului 30 ], în timp ce consumul moderat până la mare de băuturi alcoolice (mai mult de patru băuturi standard pe zi) a fost asociat cu riscul de ameliorare a cancerelor de prostată și pancreas 30 ]. Mai multe studii posterioare au furnizat în mod constant rezultate similare asociate cu cavitatea bucală [31 ], cancer pulmonar [ 24 ], ficat [ 32 , 33 ], esofag [ 14 , 32 ], colorectal [ 14 ], sân [ 14 , 34 , 35 ] sau laringe [ 31 , 36 ]. Cu toate acestea, câteva studii nu au găsit relații între anumite tipuri de cancer și consumul de alcool, cum ar fi Webb și colab., (2004) [ 37] privind cancerul ovarian și relațiile cu consumul de alcool.

Analizând relațiile compoziției elementare a alimentelor, de exemplu, conținutul său de azot (N) și fosfor (P) și raporturile acestora (N: P), cu indicatori ai sănătății umane, se pot identifica, de asemenea, asociațiile dintre compoziția dietei și sănătatea umană, inclusiv cancer risc și longevitate. Studii recente care au legat stoichiometria ecologică (în mare parte raportul N: P) de sănătatea umană au fost promițătoare. Tumorile cu creștere rapidă tind să aibă un conținut ridicat de ribozomi și oncogene cheie strâns legate de reglarea biogenezei ribozomilor și dezvoltarea tumorii au impact fiziologic asupra metabolismului fosfatului pacientului, în concordanță cu ipoteza ratei de creștere (GRH) [ 38 ]. GRH a fost central în studiile de stoichiometrie ecologică [ 39] și afirmă că ratele crescute de creștere sunt legate de cereri ridicate de P pentru sinteza ARN ribozomal bogat în P (ARNr) [ 39 , 40 , 41 , 42 ]. Principiul este că organismele trebuie să crească alocarea lor de ARN-P bogat în P pentru a satisface cererea ridicată de sinteză proteică necesară pentru o creștere rapidă. Raportul N: P și rata de creștere sunt astfel legate de conexiunile intime dintre alocarea P la ribozomi și alocarea N la sinteza proteinelor [ 43 ]; deci, ratele de creștere ridicate ale celulelor, țesuturilor, organelor și organismelor sunt astfel legate de raporturile N: P scăzute, mai ales atunci când N și P sunt prezente în concentrații mari de celule. Elser și colab., (2007) [ 44] au observat că tumorile pulmonare și de colon au avut un conținut de P și ARN semnificativ mai mare (aproximativ dublu) și raporturi N: P mai scăzute decât țesutul normal asociat și că P în ARN a contribuit cu o fracție semnificativ mai mare din totalul biomasei P la maligne comparativ cu cel din țesuturile normale , în concordanță cu GRH. Cu toate acestea, datele privind tumorile renale și hepatice nu au susținut GRH. Sănătatea umană poate depinde astfel de stoichiometria optimă prin funcția de viață adecvată, inclusiv mecanismul pentru menținerea homeostaziei N: P și aportul de N și P.

Dincolo de simpla legătură dintre compoziția alimentelor și riscul de cancer, compoziția alimentară poate afecta și alte variabile asociate sănătății umane și, astfel, cu speranța de viață (LE) la naștere la populațiile umane. De exemplu, unele fructe și legume pot ajuta la prevenirea sau tratarea bolilor cronice la om [ 45 ]. Studiile epidemiologice și statistice au constatat că unele diete, cum ar fi dietele mediteraneene, japoneze și vegetariene, sunt corelate cu riscuri mai mici de mai multe boli mortale și, prin urmare, cu durata medie de viață [ 12 ]. Atât calitatea, cât și cantitatea alimentelor (aportul de calorii) au fost, de asemenea, corelate cu sănătatea umană și longevitatea46 , 47], deși unele studii nu au reușit să găsească relații clare (de exemplu, Shanley și Kirkwood, 2006 [ 48 ]). Aportul unor molecule azotate a fost corelat cu sănătatea umană și riscul unor boli importante [ 32 ], iar dietele bogate în proteine ​​au fost asociate cu riscul mai multor boli digestive, renale și vasculare 2 ]. Legumele fertilizate excesiv cu nitrați pot acumula niveluri ridicate ale acestor substanțe chimice azotate toxice, cu mai multe riscuri pentru sănătate pentru componentele rețelelor alimentare, inclusiv pentru oameni [ 49 ]. Ar trebui, așadar, să ne așteptăm la un potențial impact global asupra sănătății umane de la intensificarea crescândă a fertilizării cu azot în ultimele decenii [ 18 , 19 , 45]. De exemplu, fertilizarea cu N în culturile de grâu a crescut la scară globală de la aproximativ 10 kg N ha − 1 y − 1 în 1961 la 100 kg N ha − 1 y − 1 în 2015 [ 50 ]. Ratele ridicate de fertilizare cu azot în culturile de grâu au fost asociate cu un conținut ridicat de proteine ​​în boabele de grâu și făină [ 50 ], deci ar trebui să ne așteptăm la aporturi mai mari de azot în această perioadă, ceea ce ar putea avea astfel un impact asupra sănătății umane și, prin urmare, LE la la scară globală. Cantitatea de P din diete poate afecta, de asemenea, sănătatea umană și LE, atât pentru deficite, cât și pentru excese [ 34 , 51 , 52]. În afară de creșterea riscului de cancer, consumul de alcool a fost asociat cu incidențe mai mari ale altor cauze principale de deces uman. Chiar dacă alcoolul moderat a fost asociat cu insuficiențe cardiace reduse la vârsta adultă timpurie în unele studii [ 53 ], consumul său continuu este legat de insuficiența cardiacă crescută [ 39 , 48 , 54 ] și, în general, cu o reducere a duratei vieții umane17 , 55 ].

Cantitatea, calitatea și tipul (de exemplu, animale și legume) de hrană și băuturi umane au fost, astfel, corelate cu cancerul și LE, deși în cea mai mare parte la nivel de populație și cu multe incertitudini. Am urmărit să facem lumină asupra acestei asociații în două moduri. În primul rând, prin utilizarea datelor integrate la nivel de țară în bazele de date oficiale ale Organizației Națiunilor Unite (ONU), Organizației Națiunilor Unite pentru Alimentație și Agricultură (FAO), Organizației pentru Cooperare și Dezvoltare Economică (OECD), Banca Mondială, Organizația Sănătății (OMS), Departamentul Agriculturii SUA, Departamentul Sănătății SUA și Eurobarometru. În al doilea rând, concentrându-se studiul nu numai asupra compușilor biochimici (de exemplu, proteine, alcool) și originii alimentare (animale terestre, animale marine,sau plante) dar și asupra relației compozițiilor elementare (N și P) și a stoichiometriilor (raporturile N: P) cu prevalența și mortalitatea cancerului și cu LE. Am emis ipoteza că aportul mai mare de N, raporturile mai mici de aport de N: P, hrana din animale terestre și băuturile alcoolice ar fi asociate cu cancer și cu speranta de viata(life expectancy) LE mai scurte, în timp ce dimpotrivă, animalele și legumele acvatice ar fi asociate cu mai puțin cancer și cu LE mai lung.

2. Materiale și metode

2.1. Colectarea și pregătirea datelor

Am adunat datele din cele mai relevante și importante baze de date mondiale cu informații disponibile despre consumul de alimente, compoziția alimentelor și indicii sănătății umane la nivel de țară și la scară globală. Setul nostru de date privind mortalitatea prin cancer provine din baza de date a mortalității OMS (Organizația Mondială a Sănătății), care cuprinde statisticile naționale de mortalitate și incidență raportate de organizațiile de sănătate ale țărilor, clasificate în conformitate cu liniile directoare privind Clasificarea Internațională a Bolilor (ICD). Baza de date în sine conține cifre brute de mortalitate, cu observații cuprinse între 1960 și 2017. Datele sunt clasificate folosind ICD versiunea 7-10, în funcție de țara raportoare. Clasificările ICD au fost armonizate folosind dicționarul de cancer de la Agenția Internațională de Cercetare a Cancerului a OMS. Pentru a obține rate de deces pe țară,au fost utilizate cifrele corespunzătoare ale OMS privind populația. Pentru a corecta diferențele specifice structurii de vârstă dintre țări, am utilizat populația standard mondială cu schema de cântărire corespunzătoare grupelor de vârstă [50 ].

Datele privind prevalența cancerului provin din OECD (Organizația pentru Cooperare și Dezvoltare Economică) și din bazele de date CI5plus ale OMS. Au fost selectate observațiile din baza de date CI5plus, care conțin un eșantion reprezentativ al întregii populații. Ratele standardizate pentru datele de prevalență au fost calculate utilizând aceeași metodă ca și în cazul mortalității prin cancer.

Am calculat aportul anual pe cap de locuitor de proteine, Kcal, N, P și N: P (baza de masă) pentru toate țările OECD după cum urmează: intake aportul anual al fiecărui grup de alimente (1) × concentrația medie de N sau P pentru fiecare aliment grup (2). (1) Date de la FAO (Organizația Națiunilor Unite pentru Alimentație și Agricultură) și (2) Date din baza de date INFOODS Composition Food for Biodiversity, USDA și Danmarks Tekniske Universitet (DTU) Fodevareinstituttet. Am estimat concentrațiile de N și P pentru fiecare grup de alimente din bazele de date FAO folosind bazele de date din (2). Aceste baze de date conțineau concentrații de proteine, Kcal, N și P pentru diverse produse alimentare. Am grupat aceste produse alimentare în seturi corespunzătoare grupurilor alimentare FAO și am calculat aportul mediu corespunzător pentru fiecare grup.Am folosit media ca valoare finală atunci când datele pentru concentrațiile de N și / sau P au fost furnizate de mai multe baze de date pentru același grup de alimente. Aporturile pe cap de locuitor de kilocalorii și proteine ​​pentru fiecare țară, an și tip de alimente au fost obținute direct din baza de date FAO.

Creșterile aporturilor anuale pe cap de locuitor de P, N, proteine ​​și kilocalorii în ceea ce privește mortalitatea prin cancer și LE pentru fiecare țară în anii 2000 față de valorile din anii 1960 au fost estimate pentru toate țările pentru care au fost disponibile informații. Am obținut date de la Banca Mondială pentru LE, PIB (produs intern brut) pe cap de locuitor și procentul populației urbane pentru fiecare țară și an. Am obținut HDI (indicele dezvoltării umane) pentru fiecare țară și an din Programul Națiunilor Unite pentru Dezvoltare. Am obținut vârsta medie a populației țării (AM) pentru fiecare țară și an de la OMS.

2.2. Analize statistice

Modele Bayesiene

Am analizat trei seturi de date diferite, unul pentru fiecare variabilă de răspuns studiată:

  1. În prima analiză, am încercat să explicăm prevalența medie a neoplasmelor maligne totale, precum și a cancerelor de sân, col uterin, colon, plămâni și prostată folosind setul nostru de indicatori medii în perioada 1998-2010 ( N= 52).
  2. În a doua analiză, am încercat să explicăm decesele medii (la 100.000 de locuitori) în perioada 1960–2010 din cauza neoplasmelor maligne, precum și a cancerelor de sân, col uterin, colon, plămâni și prostată folosind setul nostru de covariate medii în perioada 1960–2010 ( N= 85).
  3. În cele din urmă, am regresat creșterea medie a speranței de viață din 1960 până în 2010 pe setul nostru de covariabile măsurate în mediile lor în perioada 1960–2010 (100). De asemenea, am regresat creșterea speranței de viață la schimbarea setului nostru de covariabile în această perioadă.

În cadrul fiecărei analize, am folosit ca variabile explicative setul total de covariabile nutriționale disponibile, conținând observații privind N, P, N / P, kcal, proteine ​​și consumul total de kg din pământ-animale, legume, pământ-animale / legume, -surse animale și alcoolice. În plus, am folosit PIB pe cap de locuitor, vârsta mediană a populației, precum și indicele de dezvoltare umană ca variabile de control.

Pentru a trage deducție din impactul factorilor determinanți nutriționali asupra prevalenței medii a cancerului, a mortalității și a speranței de viață, am folosit un cadru bayesian flexibil. Avantajul acestui cadru a fost că ne-a permis (i) să abordăm în mod flexibil problemele de colinearitate severă dintre variabilele noastre explicative, (ii) și să ameliorăm problema supraadaptării. Aceasta din urmă a fost deosebit de îngrijorătoare, având în vedere numărul de observații limitate (variind de la 52 la 100) și numărul relativ mare de variabile de interes ( K= 33 covariabile).

Pentru a atenua colinearitatea în cadrul variabilelor explicative, le-am grupat pe baza matricei lor de covarianță și folosind pachetul hclust R, împreună cu algoritmul semi-automat de la Kelley și colab. (1996) [ 35 ], pentru a ajunge la cinci clustere distincte ( tabelul suplimentar S1). Din fiecare cluster, am folosit analiza componentelor principale pentru a obține cei trei vectori proprii asociați cu cele mai mari valori proprii. În cadrul fiecărui grup, acestea au acoperit peste 90% din variația din covariabile. Vectorii proprii obținuți astfel au fost folosiți ca variabile explicative în analiza noastră de regresie. Această reducere a dimensiunii variabilelor explicative reduce foarte mult colinearitatea, în timp ce captează în continuare variația cheie în variabilele observate. În plus, impacturile estimate ale factorilor pot fi mapate înapoi la variabilele explicative folosind încărcările factorilor precalculați.

Acest model poate fi ușor estimat folosind estimarea maximă a probabilității. Cu toate acestea, întrucât unul dintre obiectivele acestui studiu a fost de a analiza forțele motrice care se corelează cu ratele de prevalență a cancerului între țări, aveam nevoie de o abordare mai flexibilă care să permită evaluarea incertitudinii cu privire la modelul structural de bază. În acest scop, am folosit o formă de selecție a variabilelor bayesiene, etichetată ca selecție variabilă de căutare stocastică (SSVS) anterior (vezi [ 48 , 52]). Avantajul acestei abordări constă în faptul că impactul covariabilelor despre care se estimează a posteriori că au o importanță relativ scăzută se micșorează spre zero, crescând astfel gradele efective de libertate și permițându-ne să deducem importanța relativă a covariabilelor. Am efectuat estimarea modelului utilizând un algoritm de lanț Markov Monte Carlo (MCMC), ale cărui detalii, împreună cu specificațiile anterioare, sunt furnizate în materialele suplimentare .

2.3. Analize ale axei majore reduse, modele liniare generalizate și analize ale componentelor principale

De asemenea, am folosit o analiză directă redusă a axelor majore pentru a evalua vizual relațiile bivariate dintre mortalitatea prin cancer (pentru 1960-2010), prevalența cancerului (1998-2010) și schimbarea LE între anii 1960 și 2000 în 100 de țări cu valorile corespunzătoare fiecărei variabile explicative (aporturile totale pe cap de locuitor și aporturile din alimentele animale terestre, alimentele pentru animale acvatice și alimentele vegetale / vegetale, proteinele, kcal, alcoolul, raportul N, P și N: P). Pentru a analiza efectul altor variabile care pot influența asupra acestor relații bivariate comentate, am realizat, de asemenea, modele liniare generalizate pentru a analiza aceste relații și am inclus în modele LE per capita corespunzător, PIB, IDU și AM național ca variabile independente împreună cu cele menționate variabile ale consumului de alimente.Am folosit funcția gls pentru a se potrivi unui model liniar folosind cele mai mici pătrate generalizate cu pachetul R nlme [56 ]. Am cuplat aceste analize cu funcția stepAIC pentru a selecta în fiecare caz cel mai bun model (AIC inferior) cu pachetul MASS [ 55 ] din modelele saturate cu LE, GDP, HDI, MA națională și o variabilă alimentară diferită în fiecare saturată model ca variabile independente. În cele din urmă, am efectuat, de asemenea, APC cu setul de date de variabile explicative ( tabelul suplimentar S1 ) și prevalența și mortalitatea neoplasmului pe țară pe cap de locuitor, precum și creșterea LE în ultimele decenii.Mergi la:

3. Rezultate

Pentru a analiza impactul consumului de nutrienți asupra prevalenței, mortalității și speranței de viață a cancerului, am utilizat cadrul de regresie bayesiană flexibil pentru inferență. figura 1conține estimările coeficientului corespunzător pentru principalele variabile de interes (variabilele de control au fost omise din motive de lizibilitate; rezultatele detaliate sunt disponibile în materialele suplimentare ) ca variabile explicative ale prevalenței cancerului, mortalității prin cancer și speranței de viață.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijerph-17-07240-g001.jpg

Deschideți într-o fereastră separatăfigura 1

Estimări medii ale coeficientului posterior din modelele econometrice bayesiene. Fiecare panou corespunde seturilor de date (pentru prevalență, decese și LE – speranța de viață; umbrirea indică magnitudinea impactului posterior. Estimările nu semnificative sub intervale de încredere de 95% sunt umbrite în alb. Rezultatele se bazează pe trei vectori proprii asociați cu valorile proprii cele mai mari din fiecare grup ( tabelul suplimentar S1 ). Predictorii discutați în text sunt notați cu caractere aldine.

În termeni kilocalorici, un consum mai mare din surse vegetale a fost asociat cu o mortalitate semnificativ mai mică din neoplasmele totale maligne, precum și din neoplasmele colului uterin (figura 1 și Figura 2). Un procent mai mare din consumul kilocaloric din surse de animale terestre a fost asociat invers cu o prevalență mai mare a neoplasmelor pulmonare și de prostată și a deceselor cauzate de neoplasmele maligne totale, precum și a neoplasmelor maligne ale sânului, colonului și plămânului (figura 1 și Figura 3).

Un fișier extern care conține o imagine, o ilustrare etc. Numele obiectului este ijerph-17-07240-g002.jpg

Figura 2

Relația mortalității (la 100.000 de locuitori) a neoplasmelor maligne (numărul total de cancere) cu procentul mediu anual al țării din Kcal total din surse vegetale. p <0,001.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijerph-17-07240-g003.jpg

Deschideți într-o fereastră separatăFigura 3

Relația mortalității (la 100.000 de locuitori) a neoplasmelor maligne (numărul total de cancere) și a speranței de viață medii pe țară din 1960 până în 2010 cu procentul mediu anual al țării din Kcal total din surse animale terestre. p <0,001.

Un consum mai mare de N din surse animale terestre a fost asociat cu o prevalență mai mare a neoplasmelor maligne ale sânului, colului uterin și colonului ( Tabelul suplimentar S2 ). În mod similar, consumul mai mare de P din sursa animalelor terestre a fost asociat cu o prevalență și mortalitate crescută a cancerului de sân, precum și cu prevalența neoplasmelor maligne ale colonului ( Tabelul suplimentar S2). Această asociere și celelalte descrise aici au fost separabile de asociațiile cu alte variabile coliniare, de exemplu, de la un procent mai mare de animale în aport, deoarece am folosit o formă de analiză de regresie a componentelor principale (prin grupuri), care ar trebui să poată urmări acest lucru afară (testele precum VIF (variația factorului de inflație) au indicat, de asemenea, multicolinearitate reziduală scăzută printre variabilele descrise aici). Un consum mai mare de P din surse vegetale a fost asociat cu mai puține decese cauzate de cancerul de prostată. În ceea ce privește raportul dintre consumul de N și P, nu s-a găsit nicio relație semnificativă între raportul N: P și prevalența neoplasmului malign (figura 1).

Aportul de proteine ​​din surse animale terestre a fost legat de o prevalență mai mare a cancerelor de sân și de colon, precum și de creșterea deceselor cauzate de cancerul de sân ( Tabelul suplimentar S3 ). Consumul total de alcool pe cap de locuitor a fost legat de incidența și mortalitatea ridicată din neoplasmele maligne, precum și de incidența ridicată a cancerelor de col uterin, de colon și pulmonare, dar cu o relație mai slabă (figura 1 și Figura 4). Un consum total mai mare de animale acvatice a fost legat de o creștere mică, dar semnificativă, a speranței de viață.

Un fișier extern care conține o imagine, o ilustrare etc. Numele obiectului este ijerph-17-07240-g004.jpg

Figura 4

Relația prevalenței (la 100.000 de locuitori) a neoplasmelor maligne pe țară cu aportul mediu anual de băuturi alcoolice. p <0,001.

Modelele liniare generalizate au confirmat asocierea dintre prevalența ridicată a neoplasmelor maligne pentru 1998-2010 și aporturile de N, P, proteine ​​și kilocalorii din surse animale terestre, în special pentru neoplasmele de colon, plămâni, sân și prostată. Asocierea a fost și mai puternică atunci când s-a luat în considerare raportul dintre animalul / legumele terestre pentru hrana totală, aportul de N, P, proteine ​​și kilocalorii ( tabelul suplimentar S4 ). Când variabilele potențial confuze (de exemplu, cele care pot influența potențialul sănătății populației, cum ar fi vârsta medie națională a populației (AM), IDU, LE și PIB) au fost luate în considerare și în analize, cele mai bune modele au continuat să găsiți asocieri pozitive cu surse nutriționale din aporturile de alimente animale terestre (Tabel suplimentar S5 ). Cele mai bune modele au găsit, de asemenea, asociații negative între alimentele vegetale și unele neoplasme maligne ( Tabelul suplimentar S5 ).

Mortalitatea ridicată prin neoplasme maligne (suma tuturor tipurilor) pentru anii 1960–2010 a fost asociată cu aportul național ridicat pe cap de locuitor, N, P, proteine ​​și kilocalorii din hrana animalelor terestre (nu acvatice) ( Tabelul suplimentar S6 ). Cu toate acestea, acest efect nu a fost observat în raport cu aporturile totale pe cap de locuitor de N, P, proteine ​​și kilocalorii de la animale acvatice pentru aceeași perioadă ( Tabelul suplimentar S6). Atunci când celelalte variabile care pot influența potențialul sănătății populației, cum ar fi MA, HDI, LE și PIB, au fost luate în considerare și în analize, cele mai bune modele au continuat să găsească asociații pozitive de aport total, N, proteine ​​și kilocalorii din alimente animale terestre cu mortalitate din neoplasme maligne totale, de prostată, colon, sân și plămâni ( Tabel suplimentar S7 ). Concentrațiile de N și P ale alimentelor animale terestre au fost corelate pozitiv, iar concentrațiile de N și P ale alimentelor vegetale au fost corelate negativ cu mortalitatea totală prin neoplasm în perioada 1960-2010.

LE național în perioada 1960-2010 a fost asociat pozitiv cu aportul total național per capita de hrană și aporturile de N, P, proteine ​​și kilocalorii, în principal de la animale terestre ( Tabelul suplimentar S8 ). Analizele liniare corespunzătoare, incluzând PIB, HDI și AM ca factori independenți care influențează, de asemenea, sănătatea populației, au menținut relațiile pozitive ale alimentelor terestre pentru animale și legume cu LE (Figura 3Tabel suplimentar S9 ).

Analizele PCA cu bazele de date ale prevalenței neoplasmului, mortalității și speranței de viață au arătat modele similare cu cele ale modelelor liniare Bayesiene și generalizate. Cu cât dezvoltarea socioeconomică a țării este mai mare, cu atât este mai lungă LE ( Figura suplimentară S1 ), dar cu atât este mai mare prevalența și mortalitatea neoplasmelor maligne (cu excepția colului uterin) (Figura 5). Sursele de hrană provenite de la animale terestre au fost asociate cu o prevalență mai mare a neoplasmelor maligne, în timp ce cele de la animale acvatice sau alimente vegetale nu au fost (Figura 5). Când ne-am concentrat asupra schimbării din ultimele decenii, creșterea LE a fost puternic asociată cu o creștere a aportului de alimente vegetale și animale împreună cu ceilalți indicatori socioeconomici de dezvoltare (Figura 6).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijerph-17-07240-g005.jpg

Figura 5

PCA (analiza componentelor principale) cu prevalență neoplasmă pe țară per capita (L = plămân, C = colon, Ce = col uterin, P = prostată, TN = neoplasm total, B = sân), variabile socioeconomice diferite (LE = speranța de viață la naștere, AM = vârsta medie, IDU = indicele dezvoltării umane, PIB = produsul intern brut pe cap de locuitor) și surse de hrană (t = total, N = aport de azot, P = aport de fosfor, prot = proteine ​​și Kcal = kilocalorii aport pe cap de locuitor) de pe terestre surse animale (ta) (roșu), legume (v) (verde) și animale acvatice (aa) (albastru) în perioada 1990–2010. AUS = Australia, AUT = Austria, BEL = Belgic, CAN = Canada, CHE = Elveția, CHL = Chile, CHN = China, COL = Columbia, CRI = Costa Rica, CZE = Republica Cehă, DEU = Germania, DNK = Danemarca, ECU = Ecuador, ESP = Spania, EST = Estonia, FIN = Finlanda, FRA = Franța, GBR = Regatul Unit,GRC = Grecia, HUN = Ungaria, IDN = India, IND = Indonezia, IRL = Irlanda, ISL = Islanda, ISR = Israel, ITA = Italia, JPN = Japonia, KOR = Coreea, KWT = Kuweit, LUX = Luxemburg, MEX = Mexic, MLT = Malta, NLD = Olanda, NOR = Norvegia, NZL = Noua Zeelandă, PHL = Filipine, POL = Polonia, PRT = Portugalia, SVK = Slovacia, SVN = Slovenia, SWE = Suedia, THA = Thailanda, TUR = Turcia , UGA = Uganda, SUA = Statele Unite ale Americii, ZAF = Africa de Sud.SUA = Statele Unite ale Americii, ZAF = Africa de Sud.SUA = Statele Unite ale Americii, ZAF = Africa de Sud.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijerph-17-07240-g006.jpg

Figura 6

APC cu creșterile mediilor medii în perioada 1960–2010 a speranței de viață la naștere la țară (LE), diferite variabile socioeconomice (AM = vârsta medie, IDU = indicele dezvoltării umane, PIB = produsul intern brut per capita) și sursele de hrană ( t = total, N = aport de azot, P = aport de fosfor, prot = proteine ​​și Kcal = kilocalorii aport pe cap de locuitor) din surse animale terestre (ta) (roșu), legume (v) (verde) și animale acvatice (aa) (albastru). AFG = Afganistan, DZA = Algeria, ARG = Argentina, AUS = Australia, AUT = Austria, BHS = Bahamas, BGD = Bangladesh, BEL = Belgia, BLZ = Belize, BEN = Benin, BOL = Bolivia, BWA = Botswana, BRN = Brunei Darussalam, BFA = Burkina Faso, KHM = Cambodgia, CMR = Camerun, CAN = Canada, CAF = Republica Centrafricană, TCD = Ciad, CHL = Chile, CHN = China, COL = Columbia, CRI = Costa Rica,CIV = Cote Ivoire, CUB = Cuba, DNK = Danemarca, DOM = Republica Dominicană, ECU = Ecuador, EGY = Egipt, SLV = El Salvador, FJI = Fiji, FIN = Finlanda, FRA = Franța, PYF = Polinezia Franceză, GAB = Gabon, GMB = Gambia, DEU = Germania, GHA = Ghana, GRC = Grecia, GTM = Guatemala, GNB = Guineea-Bissau, GUY = Guyana, HND = Honduras, ISL = Islanda, IND = India, IDN = Indonezia, IRN = Iran, IRQ = Irak, IRL = Irlanda, ITA = Italia, JAM = Jamaica, JPN = Japonia, JOR = Iordania, KEN = Kenya, KIR = Kiribati, KOR = Coreea, KWT = Kuweit, LSO = Lesotho, LBR = Liberia, LUX = Luxemburg, ODM = Madagascar, MWI = Malawi, MYS = Malaezia, MLI = Mali, MLT = Malta, MRT = Mauritania, MEX = Mexic, MAR = Maroc, NPL = Nepal, NLD = Olanda, NCL = Noua Caledonie, NZL = Noua Zeelandă, NER = Niger, NGA = Nigeria, NOR = Norvegia, OMN = Oman, PAK = Pakistan, PAN = Panama, PRY = Paraguay,PER = Peru, PHL = Filipine, PRT = Portugalia, RWA = Rwanda, VCT = Saint Vincent și Grenadine, SAU = Arabia Saudită, SEN = Senegal, SLE = Sierra Leone, SLB = Insulele Solomon, ZAF = Africa de Sud, ESP = Spania, LKA = Sri Lanka, SDN = Sudan, SUR = Surinam, SWZ = Swaziland, SWE = Suedia, CHE = Elveția, THA = Thailanda, TGO = Togo, TTO = Trinidad și Tobago, TUN = Tunisia, TUR = Turcia, UGA = Uganda, GBR = Regatul Unit, SUA = Statele Unite ale Americii, URY = Uruguay, VEN = Venezuela (Republica Bolivariană), ZMB = Zambia, ZWE = Zimbabwe.THA = Thailanda, TGO = Togo, TTO = Trinidad și Tobago, TUN = Tunisia, TUR = Turcia, UGA = Uganda, GBR = Regatul Unit, SUA = Statele Unite ale Americii, URY = Uruguay, VEN = Venezuela (Republica Bolivariană) , ZMB = Zambia, ZWE = Zimbabwe.THA = Thailanda, TGO = Togo, TTO = Trinidad și Tobago, TUN = Tunisia, TUR = Turcia, UGA = Uganda, GBR = Regatul Unit, SUA = Statele Unite ale Americii, URY = Uruguay, VEN = Venezuela (Republica Bolivariană) , ZMB = Zambia, ZWE = Zimbabwe.Mergi la:

4. Discutie

Analiza noastră bayesiană la scară de țară a confirmat astfel ipotezele noastre, cu excepția celei privind raportul N: P. Atunci când se ține cont, de asemenea, de varianța explicată de variabilele socioeconomice de dezvoltare și bogăție, s-au găsit relații pozitive între prevalența și mortalitatea din cancerele totale, de colon, de prostată și respiratorii și aportul de animale terestre și băuturile alcoolice. Aceste relații au fost deosebit de puternice pentru aportul de N și proteine ​​de la animale terestre. Cele mai bune (și mai simple) modele liniare au identificat, de asemenea, aceleași legături, pe lângă legăturile cu PIB-ul național, IDU și AM. Aporturile mari pe cap de locuitor de N, P, proteine ​​și aportul total de la animalele acvatice și în special din legume au avut în schimb relații negative cu prevalența cancerului. Nu s-a găsit nicio asociere negativă între N:Raportul P și prevalența malignă a neoplasmului. Diferitele rezultate pentru cancerul de col uterin sugerează că cauzele de mediu ale acestui tip de cancer pot fi foarte distincte de cele care stau la baza cancerului de colon, respirator și de prostată. Cancerul de col uterin poate fi asociat cu alți factori care afectează calitatea vieții, care nu sunt asociați direct cu trăsăturile alimentare pe care le-am studiat.

Ne așteptam la o relație pozitivă între LE național la naștere și consumul total de alimente. Rezultatele au confirmat, de asemenea, aceste așteptări; consumul de alimente a reprezentat în special LE în majoritatea modelelor, chiar și atunci când a inclus schimbările în PIB, IDU și AM inițiale pentru fiecare țară. Datele au indicat astfel în mod clar că variabilele cheie la scară largă care reprezintă mortalitatea prin cancer sunt legate în mare parte de aportul ridicat de produse de origine animală caracteristic în principal țărilor bogate (Figura 5). Aceste țări bogate, pe de altă parte, au condiții de viață mai bune care permit LE mai lung (Figura 6) și, astfel, sunt și mai susceptibili la cancer. Pe de altă parte, prelungirea generală și substanțială a LE la scară globală ar fi în general asociată cu o cantitate adecvată de aport alimentar, indiferent de origine, fie animală, fie vegetală. Creșterea globală a LE din 1960 până în 2000 a fost asociată cu creșterea aportului de alimente vegetale și animale (Figura 6). Astfel, analizele multivariate prezentate înFigura 5 și Figura 6arată clar că țările mai bogate au un LE mai mare asociat cu un aport alimentar mai bogat și mai abundent și cu alte variabile asociate calității vieții decât țările mai sărace. Cu toate acestea, în același timp, țările mai bogate au o incidență mai mare a cancerului datorită aportului mai mare de surse de hrană provenite de la animale terestre și asociate cu vârsta mai în vârstă a populației lor. În schimb, țările sărace care au avut o îmbunătățire a condițiilor lor economice și-au crescut nivelul LE printr-o creștere a cantității de surse de hrană atât de la animale, cât și de la plante.Mergi la:

5. Concluzii

Analizele noastre au dat astfel patru concluzii în general consecvente după efectuarea unor analize bayesiene profunde ale datelor la nivel de țară în care relațiile dintre diferite surse de dietă și prevalența cancerului au fost analizate separat de alte variabile însoțitoare, cum ar fi vârsta medie, PIB-ul sau stadiul de dezvoltare al fiecărei țară.

În primul rând, aportul excesiv de hrană din animale terestre, în special nivelurile de proteine, N și P, în țările dezvoltate a fost asociat cu o prevalență mai mare a cancerului, în timp ce aportul echivalent din legume a fost asociat cu o prevalență mai mică. Factorii de confuzie reziduali asociați cu stilul de viață al țărilor care consumă mai mult sau mai puțin alimente pentru animale și legume ar putea masca aceste relații, dar am luat în considerare PIB-ul, vârsta medie, speranța de viață și IDU,sunt strâns legate de stilul de viață al cetățenilor lor și, totuși, aceste relații încă au avut loc.

În al doilea rând, nu s-au găsit relații consistente pentru raportul alimentar N: P, falsificând astfel ipoteza ratei de creștere a îmbunătățirii prevalenței neoplasmului malign.

În al treilea rând, consumul de băuturi alcoolice este puternic corelat cu prevalența și mortalitatea neoplasmelor maligne, confirmând cercetările anterioare.

În al patrulea rând, lupta împotriva foametei este cea mai importantă sarcină pentru îmbunătățirea sănătății și creșterea sperantei de viata LE în țările subdezvoltate.

Abrevieri

LE, speranța de viață; OMS, Organizația Mondială a Sănătății; ONU, Națiunile Unite; ICD, Clasificarea internațională a bolilor; OECD, Organizația pentru Cooperare și Dezvoltare Economică; FAO, Organizația Națiunilor Unite pentru Alimentație și Agricultură; PIB, produs intern brut; IDU, indice de dezvoltare umană; AM, vârsta medie a populației.Mergi la:

Materiale suplimentare

Următoarele sunt disponibile online la https://www.mdpi.com/1660-4601/17/19/7240/s1, Figura S1: APC cu medii medii ale speranței țării la naștere (LE) (negru), diferite variabile socioeconomice (AM = vârstă medie, IDU = indicele dezvoltării umane, PIB = produsul intern brut per capita) (galben) și surse de hrană ( t = total, N = aport de azot, P = aport de fosfor, prot = proteine ​​și Kcal = kilocalorii aport pe cap de locuitor) din surse de animale terestre (ta) (roșu), legume (v) (verde) și animale acvatice (aa ) (albastru) în perioada 1960–2010; Tabelul S1: Clustering, acronime și surse de informații pentru fiecare variabilă explicativă utilizată în modele; Tabelul S2: Impacturi mediane posterioare pentru prevalența medie a cancerului, 1998-2010. Tabelul S3: Impacturi mediane posterioare pentru mortalitatea medie prin cancer, 1960-2010. Tabelul S4: Impacturi mediane posterioare pentru speranța medie de viață, 1960-2010. Tabelul S5:Relații bivariate la nivel național între prevalența națională a neoplasmelor maligne ale colonului, prostatei, sânului, colului uterin și ale plămânului și diverse trăsături ale aportului anual pe cap de locuitor în aceeași perioadă (perioada 1998-2010). Tipul bold indică semnificația statistică (p <0,01). Tabelul S6: Cele mai bune modele liniare care prezintă prevalența (perioada 1998-2010) din neoplasmele maligne (total (TN), colon (CN), colul uterin (CEN), sân (BN), prostată (PN) și pulmonar (LN) ca funcții ale bogăției naționale pe cap de locuitor (utilizând PIB), indicele de dezvoltare umană (IDU), vârsta medie a populației (AM), speranța de viață la naștere (LE) și aportul mediu pe cap de locuitor de alimente din diferite surse. prevăzute pentru variabile standardizate. Tabelul S7: Relațiile dintre țări între mortalitatea totală națională din neoplasmele maligne ale colonului, prostatei, sânului, colului uterin și ale plămânului (perioada 1960-2010) și diferite trăsături ale aportului anual pe cap de locuitor în aceeași perioadă. tipul aldin indică semnificația statistică ( pag<0,01). Tabelul S8: Cele mai bune modele liniare care reprezintă mortalitatea prin neoplasme maligne (total (TN), colon (CN), col uterin (CEN), sân (BN), prostată (PN) și pulmonar (LN)) ca funcții ale naționalului per capita bogăția (folosind PIB), indicele de dezvoltare umană (IDU), vârsta medie a populației (AM), speranța de viață la naștere (LE) și aportul mediu pe cap de locuitor de alimente din diferite surse. speranța la naștere (perioada 1960–2010) și diverse trăsături ale aportului anual pe cap de locuitor în aceeași perioadă.Tipul îndrăzneț indică semnificație statistică ( p <0,01).Faceți clic aici pentru fișier de date suplimentare. (2,5M, pdf)Mergi la:

Contribuțiile autorului

JP și JS au conceput studiul; JP, JS și TK au adunat datele și le-au analizat; JP, JS, TK, MO, FH, HW, IAJ și PC au participat activ la discutarea și scrierea lucrării. Toți autorii au citit și au acceptat versiunea publicată a manuscrisului.Mergi la:

Finanțarea

Autorii ar dori să recunoască sprijinul financiar acordat de Consiliul European de Cercetare pentru grantul Synergy ERC-SyG-2013-610028 IMBALANCE-P.Mergi la:

Conflicte de interes

Autorii declară că nu au interese concurente.

Int J Environ Res Health Public . 2020 oct; 17 (19): 7240.Publicat online 2020 octombrie 3. doi:  10.3390 / ijerph17197240 PMCID: PMC7579602PMID: 33022999

Relațiile la nivel de țară ale aportului uman de N și P, alimente de origine animală și vegetală și băuturi alcoolice cu cancer și speranță de viață

Josep Penuelas , 1, 2, Tamás Krisztin , Michael Obersteiner , Florian Huber , Hannes Winner , 4, Ivan A. Janssens , Philippe Ciais , 7 și Jordi Sardans 1, 2Informații despre autor Note despre articol Informații privind drepturile de autor și licență Renunțare

Date asociate

Materiale suplimentare

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7579602/

Referințe

1. Peñuelas J., Janssens IA, Ciais P., Obersteiner M., Krisztin T., Piao S., Sardans J. Creșterea decalajului în înălțimea umană între țările bogate și cele sărace asociate cu aporturile lor diferite de N și P. Sci. Rep. 2017; 7 : 1-10. doi: 10.1038 / s41598-017-17880-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Ross AC, Caballero BH, Cousins ​​RJ, Tucker KL, Ziegler TR Nutriție modernă în sănătate și boli. Wolters Kluwer Health / Lippincott Williams & Wilkins; Philadelphia, PA, SUA: 2014. [ Google Scholar ]3. Wada K., Oba S., Tsuji M., Tamura T., Konishi K., Goto Y., Mizuta F., Koda S., Hori A., Tanabashi S., și colab. Consumul de carne și riscul de cancer colorectal în Japonia: Studiul Takayama. Cancer Sci. 2017; 108 : 1065-1070. doi: 10.1111 / cas.13217. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Wilson KM, Mucci LA, Drake BF, Preston MA, Stampfer MJ, Giovannucci E., Kibel AS Carne, pește, carne de pasăre și consum de ouă la diagnostic și risc de progresie a cancerului de prostată. Cancer Prev. Rez. 2016; 9 : 933–941. doi: 10.1158 / 1940-6207.CAPR-16-0070. [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Xu WH, Dai Q., ​​Xiang YB, Zhao GM, Zheng W., Gao YT, Ruan ZX, Cheng JR, Shu XO Consum de hrană pentru animale și metode de gătit în raport cu riscul de cancer endometrial în Shanghai. Fr. J. Rac. 2006; 95 : 1586–1592. doi: 10.1038 / sj.bjc.6603458. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Dwan C., Miles A. Rolul atitudinii și ambivalenței atitudinii în acceptarea riscului de cancer asociat cu carnea roșie. Risc pentru sănătate Soc. 2018; 20 : 147–162. doi: 10.1080 / 13698575.2018.1494267. [ CrossRef ] [ Google Scholar ]7. Hur SJ, Jo C., Yoon Y., Jeong JY, Lee KT Controversă asupra corelației consumului de carne roșie și procesată cu riscul de cancer colorectal: O perspectivă asiatică. Crit. Rev. Food Science. Nutr. 2019; 59 : 3526–3537. doi: 10.1080 / 10408398.2018.1495615. [ PubMed ] [ CrossRef ] [ Google Scholar ]8. Zheng W., Kushi L., Potter J., Sellers T., Doyle T., Bostick R., Folsom A. Aportul alimentar de energie și alimente de origine animală și incidența cancerului endometrial. Studiul sănătății femeilor din Iowa. A.m. J. Epidemiol. 1995; 142 : 388-394. doi: 10.1093 / oxfordjournals.aje.a117646. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. IARC. [(accesat la 20 martie 2020)]; 2020 Disponibil online: https://monographs.iarc.fr/agents-classified-by-the-iarc/10. IARC, Institutul American pentru Cercetarea Cancerului. Sănătate Mănâncă. A.m. Inst. Cancer Res. (2020), WRC. [(accesat la 12 aprilie 2020)]; 2020 Disponibil online: https://www.aicr.org/cancer-prevention/healthy-eating/11. Crippa A., Larsson SC, Discacciati A., Wolk A., Orsini N. Consumul de carne roșie și procesată și riscul de cancer al vezicii urinare: O meta-analiză doză-răspuns a studiilor epidemiologice. Euro. J. Nutr. 2018; 57 : 689-701. doi: 10.1007 / s00394-016-1356-0. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Perloy A., Maasland DHE, van den Brandt PA, Kremer B., Schouten LJ Aportul de carne și pește și riscul de subtipuri de cancer cap-gât în ​​studiul cohortei olandeze. Controlul cauzelor cancerului. 2017; 28 : 647-656. doi: 10.1007 / s10552-017-0892-0. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Le Marchand L., Wilkens LR, Hankin JH, Kolonel LN, Lyu LC Un studiu caz-control al dietei și cancerului colerectal la o populație multietnică din Hawaii (Statele Unite): lipide și alimente de origine animală. Controlul cauzelor cancerului. 1997; 8 : 637–648. doi: 10.1023 / A: 1018406716115. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Joshi AD, Corral R., Catsburg C., Lewinger JP, Koo J., John EM, Ingles SA, Stern MC Carne roșie și carne de pasăre, practici de gătit, susceptibilitate genetică și risc de cancer de prostată: Rezultate dintr-un caz multietnic studiu de control. Carcinogeneză. 2012; 33 : 2108–2118. doi: 10.1093 / carcin / bgs242. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Bao PP, Shu XO, Zheng Y., Cai H., Ruan ZX, Gu K., Su Y., Gao YT, Zheng W., Lu W. Aportul de alimente din fructe, legume și animale și riscul de cancer mamar prin starea receptorului hormonal. Nutr. Cancer. 2012; 64 : 806–819. doi: 10.1080 / 01635581.2012.707277. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Diallo A., Deschasaux M., Latino-Martel P., Hercberg S., Galan P., Fassier P., Allès B., Guéraud F., Pierre FH, Touvier M. Aportul de carne roșie și procesată și riscul de cancer : Rezultate din prospectivul studiu de cohortă NutriNet-Santé. Int. J. Rac. 2018; 142 : 230–237. doi: 10.1002 / ijc.31046. [ PubMed ] [ CrossRef ] [ Google Scholar ]17. Van Hecke T., Vossen E., Hemeryck LY, Vanden Bussche J., Vanhaecke L., De Smet S. Creșterea reacțiilor oxidative și nitrozative în timpul digestiei ar putea contribui la asocierea dintre consumul bine făcut de carne roșie și cancerul colorectal. Food Chem. 2015; 187 : 29–36. doi: 10.1016 / j.foodchem.2015.04.029. [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Samraj AN, Pearce OMT, Läubli H., Crittenden AN, Bergfeld AK, Band K., Gregg CJ, Bingman AE, Secrest P., Diaz SL, și colab. Un glican derivat din carne roșie promovează inflamația și progresia cancerului. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 2015; 112 : 542-547. doi: 10.1073 / pnas.1417508112. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]19. Schulz M., Nöthlings U., Allen N., Onland-Moret NC, Agnoli C., Engeset D., Galasso R., Wirfält E., Tjønneland A., Olsen A. și colab. Nicio asociere a consumului de alimente de origine animală cu risc de cancer ovarian. Cancer Epidemiol. Biomark. Anterior 2007; 16 : 852–855. doi: 10.1158 / 1055-9965.EPI-07-0054. [ PubMed ] [ CrossRef ] [ Google Scholar ]20. Marcondes LH, Franco OH, Ruite R., Arfan Ikram M., Mulder M., Stricker BH, Kiefte-de Jon JC Alimentele animale și riscul de cancer de sân postmenopauză: un studiu prospectiv de cohortă. Fr. J. Nutr. 2019; 122 : 586-591. doi: 10.1017 / S0007114519000072. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Allen NE, Key TJ, Appleby PN, Travis RC, Roddam AW, Tjønneland A., Johnsen NF, Overvad K., Linseisen J., Rohrmann S., și colab. Alimente de origine animală, proteine, calciu și risc de cancer de prostată: Investigația europeană prospectivă asupra cancerului și nutriției. Fr. J. Rac. 2008; 98 : 1574–1581. doi: 10.1038 / sj.bjc.6604331. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Do M., Lee S., Jung P., Lee M. Aportul de fructe, legume și alimente din soia în raport cu riscul de cancer mamar la femeile din Coreea: Un studiu de caz-control. Nutr. Cancer. 2007; 57 : 20-27. doi: 10.1080 / 01635580701268063. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Ferreira PMP, Rodrigues LARL, de Alencar Carnib LP, de Lima Sousa PV, Nolasco Lugo LM, Nunes NMF, do Nascimento Silva J., da Silva Araûjo L., de Macêdo Gonçalves Frota K. Cruciferous Vegetables as Antioxidative, Chemopreventive and Alimente funcționale antineoplasice: dovezi preclinice și clinice ale sulforafanului împotriva cancerelor de prostată. Curr. Pharm. Des. 2019; 24 : 4779–4793. doi: 10.2174 / 1381612825666190116124233. [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Freudenheim JL, Ritz J., Smith-Warner SA, Albanes D., Bandera EV, Van Den Brandt PA, Colditz G., Feskanich D., Goldbohm RA, Harnack L., și colab. Consumul de alcool și riscul de cancer pulmonar: o analiză combinată a studiilor de cohortă. A.m. J. Clin. Nutr. 2005; 82 : 657–667. doi: 10.1093 / ajcn / 82.3.657. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Goncalves A., Claggett B., Jhund PS, Rosamond W., Deswal A., Aguilar D., Shah AM, Cheng S., Solomon SD Consumul de alcool și riscul de insuficiență cardiacă: Studiul riscului de ateroscleroză în comunități. Euro. Heart J. 2015; 36 : 939-945. doi: 10.1093 / eurheartj / ehu514. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Xu M., Chen YM, Huang J., Fang YJ, Huang WQ, Yan B., Lu MS, Pan ZZ, Zhang CX Aportul de flavonoizi din legume și fructe este invers asociat cu riscul de cancer colorectal: un studiu caz-control in China. Fr. J. Nutr. 2016; 116 : 1275–1287. doi: 10.1017 / S0007114516003196. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Kim S., Trudo SP, Gallaher DD Legume apiacee și crucifere hrănite în etapa post-inițiere Reducerea markerilor de risc de cancer de colon la șobolani. J. Nutr. 2019; 149 : 249–257. doi: 10.1093 / jn / nxy257. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. IARC. Agenți biologici. O revizuire a carcinogenezei umane. În: Organizația Mondială a Sănătății, editor. Monografii privind evoluția riscului cancerigen pentru oameni. Volumul 100. Agenția Internațională pentru Cercetarea Cancerului; Lyon, Paris: 2010. 487p [ Google Scholar ]29. ARC. Consumul de alcool și carbamat de etil. În: Organizația Mondială a Sănătății, editor. Monografii privind evoluția riscului cancerigen pentru oameni. Volumul 96. Agenția Internațională pentru Cercetarea Cancerului; Lyon, Paris: 2010. 1428p [ Google Scholar ]30. Bagnardi V., Blangiardo M., La Vecchia C., Corrao G. O meta-analiză a consumului de alcool și a riscului de cancer. Fr. J. Rac. 2001; 85 : 1700–1705. doi: 10.1054 / bjoc.2001.2140. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Pelucchi C., Gallus S., Garavello W., Bosetti C., La Vecchia C. Risc de cancer asociat consumului de alcool și tutun: Concentrare asupra tractului aerodigestiv superior și a ficatului. Alcool Res. Sănătate. 2006; 29 : 193–198. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]32. Handa A., Fatima T., Mattoo A. Poliamine: Bio-molecule cu funcții diverse în sănătatea și bolile plantelor și umane. Față. Chem. Chem. 2018: 6. doi: 10.3389 / fchem.2018.00010. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Prudhomme M. Perspectiva cererii și ofertei globale de îngrășăminte azotate. Știință. China Ser. C Life Science. 2005; 48 : 818–826. doi: 10.1007 / BF03187121. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Gupta UC, Gupta SC Sursele și bolile deficitare ale nutrienților minerali în sănătatea umană și nutriție: o revizuire. Pedosfera. 2014; 24 : 13–38. doi: 10.1016 / S1002-0160 (13) 60077-6. [ CrossRef ] [ Google Scholar ]35. Kelley LA, Gardner SP, Sutcliffe MJ O abordare automată pentru gruparea unui ansamblu de structuri proteice derivate de RMN în subfamilii corelate. Proteina ing. 1996; 9 : 1063–1065. doi: 10.1093 / protein / 9.11.1063. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Altieri A., Garavello W., Bosetti C., Gallus S., La Vecchia C. Consumul de alcool și riscul de cancer laringian. Oncol oral. 2005; 41 : 956–965. doi: 10.1016 / j.oraloncology.2005.02.004. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Webb PM, Purdie DM, Bain CJ, Green AC Alcool, vin și riscul de cancer ovarian epitelial. Cancer Epidemiol. Biomark. Anterior 2004; 13 : 592–599. [ PubMed ] [ Google Scholar ]38. Elser JJ, Acharya K., Kyle M., Cotner J., Makino W., Markow T., Watts T., Hobbie S., Fagan W., Schade J., și colab. Cuplaje rata de creștere-stoichiometrie în diverse biote. Ecol. Lett. 2003; 6 : 936–943. doi: 10.1046 / j.1461-0248.2003.00518.x. [ CrossRef ] [ Google Scholar ]39. Sterner RW, Stoichiometria ecologică Elser JJ : Biologia elementelor de la molecule la biosferă. Princeton University Press; Princenton, NJ, SUA: 2002. [ Google Scholar ]40. Elser JJ, Sterner RW, Gorokhova E., Fagan WF, Markow TA, Cotner JB, Harrison JF, Hobbie SE, Odell GM, Weider LW Stoichiometrie biologică de la gene la ecosisteme. Ecol. Lett. 2000; 3 : 540–550. doi: 10.1046 / j.1461-0248.2000.00185.x. [ CrossRef ] [ Google Scholar ]41. Elser JJ, Fagan WF, Denno RF, Dobberfuhl DR, Folarin A., Huberty A., Interlandi S., Kilham SS, McCauley E., Schulz KL, și colab. Constrângeri nutriționale în rețelele alimentare terestre și de apă dulce. Natură. 2000; 408 : 578-580. doi: 10.1038 / 35046058. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Elser JJ, Sterner RW, Galford AE, Chrzanowski TH, Findlay DL, Mills KH, Paterson MJ, Stainton MP, Schindler DW Pelagic C: N: P stoichiometrie într-un lac eutrofizat: Răspunsuri la o manipulare a rețelei alimentare a întregului lac . Ecosisteme. 2000; 3 : 293–307. doi: 10.1007 / s100210000027. [ CrossRef ] [ Google Scholar ]43. Hessen DO, Jensen TC, Kyle M., Elser JJ RNA răspunsuri la limitarea N și P; reglarea reciprocă a stoichiometriei și a ritmului de creștere la Brachionus. Funct. Ecol. 2007; 21 : 956-962. doi: 10.1111 / j.1365-2435.2007.01306.x. [ CrossRef ] [ Google Scholar ]44. Elser JJ, Kyle MM, Smith MS, Nagy JD Stoichiometrie biologică în cancerul uman. Plus unu. 2007; 2 : e1028. doi: 10.1371 / journal.pone.0001028. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Peñuelas J., Poulter B., Sardans J., Ciais P., van der Velde M., Bopp L., Boucher O., Godderis Y., Hinsinger P., Llusia J., și colab. Dezechilibrele azot-fosfor induse de om modifică ecosistemele naturale și gestionate de pe tot globul. Nat. Comun. 2013; 4 : 2934. doi: 10.1038 / ncomms3934. [ PubMed ] [ CrossRef ] [ Google Scholar ]46. Everitt AV, Le Couteur DG Extensie de viață prin restricție de calorii la om. Ann. NY Acad. Știință. 2007; 1114 : 428-433. doi: 10.1196 / annals.1396.005. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Willcox DC, Willcox BJ, Todoriki H., Curb JD, Suzuki M. Restricție calorică și longevitate umană: Ce putem învăța de la Okinawa? Biogerontologie. 2006; 7 : 173–177. doi: 10.1007 / s10522-006-9008-z. [ PubMed ] [ CrossRef ] [ Google Scholar ]48. Shanley DP, Kirkwood TBL Restricția calorică nu sporește longevitatea la toate speciile și este puțin probabil să o facă la om. Biogerontologie. 2006; 7 : 165–168. doi: 10.1007 / s10522-006-9006-1. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Anjana, Umar S., Iqbal M. Acumularea de nitrați în plante, factorii care afectează procesul și implicațiile asupra sănătății umane. Un comentariu. Agron. Susține. Dev. 2007; 27 : 45–57. doi: 10.1051 / agro: 2006021. [ CrossRef ] [ Google Scholar ]50. Segi M. Mortalitatea prin cancer pentru anumite locuri din 24 de țări (1950–57) Departamentul de Sănătate Publică, Școala de Medicină a Universității Tohoku; Sendai, Japonia: 1960. [ Google Scholar ]51. Cooke A. Fosfat aditiv alimentar dietetic și rezultate pentru sănătatea umană. Compr. Rev. Food Science. Food Saf. 2017; 16 : 906–1021. doi: 10.1111 / 1541-4337.12275. [ CrossRef ] [ Google Scholar ]52. Trautvetter U., Jahreis G., Kiehntopf M., Glei M. Consecințele unui aport ridicat de fosfor asupra metabolismului mineral și a remodelării osoase în dependența de aportul de calciu la subiecții sănătoși – Un studiu randomizat de intervenție controlat cu placebo la om. Nutr. J. 2016; 15 : 1-11. doi: 10.1186 / s12937-016-0125-5. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Seitz HK, Becker P. Metabolismul alcoolului și riscul de cancer. Alcool Res. Sănătate. 2007; 30 : 38–47. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]54. George EI, McCulloch RE Selecție variabilă prin eșantionare Gibbs. J. Am. Stat. Conf. Univ. 1993; 88 : 881-889. doi: 10.1080 / 01621459.1993.10476353. [ CrossRef ] [ Google Scholar ]55. Turati F., Rossi M., Pelucchi C., Levi F., La Vecchia C. Fructe și legume și riscul de cancer: o revizuire a studiilor din sudul Europei. Fr. J. Nutr. 2015; 113 : S102 – S110. doi: 10.1017 / S0007114515000148. [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Pinheiro J., Bates D., DebRoy S., Sarkar D., Team RC nlme: Modele de efecte mixte liniare și neliniare. Versiunea pachetului R. 2014; 3 : 1–117. [ Google Scholar ]


Articolele din Jurnalul Internațional de Cercetare a Mediului și Sănătate Publică sunt furnizate aici prin amabilitatea Institutului de Publicare Digitală Multidisciplinară (MDPI)

Efectul suplimentelor cu vitamina D3 asupra dezvoltării cancerului avansat . O analiză secundară a studiului clinic randomizat VITAL

Oncologie inițială de investigație 18 noiembrie 2020

Paulette D. Chandler, MD, MPH 1 ; Wendy Y. Chen, MD, MPH 2,3 ; Oluremi N. Ajala, MD, MPH 1 ; și colab., Aditi Hazra, dr., MPH 1 ; Nancy Cook, ScD 1 ; Vadim Bubes, doctorat 1 ; I-Min Lee, MBBS, ScD 1 ; Edward L. Giovannucci, MD, ScD 3,4,5 ; Walter Willett, MD, DrPH 3,4,5 ; Julie E. Buring, ScD 1,5 ; JoAnn E. Manson, MD, DrPH 1,3,5 ; pentru Grupul de Cercetare VITAL

Afilierile Autorului

Informații despre articol

JAMA Netw Open. 2020; 3 (11): e2025850. doi: 10.1001 / jamanetworkopen.2020.25850

Efectul suplimentelor de vitamina D asupra dezvoltării cancerului avansat

Întrebare  Suplimentarea cu   vitamina D 3 reduce riscul de a dezvolta cancer avansat (metastatic sau fatal) la adulți fără diagnostic de cancer la momentul inițial?

Rezultate   În această analiză secundară a unui studiu clinic randomizat cu 25 871 de pacienți, suplimentarea cu vitamina D 3 a  redus incidența cancerului avansat (metastatic sau letal) în cohorta generală, cu o reducere a riscului mai puternică la persoanele cu greutate normală și fără reducere la indivizi cu supraponderalitate sau obezitate.

Semnificație   Aceste constatări sugerează că vitamina D 3  poate reduce riscul de a dezvolta cancer avansat la adulți fără un diagnostic de cancer la momentul inițial; acest efect protector este evident pentru cei care au un indice de masă corporală normal, dar nu crescut

Importanță   Datele epidemiologice și studiile sugerează că suplimentarea cu vitamina D poate reduce cancerul metastatic și mortalitatea prin cancer, reflectând căile biologice comune.

Obiectiv   Urmărirea posibilei reduceri a deceselor provocate de cancer în studiul cu vitamina D și Omega-3 (VITAL) cu o evaluare a faptului dacă vitamina D reduce incidența cancerului avansat (metastatic sau fatal) și o examinare a posibilului efect modificat de indexul/indicele de masa corporală.

Proiectare, setare și participanți   VITAL este un studiu clinic randomizat, dublu-orb, controlat cu placebo, factor clinic 2 × 2 factorial de vitamina D 3  (colecalciferol, 2000 UI / zi) și acizi grași omega-3 marini (1 g / zi) . Acest studiu clinic multicentric a fost realizat în Statele Unite; participanții au inclus bărbați în vârstă de 50 de ani sau mai mult și femei cu vârsta de 55 de ani sau mai mult, care nu aveau cancer și boli cardiovasculare la momentul inițial. Randomizarea a avut loc din noiembrie 2011 până în martie 2014, iar medicamentele de studiu s-au încheiat la 31 decembrie 2017. Datele pentru această analiză secundară au fost analizate de la 1 noiembrie 2011 până la 31 decembrie 2017.

Intervenții   Suplimentele cu vitamina D 3  (colecalciferol, 2000 UI / zi) și acizi grași omega-3 marini (1 g / zi).

Principalele rezultate și măsuri   Pentru prezenta analiză, rezultatul primar a fost o incidență compozită a cancerului total invaziv metastatic și fatal, deoarece principalul studiu VITAL a arătat o posibilă reducere a cancerului fatal cu suplimentarea cu vitamina D și modificarea efectului prin indicele de masă corporală (IMC; calculat ca greutate în kilograme împărțit la înălțimea în metri pătrati) pentru reducerea incidenței totale a cancerului la persoanele cu IMC normal, dar nu și la persoanele cu supraponderalitate sau obezitate. Analizele secundare au inclus examinarea IMC (<25, 25 la <30 și ≥30) ca modificatori ai efectelor asociațiilor observate.

Rezultate   Dintre 25 871 de participanți VITAL randomizați (51% femei; vârstă medie [SD], 67,1 [7,1] ani), 1617 au fost diagnosticați cu cancer invaziv pe o perioadă mediană de intervenție de 5,3 ani (interval, 3,8-6,1 ani). După cum s-a raportat anterior, nu au fost observate diferențe semnificative pentru incidența cancerului în funcție de brațul de tratament. Cu toate acestea, s-a găsit o reducere semnificativă a cancerelor avansate (metastazate sau fatale) pentru cei randomizați la vitamina D comparativ cu placebo (226 din 12 927 atribuite vitaminei D [1,7%] și 274 din 12 944 atribuite placebo [2,1%]; HR, 0,83 [IC 95%, 0,69-0,99];  P = .04). Când a fost stratificat în funcție de IMC, a existat o reducere semnificativă pentru brațul cu vitamina D în cazul cancerului metastatic sau letal incident la cei cu IMC normal (IMC <25: HR, 0,62 [IC 95%, 0,45-0,86]), dar nu si la cei cu supraponderalitate sau obezitate (IMC 25- <30: HR, 0,89 [IÎ 95%, 0,68-1,17]; IMC ≥30: HR, 1,05 [IÎ 95%, 0,74-1,49]) ( P  = 0,03 pentru interacțiunea prin IMC).

Concluzii și relevanță   În acest studiu clinic randomizat, suplimentarea cu vitamina D a redus incidența cancerului avansat (metastatic sau fatal) în cohorta generală, cu cea mai puternică reducere a riscului observată la persoanele cu greutate normală.

Înregistrare proces   ClinicalTrials.gov Identificator:  NCT01169259 Introducere

Datele studiilor randomizate sugerează un beneficiu mai puternic al vitaminei D asupra mortalității și supraviețuirii de cancer decât in ceea ce priveste incidența cancerului1 , 2  Aceste date sugerează că vitamina D poate avea un rol în reducerea cancerelor mai avansate sau fatale, dar această întrebare specifică nu a fost abordată anterior în studiile randomizate. Studiile de laborator și pe animale arată că vitamina D poate inhiba carcinogeneza și încetini progresia tumorii, inclusiv promovarea diferențierii celulare, inhibarea proliferării celulelor canceroase și a efectelor antiinflamatorii, imunomodulatoare, proapoptotice și antiangiogene. 1 – 4  Vitamina D poate reduce invazivitatea tumorii și înclinația către metastaze, ducând la reducerea mortalității prin cancer. 3 Nivelurile serice mai ridicate de 25-hidroxivitamină D (25 [OH] D) la diagnostic au fost corelate cu supraviețuirea mai lungă la pacienții cu cancer. 5

Comparativ cu placebo în Vitamina D și Omega-3 Trial (VITAL) 6  , raportul de risc (HR) pentru brațul de vitamina D pentru cancerul invaziv total incident a fost de 0,96 (IC 95%, 0,88-1,06), dar pentru mortalitatea totală prin cancer a fost de 0,83 (0,67-1,02), sugerând un rol potențial al vitaminei D în reducerea cancerelor metastatice sau letale. Mai mult, incidenta cancerului a fost redusa la cei cu indice de masă corporală normal (IMC), dar nu și la cei cu supraponderalitate sau obezitate, sugerând că factorii asociați cu obezitatea pot diminua efectul suplimentării cu vitamina D6  Suplimentarea cu vitamina D poate avea efecte diferite la pacienții cu obezitate față de cei fără obezitate, pe baza funcției imune afectate la obezitate. 7 , 8 Afectarea funcției imune în prezența obezității a fost demonstrată atât la modelele umane, cât și la cele animale. 9 , 10  Obezitatea a fost asociată cu inflamația cronică, de grad scăzut și cu dereglarea sistemică a funcției celulelor ucigașe naturale (NK). 11 , 12  Dacă obezitatea este legată de o imunitate tumorală mai slabă, nu este bine stabilit, dar unele dovezi sugerează că terapia de blocare a punctelor de control imunitar în cancer pare să funcționeze mai bine la persoanele cu obezitate. 13  O teorie este că persoanele cu obezitate pot avea unele defecte, cum ar fi expresia PD-1 indusă de obezitate și epuizarea și disfuncția celulelor T, care este corectată cu blocarea punctului de control imun. 14 , 15 Astfel, un echilibru complicat între adipozitate și mediatori imunomodulatori sau inflamatori poate contribui la răspunsul diferențial la vitamina D 3 . 16  Ipotezăm că  suplimentarea cu vitamina D 3 reduce incidența cancerului metastatic la diagnostic sau a cancerului letal și că reducerea riscului este mai pronunțată la persoanele cu greutate normală.

Studiul VITAL a fost un studiu factorial randomizat, dublu-orb, controlat placebo, 2 × 2 factorial, care a examinat beneficiile și riscurile vitaminei D 3  (colecalciferol, 2000 UI / zi) și ale acizilor grași omega-3 marini (1 g / zi) ) (NOTA: aceste doze sunt pentru profilaxie/ preventie ; terapeutic se recomanda 50.000 ui D3 saptamanal si 2 grame EPA omega 3 zilnic) pentru prevenirea primară a cancerului și a bolilor cardiovasculare la 25 871 de participanți (bărbați cu vârsta ≥50 de ani și femei cu vârsta ≥55 de ani).  Figura 1  prezintă proiectarea factorială de test 2-la-2. Persoanele au fost randomizate pentru a primi vitamina D 3 , acizi grași omega-3 marini, ambii agenți activi sau ambii placebo. Protocolul de studiu a fost descris în detaliu în altă parte. 11  Suplimentul 1 conține (1) protocolul original, protocolul final și rezumatul modificărilor și (2) planul original de analiză statistică, planul final de analiză statistică și rezumatul modificărilor. Acest studiu a urmat ghidul de raportare a standardelor consolidate de raportare a testelor ( CONSORT ) pentru studiile clinice randomizate. 17  Procesul a fost aprobat de către comisia de revizuire instituțională a Partners Healthcare / Brigham and Women’s Hospital și a fost monitorizat de un comitet extern de monitorizare a datelor și siguranței, iar agenții studiului au primit aprobarea de investigație pentru noi medicamente de la Administrația SUA pentru Alimente și Medicamente. Toți participanții au acordat consimțământul scris în scris.

Participanții au fost recrutați în toată SUA, echilibrați în funcție de sex și cu scopul de a include cel puțin 5000 de participanți negri. Participanții eligibili nu aveau antecedente de cancer (cu excepția cancerului de piele nonmelanom) sau de boli cardiovasculare la intrarea în studiu. Alte criterii de excludere au inclus insuficiența renală sau dializa, ciroza, istoricul hipercalcemiei sau alte afecțiuni grave care ar împiedica participarea ( Figura 1 ). Participanții au fost obligați să fie de acord să limiteze vitamina D la cel mult 800 UI / zi din toate sursele suplimentare, inclusiv multivitaminele, și să renunțe la utilizarea oricăror suplimente de ulei de pește din afara studiului. Toți participanții finali au finalizat o fază de run-in de 3 luni cu placebo (a se vedea  Figura 1  pentru diagrama fluxului de recrutare). Randomizarea la vitamina D 3, acizii grași omega-3, ambii agenți activi sau ambii placebo au avut loc din noiembrie 2011 până în martie 2014. Medicația de studiu s-a încheiat conform planificării la 31 decembrie 2017. Perioada medie de intervenție a fost de 5,3 ani (interval, 3,8-6,1 ani). După cum sa raportat anterior, rata medie de răspuns la chestionare a fost de 93,1%, iar urmărirea mortalității a fost mai mare de 98% în perioada de urmărire. 6  Utilizarea non-studiu a vitaminei D (> 800 UI / zi) a fost scăzută (3,8% și 6,4% în grupul cu vitamina D 3  și 5,6% și 10,8% în grupul placebo la 2 ani și respectiv 5 ani). 6  Rata medie de aderență (definită ca luând cel puțin două treimi din capsulele de studiu) a fost de 82,0% în grupul cu vitamina D 3  și de 80,3% în grupul placebo. 6

Probele de sânge inițiale au fost colectate în timpul perioadei de testare de la toți participanții dispuși, inclusiv 16 956 din 25 871 randomizați (65,5%). Quest Diagnostics a efectuat 25 de teste (OH) D pe toate probele analizabile folosind cromatografie lichidă – spectrometrie de masă tandem. Linia de bază 25 (OH) D a fost utilizată pentru a evalua modificarea efectului prin starea inițială 25 (OH) D asupra cancerului metastatic și fatal incident. Participanții au primit chestionare de urmărire la 6 luni și 1 an după randomizare și anual ulterior pentru a colecta informații despre aderarea la tratamente randomizate, utilizarea de suplimente de vitamina D și ulei de pește nestudiat, dezvoltarea bolilor majore, recurența cancerului, actualizări privind factorii de risc și potențiale efecte secundare ale agenților de studiu. Capsulele de studiu au fost trimise prin poștă cu chestionare participanților.Chestionarele de bază au colectat date despre factorii de risc pentru cancer, boli cardiovasculare și alte afecțiuni și au inclus un chestionar privind frecvența alimentelor.

Punctele finale principale ale acestei analize au fost ratele punctului final compozit al cancerului metastatic și / sau fatal și timpul de la momentul inițial până la cancerul metastatic / fatal. Ca rezultat secundar, am examinat modificarea efectului prin IMC pe baza suplimentării cu vitamina D 3  . Aceasta este o analiză a intenției de a trata care include participanții pierduți în urma monitorizării.

Participanții care raportează un punct final au fost rugați să semneze o eliberare pentru înregistrările medicale, care au fost revizuite pentru confirmare de către medici orbi la atribuirea tratamentului. Cancerul a fost confirmat cu date histologice sau citologice. 18 Participanții au fost chestionați în fiecare an cu privire la cancer. Metastazele la distanță au fost verificate prin revizuirea dosarului medical în momentul diagnosticului sau când cauza decesului a fost verificată ca fiind cancer. Analizele au inclus doar puncte finale confirmate. Pentru decesele raportate de membrii familiei, rudelor apropiate i s-a cerut permisiunea de a obține dosare medicale și o copie a certificatului de deces. Alternativ, acesta din urmă a fost obținut de la biroul de evidență vitală al statului. Înregistrările au fost examinate de medici pentru a atribui cauza morții. Dacă înregistrările nu erau disponibile (sau participanții au pierdut în urma monitorizării), bazele de date National Index Index Plus și Centers for Medicare și Medicaid Services au fost căutate pentru cauza decesului pe baza informațiilor din certificatul de deces.

Datele au fost analizate de la 1 noiembrie 2011 până la 31 decembrie 2017. S-a stabilit că eșantionul studiului are o putere mai mare de 85% pentru a detecta rapoarte de risc de 0,85 și 0,80 pentru punctele finale primare ale cancerului și respectiv ale bolilor cardiovasculare.

Pentru această analiză, analizele inițiale au comparat caracteristicile inițiale ale participanților în funcție de intervenția randomizată a studiului cu utilizarea   testelor t sau testelor χ 2  . Pentru prezenta analiză, rezultatul principal a fost cancerul avansat (un compozit de cancer total invaziv metastatic și fatal). Am comparat principalele efecte ale vitaminei D 3 pe cancer metastatic și / sau fatal cu utilizarea modelelor de riscuri proporționale Cox care au fost controlate pentru vârstă, sex și grup de randomizare (grupul cu acizi grași omega-3 sau grupul cu placebo). Timpul de persoană a fost numărat de la randomizare până la punctul final, deces sau sfârșitul procesului la 31 decembrie 2017. Am inclus subiecții pierduți pentru urmărire. Graficele de incidență cumulativă și interacțiunile cu timpul au fost utilizate pentru a examina dacă efectele au variat în timp. Pentru a evalua efectele latente, am efectuat analize de sensibilitate prin excluderea primilor 2 ani de urmărire. A fost efectuat un test de proporționalitate pentru a evalua semnificația diferenței în curbele de incidență cumulative.

Analizele secundare au inclus examinarea IMC (<25, 25- <30 și ≥30 kg / m 2 ) ca modificatori de efect ai asociațiilor observate. Am evaluat diferențele generale și specifice site-ului în cancerul metastatic și fatal și timpul de la momentul inițial până la decesul cauzat de cancer pe baza suplimentării cu vitamina D 3  și a IMC. Am evaluat dacă IMC a fost încă echilibrat de grupul de randomizare după stratificarea mediană 25 (OH) D (<31 ng / ml vs ≥31 ng / ml). Am folosit   testul t pentru a compara IMC-ul mediu pentru vitamina D activă versus placebo în cadrul subgrupurilor inițiale de peste și sub mediana 25 (OH) D. Un P  <.05 pe 2 fețe a  fost considerat semnificativ statistic.

Rezultatele secundare suplimentare au inclus influența suplimentării cu vitamina D 3  asupra cancerului metastatic și letal specific la nivelul locului (sân, prostată, colorectal și pulmonar) și variații ale efectului în funcție de rasă sau grup etnic și starea inițială a vitaminei D. Cu toate acestea, nu a existat niciun control pentru testarea ipotezelor multiple și nu s-a făcut nicio ajustare formală a   valorilor P sau a intervalelor de încredere. Astfel, rezultatele privind punctele finale secundare ar trebui interpretate cu prudență

Acest studiu a inclus 25 871 de participanți VITAL randomizați (51% femei) cu vârsta medie (SD) de 67,1 (7,1) ani. Nu au existat diferențe semnificative în caracteristicile inițiale între  grupurile de vitamina D 3 și placebo ( Tabelul 1 ). Participanții au fost echilibrați în funcție de sex, au fost rasial / etnic divers (inclusiv 20,2% afro-americani / negri) și au avut un IMC mediu (SD) de 28,1 (5,7) kg / m 2 . În general, 11 030 de persoane (43%) din  grupurile de vitamina D 3 și placebo au luat vitamina D suplimentară (permisă până la doza recomandată, ≤800 UI / zi). ( Tabelul 1 ) Per total, participanții nu au fost deficienți de vitamina D (medie 25 (OH) D – 30 ng / ml atât în ​​grupurile cu vitamina D, cât și în grupurile placebo). ( Tabelul 112  Nu au existat diferențe semnificative între grupurile de vitamina D și placebo în ceea ce privește diagnosticul incident de hipercalcemie, calculi renali sau simptome gastro-intestinale. 6  Din cei 25 871 de participanți la VITAL, 1617 au fost diagnosticați cu cancer invaziv pe o perioadă mediană de intervenție de 5,3 ani (interval, 3,8-6,1 ani). După cum s-a raportat anterior, nu s-au observat diferențe semnificative în funcție de brațul de tratament pentru cancerul incident (vitamina D 3  vs placebo: raportul de risc [HR] = 0,96; IC 95%, 0,88-1,06;  P  =, 47) sau mortalitatea prin cancer (HR = 0,83 ; IC 95%, 0,67-1,02];  P  = 0,08). 6  Din cele 17 tipuri de cancer specifice site-ului examinate separat, doar cancerul uterin (la 35 de pacienți alocați vitaminei D 3 [0,3%] și 20 atribuite placebo [0,2%]; HR, 1,75; IC 95%, 1,01-3,03;  P  = .046) au arătat diferențe semnificative în funcție de grupul de tratament (eTable 1 în  Suplimentul 2 ). Cu toate acestea, s-a constatat o reducere semnificativă a cancerelor avansate (metastazate sau fatale) pentru cei randomizați la vitamina D comparativ cu placebo (în 226 din 12 927 atribuite vitaminei D 3  [1,7%] și în 274 din 12 944 atribuite placebo [2,1 %]; HR, 0,83; IC 95%, 0,69-0,99;  P  = 0,04) ( Tabelul 2 ). Rata de incidență cumulată a cancerului metastatic și fatal total este prezentată în  Figura 2 . Vitamina D 3 vs curbele placebo încep să divergă la 2 ani; testul de proporționalitate în timp nu a fost semnificativ Rezultatele au fost similare chiar și după excluderea primilor 2 ani de urmărire. ( Tabelul 2 ) Dintre cei 12 927 de participanți repartizați la tratamentul cu vitamina D, 16 au avut cancer metastatic incident și, de asemenea, au murit din cauza cancerului în perioada de studiu; dintre cei 12 944 de participanți randomizați la vitamina D placebo, 24 cu cancer metastatic incident au murit de cancer în perioada de randomizare. Nu a existat nicio asociere a suplimentării cu acizi grași omega-3 cu cancer avansat și nici nu a existat o interacțiune cu brațul de tratament cu omega-3.

Deoarece cancerul de prostată a fost asociat cu o reducere mai mică, dar nesemnificativă, a incidenței cu suplimentarea cu vitamina D (HR, 0,88; IC 95%, 0,72-1,07; P  = 0,19  ) și a fost cel mai mare contribuitor la incidența totală a cancerului, am efectuat analize de sensibilitate, excluzând cancer de prostată metastatic / fatal. Rezultatele au fost similare (HR, 0,85; IC 95%, 0,71-1,02;  P  = 0,08). Numerele de cazuri pentru HR-ul specific site-ului pentru mortalitatea mamară, prostatică, colorectală și pulmonară sunt prea mici pentru a fi interpretate (tabelul 2 din  Suplimentul 2 ).

Când a fost stratificat în funcție de IMC, a existat o reducere semnificativă pentru  brațul cu vitamina D 3 în cazul cancerului metastatic sau letal incident în rândul celor cu IMC normal (IMC <25: HR, 0,62; IC 95%, 0,45-0,86), dar nu în rândul celor cu supraponderal sau obezitate (IMC 25 la <30: HR, 0,89; IC 95%, 0,68-1,17; IMC ≥30: HR, 1,05; IC 95%, 0,74-1,49;  P  = 0,03 pentru interacțiune) ( Tabelul 3 ). A existat o scădere treptată a dimensiunii efectului asocierii tratamentului cu vitamina D cu cancer metastatic și mortalitate prin cancer de către fiecare subgrup mai mare de IMC. Dimensiunile efectului pentru IMC <25 au fost similare pentru decesul total al cancerului, cancerul metastatic și punctul final compozit al cancerului avansat ( Tabelul 3). În timp ce IMC mediu a variat în funcție de valoarea inițială 25 (OH) D (25 [OH] D <31 ng / ml: IMC mediu [SD] în grupul cu vitamina D, 29,0 [6,0]; în grupul placebo, 28,9 [6,0] [ P  = .46]; 25 [OH] D ≥31 ng / mL: medie [SD] IMC în grupul cu vitamina D, 26.9 [5.1]; în grupul placebo, 26.7 [5.0] [ P  = .05]), IMC a rămas echilibrat după grupul de tratament după stratificarea cu 25 (OH) D.

În analizele stratificate în funcție de rasă, nu a fost observată nicio modificare a efectului. Participanți albi non-hispanici (163 alocați vitaminei D 3  și 205 alocați placebo; HR, 0,80; IC 95%, 0,65-0,98;  P  = 0,03) și participanții negri (40 alocați vitaminei D 3  și 46 alocați placebo ; HR, 0,86; IC 95%, 0,56-1,32;  P  = 0,49) a avut o reducere similară a riscului pentru cancerul metastatic total / mortalitatea cauzată de cancer (tabelul 3 din  Suplimentul 2 ).

Pentru persoanele cu niveluri serice scăzute de 25 (OH) D (<20 ng / mL) (n = 2001), rata rezultatelor cancerului metastatic / fatal (la 20 de participanți alocați vitaminei D și 25 atribuiți placebo; HR, 0,85; IC 95%, 0,47-1,54) a fost similar cu rata în rândul persoanelor cu niveluri serice de 25 (OH) D mai mari sau egale cu 20 ng / mL (n = 13 786) (la 124 de participanți alocați vitaminei D și 140 alocați la placebo; HR 0,88; IC 95%, 0,69-1,12) ( P  = 0,95 pentru interacțiune).

În mod similar, nu s-a observat nicio interacțiune semnificativă la nivelul inițial 25 (OH) D la persoanele cu niveluri 25 (OH) D sub mediana 25 (OH) D (<31 ng / ml) (n = 7812) pentru rezultatele cancerului metastatic / fatal ( la 79 de participanți atribuiți vitaminei D și 77 atribuiți placebo; HR 1,05; IC 95%, 0,77-1,44) față de indivizi cu 25 seric (OH) D mai mare sau egal cu 31 ng / ml (n = 7975) (în 65 participanți alocați la vitamina D și 88 alocați la placebo; HR 0,72; IC 95%, 0,52-1,00) ( P  = 0,10 pentru interacțiune).

În această analiză secundară mai detaliată a VITAL, vitamina D 3 a  redus riscul de a dezvolta cancer avansat (metastatic sau fatal) la adulți fără diagnostic de cancer la momentul inițial. Cu toate acestea, acest efect protector a fost evident doar pentru cei cu IMC normal.

Nu am văzut diferențe de efect în funcție de rasă sau nivelurile inițiale de vitamina D.

Descoperirile noastre nu se datorează unui anumit cancer, deoarece a contribuit un amestec larg de cancere. Eliminarea cancerului de prostată din analize nu a atenuat efectul observat al suplimentării cu vitamina D asupra cancerului avansat, sugerând că rezultatele nu au fost determinate doar de cancerul de prostată. Descoperirile noastre sugerează că suplimentarea cu vitamina D poate funcționa printr-un mecanism general, mai degrabă decât specific site-ului, pentru a reduce riscul de cancer avansat.

Primele 2 studii clinice randomizate de  suplimentare cu vitamina D 3 la pacienții cu cancer au fost mixte. Studiul SUNSHINE 19 a  comparat adăugarea de doze mari de vitamina D 3  (vitamina D 3  8000 UI / zi timp de 2 săptămâni și 4000 UI / zi după aceea) comparativ cu doza standard de vitamina D 3  (400 UI / zi) împreună cu chimioterapia standard la 139 de pacienți cu cancer colorectal avansat sau metastatic (urmărire mediană de 22,9 luni) cu o îmbunătățire nesemnificativă a supraviețuirii fără progresie (13,0 vs 11,0 luni;  P  = 0,07), dar cu un risc scăzut de supraviețuire fără progresie sau deces ( HR, 0,74;  P  = 0,02). Mai mult, efectul unei doze mari de vitamina D 3 cu privire la îmbunătățirea supraviețuirii fără progresie părea să fie mai mare la pacienții cu un IMC mai mic ( P  = 0,04 pentru interacțiune). Cu toate acestea, acest studiu a fost mic și insuficient. Studiul AMATERASU 20 a  inclus 417 pacienți cu cancer de tract digestiv în stadiul I-III randomizat la vitamina D 3  (2000 UI / zi) sau placebo. Suplimentarea cu vitamina D a dus la o îmbunătățire semnificativă a supraviețuirii fără recidive la 5 ani. Cu toate acestea, studiul AMATERASU a avut un dezechilibru alocării tratamentului pentru vârstă, iar analiza post-hoc ajustată în funcție de vârstă a relevat un beneficiu semnificativ statistic în favoarea suplimentării (HR de supraviețuire fără recidive, 0,66; IC 95%, 0,43-0,99). 20 O meta-analiză recentă a studiilor clinice randomizate a comparat persoanele care au luat suplimente de vitamina D cu cele care au luat placebo timp de cel puțin 3 ani; persoanele care au luat suplimente de vitamina D au avut un risc cu 13% mai mic de a muri de cancer decât cele care au luat un placeboP  = .005), ceea ce a fost în mare parte atribuit intervențiilor cu administrare zilnică (spre deosebire de administrarea bolusului). 1  O altă meta-analiză a studiilor clinice cu vitamina D a arătat că suplimentarea cu vitamina D a redus riscul de deces prin cancer cu 16%, iar mortalitatea pentru toate cauzele a fost semnificativ mai mică în studiile cu  supliment de vitamina D 3 față de suplimentarea cu vitamina D22 Descoperirile noastre, împreună cu studiile randomizate anterioare, susțin evaluarea continuă a suplimentării cu vitamina D pentru cancerul metastatic. O asociere între suplimentarea cu vitamina D și cancerul metastatic și fatal este plauzibilă biologic. Receptorii vitaminei D se exprimă pe scară largă în tot corpul, iar dovezile experimentale sugerează că vitamina D are activitate antineoplazică. 21  Legarea vitaminei D de receptorul vitaminei D are ca rezultat activarea transcripțională și reprimarea genelor țintă, producând apoptoză, 21  efecte antiproliferative, 22  și efecte imunomodulatoare care pot contribui la reducerea bolii metastatice 21  și a cancerului fatal. 23 O meta-analiză a studiilor prospective de cohortă a arătat că o concentrație mai mare de 25 (OH) D a fost asociată cu 19% risc mai mic de mortalitate prin cancer, iar riscul de mortalitate prin cancer a fost cu 2% mai mic cu fiecare creștere de 20 nmol / L de 25 (OH) Concentrația D. 24  Prevalența deficitului de vitamina D este ridicată la pacienții cu cancer, 25 , 26 ,  cu un studiu care a raportat deficit de vitamina D la 72% dintre pacienții cu cancer. 19 , 27  Factorii de risc cunoscuți pentru deficiența vitaminei D sunt frecvente la această populație, inclusiv sexul feminin, expunerea scăzută la soare, tratamentul paliativ, chimioterapia adjuvantă sau antecedente de intervenții chirurgicale gastrointestinale. 27

Interesant este că am găsit modificări semnificative ale efectului prin IMC. Modificarea efectului nu s-a datorat puterii mai mari de a detecta un efect protector în grupul IMC sănătos. Grupul IMC sănătos a avut cea mai scăzută rată absolută de cancer (doar 31% din cazurile de cancer incidente au fost la participanții cu IMC <25). Puterea statistică a fost de fapt mai mare în rândul celor cu IMC crescut.

O interacțiune dinamică între adipozitate și mediatori imunomodulatori sau inflamatori poate contribui la răspunsul diferențial la vitamina D 3 . În publicația inițială VITAL, 2000 UI / zi de vitamina D a fost asociată cu o incidență totală mai mică a cancerului la participanții cu IMC normal (HR, 0,76; IC 95%, 0,63-0,90), dar nu la cei cu supraponderalitate (HR, 1,04; 95 % CI, 0,90-1,21) sau obezitate (HR, 1,13; 95% CI, 0,94-1,37). 6  În mod similar, am constatat că nivelurile inițiale ale serului 25 (OH) D nu au modificat efectul suplimentării cu vitamina D asupra cancerului metastatic / fatal incident. Aceste rezultate sunt congruente cu analiza inițială VITAL, în care valoarea inițială 25 (OH) D nu a fost un modificator de efect pentru cancerul invaziv total incident (25 [OH] D <mediană de 31 ng / mL vs 25 [OH] D ≥ mediană de 31 ng / mL, P  = .57 pentru interacțiune) în timp ce IMC a fost un modificator semnificativ al efectului pentru cancerul total ( P  = .002 pentru interacțiune). Mai mult, un nivel seric 25 (OH) D mai mare a fost corelat cu IMC mai mic.

Deși aceste descoperiri s-ar putea datora întâmplării, se știe că obezitatea afectează axa vitaminei D. 28  Capacitatea mai mare de stocare a vitaminei D la persoanele cu obezitate prin sechestrarea grăsimilor 29  sau diluția volumetrică 30  poate duce la scăderea vitaminei plasmatice D. Cu toate acestea, în cohorta generală VITAL, nici persoanele cu sau fără obezitate nu au avut deficit de vitamina D după suplimentarea cu vitamina D . 6  Nivelul hormonului paratiroidian, un marker al eficacității vitaminei D, este mai mare la persoanele cu obezitate comparativ cu persoanele slabe la un nivel dat de 25 (OH) D, 31 , 32 ,  care ar fi în concordanță cu dereglarea hormonală legată de obezitate și cu un beneficiu mai mic de suplimentare. 31 Nivelurile scăzute de 25-hidroxivitamină D 3  (<20 ng / ml) declanșează o creștere compensatorie a nivelurilor hormonilor paratiroidieni, care accelerează resorbția osoasă și stabilizează calciu. Atunci când nivelurile de vitamina D sunt deficitare, suplimentarea cu vitamina D duce de obicei la reducerea nivelului seric al hormonilor paratiroidieni la persoanele cu greutate normală. Cu toate acestea, doza de suplimentare cu vitamina D pentru suprimarea nivelurilor hormonilor paratiroidieni poate diferi la adulții cu supraponderalitate și obezitate. 33

Alternativ, din cauza diluției volumetrice 30  sau a scăderii bioactivității vitaminei D, persoanele cu supraponderalitate sau obezitate pot necesita doze mai mari pentru a obține beneficii de cancer, analog diferențelor de mărime corporală în cerințele de dozare a aspirinei. În  plus, cercetările anterioare indică alte mecanisme prin care suplimentarea cu vitamina D ar putea reduce riscul de cancer la participanții cu greutate normală, dar nu și la cei cu supraponderalitate sau obezitate. Vitamina D poate modula activitatea NK; suplimentarea dietetică cu vitamina D a crescut activitatea NK la șoarecii slabi, dar nu la șoarecii obezi. 12  În mod similar, un studiu a raportat alterarea fenotipului celulei NK și a modificărilor subsetului celulelor NK la indivizii obezi față de indivizii slabi. 11 

Puncte tari și limitări

Studiul nostru are mai multe puncte forte, incluzând un eșantion larg de populație generală cu diversitate rasială / etnică și geografică, dozare zilnică a vitaminei D, rate ridicate de urmărire și aderență la administrarea pilulelor, puncte finale stabilite riguros, linii de bază și recoltări de sânge de urmărire în multe participanți și a atins nivelul mediu de 25 (OH) D în intervalul vizat. Limitările studiului nostru justifică totuși luarea în considerare. Puterea este încă limitată în acest moment, dar aceste date preliminare pot informa studiile curente în curs cu vitamina D. Ca studiu de prevenție primară, VITAL a studiat 2000 UI pe zi, dar pot fi luate în considerare doze mai mari pentru studii viitoare. Durata medie a tratamentului a fost de 5,3 ani, dar aceasta este o durată obișnuită pentru tratamentele adjuvante utilizate în cancer, inclusiv cancerul de sân. studii în curs 35 , 36 va adăuga informații referitoare la alte doze, deși unele utilizează dozarea în bolus. O urmărire postintervențională de 2 ani a cohortei noastre este în desfășurare pentru a surprinde evenimentele ulterioare și a crește puterea statistică pentru a evalua punctele finale.

În rezumat, acest studiu clinic randomizat cu suplimente zilnice cu doze mari de vitamina D timp de 5 ani a redus incidența cancerului avansat (metastatic sau fatal) în cohorta generală a adulților fără diagnostic de cancer la momentul inițial, cu o reducere a riscului mai puternică la persoanele cu greutate normală. Ar trebui luate în considerare studii suplimentare randomizate care se concentrează pe pacienții cu cancer, precum și investigații privind beneficiul diferențial prin IMC. Chiar dacă efectele vitaminei D au fost modeste, suplimentarea cu vitamina D la nivelurile studiate este mult mai puțin toxică și costuri mai mici decât multe terapii actuale împotriva cancerului. Înapoi sus Informații despre articol

Acceptat pentru publicare:  9 septembrie 2020.

Publicat:  18 noiembrie 2020. doi: 10.1001 / jamanetworkopen.2020.25850

Acces deschis:  Acesta este un articol cu ​​acces deschis distribuit în condițiile  licenței CC-BY . © 2020 Chandler PD și colab. Rețea JAMA deschisă .

Autor corespondent:  Paulette D. Chandler, MD, MPH, Brigham and Women’s Hospital, Harvard Medical School, 900 Commonwealth Ave, 3rd Floor, Boston, MA 02215 ( pchandler@bwh.harvard.edu ).

Contribuțiile autorului:  Dr. Chandler și Chen au avut acces deplin la toate datele din studiu și își asumă responsabilitatea pentru integritatea datelor și acuratețea analizei datelor.

Concept și design:  Chandler, Giovannucci, Manson.

Achiziționarea, analiza sau interpretarea datelor:  Chandler, Chen, Ajala, Hazra, Cook, Bubes, Lee, Willett, Buring, Manson.

Redactarea manuscrisului:  Chandler, Ajala, Hazra, Manson.

Revizuirea critică a manuscrisului pentru un conținut intelectual important:  Toți autorii.

Analiză statistică:  Chandler, Chen, Hazra, Cook, Bubes, Giovannucci, Willett.

Finanțare obținută:  Manson.

Suport administrativ, tehnic sau material:  Bubes, Lee, Manson.

Supraveghere:  Lee, Manson.

Epidemiologia cancerului:  Hazra.

Dezvăluiri privind conflictele de interese:  Dr. Lee a raportat că a primit subvenții de la Institutele Naționale de Sănătate în timpul desfășurării studiului. Dr. Buring a raportat că a primit subvenții de la Institutele Naționale de Sănătate în timpul desfășurării studiului; în plus, soțul doctorului Buring a făcut parte din consiliul consultativ științific al Pharmavite, care a furnizat vitamina D, placebo și ambalaje pentru acest studiu. Dr. Manson a raportat că a primit subvenții de la Institutele Naționale de Sănătate, sprijin non-financiar de la Pronova BioPharma / BASF, Pharmavite și Quest Diagnostics în timpul desfășurării studiului. Nu au fost raportate alte dezvăluiri.

Finanțare / sprijin: VITAL a fost sprijinit prin subvenții U01 CA138962 și R01 CA138962, care au inclus sprijin din partea Institutului Național al Cancerului; Institutul Național al Inimii, Plămânilor și Sângelui; Biroul de suplimente alimentare; Institutul Național pentru Tulburări Neurologice și Accident vascular cerebral; și Centrul Național pentru Sănătate Complementară și Integrativă. Studiile auxiliare sunt susținute de subvenții de la mai multe institute, inclusiv Institutul Național pentru Inimă, Plămân și Sânge; Institutul Național al Diabetului și al Bolilor Digestive și Renale; Institutul Național pentru Îmbătrânire; Institutul Național de Artrită și Boli Musculo-scheletice și ale Pielii; Institutul Național de Sănătate Mentală; si altii. Dr. Chandler a primit sprijin din grantul U01 CA138962 de la Institutul Național al Cancerului și din grantul 127524-MRSG-15-012-01-CNE de la Societatea Americană a Cancerului.Pharmavite LLC (vitamina D) și Pronova BioPharma din Norvegia și BASF (ulei de pește Omacor) au donat agenții de studiu, potrivind placebo-urile și ambalarea sub formă de pachete calendaristice. Quest Diagnostics a măsurat 25-hidroxivitamina D în ser, fără niciun cost pentru studiu.

Rolul  finanțatorului / sponsorului: sponsorii Institutelor Naționale de Sănătate ale VITAL au avut un rol de colaborare în proiectarea și desfășurarea studiului și interpretării datelor. Cu toate acestea, deciziile finale referitoare la cele de mai sus, precum și colectarea, gestionarea, analiza, revizuirea sau aprobarea manuscrisului, precum și decizia de a trimite manuscrisul pentru publicare au rămas la investigatorii studiului și la grupul de cercetare al studiului.

Grupul de cercetare VITAL:  Membrii grupului de cercetare VITAL sunt după cum urmează:  Comitetul de conducere VITAL:  Brigham and Women’s Hospital, Harvard Medical School, Boston: JoAnn E. Manson, MD, DrPH (președinte), Julie E. Buring, ScD ( Președinte), Nancy R. Cook, ScD, I-Min Lee, MD, ScD, William Christen, ScD, Shari S. Bassuk, ScD, Samia Mora, MD, MHS, Heike Gibson, PhD, David Gordon, MAT, Trisha Copeland , MS, RD, Denise D’Agostino, BS, Georgina Friedenberg, MPH, Claire Ridge, MPH, Vadim Bubes, PhD, Edward L. Giovannucci, MD, ScD, Walter C. Willett, MD, DrPH; Școala de sănătate publică Harvard TH Chan: doctorii Manson, Buring, Cook, Lee, Giovannucci și Willett.  Consultanți științifici: Universitatea din Carolina de Nord, Chapel Hill: John Baron, MD, MS, MSc; Boston Medical Center: Michael Holick, MD, dr.; Universitatea din Carolina de Sud: Bruce Hollis, dr.  Alți membri ai grupului de cercetare VITAL: Spitalul Brigham și Femei: Christine M. Albert, MD, MPH, Diane Gold, MD, MPH, Meryl LeBoff, MD, Olivia Okereke, MD, MS, Aruna Pradhan, MD, MPH, MSc, Howard Sesso, ScD, MPH, Wendy Chen, MD, MPH, Paulette Chandler, MD, MPH, J. Michael Gaziano, MD, MPH, Olga Demler, dr., Kathryn Rexrode, MD, MPH, Karen Costenbader, MD, MPH, John Forman, MD, Erik Alexander, MD , Sonia Friedman, MD, Jeffrey Katz, MD, MS, Shumin Zhang, MS, ScD, Jennifer Lin, dr., Joseph Walter, BS, Julie Duszlak, BS, Kate Kalan, BS, Jean MacFadyen, BA, Natalya Gomelskaya, MD, David Bates, BS, Ara Sarkissian, MS, Mary Breen, Yeulolani Andrade, Manickavasagar Vinayagamoorthy, dr., Chunying Li, BM, dr., Eunjung Kim, MS, Franco Giulianini, BS, MS, dr., Gregory Kotler, dr., Marty Van Denburgh , BA, Rimma Dushkes, MS, Yanyan Liu, MS, dr., Eduardo Pereira, MS, Lisa Fields-Johnson, BS,George Menjin, AA, Lucy Liu, BA, Lauren Girard, BS, Scott Zeller, MA, PA, Naomi Riches, BA, MPH, Katelyn Hasson, BS, Ellen Bhang, BA, MSW, Maria Revilla, BS, Elena McCarthy, BS , Alex Moran, BS, Kristen Haise, Leah Arsenault, BA, Philomena Quinn, Sancia Grimes, Ivan Fitchorov, MS, dr., Kurt Schwerin, BA, Shamikhah Curry, Annie Murray, Angela Zhang, Diana Walrond-Williams, Alison Weinberg, MA , Chris Pfeffer, BS, Margarette Haubourg, Viviane Nguyen, BS, Henry Ouellette, Rolando Rodriguez, Tony Montgomery, Keith Morse, Vincent Guzman, Megan Perry, BA, Sandra Weekes, Doug Smith, BS, Allison Clar, BS, Sara Curran, BS, Yaneve Fonge, BSc, David Hibbert, BA, Louisa Paine, BA, Kelly Royce, BS, Courtney Splaine, BA, Jennifer McMahon, David Eldridge, BA, Laura Hand, BA, Kay Inandan, BS, Meghan Rieu Werden, BS , Harriet Samuelson, MA, Andrea Hrbek, Megan Mele,BS, Eileen Bowes, Mary Anne Ryan, BA; Spitalul General din Massachusetts, Boston: Carlos Camargo, MD, DrPH, Jacqueline Danik, MD, DrPH, Ravi Thadhani, MD, MPH; Universitatea Vanderbilt, Nashville: Thomas Wang, MD; Rush University Medical Center, Chicago: Raj C. Shah, MD; Universitatea din California, San Francisco: Michelle A. Albert, MD, MPH; Universitatea Emory: Carlos Kase, MD; Centre pentru controlul și prevenirea bolilor, programul de standardizare a vitaminei D: Hubert Vesper, dr., Și Julianne Botelho, dr.Carlos Kase, MD; Centre pentru controlul și prevenirea bolilor, programul de standardizare a vitaminei D: Hubert Vesper, dr., Și Julianne Botelho, dr.Carlos Kase, MD; Centre pentru controlul și prevenirea bolilor, programul de standardizare a vitaminei D: Hubert Vesper, dr., Și Julianne Botelho, dr. Consiliul de monitorizare a datelor și siguranței (membri votanți):  Universitatea Yale: Lawrence S. Cohen, MD; Universitatea din Boston: Theodore Colton, ScD; Universitatea Wake Forest: Mark A. Espeland, dr.; Universitatea din California, San Francisco: Craig Henderson, MD; Universitatea din Boston: Alice H. Lichtenstein, ScD, Rebecca A. Silliman, MD, PhD; Universitatea Emory: Nanette Wenger, MD (catedră). Ex-Officio Members:  National Institutes of Health: Josephine Boyington, PhD, MPH, Rebecca Costello, PhD, Cindy Davis, PhD, Peter Greenwald, MD, Gabriela Riscuta, MD, and Harold Seifried, PhD.

Disclaimer:  Opiniile exprimate în manuscris sunt cele ale autorilor studiului și nu reprezintă neapărat punctele de vedere ale Departamentului Sănătății și Serviciilor Umane / Institutelor Naționale de Sănătate.

Declarație privind partajarea datelor: a se  vedea  suplimentul 3 .

Contribuții suplimentare:  Autorii mulțumesc anchetatorilor VITAL, personalului și participanților la proces pentru devotamentul și angajamentul remarcabil . 

Referințe 

1. Keum N, Lee DH, Greenwood DC, Manson JE, Giovannucci E. Suplimentarea cu vitamina D și incidența totală a cancerului și mortalitatea: o meta-analiză a studiilor controlate randomizate.    Ann Oncol . 2019; 30 (5): 733-743. doi: 10.1093 / annonc / mdz059 PubMed Google Scholar Crossref 

2. Zhang Y, Fang F, Tang J, și colab. Asocierea între suplimentarea cu vitamina D și mortalitate: revizuire sistematică și meta-analiză.    BMJ . 2019; 366: l4673. doi: 10.1136 / bmj.l4673 PubMed Google ScholarCrossref 

3. Feldman D, Krishnan AV, Swami S, Giovannucci E, Feldman BJ. Rolul vitaminei D în reducerea riscului și progresiei cancerului.    Nat Cancer Rev . 2014; 14 (5): 342-357. doi: 10.1038 / nrc3691 PubMed Google Scholar Crossref 

4. Institutul de Medicină Comitetul pentru revizuirea aporturilor dietetice de referință pentru vitamina D și calciu. Ross AC, Taylor CL, Yaktine AL, Del Valle HB, eds.   Dietary de referință pentru calciu și vitamina D . Washington, DC: National Academies Press; 2011. 

5. Keum N, Giovannucci E. Suplimentele cu vitamina D și incidența și mortalitatea prin cancer: o meta-analiză.    Br J Cancer . 2014; 111 (5): 976-980. doi:10.1038 / bjc.2014.294 PubMed Google Scholar Crossref 

6. Manson JE, Cook NR, Lee IM, și colab. Grupul de cercetare VITAL. Suplimentele cu vitamina D și prevenirea cancerului și a bolilor cardiovasculare.    N Engl J Med . 2019; 380 (1): 33-44. doi: 10.1056 / NEJMoa1809944 PubMed Google Scholar Crossref 

7. Martineau AR, Jolliffe DA, Hooper RL, și colab. Suplimentarea cu vitamina D pentru prevenirea infecțiilor acute ale tractului respirator: revizuire sistematică și meta-analiză a datelor individuale ale participanților.    BMJ . 2017; 356: i6583. doi: 10.1136 / bmj.i6583 PubMed Google Scholar Crossref

 8.Formenti AM, Tecilazich F, Frara S, Giubbini R, De Luca H, Giustina A. Indicele de masă corporală prezice rezistența la vitamina D activă la pacienții cu hipoparatiroidism.    Endocrine . 2019; 66 (3): 699-700. doi: 10.1007 / s12020-019-02105-6 PubMed Google Scholar Crossref 

9. Guzik TJ, Skiba DS, Touyz RM, Harrison DG. Rolul infiltrării celulelor imune în țesutul adipos disfuncțional.    Cardiovasc Res . 2017; 113 (9): 1009-1023. doi: 10.1093 / cvr / cvx108 PubMed Google Scholar Crossref 

10. Martí A, Marcos A, Martínez JA. Relațiile obezității și funcției imune.    Obes Rev . 2001; 2 (2): 131-140. doi:10.1046 / j.1467-789x.2001.00025.x PubMed Google Scholar Crossref 

11. Bähr I, Jahn J, Zipprich A, Pahlow I, Spielmann J, Kielstein H. Fenotipuri de subseturi de celule ucigașe naturale afectate la obezitatea umană.    Immunol Res . 2018; 66 (2): 234-244. doi: 10.1007 / s12026-018-8989-4 PubMed Google Scholar Crossref 

12. Lee GY, Park CY, Cha KS, Lee SE, Pae M, Han SN. Efect diferențial al suplimentării dietetice cu vitamina D asupra activității naturale a celulelor ucigașe la șoareci slabi și obezi    J Nutr Biochem . 2018; 55: 178-184. doi: 10.1016 / j.jnutbio.2018.01.004 PubMed Google Scholar Crossref 

13.Woodall MJ, Neumann S, Campbell K, Pattison ST, Young SL. Efectele obezității asupra imunității anti-cancer și a imunoterapiei împotriva cancerului.    Cancerele (Basel) . 2020; 12 (5): E1230. doi: 10.3390 / cancers12051230 PubMed Google Scholar 

14. Cuyàs E, Verdura S, Martin-Castillo B, și colab. Imunometabolismul intrinsec al celulelor tumorale și nutriția de precizie în imunoterapia cancerului.    Cancerele (Basel) . 2020; 12 (7): E1757. doi: 10.3390 / cancers12071757 PubMed Google Scholar 

15. Wang Z, Aguilar EG, Luna JI, și colab. Efectele paradoxale ale obezității asupra funcției celulelor T în timpul progresiei tumorii și blocării punctului de control PD-1.    Nat Med. 2019; 25 (1): 141-151. doi: 10.1038 / s41591-018-0221-5 PubMed Google Scholar Crossref 

16. Abbas MA. Funcțiile fiziologice ale vitaminei D în țesutul adipos.    J Steroid Biochem Mol Biol . 2017; 165 (Pt B): 369-381. doi: 10.1016 / j.jsbmb.2016.08.004 Google Scholar

 17. Schulz KF, Altman DG, Moher D, CONSORT Group. Declarație CONSORT 2010: ghiduri actualizate pentru raportarea studiilor randomizate de grup paralel.    Ann Intern Med . 2010; 152 (11): 726-732. doi: 10.7326 / 0003-4819-152-11-201006010-00232 PubMed Google Scholar Crossref 

18. Fritz AG, Percy C, Jack A, și colab.  Clasificarea internațională a bolilor pentru oncologie (ICD-O) , ediția a treia. Geneva: Organizația Mondială a Sănătății; 2000. 

19. Ng K, Nimeiri HS, McCleary NJ și colab. Efectul suplimentării cu doză mare comparativ cu doza standard de vitamina D3 asupra supraviețuirii fără progresie la pacienții cu cancer colorectal avansat sau metastatic: studiul clinic randomizat SUNSHINE    JAMA . 2019; 321 (14): 1370-1379. doi: 10.1001 / jama.2019.2402
Articolul PubMed Google Scholar Crossref 

20. Urashima M, Ohdaira H, Akutsu T, și colab. Efectul suplimentării cu vitamina D asupra supraviețuirii fără recidive la pacienții cu cancer de tract digestiv: studiul clinic randomizat AMATERASU.    JAMA. 2019; 321 (14): 1361-1369. doi: 10.1001 / jama.2019.2210
Articolul PubMed Google Scholar Crossref 

21. Díaz GD, Paraskeva C, Thomas MG, Binderup L, Hague A. Apoptoza este indusă de metabolitul activ al vitaminei D3 și analogul său EB1089 în celulele adenomului colorectal și carcinomului: posibile implicații pentru prevenire și terapie.    Cancer Res . 2000; 60 (8): 2304-2312. PubMed Google Scholar 

22. Scaglione-Sewell BA, Bissonnette M, Skarosi S, Abraham C, Brasitus TA. Un analog de vitamina D3 induce o oprire a fazei G1 în celulele CaCo-2 prin inhibarea cdk2 și cdk6: rolurile ciclinei E, p21Waf1 și p27Kip1.    Endocrinologie . 2000; 141 (11): 3931-3939. doi:10.1210 / endo.141.11.7782 PubMed Google Scholar Crossref

 23. Holick MF. Deficitul de vitamina D.    N Engl J Med . 2007; 357 (3): 266-281. doi: 10.1056 / NEJMra070553 PubMed Google Scholar Crossref 

24. Han J, Guo X, Yu X și colab. 25-hidroxivitamina D și incidența totală a cancerului și mortalitatea: o meta-analiză a studiilor prospective de cohortă.    Nutrienți . 2019; 11 (10): E2295. doi: 10.3390 / nu11102295 PubMed Google Scholar 

25.Yuan C, Sato K, Hollis BW și colab. Nivelurile plasmatice de 25-hidroxivitamină D și supraviețuirea la pacienții cu cancer colorectal avansat sau metastazat: constatări din CALGB / SWOG 80405 (Alianța).   Clin Cancer Res . 2019; 25 (24): 7497-7505. doi: 10.1158 / 1078-0432.CCR-19-0877

 26. Kennel KA, Drake MT. Vitamina D la pacientul cu cancer.    CurrOpin Suport Palliat îngrijire . 2013; 7 (3): 272-277. doi: 10.1097 / SPC.0b013e3283640f74 PubMed Google Scholar Crossref 

27. Alkan A, Köksoy EB. Deficitul de vitamina D la pacienții cu cancer și predictori pentru screening (studiu D-ONC).    Curr Cancer Probi . 2019; 43 (5): 421-428. doi: 10.1016 / j.currproblcancer.2018.12.008PubMed Google Scholar Crossref

 28. Jung YS, Wu D, Smith D, Meydani SN, Han SN. Nivelurile de 1,25-dihidroxivitamină disregulate în obezitatea indusă de dietă bogată în grăsimi pot fi restabilite prin trecerea la o dietă cu conținut scăzut de grăsimi la șoareci.    Nutr Res . 2018; 53: 51-60. doi: 10.1016 / j.nutres.2018.03.008 PubMed Google Scholar Crossref 

29. Wortsman J, Matsuoka LY, Chen TC, Lu Z, Holick MF. Scăderea biodisponibilității vitaminei D la obezitate.    Am J Clin Nutr . 2000; 72 (3): 690-693. doi: 10.1093 / ajcn / 72.3.690 PubMed Google Scholar Crossref 

30.Drincic AT, Armas LA, Van Diest EE, Heaney RP. Diluția volumetrică, mai degrabă decât sechestrarea explică cel mai bine starea scăzută de vitamina D a obezității.    Obezitatea (Silver Spring) . 2012; 20 (7): 1444-1448. doi: 10.1038 / oby.2011.404 PubMed Google Scholar Crossref 

31. Kim H, Chandler P, Ng K, Manson JE, Giovannucci E. Obezitatea și eficacitatea suplimentării cu vitamina D 3  la adulții negri sănătoși.    Cancerul Cauze de control . 2020; 31 (4): 303-307. doi: 10.1007 / s10552-020-01275-3 PubMed Google Scholar Crossref 

32.Moslehi N, Shab-Bidar S, Mirmiran P, Hosseinpanah F, Azizi F. Determinanți ai răspunsului hormonului paratiroidian la suplimentarea cu vitamina D: o revizuire sistematică și meta-analiză a studiilor controlate randomizate.    Br J Nutr . 2015; 114 (9): 1360-1374. doi: 10.1017 / S0007114515003189 PubMed Google Scholar Crossref 

33. Lotito A, Teramoto M, Cheung M, Becker K, Sukumar D. Răspunsurile serice ale hormonilor paratiroidieni la suplimentarea cu vitamina D la adulții supraponderali / obezi: o revizuire sistematică și meta-analiză a studiilor clinice randomizate.    Nutrienți . 2017; 9 (3): E241. doi: 10.3390 / nu9030241 PubMed Google Scholar

 34.Rothwell PM, Cook NR, Gaziano JM și colab. Efectele aspirinei asupra riscurilor de evenimente vasculare și cancer în funcție de greutatea corporală și doză: analiza datelor individuale ale pacienților din studiile randomizate.    Lancet . 2018; 392 (10145): 387-399. doi: 10.1016 / S0140-6736 (18) 31133-4 PubMed Google Scholar Crossref 

35. Bassuk SS, Manson JE, Lee IM, și colab. Caracteristicile de bază ale participanților la VITamin D și OmegA-3 TriaL (VITAL).    Procesele Contemp Clin . 2016; 47: 235-243. doi: 10.1016 / j.cct.2015.12.022 PubMed Google Scholar Crossref 

36.Haidari F, Abiri B, Iravani M și colab. Efectele co-suplimentării acizilor grași cu vitamina D și omega-3 asupra biomarkerilor inflamatori, a markerului tumoral CEA și a stării nutriționale la pacienții cu cancer colorectal: un protocol de studiu pentru un studiu controlat randomizat dublu orb   Procesele . 2019; 20 (1): 682. doi: 10.1186 / s13063-019-3719-3 PubMed Google Scholar Crossref

https://jamanetwork.com/journals/jamanetworkopen/fullarticle/10.1001/jamanetworkopen.2020.25850

Latura întunecată a alimenelor – glucoză, cetone și COVID-19: un rol posibil pentru dieta ketogenică?

Jurnalul de Medicină Translațională volum 18 , Număr articol:  441 ( 2020 ) Citați acest articol

Abstract

Noua boală coronavirus (COVID-19) reprezintă o provocare serioasă pentru sistemele de îngrijire a sănătății din întreaga lume, cu un impact enorm asupra condițiilor de sănătate și pierderea de vieți omenești. În special, obezitatea și comorbiditățile sale asociate sunt strict legate de rezultatele clinice mai slabe ale bolii COVID-19. Recent, există un interes tot mai mare în utilizarea clinică a dietelor ketogenice (KD), în special în contextul obezității severe cu complicații metabolice asociate. KD s-au dovedit eficiente pentru o reducere rapidă a masei grase, păstrând masa slabă și oferind o stare nutrițională adecvată. În special, creșterea fiziologică a nivelurilor plasmatice ale corpurilor cetonice exercită importante efecte antiinflamatorii și imunomodulatoare, care pot fi dezvăluite ca instrumente prețioase pentru prevenirea infecției și a posibilelor rezultate adverse ale bolii COVID-19.Discutăm aici despre importanța KD pentru o reducere rapidă a mai multor factori de risc critici pentru COVID-19, cum ar fi obezitatea, diabetul de tip 2 și hipertensiunea, pe baza efectelor cunoscute ale corpurilor cetonice asupra inflamației, imunității, profilului metabolic și funcției cardiovasculare. Credem că o reducere rapidă a tuturor factorilor de risc modificabili, în special a obezității, cu complicațiile sale metabolice, ar trebui să fie un pilon al politicilor și intervențiilor de sănătate publică, având în vedere viitoarele valuri de infecție cu SARS-CoV-2.în special obezitatea, cu complicațiile sale metabolice, ar trebui să fie un pilon al politicilor și intervențiilor de sănătate publică, având în vedere viitoarele valuri de infecție cu SARS-CoV-2.în special obezitatea, cu complicațiile sale metabolice, ar trebui să fie un pilon al politicilor și intervențiilor de sănătate publică, având în vedere viitoarele valuri de infecție cu SARS-CoV-2.

Introducere

Datele Organizației Mondiale a Sănătății (OMS) indică faptul că gripa sezonieră cauzează aproximativ 3 până la 5 milioane de cazuri de boli grave, 290.000 până la 650.000 de decese din cauze respiratorii și 99.000-200.000 de decese din infecții ale tractului respirator inferior [ 1 ]. În general, infecțiile respiratorii acute sunt una dintre principalele cauze de morbiditate din întreaga lume și, mai precis, infecțiile tractului respirator inferior sunt principala cauză infecțioasă de deces și a cincea cauză de deces în general.

Având în vedere eficacitatea relativ scăzută a vaccinării antigripale, practicile de sănătate publică au fost puse în aplicare de către autoritățile sanitare pentru a limita răspândirea virusurilor respiratorii. Practicile comune de sănătate sugerate sunt legate de comportamentele oamenilor, cum ar fi spălarea mâinilor, utilizarea măștilor de față și protecția ochilor, distanțarea socială și au fost încurajate în timpul răspândirii pandemice a bolii Coronavirus 2019 (COVID-19), cauzată de un virus (SARS-CoV -2) pentru care nu există încă un vaccin [ 2 ] și nici tratamente farmacologice eficiente până acum.

Factori de risc pentru COVID-19: rolul comportamentelor stilului de viață

În ciuda ratei actuale a mortalității este de 2,3% [ 3 ], apariția unui număr mare de pacienți infectați într-o perioadă scurtă de timp a determinat dificultăți relevante în sistemul de îngrijire a sănătății din mai multe țări, cu o pierdere enormă de vieți omenești. Printre factorii de risc pentru SARS-CoV-2, numeroase studii au identificat o asociere specifică a decesului COVID-19 cu vârsta cronologică avansată [ 3 ] și prezența comorbidităților, în special diabet, hipertensiune arterială, obezitate și boli renale cronice [ 4 ]. Unele dintre aceste boli sunt legate de comportamentul stilului de viață, prin urmare ar trebui să fie obligatoriu să se acționeze asupra factorilor de risc menționați mai sus pentru a îmbunătăți rezultatele pacienților și pentru a reduce impactul asupra sănătății a posibilelor noi focare viitoare [ 5 ].

Merită menționat faptul că, de asemenea, creșterea sedentarismului a avut loc în timpul măsurilor recente de blocare a dus la un impact negativ asupra stării generale de sănătate. Sedentarismul datorat politicii de adăpost în loc aplicat în mai multe țări în timpul pandemiei COVID-19, a manifestat efecte dăunătoare asupra metabolismului mușchilor scheletici, inducând rezistența la insulină, depunerea grăsimilor și inflamația sistemică de grad scăzut, cu o agravare generală a parametrilor metabolici, controlul glucozei și stare inflamatorie. În acest sens, obezitatea sarcopenică, caracterizată prin coexistența adipozității excesive și a masei musculare scăzute, este puternic asociată cu un risc cardiovascular crescut, rezistență la insulină și inflamație de grad scăzut; prin urmare, reprezintă, împreună cu inadecvarea stării nutriționale,o afecțiune asociată cu o susceptibilitate crescută la infecția virală [6 ]. Important, pacienții cu COVID-19 bolnavi critici cu obezitate și malnutriție au prezentat rezultate mai slabe decât pacienții obezi fără malnutriție [ 7 ].

În timpul blocării, stilul de viață și obiceiurile alimentare ale unei mari părți a populației din întreaga lume s-au schimbat dramatic. Cele mai importante sfaturi nutriționale au fost reducerea consumului de junk food și preferarea produselor alimentare cu proprietăți antioxidante și antiinflamatorii, cu potențialul de a afecta pozitiv sistemul imunitar [ 8 , 9 ]. Se știe că obiceiurile nutriționale nesănătoase, bogate în grăsimi și carbohidrați, sunt asociate cu obezitatea și tulburările de somn. Important, o scădere marcată a calității somnului și o creștere asociată a indicelui de masă corporală au fost descrise în timpul carantinei [ 10 ]. Mai mult, cantitatea redusă de activitate fizică în timpul carantinei a afectat în mod semnificativ starea generală de sănătate a populației [ 6 ,11 , 12 ]. Prin urmare, există riscul real ca un număr mai mare de pacienți cu obezitate și un control slab al glicemiei să fie expus la noi valuri de infecție cu Sars-Cov2.

Obezitate și hiperglicemie: doi ticăloși pe etapa COVID-19

Obezitatea reprezintă unul dintre factorii de prognostic recunoscuți pentru necesitatea terapiei intensive și a riscului ridicat de deces în timpul infecției cu SARS-CoV-2 [ 13 ]. În concordanță cu aceasta, o schimbare importantă a bolii severe COVID-19 la vârste mai mici a fost clar documentată cu obezitatea [ 14 ]. Obezitatea afectează mai multe funcții critice, caracterizând o vulnerabilitate crescută față de rezultatele adverse ale COVID-19 [ 15 ]. Starea de obezitate restricționează ventilația prin întreruperea excursiei diafragmei, modifică răspunsurile imune la infecția virală [ 16 ], determină o inflamație cronică, de grad scăzut și agravează toleranța la glucoză și stresul oxidativ cu efecte adverse asupra funcției cardiovasculare [ 17].]. Important, pacienții obezi prezintă un sindrom COVID-19 mai sever, deoarece obezitatea se caracterizează printr-un echilibru hemostatic modificat, cu coagulare crescută și fibrinoliză defectă, ceea ce duce la o stare pro-trombotică [ 18 ]. Mai mult, coexistența obezității și a bolii hepatice grase asociate cu metabolizarea (MAFLD) determină un risc crescut de ~ 6 ori de apariție severă a COVID-19, independent de vârstă, sex, fumat, diabet, hipertensiune și dislipidemie [ 19 ] .

În special, un raport recent a arătat că țesutul adipos exprimă niveluri foarte ridicate de transcrieri pentru ACE2 [ 20 ], o enzimă atașată la suprafața exterioară a pneumocitelor, care este utilizată de coronavirusuri pentru a intra și a infecta celulele, ridicând întrebarea dacă țesutul adipos poate reprezenta un rezervor de SARS-CoV-2 și un sit strategic pentru a amplifica cascada de citokine declanșată de infecția virală [ 21 ].

Epidemia globală a COVID-19 a determinat, de asemenea, implicații importante asupra terapiei tulburărilor metabolice comune, cum ar fi diabetul de tip 2 (T2D), deoarece două proteine ​​ale receptorilor coronavirusului, dipeptidil peptidaza-4 (DPP4) și enzima de conversie a angiotensinei 2 (ACE2) sunt traductori bine stabiliți ai semnalelor metabolice care controlează homeostazia glucozei, împreună cu alte căi implicate în reglarea fiziologiei cardiovasculare, a inflamației și a activității renale [ 22 ]. Agenții care scad glucoza, cum ar fi inhibitorii DPP4, utilizați pe scară largă în terapia T2D, pot modifica activitățile biologice ale mai multor substraturi imunomodulatoare [ 23]. ACE2 este receptorul de intrare recunoscut de proteina spike (S) a SARS-CoV-2 și se știe că este exprimat în mai multe țesuturi diferite, inclusiv plămânul, tubulii renali, inima, suprafața luminală a intestinului subțire, adipos țesuturi și vase de sânge [ 24 ]. Concentrația urinară de proteine ​​ACE2 și activitatea sa enzimatică sunt crescute la subiecții cu diabet zaharat de tip 1 (T1D) [ 25 ] și T2D [ 26 ]. Dacă hiperglicemia poate regla expresia ACE2 în țesuturile umane nu s-a stabilit încă suficient, dar se știe că la modelele de diabet la șoareci, ACE2 este supraexprimat în plămâni, rinichi și inimă [ 27].]. În plus, mai multe medicamente pentru tratamentul hipertensiunii arteriale, cum ar fi inhibitorii ECA (ACEi) și blocantele receptorilor angiotensinei (ARB), sunt cunoscute pentru a regla în sus expresia ACE2 [ 28 ]. Astfel, datorită creșterii expresiei receptorilor ACE2 în mai multe țesuturi ale pacienților cu diabet zaharat, s-a argumentat că severitatea COVID-19 ar putea fi potențial agravată [ 29 ]. Cu toate acestea, având în vedere efectele bine stabilite de protecție a organelor inhibitorilor sistemului renin angiotensinei aldosteronului (RAAS), mai multe societăți științifice autorizate au recomandat oprirea întreruperii acestor medicamente la pacienții cu risc crescut de infecție COVID-19 [