Rezultatele căutări pentru: carcinom bazocelular

Test deschis, explorator, de fază II, de Itraconazol oral pentru tratamentul carcinomului bazocelular

Daniel J. Kim , James Kim , Katrina Spaunhurst , Javier Montoya , Rita Khodosh , Kalyani Chandra …Afișați mai multe

Itraconazolul, un medicament antifungic aprobat de US Food and Drug Administration, inhibă calea de semnalizare Hedgehog (HH), un factor crucial al tumorigenezei carcinomului bazocelular (BCC) și reduce creșterea BCC la șoareci. Am evaluat efectul itraconazolului asupra căii HH și asupra dimensiunii tumorii în tumorile BCC umane.Pacienți și metode

Pacienții cu ≥ o tumoră BCC> 4 mm în diametru au fost înscriși pe două cohorte pentru a primi itraconazol oral 200 mg de două ori pe zi timp de 1 lună (cohorta A) sau 100 mg de două ori pe zi pentru o medie de 2,3 luni (cohorta B). Punctul final principal a fost modificarea biomarkerilor: proliferarea tumorii Ki67 și activitatea HH ( ARNm GLI1 ). Punctele finale secundare au inclus modificarea dimensiunii tumorii la un subgrup de pacienți cu tumori multiple.Rezultate

Au fost înrolați în total 29 de pacienți, dintre care 19 au fost tratați cu itraconazol. Tratamentul cu Itraconazol a fost asociat cu două evenimente adverse (oboseală de gradul 2 și insuficiență cardiacă congestivă de gradul 4). Itraconazolul a redus proliferarea celulară cu 45% ( P = 0,04), activitatea căii HH cu 65% ( P = 0,03) și a redus aria tumorii cu 24% (IC 95%, 18,2% până la 30,0%). Din opt pacienți cu mai multe tumori nonbiopsiate, patru au obținut un răspuns parțial și patru au avut boală stabilă. Tumorile de la pacienții de control netratați și de la cei tratați anterior cu vismodegib nu au prezentat modificări semnificative ale proliferării sau dimensiunii tumorii.

Concluzie

Itraconazolul are activitate anti-BCC la om. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului, în special în raport cu alți inhibitori ai căii

Carcinomul cu celule bazale (BCC) este cel mai frecvent diagnosticat cancer la om, cu aproximativ 2 milioane de cazuri noi în Statele Unite în fiecare an. 1 Pacienții afectați de sindromul nev de celule bazale (Gorlin), ereditar (mostenire online mendeliană la om nr. 109400) pot dezvolta sute până la mii de BCC. 2 Pacienții cu sindromul nevocelular bazal moștenesc o copie defectă a genei supresoare tumorale PTCH1 , care acționează ca un inhibitor primar al căii de semnalizare Hedgehog (HH). 3 – 5 PTCH1 mutațiilor genetice și pierderea de tip sălbatic rămase alelă apar și în sporadice BCC. 3 – 5În esență, toate BCC au activare malignă a căii de semnalizare HH, care este în mod obișnuit măsurată prin expresia unei gene țintă care codifică factorul de transcripție GLI1 . 2 – 4 Recenta aprobare din partea US Food and Drug Administration (FDA) a vismodegib, un antagonist al componentei esențiale a căii HH Smoothened (SMO), validează eficacitatea inhibării căii HH în tratamentul BCC. 6 Vismodegib este aprobat pentru BCC local avansat (inoperabil) sau metastatic, care cuprinde doar 2% din toate BCC. Majoritatea BCC pot fi tratate prin excizie chirurgicală, deși intervenția chirurgicală poate duce la cicatrici și morbiditate semnificative. 5Având în vedere incidența în creștere a BCC și tratamentul său costisitor – unul dintre cei mai mari în rândul beneficiarilor Medicare 7 – există o mare nevoie clinică nesatisfăcută de forme nechirurgicale de tratament. 8 Deși unele creme chimioterapeutice precum imiquimod și fluouracil sunt aprobate de FDA, aceste opțiuni topice sunt eficiente numai împotriva subtipului superficial al BCC, care cuprinde doar 30% din toate BCC. 9 , 10 Efectele adverse frecvente (căderea părului, pierderea în greutate, crampele musculare) ale vismodegibului îl exclud ca opțiune de tratament viabilă pentru majoritatea BCC-urilor non-avansate. 6

Am efectuat un screening al medicamentelor aprobate de FDA și am identificat itraconazolul, un agent antifungic oral utilizat pe scară largă, ca un puternic antagonist al căii HH. 11 Anterior, am demonstrat că itraconazolul suprimă carcinogeneza BCC murină autohtonă, induce necroza tumorală și reduce expresia ARNm GLI1 la șoareci. 11 Pentru a evalua mecanismul de acțiune și eficacitatea clinică a itraconazolului în BCC umană, am efectuat un studiu deschis, de dovadă a conceptului, de fază II, în două cohorte de pacienți cu BCC sporadică. Obiectivele principale ale celor două cohorte au fost de a evalua dacă inhibarea indusă de itraconazol a activității căii HH ( GLI1 ARNm) ar putea reduce proliferarea tumorii (Ki67) și dimensiunea tumorii la BCC umană și pentru a evalua dacă s-ar putea realiza reduceri semnificative ale dimensiunii tumorii cu doze mai mici de itraconazol administrate pe o durată mai lungă.PACIENTI ȘI METODEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODE <<REZULTATEDISCUŢIEREFERINȚEPacienți și tratamente

Am recrutat pacienți cu ≥ o tumoră BCC> 4 mm (cel mai lung diametru), fără comorbidități și teste normale ale funcției hepatice în decurs de 1 an înainte de înscriere. Cei care au luat medicamente care ar putea afecta tumorile BCC sau metabolismul itraconazolului (de exemplu, anticonvulsivante, corticosteroizi) și cei care nu au putut participa atât la biopsie inițială, cât și la excizia chirurgicală la aceeași instituție au fost excluși din studiu. Toți pacienții au fost măsurați AST / ALT după 1 lună de itraconazol.

Am examinat 67 de pacienți pentru eligibilitate și am înscris 29 la două site-uri; 37 de pacienți au fost excluși de la înscriere din cauza incapacității lor de a avea atât biopsie, cât și excizie în același loc. Cohorta A (Universitatea Stanford, Stanford, CA) a înrolat 25 de pacienți din aprilie 2010 până în decembrie 2010, iar cohorta B (Universidad Católica de Chile, Santiago, Chile) a înrolat patru pacienți din iulie 2010 până în septembrie 2011 (diagrama CONSORT; Fig 1). Un singur pacient a întâmpinat diagnosticul clinic pentru sindromul nevocelular bazal.

Fig. 1.Diagrama CONSORT. qPCR, reacție în lanț cantitativă a polimerazei.

În cohorta A, pacienții au primit itraconazol în comprimate de 200 mg pe cale orală de două ori pe zi, între momentul biopsiei și momentul exciziei definitive (în mod obișnuit 4 săptămâni). Scopul principal al cohortei A a fost evaluarea biomarkerilor tumorali (proliferarea Ki67 și activitatea căii HH [ GLI1mARN]) și dimensiunea tumorii se modifică după 1 lună de tratament. În cohorta B, pacienții au primit comprimate de 100 mg pe cale orală de două ori pe zi. Scopul principal al cohortei B a fost de a determina dacă o doză mai mică de itraconazol administrată pe o durată mai lungă (medie, 2,3 luni; interval, 1 până la 4 luni) ar putea realiza în continuare efecte semnificative clinic. Pacienții eligibili altfel, dar care nu doreau să ia itraconazol, au fost înrolați pe brațul de control al studiului și nu au primit tratament. Studiile paralele au fost aprobate de către comitetele de revizuire instituționale respective.

Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresie în timpul terapiei, probabil ca urmare a rezistenței secundare la vismodegib. 12 Deoarece itraconazolul antagonizează și SMO și se știe puțin despre modul în care rezistența la un medicament poate afecta eficacitatea unui alt inhibitor al SMO, cei tratați anterior cu vismodegib au fost analizați separat de pacienții naivi cu vismodegib. Prin urmare, am analizat în cele din urmă trei grupuri discrete: unul, pacienții care nu au primit nici un itraconazol; doi, pacienți cărora li s-a administrat itraconazol fără tratament anterior cu vismodegib; și trei, pacienți cărora li s-a administrat itraconazol cu ​​tratament anterior cu vismodegib.Biopsii tumorale și evaluări ale biomarkerului (cohorta A)

La momentul înscrierii, pacienții din cohorta A aveau leziuni BCC țintă (una sau două dintre cele mai reprezentative tumori) selectate pentru biopsie. Tumorile biopsiate au fost încorporate în parafină și colorate pentru Ki67 pentru a evalua proliferarea celulară. Celulele cu colorare nucleară pozitivă (indicând celule în proliferare activă) au fost numărate de Flagship Biosciences (Flagstaff, AZ) și normalizate la numărul total de nuclee prezente în BCC. Datele de proliferare celulară prezentate aici sunt exprimate ca procent de celule cu un semnal pozitiv. Pentru a evalua activitatea căii HH, probele de biopsie proaspete au fost congelate rapid, plasate în Trizol (Invitrogen, Carlsbad, CA) și omogenizate utilizând MP FastPrep 24 (MP Biomedicals, Solon, OH). ARN-ul total a fost purificat cu tuburi de fază Lock Gels (Eppendorf, Hamburg, Germania) și un kit ARN PureLink Micro (Invitrogen).ADNc a fost sintetizat cu SuperScript III Reverse Transcriptase (Invitrogen). Reacția în lanț a polimerazei în timp real a fost efectuată pe un iCycler Bio-Rad folosind iQ SyberGreen Supermix (Bio-Rad, Hercules, CA). Schimbare de oriExpresia ARNm GLI1 a fost măsurată utilizând analiza ΔΔC t , cu HPRT1 ca genă de control intern și pielea normală colectată de la pacienții cu BCC ca probe de control pentru normalizarea probelor BCC. Secvențele de primer de reacție în lanț ale polimerazei au fost:

  • GLI1 înainte: 5 ′ GAAGTCATACTCACGCCTCGAA 3 ′
  • GLI1 invers: 5 ′ CAGCCAGGGAGCTTACATACAT 3 ′
  • HPRT1 înainte: 5 ′ GGTCAGGCAGTATAATCCAAAG 3 ′
  • Revers HPRT1 : 5 ′ GGACTCCAGATGTTTCCAAAC 3 ′

În cazurile în care biopsia / excizia a avut un volum tumoral limitat, probele au fost prioritare pentru analiza proliferării celulare. Nici o tumoră nu a fost biopsiată pentru analiza biomarkerului în cohorta B, deoarece scopul său principal a fost de a evalua efectul dozei mici de itraconazol asupra dimensiunii tumorii.Măsurători ale dimensiunii tumorii

În cohorta A, 11 din 15 pacienți au avut o singură tumoare BCC. Această leziune țintă a fost biopsiată și excizată pentru analiza biomarkerului. Leziunile țintă nu au fost evaluate pentru modificarea dimensiunii tumorii, deoarece au fost biopsiate la momentul inițial. Doar patru din 15 pacienți au avut ≥ o tumoră BCC și au fost observate leziuni nedestinate (n = 42) pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial. Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. În schimb, toate tumorile de la cei patru pacienți (n = 14 BCC) din cohorta B au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 200 mg pe zi (durata medie, 2,3 luni).Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) a fost calculată de la data înscrierii până la data ultimei evaluări clinice.

Pentru fiecare pacient măsurat pentru zona tumorii, parametrii de răspuns clinici BCC validați au fost utilizați conform Skvara și colab 13 și definiți după cum urmează: răspuns complet, nu mai există dovezi vizibile ale unei leziuni în concordanță cu BCC; răspuns parțial, deși rămâne un BCC, există o scădere vizibilă a dimensiunii; și fără răspuns, BCC nu a scăzut vizibil în dimensiune. Un investigator dermatolog care a fost orbit de grupurile de tratament a efectuat toate evaluările clinice folosind fotografii făcute înainte și după tratament. Nu am utilizat criterii RECIST pentru tumorile solide, deoarece majoritatea leziunilor BCC aveau o dimensiune <10 mm, iar leziunile tumorale au fost evaluate în primul rând pentru modificările biomarkerului.Analize statistice

Ca studiu exploratoriu, am calculat că un număr minim de 27 de pacienți trebuia să fie înrolați pentru a detecta o diferență de două ori între modificarea Ki67 la pacienții netratați față de cei tratați cu itraconazol (β, 0,80; față-verso α, 0,05). Testul sumelor de rang nonparametric Mann-Whitney a fost utilizat pentru comparații nepereche, iar testul de rang semnat Wilcoxon a fost utilizat pentru comparații pereche. Toate valorile P raportate sunt pe două fețe.REZULTATEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATE <<DISCUŢIEREFERINȚEDemografia pacientului

Am înrolat 29 de pacienți cu un total de 101 tumori BCC; 19 pacienți cu un total de 90 BCC au consimțit la tratamentul cu itraconazol (cohorta A, n = 15; cohorta B, n = 4). La momentul inițial, pacienții tratați cu itraconazol și pacienții martor au fost similari ca vârstă, sex, tip BCC și localizarea tumorilor BCC ( Tabelul 1 ). Tumorile au apărut în regiunile corpului expuse în mod clasic la soare, inclusiv fața, gâtul și trunchiul. Pacienții au fost predominant bărbați mai în vârstă (vârsta medie, 60 de ani) cu subtipuri BCC nodulare. Pacienții cărora li sa administrat itraconazol au avut, în medie, aproape 5 ori mai multe tumori la momentul inițial comparativ cu cei care nu au fost tratați cu itraconazol ( P= .13). Durata medie de observare / tratament a fost de aproximativ 1 lună la pacienții martor și la pacienții tratați cu itraconazol din cohorta A (n = 76 de tumori) și 2,3 luni la pacienții tratați cu itraconazol din cohorta B (n = 14 tumori). Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresia bolii și au oprit vismodegibul timp de ≥ 6 luni înainte de a începe itraconazolul.

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

CaracteristicăControl (n = 10)Itraconazol (n = 19)
Nu.%Nu.%
Vârsta la biopsia inițială, ani
    In medie68,562.2
    Gamă53 la 8144 – 85
Sex
    Masculin8801579
    Femeie220421
Numărul total de tumori BCC prezente1190
Numărul mediu de tumori BCC per pacient1.14,77
Tip tumoră BCC *
    Nodular6432150
    Superficial4291433
    Infiltrativ214512
    Micronodular21425
Localizarea tumorii BCC
    Față6553539
    Înapoi2181719
    Umăr001314
    Gât0089
    Cufăr0067
    Picior1967
    Braţ21822
    Scalp0022
    Ureche0013
Istoria tratamentului cu vismodegib003
Durata medie a tratamentului, luni
    Pacienți cu Stanford (200 mg de două ori pe zi)1.11.0
    Pacienți din Chile (100 mg de două ori pe zi)N / A2.3

Abrevieri: BCC, carcinom bazocelular; NA, nu se aplică.

* Include numai tumorile care au fost biopsiate.Evenimente adverse legate de droguri

Doi din 19 pacienți au întrerupt tratamentul cu itraconazol din cauza efectelor adverse descrise anterior asociate cu itraconazolul. O insuficiență cardiacă congestivă de gradul 4 a apărut la un pacient care a avut o boală cardiacă nediagnosticată în urma tratamentului anterior cu adriamicină pentru limfom Hodgkin acum 20 de aniFig 1). Un al doilea pacient a întrerupt din cauza oboselii de gradul 2. Alte efecte adverse au fost ușoare și toate efectele adverse au fost reversibile la întreruperea tratamentului. Nu s-au detectat creșteri ale testării funcției hepatice (AST / ALT) la niciun pacient în timpul tratamentului.Analiza biomarkerului (numai cohorta A)

Un total de 63 de biopsii de la 22 din 25 de pacienți înscriși în cohorta A au fost disponibile pentru analiza biomarkerului ( Fig 1). Am comparat modificarea proliferării Ki67 în biopsiile luate la momentul inițial și la excizie la o lună mai târziu la pacienții tratați cu itraconazol (20 BCC) și la pacienții netratați / de control (12 BCC). Itraconazolul a scăzut proliferarea celulară cu 35% la pacienții naivi cu vismodegib în analize nepereche ( P = .079; Fig. 2De la A la 2C). În cadrul comparațiilor pacienților cu activitatea Ki67 de la momentul inițial până la excizie, itraconazolul a scăzut proliferarea celulară cu 45% la pacienții naivi cu vismodegib (n = 8; P = 0,04 în perechi ; Fig 2D). În schimb, pacienții martori și cei tratați anterior cu vismodegib nu au prezentat modificări semnificative în proliferarea celulară ( Fig 2E).

Fig 2.Cuantificarea Ki67 și analiza tumorilor de carcinom bazocelular (BCC). (A) Analiza nepereche a tumorilor individuale de la pacienții martor și pacienții tratați cu itraconazol. Colorarea Ki67 a tumorilor BCC la momentul inițial și excizia de la pacienții de control (B) și (C) pacienți naivi cu vismodegib tratați cu itraconazol. Colorarea pozitivă (maro) indică proliferarea nucleelor; colorarea negativă (albastră) nu indică activitate proliferativă. Analiza pereche a pacientului Ki67 medii în rândul pacienților (D) naivi cu vismodegib și (E) pacienți de control tratați cu itraconazol.

Pentru analiza căii de semnalizare HH, un total de 24 de biopsii au fost colectate de la pacienții tratați cu itraconazol și analizați pentru nivelurile de ARNm GLI1 . Într-o analiză nepereche, itraconazolul a scăzut ARNm GLI1 cu 65% în tumorile de la pacienții naivi cu vismodegib comparativ cu valoarea inițială ( P = 0,028; Fig 3A). Examinând numai tumori asociate de la patru pacienți (naivi cu vismodegib), itraconazolul a scăzut ARNm GLI1 cu 45% în tumori după o lună, comparativ cu valoarea inițială ( Fig 3B). Tumorile de la pacienții cu tratament anterior cu vismodegib nu au demonstrat o scădere semnificativă a expresiei ARNm GLI1 . Alte studii clinice BCC nu au demonstrat, de asemenea, nicio modificare a expresiei ARNm GLI1 la pacienții tratați cu placebo sau pacienții de control. 14 , 15

Fig 3.Niveluri de expresie a ARNm GLI1 în tumorile de carcinom bazocelular de la pacienții tratați cu itraconazol timp de 1 lună. Unii pacienți au primit anterior tratament cu vismodegib și nu au mai răspuns la vismodegib. (A) Analiza nepereche a nivelurilor de ARNm GLI1 din tumorile inițiale și tumorile excizate după tratamentul cu itraconazol. Ca martor, ARNm GLI1 a fost evaluat pe pielea normală nontumorală. ARNm GLI1 a scăzut cu 65% la pacienții naivi cu vismodegib tratați cu itraconazol de la momentul inițial până la excizie ( P = .028). (B) În analiza asociată a tumorilor de la aceiași pacienți, itraconazolul a scăzut expresia GLI1 cu 45% după o lună numai la pacienții naivi cu vismodegib.Modificări ale dimensiunii tumorii și răspunsul clinic (cohorte A și B)

Itraconazolul a redus dimensiunea tumorii și a favorizat reepitelizarea în tumorile BCC a opt din cei 29 de pacienți naivi cu vismodegib ( Fig 4). În cohorta A, patru pacienți au avut> o tumoră BCC, iar aceste leziuni nedestinate au fost observate pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial (n = 43). Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. La cei patru pacienți din cohorta B, toate cele 14 tumori BCC au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 100 mg de două ori pe zi (durata medie, 2,3 luni). Niciuna dintre tumorile cohortei B nu a fost biopsiată pentru analiza biomarkerului, deoarece scopul cohortei B a fost de a evalua o doză mai mică de itraconazol pentru o durată mai lungă. Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) este prezentată în Figura 5. În medie, tumorile de la pacienții naivi cu vismodegib au scăzut cu 24% (IÎ 95%, 18,2% până la 30,0%) după tratamentul cu itraconazol ( Fig 5). Mai mult, reducerile medii ale tumorilor la pacienții din cohorta B au fost comparabile cu cele ale cohortei A ( P = .435). Această constatare sugerează că administrarea alternativă de itraconazol (doze mai mici pe o durată mai lungă) poate realiza în continuare reduceri semnificative clinic.

Fig 4.Reducerea sau reepitelizarea tumorilor de carcinom bazocelular (BCC) de către itraconazol la pacienții fără vismodegib. (A) Tumoră BCC nodulară pe picior de la înrolare până în ziua 25. (B) Tumoră BCC infiltrativă pe umăr de la înrolare până în ziua 28. (C) Vedere laterală și (D) laterală a tumorii BCC nodulare pe frunte de la înrolare până în ziua 59.

Fig 5.Modificarea procentuală a zonei tumorale pentru 57 de tumori de carcinom bazocelular (BCC) de la opt pacienți tratați cu itraconazol. În timpul tratamentului cu itraconazol, aria tumorii a scăzut în medie cu 24% (IC 95%, 18,2% până la 30,0%). În cohorta A, patru pacienți au avut mai multe tumori BCC, iar leziunile nedestinate au fost disponibile pentru măsurarea dimensiunii tumorii. Aria tumorii a fost aproximată prin înmulțirea celor mai lungi diametre perpendiculare ale tumorilor, măsurate cu etriere. Tumorile nonbiopsiate au fost evaluate pentru modificarea zonei tumorale la momentul inițial și după 4 săptămâni. În cohorta B, tumorile BCC nu au fost evaluate pentru biomarkeri; au fost evaluați numai pentru modificarea dimensiunii clinice la momentul inițial (după biopsia inițială care confirmă diagnosticul BCC) și după tratamentul cu itraconazol 200 mg în medie 2,3 luni.Procentul de modificare a zonei a fost calculat de la data înscrierii până la data ultimei evaluări clinice.

În ciuda reducerii generale a dimensiunii, niciuna dintre tumorile BCC nu a dispărut complet cu tratamentul cu itraconazol după o medie de 1,1 luni (cohorta A, n = 43 tumori) și 2,3 luni (cohorta B, n = 14 tumori). Patru pacienți au prezentat răspuns parțial și patru au prezentat o boală stabilă folosind liniile directoare descrise anterior. 16 În evaluările clinice, nici pacienții de control, nici pacienții cu antecedente de tratament cu vismodegib nu au prezentat modificări ale dimensiunii tumorii

În acest studiu de dovadă a conceptului, am demonstrat prima utilizare off-label, după cunoștințele noastre, a unui medicament aprobat de FDA pentru tratamentul BCC care vizează activitatea căii HH. Itraconazolul poate reduce dimensiunea tumorii BCC prin inhibarea căii de semnalizare HH după 1 lună de tratament. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului.

Ca un studiu exploratoriu de fază II, scopul principal al acestui studiu a fost de a determina dacă itraconazolul la doze prescrise în mod obișnuit de 200 până la 400 mg zilnic ar putea reduce proliferarea tumorii și calea HH în BCC umane după o lună. Doar patru pacienți din cohorta B au fost tratați timp de> 1 lună și, prin urmare, nu avem rezultate privind eficacitatea clinică anti-BCC a itraconazolului pe o perioadă mai lungă de tratament. Mai mult, nu putem compara în mod direct eficacitatea pe termen scurt a itraconazolului cu cea a vismodegibului, primul inhibitor de HH aprobat de FDA care a prezentat o rată de răspuns de 40% la pacienții cu BCC avansat local tratați timp de> 10 luni. 6Itraconazolul pare să aibă o utilitate clinică mai mică în comparație cu vismodegib ca tratament de primă linie, deoarece concentrația inhibitoare jumătate maximă a itraconazolului este de 100 × mai puțin puternică in vitro comparativ cu vismodegib, iar itraconazolul reduce calea HH cu 65% după 1 lună, spre deosebire de Reducere de 90% cu vismodegib. 15 Itraconazolul poate fi eficient ca terapie de linia a doua, deoarece itraconazolul acționează asupra SMO într-un loc distinct de ciclopamină și vismodegib. 11 După cum se demonstrează prin teste de semnalizare in vitro, 17eficacitatea itraconazolului este dependentă de doză, iar studiile viitoare ar trebui să examineze dacă dozele mai mari de itraconazol administrate pe perioade mai lungi de tratament pot aborda eficacitatea observată cu vismodegib și alți antagoniști SMO. Cu toate acestea, administrarea cronică a itraconazolului ar putea avea, de asemenea, efecte adverse și toxicitate suplimentare, care nu au fost observate în acest studiu exploratoriu, deși au fost raportate tratamente pe termen lung cu 600 până la 900 mg pe zi, cuprinse între 3 și 16 luni, cu toxicități controlabile. 18 , 19

Studiul nostru are mai multe limitări. În primul rând, a fost limitată de mărimea eșantionului, deoarece am înrolat doar 29 de pacienți; cu toate acestea, mulți pacienți au avut mai multe tumori, iar acest studiu a evaluat 101 BCC. În al doilea rând, toți, cu excepția unuia dintre pacienții din acest studiu, au avut BCC non-avansat și niciunul nu a avut boală metastatică; astfel, rezultatele noastre nu pot fi comparate cu rata globală de răspuns de 40% observată cu vismodegib la pacienții cu BCC avansat sau metastatic. 6În al treilea rând, am avut doar trei pacienți care au prezentat progresia cu vismodegib și nu au efectuat analize de secvențiere pentru a determina mecanismul de rezistență la medicamente vismodegib. Astfel, nu am putut testa în mod direct dacă itraconazolul ar putea fi o opțiune viabilă ca tratament de linia a doua după eșecul vismodegibului. În al patrulea rând, am evaluat doar eficacitatea pe termen scurt a itraconazolului și este necesară administrarea cronică pentru a compara eficacitatea și toxicitatea itraconazolului în raport cu vismodegib. Viitoare studii clinice randomizate sunt necesare pentru a determina eficacitatea itraconazolului la o gamă mai largă de pacienți cu sarcini variate ale bolii, o eficacitate diferențială potențială în tumorile rezistente la vismodegib versus tumorile naive cu vismdoegib și posibilitatea dacă un dublu atac anti-SMO ar fi da rezultate superioare.Rezultatele noastre preclinice sugerează că o dublă inhibare anti-SMO reduce creșterea tumorii mai eficient decât itraconazolul sau ciclopamina în monoterapie.11

Recent, terapia combinatorie cu trioxid de arsen (ATO), aprobată de FDA pentru leucemia promielocitară acută, s-a dovedit a fi eficientă în BCC murin și medullobloastomul rezistent la vismodegib. 20 ATO acționează ca un antagonist HH prin prevenirea traficului ciliar și destabilizarea GLI2, un factor de transcripție în aval de SMO. 17 Tratamentul combinat cu itraconazol și ATO s-ar putea dovedi deosebit de benefic în tumorile BCC rezistente 21 la antagoniștii SMO, cum ar fi vismodegib, care imită și concurează pentru legarea cu ciclopamina. 20 Presupunând că BCC rezistente la vismodegib se comportă similar cu meduloblastomul, 22 , 23 terapia combinată cu itraconazol-ATO poate depăși rezistența rezultată dinMutații SMO și amplificări GLI2 , deoarece itraconazolul inhibă SMO printr-un mecanism distinct de ciclopamină, 11 și ATO inhibă factorii de transcripție GLI . În acest scop, am inițiat un studiu al combinației de itraconazol și ATO la pacienții cu BCC metastatice pentru care vismodegib a eșuat (clinictrials.gov NCT01791894).© 2014 de Societatea Americană de Oncologie Clinică

Vezi editorialul însoțitor la pagina 720

Susținut de Stanford Clinical and Translational Science Institute (SPARK) și Damon Runyon Clinical Investigator Award (JYT).

Prezentat parțial la reuniunea anuală a Asociației Americane pentru Cercetarea Cancerului, Orlando, FL, 2-6 aprilie 2011.

Dezvăluirile autorilor despre posibilele conflicte de interese și contribuțiile autorilor se găsesc la sfârșitul acestui articol.

Informații despre studiile clinice: NCT01108094.DIVULGAREA AUTORILOR PRIVIND POTENȚIALELE CONFLICTE DE INTERES

Deși toți autorii au completat declarația de divulgare, următorii autor (i) și / sau membrii apropiați ai familiei unui autor au indicat un interes financiar sau de altă natură care este relevant pentru subiectul examinat în acest articol. Anumite relații marcate cu „U” sunt cele pentru care nu s-a primit nicio compensație; acele relații marcate cu „C” au fost compensate. Pentru o descriere detaliată a categoriilor de divulgare sau pentru mai multe informații despre politica ASCO privind conflictele de interese, vă rugăm să consultați Declarația de divulgare a autorului și secțiunea Dezvăluiri de potențiale conflicte de interese din Informații pentru contribuabili.

Ocuparea forței de muncă sau poziția de conducător: Niciun Consultant sau Rol consultativ: Jean Y. Tang, Genentech (C) Proprietate de acțiuni: Niciun Onorariu: Niciun Finanțare pentru cercetare: Niciun Mărturie de expert: Niciun Brevete, Redevențe și Licențe: Niciun Alt Remunerație: Nici unulCONTRIBUȚIILE AUTORULUI

Concepție și design: Philip A. Beachy, Jean Y. Tang

Sprijin financiar: Philip A. Beachy, Jean Y. Tang

Sprijin administrativ: Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Furnizarea de materiale de studiu sau pacienți: Jean Y. Tang

Colectarea și asamblarea datelor: Daniel J. Kim, Katrina Spaunhurst, Javier Montoya, Rita Khodosh, Kalyani Chandra, Teresa Fu, Anita Gilliam, Monserrat Molgo, Philip A. Beachy, Jean Y. Tang

Analiza și interpretarea datelor: Daniel J. Kim, James Kim, Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Scriere manuscrisă: Toți autorii

Aprobarea finală a manuscrisului: Toți autoriiREFERINȚEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATEDISCUŢIEREFERINȚE <<

1.DL Miller , MA Weinstock : Cancer de piele nonmelanom în Statele Unite: Incidență J Am Acad Dermatol 30: 774 – 778 , 1994 Crossref , Medline ,  Google Scholar
2.MR Gailani , SJ Bale , DJ Leffell , etal: Defecte de dezvoltare în sindromul Gorlin legate de o genă suppresivă tumorală putativă pe cromozomul 9 Celula 69: 111 – 117 , 1992 Crossref , Medline ,  Google Scholar
3.H Hahn , C Wicking , PG Zaphiropoulous , etal: Mutații ale omologului uman al Drosophila patch-uri în sindromul nevoid carcinom bazocelular Celula 85: 841 – 851 , 1996 Crossref , Medline ,  Google Scholar
4.RL Johnson , AL Rothman , J Xie , etal: Omolog om al patchei, o genă candidată pentru sindromul nevului cu celule bazale Știință 272: 1668 – 1671 , 1996 Crossref , Medline ,  Google Scholar
5.EH Epstein : Carcinoame bazocelulare: Atacul ariciului Nat Rev Cancer 8: 743 – 754 , 2008 Crossref , Medline ,  Google Scholar
6.A Sekulic , MR Migden , AE Oro , etal: Eficacitatea și siguranța vismodegibului în carcinomul bazocelular avansat N Engl J Med 366: 2171 – 2179 , 2012 Crossref , Medline ,  Google Scholar
7.TS Housman , SR Feldman , PM Williford , etal: Cancerul de piele este printre cele mai costisitoare dintre toate tipurile de cancer de tratat pentru populația Medicare J Am Acad Dermatol 48: 425 – 429 , 2003 Crossref , Medline ,  Google Scholar
8.E de Vries , M Louwman , M Bastiaens , etal: Creșteri rapide și continue ale ratelor de incidență a carcinomului bazocelular în sud-estul Țărilor de Jos din 1973 J Invest Dermatol 123: 634 – 638 , 2004 Crossref , Medline ,  Google Scholar
9.H Gollnick , CG Barona , RG Frank , etal: Rata de recurență a carcinomului bazocelular superficial după tratamentul cu cremă imiquimod 5%: Încheierea unui studiu de urmărire pe termen lung de 5 ani în Europa Eur J Dermatol 18: 677 – 682 , 2008 Medline ,  Google Scholar
10.K Gross , L Kircik , G Kricorian : 5% cremă 5-fluorouracil pentru tratamentul carcinomului bazocelular superficial mic: Eficacitate, tolerabilitate, rezultat cosmetic și satisfacția pacientului Dermatol Surg 33: 433 – 439 , 2007 discuție 440 Medline ,  Google Scholar
11.J Kim , JY Tang , R Gong , etal: Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii Hedgehog și creșterea cancerului Celula cancerului 17: 388 – 399 , 2010 Crossref , Medline ,  Google Scholar
12.RL Yauch , GJ Dijkgraaf , B Alicke , etal: Mutația netezită conferă rezistență la un inhibitor al căii Hedgehog în meduloblastom Știința 326: 572 – 574 , 2009 Crossref , Medline ,  Google Scholar
13.H Skvara , F Kalthoff , JG Meingassner , etal: Tratamentul topic al carcinoamelor bazocelulare în sindromul carcinomului bazocelular nevoidic cu un inhibitor netezit J Invest Dermatol 131: 1735 – 1744 , 2011 Crossref , Medline ,  Google Scholar
14.DD Von Hoff , PM LoRusso , CM Rudin , etal: Inhibarea căii arici în carcinomul bazocelular avansat N Engl J Med 361: 1164 – 1172 , 2009 Crossref , Medline ,  Google Scholar
15.JY Tang , JM Mackay-Wiggan , M Aszterbaum , etal: Inhibarea căii arici la pacienții cu sindromul nevului bazocelular N Engl J Med 366: 2180 – 2188 , 2012 Crossref , Medline ,  Google Scholar
16.GJ Dijkgraaf , B Alicke , L Weinmann , etal: inhibarea moleculei mici a GDC-0449 mutanți refractari neteziți și mecanisme din aval de rezistență la medicamente Cancer Res 71: 435 – 444 , 2011 Crossref , Medline ,  Google Scholar
17.J Kim , JJ Lee , J Kim , etal: Arsenicul antagonizează calea Hedgehog prin prevenirea acumulării ciliare și reducerea stabilității efectorului transcripțional Gli2 Proc Natl Acad Sci SUA 107: 13432 – 13437 , 2010 Crossref , Medline ,  Google Scholar
18.K Takagi , A Yoshida , T Yamauchi , etal: Tratamentul cu succes al spondilodiscitei Aspergillus cu doze mari de itraconazol la un pacient cu leucemie mielogenă acută Leucemie 15: 1670 – 1671 , 2001 Crossref , Medline ,  Google Scholar
19.PK Sharkey , MG Rinaldi , JF Dunn , et al: doze mari de itraconazol în tratamentul micozelor severe Antimicrob Agents Chemother 35: 707 – 713 , 1991 CrossRef , Medline ,  Google Academic
20.J Kim , BT Aftab , JY Tang , etal: Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți Celula cancerului 23: 23 – 34 , 2013 Crossref , Medline ,  Google Scholar
21.AL Chang , AE Oro : Evaluarea inițială a creșterii tumorale după vismodegib în carcinomul bazocelular avansat Arch Dermatol 148: 1324 – 1325 , 2012 Crossref , Medline ,  Google Scholar
22.CM Rudin , CL Hann , J Laterra , etal: Tratamentul meduloblastomului cu inhibitor al căii arici GDC-0449 N Engl J Med 361: 1173 – 1178 , 2009 Crossref , Medline ,  Google Scholar
23.S Buonamici , J Williams , M Morrissey , etal: Interferența cu rezistența la antagoniști neteziți prin inhibarea căii PI3K în medulloblastom Sci Transl Med 2: 51ra70 , 2010 Crossref , Medline ,  Google Scholar

Terapia fotodinamică PDT cu lumină violetă și acidul 6-aminolauulinic ALA local în tratamentul keratozelor actinice, a bolii Bowen și a carcinomului bazocelular.

 2001 Nov; 15 (6): 550-4.

1
Departamentul de Dermatologie, Centrul Medical Universitar Utrecht, Olanda.

Abstract

FUNDAL:

Majoritatea studiilor clinice care utilizează terapia fotodinamică (PDT) cu aplicarea topică a acidului delta-aminolauulinic (delta-ALA) utilizează lumină roșie deoarece permite o adâncime mai mare a penetrării. Cu toate acestea, având în vedere spectrul de porfirină similar cu fotosensibilitatea indusă de delta-ALA, lumina violetă asigură o suprapunere maximă cu spectrul de excitație al protoporfirinei IX, ceea ce înseamnă că PDT cu lumină violetă utilizează mai puțină energie luminoasă pentru a induce reacția fototoxică.

SCOP:

Pentru a studia eficacitatea luminii violete în combinație cu delta-ALA PDT actuală în tratamentul leziunilor pre-maligne și maligne ale pielii.

METODE:

La opt ore după aplicarea locală a delta-ALA 20%, fotiradiția a fost efectuată cu o sursă de lumină incoerentă (Philips HPM-10, 400 W) care emite lumină predominant violetă (400-450 nm). Leziunile au primit 10-20 J / cm2 în timpul unui timp de expunere de 30 de minute. Cei 38 de subiecți tratați au inclus trei cazuri cu sindrom naevus de celule bazale cu multiple (> 30) carcinoame bazale superficiale și nodulare (BCC); un subiect a suferit leziuni multiple ale bolii Bowen, implicând 50% din scalp; în total 35 BCC superficiale, 10 BCC nodulare, 4 keratoză solară mare și 5 leziuni solitare ale bolii Bowen.

REZULTATE:

Remisiunea completă, atât clinic cât și histologic, a fost observată după un singur tratament la 82% din BCC superficiale (100% după un al doilea tratament), 50% BCC nodulare, una dintre cele patru leziuni de cheratoză solară (remisiune parțială în celelalte trei) și 90-100% din leziunile solitare ale bolii Bowen.

CONCLUZII:

Delta-ALA PDT utilizând lumină violetă pare a fi un tratament alternativ bine tolerat și eficient pentru leziunile premaligne și maligne ale pielii, mai ales atunci când există leziuni multiple sau pete mari care cuprind o suprafață mare de piele.

Comentariu în

PMID: 
11843215

Gestionarea carcinomului bazocelular al pielii cu ajutorul uleiului esențial de tămâie (Boswellia sacra): un raport de caz

Abstract

Introducere

Carcinomul cu celule bazale (BCC) este cea mai comună formă de cancer de piele. Incidența BCC Carcinomului cu celule bazale este în creștere rapidă la nivel mondial asociată cu o creștere semnificativă a costurilor de îngrijire a sănătății. Sunt disponibile diverse opțiuni de tratament pentru pacienții diagnosticați cu carcinomul cu celule bazale BCC, de la intervenții chirurgicale, electrodesicare, radiații, terapie fotodinamică până la abordări terapeutice neinvazive. Folosită în mod tradițional pentru aromoterapie, pe baza abundenței compușilor aromatici foarte volatili, ulei esențial de tămâie preparat prin hidrodistilarea Boswellia sacra gumele de rășină, de asemenea, posedă activitate anticanceroasă care poate oferi o opțiune de tratament non-chirurgical și neinvaziv pentru BCC prin aplicarea topică. Acest raport de caz discută despre administrarea in BCC carcinomul cu celule bazale a pielii de tămâie ( Boswellia sacra ) ca ulei esențial.

Raport de caz

Prezentăm un caz de pacient masculin, cu două focare (braț și piept) de carcinom cu celule bazale BCC, tratate cu aplicarea locală și locală a uleiului esențial de tămâie de mai multe ori pe zi, timp de 20 de săptămâni. Biopsiile au fost efectuate înainte și după tratamentul cu ulei esențial de tămâie. Studiul patologic a demonstrat rezoluția totală a carcinomului cu celule bazale BCC pe braț și o rezoluție substanțială în BCC a toracelui după tratamentul cu tamaie(ulei esential). Creșterea semnificativă a apoptozei celulelor  a fost observată în carcinomul rezidual din piept. Aplicarea topică a uleiului esențial de tămâie nu a provocat roșeață, umflare, eroziune, cruste, vezicule, squamae, mâncărime, furnicături sau alte efecte secundare locale sau sistemice la acest pacient.

Concluzie

Aplicarea locală a uleiului esențial de tămâie poate oferi o alternativă non-chirurgicală de tratament anticancer, fără efecte secundare sau minimale pentru carcinom in situ , carcinomul minim invaziv și afecțiunile precanceroase, cum ar fi keratoza actinică. Un studiu cu un număr mai mare de pacienți cu carcinom cu celule scuamoase și carcinom celule bazale BCC este necesar pentru a confirma concluziile noastre actuale.

Introducere

Cancerul de piele este forma cea mai răspândită a tuturor cancerelor cu carcinom bazocelular (BCC) ca cea mai comună formă. Se estimează că în fiecare an mai mult de 2 milioane de cazuri de carcinom ccelule bazale BCC sunt diagnosticate în Statele Unite 1 ] . În plus, din cauza creșterii incidenței BCC la nivel mondial 2 , 3 ] , aceasta devine o problemă importantă de sănătate în ceea ce privește costurile de îngrijire a sănătății 4 ] . Deși majoritatea carcinoamelor cu celule bazale BCC cresc încet și rar se răspândesc în alte părți ale corpului 5 ] , BCC poate provoca distrugeri și deformări locale semnificative prin invadarea țesuturilor înconjurătoare. Pacienții pot prezenta, de asemenea, BCC carcioame cu celule bazale recurente, avansate local sau metastazate 6 , 7 ] . Mai multe opțiuni de tratament, inclusiv intervenții chirurgicale și alternative non-chirurgicale, au fost utilizate pentru a trata carcnomul cu celule bazale BCC localizate și avansate 8 , 9 , 10 ] .

Rășini de gumă aromatică, obținute din copaci din genul Boswellia (familia Burseraceae), cunoscută și sub numele de tămâie, au fost folosite în medicina ayurvedică și tradițională chineză pentru a trata o varietate de probleme legate de sănătate. Rășini de gumă din speciile  Boswellia conțin ingrediente active care au o activitate puternică împotriva cancerului. Extractele de cocos au demonstrat că suprimă dezvoltarea tumorală și induc apoptoza tumorală la modelele animale 11 , 12 ] . Într-un studiu clinic uman, un extract preparat dinBoswellia serrata reduce edemul cerebral cu activitate anti-cancer la pacienții iradiați pentru tumori cerebrale [13 ] . Deși uleiurile esențiale de tămâie, obținute din hidrodiistilarea rășinilor de gumă, au fost folosite clasic în aromoterapie, am demonstrat că uleiul esențial de tămâie preparat din metoda de extracție fără substanță chimică posedă activitate antitumorală în suprimarea proliferării și induce apoptoza diferitelor celule canceroase umane în  linii de culturi și într-un model animal 14 , 15 , 16 ] .

În acest raport de caz, prezentăm un caz de aplicare locală a uleiului esențial de tămâie, preparat din Boswellia sacra obținută printr-o condiție de hidrodistilare optimizată pe două carcinoame celule bazale BCC separate la un pacient cancer piele, conducând la o rezoluție totală a unei tumori și o reducere substanțială a mărimii tumorii într-o altă leziune, fără efecte secundare detectabile. Sugerăm că uleiul esențial de tămâie poate fi o opțiune eficientă de tratament non-chirurgical pentru carcinomul cu celule bazale  BCC.

Raport de caz

Un bărbat în vârstă de 56 de ani a prezentat medicului său, cu o leziune a pielii pe brațul stâng sus ( Figura 1A) și pe pieptul drept ( Figura 2A ). El a susținut că leziunile au fost prezente de la câteva luni. Aceste leziuni nu au prezentat nici mâncărime, nici dureri. Pacientul a avut o istorie de carcinom cu celule scuamoase în urmă cu trei ani, cu tratament chirurgical. Nu a existat o istorie familială a cancerului de piele sau a melanomului.Biopsia rasului a fost efectuată pe ambele leziuni. Leziunea pe braț a fost diagnosticată ca BCC carcinom celule bazale  nodular ( Figurile 1C și 1D ), iar leziunea pe piept a fost diagnosticată ca BCC carcinom celule bazale  cu model de creștere superficial, nodular și infiltrativ ( figurile 2D și 2E ). Ambele eșantioane au prezentat o excizie incompletă cu BCC carcinom celule bazale  rezidual rămas în pacient. Diapozitivele de patologie au fost revizuite de un medic patologic anatomic certificat (Dr. KM Fung), care a confirmat diagnosticul.

Figura 1:Carcinom pe braț. (A) Leziune originală înainte de tratament cancer  natural c ulei de tamaie. (B) Imaginea realizată la trei luni și o săptămână de aplicare locală de ulei esențial de tămâie și leziunea a dispărut complet. (C) și (D) O biopsie efectuată înainte de tratament anticancer natural, care prezintă carcinom celule bazale  BCC cu model de creștere nodulară. (E-J) Secțiunile seriale ale biopsiei efectuate după tratament arată o formare extensivă a cicatricilor, dar nu există  BCC carcinom celule bazale  rezidual. O cantitate mică de celule inflamatorii (săgeata în E) este prezentă și este ilustrată la o mărire mai mare în (F).
Figura 2:Carcinom pe piept. (A) Leziune originală înainte de tratament natural cancer cu ulei de tamaie. (B) și (C) Imaginile de leziune luate la trei și patru luni după tratament natural cancer, respectiv, arată progresiv regresia.(C) și (D) O biopsie prelevată înainte de tratament prezintă BCC carcinom celule bazale  cu un model de creștere infiltrativă. (F-K) Secțiunile seriale sunt efectuate în leziunea post-tratament.Există multe celule piknotice / apoptotice (săgeată și inserție în G). Rețineți că valorile BCC  carcinom celule bazale  rezidual (săgețile din (H) și (J) sunt situate în apropierea zonelor cu cicatrici extinse.

Management și rezultate

Aplicarea topică a hidrodistilatului de ulei de tămâie a fost aplicată de mai multe ori pe zi pentru ambele leziuni pe o perioadă de patru luni. La sfârșitul tratamentului, BCC carcinomul cu celule bazale  de pe braț a fost complet rezolvat ( Figura 1B ) și a fost observată o vindecare netedă a pielii. Materialul biopsic obținut din această zonă a demonstrat numai infiltrarea inflamatorie cronică focală și ușoară ( Figurile 1E și 1F ) și formarea cicatricilor, fără carcinom celule bazale BCC rezidual detectabil ( Figurile 1E-1J ).

Leziunea la nivelul pieptului a arătat o contracție progresivă la examenul brut în cursul tratamentului natural cancer cu boswellia( figurile 2Bși 2C ). La sfârșitul tratamentului cancer natural cu ulei esential de tamaie, leziunea inițială a scăzut la aproximativ 20% din dimensiunea originală ( Figura 2C ). Examinarea histologică a demonstrat formarea cicatricilor extinse. A fost identificat un focar rezidual al carcinomului cu celule bazale  BCC ( figurile 2F și 2G ) care au măsurat 1,3 mm în cea mai mare dimensiune pe diapozitivele de sticlă. Acest accent a fost estimat a cuprinde aproximativ 10% din volumul materialului de biopsie pe diapozitivele histologice. O cantitate substanțială de celule pynotice / apoptotice au fost observate în această leziune post-tratament (săgeată și inserție în figura 2G ) în comparație cu biopsia inițială ( figura 2E ), în care s-au observat numai celule piknotice / apoptotice mici. Deși o componentă infiltrativă a fost prezentă în biopsia originală, biopsia post-tratament a fost în mare parte compusă din BCC carcinom celule bazale  nodular.

Discuţie

BCC carcinomul cu celule bazale  superficial este frecvent tratat cu terapii topic-non-chirurgicale. Tratamentele conservatoare, inclusiv terapia fotodinamică și medicamentele topice, sunt disponibile pentru pacienții diagnosticați cu carcinom celule bazale  BCC. Două medicamente topice au fost aprobate de Food and Drug Administration (FDA) pentru tratarea BCC, imiquimod și fluorouracil. Crema de 5% imiquimod este aplicată local timp de șase săptămâni sau mai mult, cu rate de răspuns între 80% și 90%; și crema de 5% fluorouracil se aplică de două ori pe zi timp de 3-6 săptămâni, cu rate de răspuns mai mari de 80% 9 ] . Toate caracteristicile de tratament sunt factori determinanți semnificativi în alegerea tratamentului și există variații semnificative în preferințele populației pentru oricare dintre aceste tratamente 17 ] . În plus față de șansa de eliberare și costurile asociate cu aceste opțiuni de tratament, pacienții sunt deseori preocupați de rezultatele cosmetice și de efectele secundare pe care le-ar putea avea.

Rășina de Bowswellia a fost utilizată ca o componentă în medicamentele anti-cancer în medicina tradițională chineză. Am optimizat condițiile de hidrodistilizare pentru a pregăti ulei esențial de tămâie Boswellia sacra rășini de gumă cu activitate anticancer puternică. Am observat că uleiul esențial de tămâie poate avea activitate de supresie a creșterii puternice și de inducere a apoptozei, în special în culturile celulelor canceroase ale vezicii umane, ale sânului, colonului și celulelor pancreatice comparativ cu omologii lor normali 15 , 16 ] .Activitatea antitumorală modificătoare a uleiului esențial este observată, de asemenea, într-un model de șoarece xenograft heterotopic de șoarece de om pancreatic 14 ] . Observarea noastră a studiului de caz actual folosind aplicarea topică a uleiului esențial de tămâie pentru tratarea BCC este în concordanță cu un raport de știri precedent că ulei esențial de tămâie distilat din Boswellia carterii rășinile de gumă sunt eficiente în tratamentul melanomului malign la cai 18 ] . Mai important, aplicarea topică a uleiului esențial de tămâie nu a provocat efecte secundare pe întreaga durată a tratamentului, așa cum este descris în cazurile tratate cu alte aplicații topice, cum ar fi imiquimod, fluorouracil și terapia fotodinamică cu roșeață, umflare, eroziune, cruste, vezicule , squamae, mâncărime și furnicături 9 ] . Efectele negative scăzute ale uleiului esențial de tămâie sunt în concordanță cu un raport anterior că extracția chimică a Boswellia serrata rășinile de gumă nu au efecte adverse severe detectabile după ce au fost administrate pacienților iradiați pentru tumori cerebrale 13 ] .

Activitatea anti-cancer a uleiului esential de tifon poate rezulta dintr-o combinatie de activitati anti-proliferative si pro-apoptotice. Inhibarea creșterii induse de ulei esențial de incizie poate fi determinată de activarea fosfatidilinozitol-3-kinazei / protein kinazei B (PI3K / Akt) suprimată și progresia ciclului celular cu expresia crescută simultană a genelor de stopare a creșterii 16 ] . Apoptoza indusă de uleiul esențial este dependentă de caspază, pe baza clivajului și activării polimerazei caspase-3, -8, -9 și poli (ADP-riboză) (PARP) în diferite linii celulare de cancer uman 14 , 15 ] . Răspunsul carcinomului cu celule bazale  BCC la administrarea topică de ulei esențial de tămâie cu apoptoză crescută este în concordanță cu observațiile noastre în diverse modele experimentale.

Eficacitatea anti-cancer a uleiului esential de tifon depinde de metodele de distilare si de compozitiile chimice ale produselor finite. Într – un studiu clinic de fază II în curs de desfășurare, un extract chimic de rășini de gumă de specie Boswellia  este studiat ca agent adjuvant la pacienții cu glioame de grad înalt, cu accent pe acizii boswellic 13 ] . Deși acizii boswellic au fost considerați ca o componentă majoră a rășinilor de gumă speciile   Boswellia responsabile de activitatea antitumorală mediată de extractele de tămâie 19 , 20 , 21 , 22 , 23 , 24 , 25 ,26 ] , am arătat că alți compuși decât acizii boswellic ar putea fi la fel sau mai mult în modulul modulat de ulei de tămâie activitate anti-cancer. Cu un constituent chimic complex în ulei esențial de tămâie, multe componente pot funcționa sinergic pentru a oferi o activitate puternică împotriva cancerului. Deși s-ar putea să nu fie ușor să se izoleze un grup de compuși care lucrează sinergie, este important să se identifice un compus (compuși) de semnătura care să asigure activități viitoare biologice și anti-canceroase.

Vismodegibul, primul tratament oral pentru  carcinomul cu celule bazale BCC, a fost recent aprobat pentru tratamentul pacienților cu  carcinom cu celule bazale BCC local avansat sau metastatic, al căror cancer a fost refractar la tratamente canceroase standard sau care nu au fost candidați pentru intervenții chirurgicale sau radiații. Cele mai frecvente efecte adverse ale vismodegibului includ pierderea parului usoara pana la moderata, crampe musculare, tulburari de gust si pierderea in greutate. Costul estimat pentru o lună de tratament cu vismodegib este de 7.500 USD 10 ] . Rezultatele noastre preliminare au arătat că abundența compușilor cu greutate moleculară mare este corelată pozitiv cu citotoxicitatea indusă de uleiurile esențiale de tămâie în liniile celulare de cancer umane cultivate (datele nu sunt prezentate). Mai important, această formulă a redus considerabil efectele adverse, inclusiv iritarea capului, iritația gastrointestinală sau diareea după administrarea orală (datele nu sunt prezentate). Formula care conține compuși mai mulți compuși cu greutate moleculară mai mare poate fi utilă pentru tratarea  carcinomului cu celule bazale BCC avansat sau metastazat prin administrare orală.

Concluzie

Ulei esențial de tămâie obținut prin hidrodiistilarea  rășinilor de gumă de specie Boswellia posedă proprietăți anti-cancer prin modularea căilor multiple de semnalizare și prin activarea apoptozei dependente de caspază în celulele canceroase. Cu o mai bună înțelegere a compușilor biologici și a acțiunilor mecanistice, uleiul esențial de tămâie poate fi un agent terapeutic alternativ sigur și eficient pentru tratarea carcinomului cu celule bazale BCC prin administrare locală.

Listă de abrevieri

BCC, carcinom bazocelular.

Consimţământ

Consimțământul informat în scris a fost obținut de la pacient pentru publicarea acestui raport de caz și a imaginilor însoțitoare. O copie a consimțământului scris este disponibilă spre examinare de către editorul-șef al acestui jurnal.

Contribuția autorilor

Toți autori au contribuit la conceperea, proiectarea și pregătirea manuscrisului, precum și la citirea și aprobarea manuscrisului final.

Interesele concurente

CW și GY sunt afiliate cu uleiuri esențiale pentru tinere de viață. Restul autorilor au declarat că nu au interese concurente.

Conflict de interese

Nu au fost declarate.

AME

Toți autori respectă regulile etice ale dezvăluirii ale Asociației pentru Etică Medicală (AME).

Fung KM, Suhail MM, McClendon B, Woolley CL, Young DG, Lin HK.Gestionarea carcinomului bazocelular al pielii utilizând ulei esențial de tămâie (Boswellia sacra): un raport de caz. OA Medicină alternativă 2013 Jun 01; 1 (2): 14.
KM Fung 1,2,3 , MM Suhail 4 , B McClendon 2 , CL Woolley 5 , DG Young 5 , HK Lin 2 *

Autoritățile afiliate

(1) Departamentul de Patologie, Universitatea din Oklahoma Health Sciences Center, Oklahoma City, OK 73104, SUA

(2) Departamentul de Urologie, Universitatea din Oklahoma Health Sciences Center, Oklahoma City, OK, 73104, SUA

(3) Centrul Medical Oklahoma City Veterans, Oklahoma City, OK 73104, SUA

(4) AYUB S42 Cercetare, New Salalah, statul Dhofar 211, Sultanatul din Oman

(5) uleiuri esențiale de viață pentru tineri, Lehi, Utah, UT 84043, USA

* Autor corespondent Email: hk-lin@ouhsc.edu

Referințe

  • 1. Jackson BA. Nonmelanoma cancer de piele în persoane de culoare. Seminar Cutan Med Surg 2009 Jun; 28 (2): 93-5.
  • 2. Sng J, Koh D, Siong WC, Choo TB. Tendintele cancerului de piele in randul asiatici care traiesc in Singapore, 1968 – 2006. J Am Acad Dermatol 2009 Sep; 61 (3): 426-32.
  • 3. Ohtsuka H, ​​Nagamatsu S. Schimbarea tendințelor în numărul de decese cauzate de cancerul de piele nonmelanom în Japonia, 1955-2000. Dermatologie 2005 Mar; 210 (3): 206-10.
  • 4. Cakir BÖ, Adamson P, Cingi C. Epidemiologia și povara economică a cancerului de piele nonmelanom.Facial Plast Surg Clin Nord Am 2012 Nov; 20 (4): 419-22.
  • 5. Kim RH, Armstrong AW. Nonmelanoma cancer de piele. Dermatol Clin 2012 Jan; 30 (1): 125-39, ix.
  • 6. Bozikov K, Taggart I. Carcinomul bazocelular metastatic: este subtipul infiltrativ / morfhea, un factor de risc ?.Eur J Dermatol 2006 Nov-Dec; 16 (6): 691-2.
  • 7. Motegi S, Tamura A, Tanaka S, Nagai K, Ishikawa O. Carcinom bazocelular agresiv cu metastaze pulmonare. Eur J Dermatol 2006 Sep-Oct; 16 (5): 585-6.
  • 8. Matei C, Tampa M, Poteca T, Panea-Paunica G, Georgescu SR, Ion RM. Terapia fotodinamică în tratamentul carcinomului bazocelular. J Med Life 2013 Apr; 6 (1): 50-4.
  • 9. Arbitri AH, Mosterd K, Essers BA, Spoorenberg E, Sommer A, De Rooij MJ. Terapia fotodinamică față de imiquimodul local față de fluorouracilul topical pentru tratamentul carcinomului bazocelular superficial: un studiu orb, non-inferioritate, randomizat, controlat. Lancet Oncol 2013 Jun; 14 (7): 647-54.
  • 10. Poggi L, Kolesar JM. Vismodegib pentru tratamentul cancerului cutanat bazal celular. Am J Sănătatea Syst Pharm 2013 Jun; 70 (12): 1033-8.
  • 11. Huang MT, Badmaev V, Ding Y, Li Y, Xie JG, Ho CT. Activități antitumorale și anti-carcinogene ale acidului triterpenoid, beta-boswellic. Biofactori 2000 Mar; 13 (1-4): 225-30.
  • 12. Winking M, Sarikaya S, Rahmanian A, Jödicke A, Böker DK. Acizii Boswellic inhibă creșterea gliomului: o opțiune nouă de tratament ?. J Neurooncol 2000 Jul; 46 (2): 97-103.
  • 13. Kirste S, Treier M, Wehrle SJ, Becker G, Abdel-Tawab M, Gerbeth K. Boswellia serrata acționează asupra edemului cerebral la pacienții iradiați pentru tumori cerebrale: un studiu pilot prospectiv, randomizat, controlat cu placebo, dublu-orb. Cancer 2011 Aug; 117 (16): 3788-95.
  • 14. Ni X, Suhail MM, Yang Q, Cao A, Fung KM, Postier RG. Ulei esențial de cocos, preparat din hidrodisilarea rășinilor de guma Boswellia sacra, induce moartea celulelor canceroase pancreatice umane în culturi și într-un model murin xenograft. BMC Complement Altern Med 2012 Dec; 12 (1): 253.
  • 15. Suhail MM, Wu W, Cao A, Mondalek FG, Fung KM, Shih PT. Uleiul esential Boswellia sacra induce apoptoza celulelor tumorale si suprima agresivitatea tumorii in celulele umane de cancer de san cultivate. BMC Complement Altern Med 2011 Dec; 11 (1): 129.
  • 16. Frank MB, Yang Q, Osban J, Azzarello JT, Saban MR, Saban R. Uleiul de cocos derivat de la Boswellia carteri induce cytotoxicitatea specifică celulei tumorale. BMC Complement Altern Med 2009 Mar; 9 (1): 6.
  • 17. Tinelli M, Ozolins M, Bath-Hextall F, Williams HC. Ce determină preferințele pacientului pentru tratarea carcinomului bazocelular cu risc scăzut atunci când compară operația cu imiquimod? Un sondaj experimental de alegere discretă din studiul SINS. BMC Dermatol 2012 Oct; 12 (1): 19.
  • 18. TCN de servicii. Catifea arata promisiunea in combaterea cancerului de piele. 2006.
  • 19. Akihisa T, Tabata K, Banno N, Tokuda H, Nishimura R, Nakamura Y. Efectele chemopreventive asupra cancerului și activitățile citotoxice ale acizilor triterpenici din rășina lui Boswellia carteri. Biol Pharm Bull 2006 Sep; 29 (9): 1976-9.
  • 20. Park YS, Lee JH, Bondar J, Harwalkar JA, Safayhi H, Golubic M. Acțiunea citotoxică a acidului acetil-11-keto-b-boswellic (AKBA) asupra celulelor meningiomului. Planta Med 2002 May; 68 (5): 397-401.
  • 21. Xia L, Chen D, Han R, Fang Q, Waxman S, Jing Y. Acetat de acid Boswellic induce apoptoza prin căi mediate de caspază în celulele leucemice mieloide. Mol Cancer Ther 2005 Mar; 4 (3): 381-8.
  • 22. Liu JJ, Nilsson A, Oredsson S, Badmaev V, Duan RD. Acizii keto- și acetil-ceto-boswellic inhibă proliferarea și induc apoptoza în celulele Hep G2 printr-o cale dependentă de caspază-8. Int J Mol Med 2002 Oct; 10 (4): 501-5.
  • 23. Zhao W, Entschladen F, Liu H, Niggemann B, Fang Q, Zaenker KS. Acetat de acid boswellic induce diferențierea și apoptoza în celulele melanomului și fibrosarcomului înalt metastatic. Detectarea cancerului Prev 2003 Feb; 27 (1): 67-75.
  • 24. Liu JJ, Huang B, Hooi SC. Acidul acetil-ceto-b-boswellic inhibă proliferarea celulară printr-o cale dependentă de p21 în celulele cancerului de colon. Br J Pharmacol 2006 Aug; 148 (8): 1099-107.
  • Pang X, Yi Z, Zhang X, Sung B, Qu W, Lian X. Acidul acetil-11-ceto-b-boswellic inhibă creșterea tumorilor de prostată prin suprimarea angiogenezei mediate de receptorul 2 al factorului de creștere endotelială vasculară.Cancer Res 2009 Jul; 69 (14): 5893-900.
  • 26. Parcul B, Prasad S, Yadav V, Sung B, Aggarwal BB. Acidul Boswellic suprimă creșterea și metastazarea tumorilor pancreatice umane într-un model de șoarece nud orthotopic prin modularea țintelor multiple. PLoS One 2011 Nov; 6 (10): e26943.

Efectele chimiopreventive impotriva cancerului de hidrodistilat de rășină Boswellia sacra pe carcinomul urothelial invaziv: caz clinic

Abstract

Un bărbat hispanic în vârstă de 52 de ani a prezentat hematurie și a fost mai târziu diagnosticat cu un carcinom urothelial mare de grad invaziv (UCC) al vezicii urinare, dar cu o etapă ambiguă pT1 / pT2 în ceea ce privește invazia musculariilor propria de către UCC. A fost prezentat tratamentul convențional, inclusiv chistoprostatectomia radicală urmată de chimioterapie neoadjuvantă cu sau fără radioterapie. Pacientul a decis să amâne terapia standard până la o etapă ulterioară, dar a aleas să treacă prin rezecția transuretrală a tumorii vezicii urinare (TURBT) fără instilația de Bacillus Calmette-Guérin. În urma TURBT, pacientul a început administrarea orală de rășină Boswellia sacra gumă (aka tămâie sau Ru Xiang în chineză) de hidrodistilat (BSGRH) la 3 ml zilnic cu modificări ale stilului de viață și a continuat acest regim în ultimele 25 de luni. În primul an după diagnosticare, pacientul a prezentat 2 recidive. Tumorile recurente au fost eliminate prin TURBT în monoterapie și ambele tumori au fost mult mai mici decât cele originale. După a doua reapariție, pacientul nu are cancer detectabil în vezică pe baza de cistoscopie timp de 14 luni și are un sistem genitourinar intact. Funcțiile hepatice și renale sunt considerate a fi normale pe baza testelor de sânge. Acest caz indică faptul că BSGRH poate avea efecte chemopreventive de cancer asupra UCC.

Utilizarea produselor derivate de la Boswellia în managementul cancerului a fost  document foarte bn în alte studii publicate, iar acizii boswellic au fost sugerați a fi componenta majoră. Cu toate acestea, BSGRH conține foarte puțini acizi boswellic. Demonstrarea chemoprevenței cancerului utilizând BSGRH reprezintă un pas înainte în izolarea componentelor cheie, altele decât acizii boswellici din tămâie. Întrebarea critică cu privire la faptul dacă aceste componente pot activa simultan căi multiple în celulele canceroase pentru a efectua suprimarea cancerului / citotoxicitatea sau efectele de prevenire rămâne de rezolvat. Mai multe studii, inclusiv identificarea moleculelor cheie, farmacocinetica compușilor majori, precum și beneficiile pe termen lung și posibilele efecte adverse vor fi necesare pentru a respecta liniile directoare ale US Food and Drug Administration pentru dezvoltarea botanică a medicamentelor.

Carcinomul urothelial (UCC) al vezicii urinare este un carcinom comun în rândul adulților, cu un număr estimat de 76 960 cazuri noi și 16 390 decese în Statele Unite în 2016. Prognosticul și strategia de tratament ale UCC sunt adesea dictate de gradul histologic al tumorii și patologice de așteptare. În timp ce UCC fără invazie sau cu invazie limitată la lamina propria sunt supuse rezecției transuretrale a vaccinului cu tumori vezicale (TURBT) și a vaccinului cu Bacillus Calmette-Guérin (BCG), UCC cu invazie musculară propria necesită deseori cistectomie radicală la femele și la chistoprostatectomia radicală la bărbați pentru un tratament de succes.

Chistoprostatectomia radicală standardă elimină întreaga vezică, împreună cu veziculele prostatei și seminale și este adesea însoțită de o disecție bilaterală a ganglionilor limfatici pelvini pentru a elimina metastazele potențiale în aceste ganglioni limfatici. Pacienții vor primi apoi fie o reconstrucție ileală, fie o reconstrucție neobișnuită pentru colectarea și scurgerea urinei. După intervenția chirurgicală și reconstrucție, pacienților li se recomandă să primească chimioterapie neoadjuvantă cu sau fără radioterapie pentru tratamentul cu succes. Deși eficient, acest set de tratament este complicat, scump și duce la o morbiditate semnificativă.

Curajul (Ru Xiang în chineză), un medicament tradițional chinezesc și ayurvedic pe bază de plante, a fost descris ca având proprietăți antitumorale, în plus față de activitatea antiinflamatoare. Se demonstrează că extractele preparate din rășini de gumă de specii Boswellia au activitate anticarcino-genică în modelele de cancer de piele de șoarece induse chimic 1 , precum și activitățile antiproliferative și pro-apoptotice împotriva liniilor celulare de astrocitom de șobolan 2 și în linii celulare leucemice umane. 3 Clinic, sa demonstrat că extractele din rășini reduc edemul peritumoral la pacienții cu glioblastom 2 și inversează multiple metastaze cerebrale la un pacient cu cancer mamar. 4 Am raportat anterior că hidrodistilatul de rășină din rășină de guma Boswellia sacra (BSGRH), o formă de extract de rășini gumă de tămâie, posedă oprirea creșterii specifice a celulelor canceroase și citotoxicitatea în mai multe tipuri de linii celulare de cancer uman în culturi, 5 , 6 suprimă creșterea tumorii un model de șoarece nud de cancer pancreatic xenograft, 7 și în același timp activează căi multiple care duc la moartea specifică celulelor canceroase. 8 În acest raport, vom descrie efectele chemopreventive ale cancerului de administrare pe cale orală numai în cazul unui UCC invaziv papilar invaziv timp de 2 ani de urmărire.

Pacientul a fost un bărbat hispanic în vârstă de 52 de ani care a auto-detectat hematurie brută și cheaguri în urină în perioada octombrie-decembrie 2013. Pielograma intravenoasă (IVP) cu tomografie computerizată computerizată (CT) a fost efectuată pentru prima dată în februarie 2014 la Insight Imaging -Biltmore (Phoenix, AZ) și a detectat o masă neregulată neregulată de 4,2 x 4,3 x 3,7 cm în jurul joncțiunii ureterovesice drepte, cu îngroșarea peretelui vezicii vecine. Nu au existat caliectaze sau hidronefroze, nici complicații în sistemul de colectare a tractului superior sau în masa renală. Imaginea CT IVP a sugerat puternic o neoplazie a vezicii urinare primare. În aprilie 2014, a fost efectuată tomografie cu emisie de pozitroni fluoro-2-deoxi- d- glucoză / scanare CT la Universitatea Medicală Imaging la Centrul Medical al Universității din Arizona (Phoenix, AZ); și nu a fost detectată nici o metastază îndepărtată. Secvența evenimentelor este rezumată în figura 1 .

figura

Figura 1. Cronologia evenimentelor.

TURBT a fost efectuată în martie 2014 la Spitalul și centrul medical St Joseph (Phoenix, AZ). Tumoarea rezecționată a fost supusă evaluării patologice și etapării. Constatările endoscopice au sugerat invazia musculară propria. La examinarea patologică, două grupe diferite de patologie au exprimat opinii opuse cu privire la existența unei invazii reale a muscularis propria. In timp ce raportul de patologie initiala a facut un diagnostic de UCC invaziv cu invazie muscularis propria si astfel a corespuns pT2 conform criteriilor de stadializare ale Comitetului mixt american pentru cancer, un alt grup de patologie a facut un diagnostic de UCC de grad inalt cu invazie definitiva a lamina propria, dar nu invazia definitivă a muscularis propria corespunzătoare pT1 pe criterii de stadializare ale Comitetului mixt american privind cancerul.

Chistoprostatectomia radicală urmată de chimioterapie și / sau radioterapie a fost recomandată cu tărie de către 3 urologi independenți care au prezidat acest caz. Pacientul a refuzat chistoprostatectomia și orice chimioterapie / radioterapie neoadjuvantă, precum și tratamentul cu BCG împreună cu TURBT, care ar fi o alternativă standard în tratamentul UCC de grad înalt. În schimb, pacientul a ales să fie urmărit în mod regulat de către cistoscopie și TURBT pentru tumorile recurente.

La sfârșitul lunii aprilie 2014, pacientul a început administrarea orală a BSGRH la doza de 3 ml pe zi.BSGRH s-a obținut dintr-o sursă comercială și s-a preparat prin hidrodistilarea rășinilor gumă Boswellia sacra încărcate în apă de 55 ° C cu un raport de 1: 2,5 (greutate / volum) și s-a prelucrat la 100 ° C timp de 24 de ore, așa cum s-a descris anterior. 6 Profilul chimic al BSGRH a fost determinat și comparat cu cele raportate anterior. 6 , 9 În plus, pacientul a făcut modificări dietetice consumând mai multe cărnuri albe față de carnea roșie, luând vitamina C, multivitamine organice, extract de broccoli și sucuri zilnice (kale, morcov, ghimbir, patrunjel, mere, castravete și habanero) , precum și practicarea credințelor religioase și a exercițiilor fizice regulate.

Prima sa recurență a fost detectată în iunie 2014 în timpul cistoscopiei. Un total de 20 de tumori care au variat de la 0,2 până la 3,0 cm au fost eliminate de TURBT, dar nu a fost prezentă nici o tumoare în locul inițial. A doua reapariție a fost descoperită în februarie 2015, iar TURBT a fost efectuată în martie 2015 pentru a elimina în total 6 leziuni. Nu a fost observată implicarea rinichilor. Supravegherea cistoscopiei a fost continuată și nu a fost detectată nicio leziune nouă din cistoscopia efectuată în mai 2016, când a fost scris acest articol. În ultimii 2 ani, analiza urinei a fost efectuată, de asemenea, în mod curent, împreună cu cistoscopia și a demonstrat absența unei activități anormale. Pacientul și-a continuat doza zilnică orală de BSGRH pe parcursul întregului curs.

Pacientul a raportat absența oricărui efect advers din administrarea orală zilnică a BSGRH. Marcatorii de sânge pentru funcțiile hepatice, incluzând aspartat aminotransferaza, alanin aminotransferaza, albumina și bilirubina, s-au menținut în intervalul normal. Nivelurile creatininei serice, azotului din ureea din sânge și funcțiile renale totale de monitorizare a proteinei au fost menținute, de asemenea, în timpul furiei normale ( Tabelul 1 ). Testul de chimie de sânge obținut în martie 2014 înainte de administrarea orală a BSGRH a fost inclus ca referință.

Masa

Tabelul 1. Marcherii de sânge pentru funcțiile hepatice și renale.

Tabelul 1. Marcherii de sânge pentru funcțiile hepatice și renale.

Proba inițială TURBT obținută în martie 2014 a dat naștere unei agregate de țesut de 9,5 × 7,0 × 1,2 cm pentru a completa în total 13 casete de țesut. Specimenul a fost compus exclusiv dintr-un UCC invaziv de grad înalt ( Figura 2A ). Celulele epiteliale atipice au format o proliferare neoplastică multistrată groasă ( Figura 2B ) cu pierderea polarității și multe figuri mitotice ( Figura 2C ). Au fost invazii multifocale ale laminei propria însoțite de reacții desmoplastice semnificative ( Figura 2D ) cu necroză prezentă în unele dintre aceste focare invazive ( Figura 2E și F ). Nu a existat o invazie sinceră a muscularis propria. Cu toate acestea, au existat unele fibre musculare prinse printre celulele tumorale sugestive, dar nu definitive, de invazie a muscularis propria. Acest specimen a fost examinat de cel puțin 3 grupuri patologice diferite (inclusiv KMF, coautor al acestui articol) și au exprimat opinii diferite cu privire la existența unei invazii definitive a muscularis propria.

figura

Figura 2. Specimene patologice obținute din TURBT inițial (AF), prima recurență (GJ) și a doua recurență (KM). Primul specimen a constat din UCC (A) papilar de grad înalt cu straturi groase de proliferare epitelială neoplazică (B), pierderea polarității (C) și multe figuri mitotice (săgeți în C). A fost invazivă definitivă lamina propria cu modificări desmoplastice (D) și necroză focală (E și F). Prima recurență a constat în proliferarea neinvazivă papilară neinvazivă cu straturi groase (G) și subțiri (H) de celule epiteliale neoplazice. S-au prezentat figuri mitotice (săgețile din I și J corespunzătoare suprafețelor cu epiteliu neoplastic gros și subțire, respectiv). A doua recurență a constat exclusiv din UCC neinvaziv (K) cu straturi subțiri de celule epiteliale neoplazice cu cifre mitotice ocazionale (L). Mucin-conținând microcysts au fost observate în unele din epiteliul neoplazic (M).

Cel de-al doilea specimen TURBT (prima recurență) obținut în iulie 2014 a dat un total de 2,0 x 2,0 x 0,8 cm țesut suficient de mare pentru a umple 3 casete de țesut. Acest specimen a fost compus exclusiv din UCC neinvaziv papilar. În timp ce aproximativ jumătate din fragmentele de țesut aveau căptușeală epitelică neoplastică groasă, cealaltă jumătate avea o căptușeală neoplazică relativ subțire, care era limitată la aproximativ 5 până la 7 celule groase ( Figura 2G și H ). Au existat atypii de înaltă calitate și figurile mitotice atât în ​​straturile epiteliale neoplazice groase, cât și în cele subțiri ( figura 21 și J ), deși este mai puțin activ mitotic decât specimenul inițial TURBT.

Cel de-al treilea TURBT (a doua recurență) obținut în martie 2015 dă un agregat de 1,0 x 1,0 x 0,3 cm de țesut suficient pentru a umple cu ușurință 2 casete de țesut. Acest specimen a fost compus exclusiv din UCC neinvaziv papilar ( Figura 2K ) cu grosimea celulelor uroteliale neoplazice similare cu cele mai subțiri din cel de-al doilea specimen ( Figura 2L ). Spre deosebire de cele 2 exemplare anterioare, s-au observat chisturi cu mucină mică în interiorul epiteliului neoplastic ( Figura 2M ).

Cu diagnosticul inițial de pT1 UCC agresiv de grad înalt sau cu pT2 invaziv posibil în propria musculară, cazul este considerat potențial letal. Standardul de îngrijire recomandat de cei 3 urologi prezenți în acest caz a fost chistoprostatectomia radicală imediată, urmată de chimioterapie neoadjuvantă cu sau fără radioterapie. În schimb, pacientul a fost ales să primească TURBT fără instilare BCG.

TURBT singur a fost în măsură să reducă sarcinile tumorale imediat și a făcut alte regimuri eficiente. Cu 2 incidente de recurență în primul an după rezecția tumorală inițială, acest caz a sugerat că cancerul a rămas activ după TURBT. La prima recurență, până la 20 de tumori mici au fost identificate într-o locație separată de locul inițial și ar trebui considerate noi tumori primare. Acest lucru a indicat faptul că tumorigeneza este încă activă în curs de desfășurare. Localizarea celei de-a doua recurențe nu a fost bine documentată și este dificil să se concluzioneze dacă aceasta este o tumoare recurentă / reziduală sau o nouă tumoare. Cu toate acestea, aceste două leziuni recurente au fost mult mai mici decât tumora inițială. Morfologia a fost de asemenea diferită cu o tendință generală ca epiteliul neoplastic recurent să devină mai subțire și mai organizat în comparație cu tumoarea inițială.

Vor fi necesare mai multe studii pentru a înțelege modificările patofiziologice, în special la nivel molecular în celulele cancerului de vezică după tratamentul cu BSGRH. În plus, mucinele sunt o familie de molecule polidispersive, pot fi prezente fie în formă secretă, fie asociată cu membrană, și fac parte din sistemul complex de apărare a mucoasei. 10 Stojnev și alții au studiat o corelație între progresia mucinilor multiple și a cancerului vezicii urinare și au raportat că mucinsul 2 și 6 sunt asociate cu o supraviețuire globală mai bună, în timp ce expresia mucinei 1 poate reprezenta un fenotip mai agresiv. În cazul acestui indice, o doză zilnică de 3 ml de BSGRH pare să aibă un efect de prevenire a cancerului, deoarece pacientul nu prezintă UCC în vezica urinară în ultimele 14 luni de la ultima recurență, ca urmare a supravegherii cistoscopice. De asemenea, deoarece ambele recidive au apărut în primele 12 luni după TURBT inițial, aceasta ridică o ipoteză că efectele chemopreventive ale cancerului BSGRH se acumulează probabil într-o perioadă de timp, ceea ce duce apoi la 14 luni fără tumori după a doua recurență.

Comunitatea de cancer a studiat și a promovat un stil de viață sănătos pentru prevenirea și supraviețuirea cancerului. Factorii de stil de viață incluzând dieta, suplimentele nutritive, exercițiile fizice și altele au efecte protectoare pentru a reduce riscul de cancer. Studiile sugerează că consumul crescut de carne roșie și prelucrată este asociat cu un risc mai mare de cancer și cu mortalitate asociată cancerului la cancerul de sân, 12 cancer pancreatic, 13 și cancerul superior al tractului aerodigestiv. 14 Modelele dietetice sănătoase, inclusiv cerealele integrale, legumele, fructele, uleiul de măsline și peștele, par a fi mai favorabile pentru prevenirea și prognosticul cancerului. În plus, s-au descris efecte semnificative de chimioprotecție ale consumurilor mai mari de fructe și legume pentru cancerul de sân, 15 cancerul vezicii urinare, 16 și cancerul colorectal. 17 În schimb, alte studii nu au putut demonstra efectul protector al cancerului din consumul de fructe și legume. Această discrepanță se poate datora diferitelor acțiuni mecanistice activate de compuși biologici prezenți în diferite fructe și legume.

Deși au fost obținute rezultate incoerente din multe studii observaționale și studii clinice privind beneficiile suplimentelor dietetice în ceea ce privește riscul de supraviețuire și cancer, suplimentele alimentare au fost utilizate într-o mare parte a pacienților diagnosticați cu cancer. 19 , 20 Având în vedere numărul mare de pacienți cu cancer care combină vitamine și ierburi cu tratamente convenționale pentru cancer, sunt necesare urgențe mai multe cercetări pentru a aborda aspecte legate de posibilele beneficii sinergice sau de efectele adverse ale interacțiunii plante-vitamina și medicamente-plante-vitamine. Mai important, datorită variațiilor semnificative în formularea și fabricarea suplimentului alimentar, comunitatea de cancer trebuie să îmbunătățească comunicarea pacientului-furnizor și să ofere informații fiabile pacienților prin cercetări adecvate.

Multe studii au raportat în mod constant că activitatea fizică crescută la adulți poate reduce riscul de a dezvolta mai multe tipuri de cancer. Morales-Oyarvide și alții au rezumat că nivelurile mai ridicate ale activității fizice sunt asociate cu o mortalitate mai mică generală și cu cancer specific la pacienții diagnosticați cu cancer colorectal localizat. 21 Leach și colab. Au descris că un program de exerciții cu durată mai lungă poate fi benefic pentru îmbunătățirea calității vieții la pacienții cu cancer mamar. 22Exercițiul sau activitatea fizică este o intervenție sigură, fezabilă, ieftină, dar eficientă pentru îmbunătățirea prognosticului cancerului.

Abordările integrative care utilizează terapia convențională împreună cu modificările stilului de viață, suplimentele alimentare și exercițiile fizice ar îmbunătăți semnificativ supraviețuirea cancerului.

Grupul major de compuși chimici din speciile Boswellia , acizi boswellic, au fost parțial purificați pentru tratarea artritei pe baza proprietății lor antiinflamatorii. 23 În plus, acizii boswellic au fost studiați pentru activitatea lor anticanceroasă în cazurile umane. 4 , 24 Totuși, trebuie subliniat că acizii boswellici nu pot fi compușii activi prezentați în BSGRH datorită prezenței acizilor boswellic cu greutate moleculară foarte scăzută în hidrodistilat. 6 Demonstrarea chemoprevenței cancerului utilizând BSGRH reprezintă un pas înainte în identificarea și izolarea componentelor-cheie, altele decât acidul boswellic din specia Boswellia .Mai mult, combinațiile de compuși chimici diferiți pot întări efectele chemopreventive. Identificarea compusului (compușilor) biologic activi și studierea posibilelor efecte sinergice ale diferiților constituenți care asigură beneficii chemopreventive vor fi abordate în viitor.

Extractele din rășini de gumă de specii Boswellia sunt considerate a fi relativ sigure. De exemplu, la șobolani s-au studiat 2 formule de extracte de Boswellia serrata și nu a avut efecte adverse detectabile.Administrarea orală a unui extract de Boswellia serrata conținând 30% acid acid 3-O-acetil-11-ceto-p-boswellic (AKBA) la doza de 1,5 g / kg / zi la șobolani masculi și femele Sprague-Dawley timp de 90 de zile nu a determină modificări anormale bazate pe hematologie, chimie clinică și evaluări histopatologice. 25 Un alt extract de Boswellia serrata format din cel puțin 20% AKBA nu a arătat nici un efect advers observat la mai mult de 2,5 g / kg greutate corporală la șobolani Sprague-Dawley. Aceste extracte au fost folosite la om în studiile clinice la doza de 0,1 g / zi și au demonstrat siguranța și eficacitatea în tratamentul osteoartritei genunchiului. 10 , 27 În plus, administrarea orală a unui extract alcoolic de cochilie Boswellia ovalifoliolata la șobolani masculi Wistar albino la doza de 0,5 g / kg timp de 28 de zile nu a avut ca rezultat anomalie detectabilă. 28 În acest raport, pacientul a luat doza echivalentă cu 0,04 mL / kg greutate corporală / zi a BSGRH cu o densitate relativă de aproximativ 0,9. După 2 ani de administrare orală neîntreruptă, toți markerii de sânge pentru funcțiile hepatice și renale au rămas în limitele normale.

Dezvoltarea curentă a medicamentelor farmaceutice sa bazat în mare parte pe strategia unică compusă-singură cale. Terapia combinată cu medicamente a fost practicată în medicina modernă pentru bolile complicate cum ar fi SIDA și cancerul, pentru a bloca simultan căile multiple pentru a oferi o eficacitate mai mare. BSGRH conține mai mult de 600 de compuși identificabili. 6 , 7 Amestecul de constituenți chimici din BSGRH activează simultan multe gene responsabile pentru efectele antiproliferative și pro-apoptotice prin căi multiple de semnalizare în celulele canceroase. Mai important, BSGRH, într-o fereastră de concentrare, execută citotoxicitatea specifică celulelor canceroase în mai multe tipuri de linii celulare de cancer uman.Izolarea și purificarea unui singur compus din extractele de tămâie poate să nu fie la fel de eficace ca și extractele brute pentru scopul terapeutic intenționat datorită complexității profilurilor chimice și posibilelor efecte sinergice ale constituenților multipli. 3 Mai important, pe baza rezultatelor noastre, BSGRH are nu numai efecte citotoxice asupra celulelor canceroase cultivate, un model de cancer pancreatic de șoarece xenograft, 7 și un caz de cancer de piele uman 29 , dar poate de asemenea să acționeze sistemul imunitar gazdă pentru a lupta împotriva cancerului. 29 Studii mai detaliate vor aborda acțiunile mecanice ale BSGRH împotriva cancerelor.

Tehnicile moderne chimice și biomedicale trebuie încorporate pentru a studia extractele pe bază de plante care sunt destinate scopurilor terapeutice. De exemplu, tehnicile de analiză chimică cum ar fi cromatografia de gaz-spectrometrie de masă, cromatografia de lichid tandem-spectrometrie de masă și cromatografia lichidă de înaltă performanță sunt adecvate pentru analiza detaliată a componentelor chimice și a farmacocineticii BSGRH. Tehnicile moleculare și biologice celulare sunt utile în modelele experimentale și probele clinice pentru a înțelege mecanismele de acțiune. 6 , 7 Tehnologiile și bioinformațiile dezvoltate în epoca post-genomică sunt foarte utile pentru a înțelege farmacodinamica și farmacogenomica. În plus, sunt necesare studii clinice sistemice pentru a demonstra siguranța și eficacitatea oricărui agent terapeutic pe bază de plante.

Componentele chimice ale BSGRH diferă semnificativ datorită speciilor de plante Boswellia , precum și a climatului, a zonelor geografice, a timpului de recoltare și a condițiilor de depozitare a rășinilor de gumă. 30Metodele de hidrodistilare pot produce, de asemenea, profile chimice diferite care pot duce la variații ale activității biologice. 6 Prin urmare, este mai dificil să se standardizeze extractele botanice pentru a îndeplini standardele farmaceutice în scopuri terapeutice. Pe lângă buna practică de laborator și buna practică de fabricație, US Food and Drug Administration Guidance for Industry-Botanical Drug Products prezintă o bună practică agricolă și de colectare pentru plantarea copacilor, condițiile de recoltare și depozitare, precum și procedurile de prelucrare pentru a obține produse terapeutice consecvente rezultatele clinice fiabile ( http://www.fda.gov/AboutFDA/CentersOffices/OfficeofMedicalProductsandTobacco/CDER/ucm090946.htm ).Pentru a răspunde standardelor medicale moderne și liniilor directoare privind administrarea produselor alimentare și medicamentelor pentru dezvoltarea medicamentelor botanice, identificarea compușilor cheie, a mecanismelor de acțiune, a fumacocineticii compușilor-cheie, precum și a eficacității și posibilelor efecte adverse vor fi abordate pentru viitoarea aplicație experimentală nouă de droguri.

Autorii recunosc că pacientul a furnizat consimțământul scris și dosarele medicale pentru pregătirea acestui raport de caz. De asemenea, îi mulțumim pacientului pentru revizuirea tuturor descrierilor prezentate pentru a asigura exactitatea raportului.

Declarația privind interesele conflictuale
Autorul (autorii) nu a declarat niciun conflict potențial de interes în ceea ce privește cercetarea, autorul și / sau publicarea acestui articol.

Finanțarea
Autorul (autorii) nu a primit niciun sprijin financiar pentru cercetare, autor, și / sau publicarea acestui articol.

1. Huang, MT, Badmaev, V, Ding, Y, Liu, Y, Xie, JG, Ho, CT. Activități anti-tumorale și anti-carcinogene ale acidului triterpenoid, β-boswellic . Biofactors. 2000 ; 13: 225-230 . Google Scholar Crossref , Medline , ISI
2. Winking, M, Sarikaya, S, Rahmanian, A, Jodicke, A, Boker, DK. Acidul Boswellic inhibă creșterea gliomului: o opțiune nouă de tratament? J Neurooncol. 2000 ; 46: 97-103 . Google Scholar Crossref , Medline , ISI
3. Hostanska, K, Daum, G, Saller, R. In vitro activitatea citostatică și de apoptoză a acizilor boswellic față de liniile celulare maligne . Anticancer Res. 2002 ; 22: 2853-2862 . Google Scholar Medline , ISI
4. Flavin, DF. Un inhibitor al lipoxigenazei în metastazele cerebrale de cancer mamar . J Neurooncol. 2007 ; 82: 91-93 .Google Scholar Crossref , Medline , ISI
5. Frank, MB, Yang, Q, Osban, J. Ulei de lămâie derivat din Boswellia carteri induce cytotoxicitatea specifică celulei tumorale . BMC Complement Altern Med. 2009 ; 9: 6 . Google Scholar Crossref , Medline , ISI
6. Suhail, MM, Wu, W, Cao, ulei de esență sacra A. Boswellia induce apoptoza specifică celulelor tumorale și suprimă agresivitatea tumorală în celulele cancerigene de sân umane cultivate . BMC Complement Altern Med. 2011 ; 11: 129 .Google Scholar Crossref , Medline , ISI
7. Ni, X, Suhail, MM, Yang, Q. Ulei esențial de tămâie preparat din hidrodistilarea rășinilor de gumă Boswellia sacrainduce moartea celulelor cancerului pancreatic uman în culturi și într-un model murin xenograft . BMC Complement Altern Med. 2012 ; 12: 253 . Google Scholar Crossref , Medline , ISI
8. Dozmorov, MG, Yang, Q, Wu, W. Efectele diferențiate ale uleiului esențial de trandafir selectiv (Ru Xiang) versus lemn de santal neselectiv (Tan Xiang) asupra celulelor canceroase vezicule de cultura: un studiu microarray și bioinformatică. Chin Med. 2014 ; 9: 18 . Google Scholar Crossref , Medline , ISI
9. Woolley, CL, Suhail, MM, Smith, BL. Diferențierea chimică a uleiurilor esențiale Boswellia sacra și Boswellia carteriiprin cromatografie în fază gazoasă și spectrometrie de masă chirală de gaz chirală . J Chromatogr A. 2012 ; 1261: 158-163 . Google Scholar Crossref , Medline , ISI
10. Vishal, AA, Mishra, A, Raychaudhuri, SP. Un studiu clinic dublu-orb, randomizat, controlat cu placebo, evaluează eficacitatea timpurie a afla-pinei la subiecții cu osteoartrita genunchiului . Int J Med Sci. 2011 ; 8: 615-622 . Google Scholar Crossref , Medline , ISI
11. Stojnev, S, Ristic-Petrovic, A, Velickovic, LJ. Semnificația prognostică a expresiei mucinei în cancerul vezical urothelial. Int J Clin Exp Pathol. 2014 ; 7: 4945 – 4958 . Google Scholar Medline , ISI
12. Inoue-Choi, M, Sinha, R, Gierach, GL, Ward, MH. Carne roșie și prelucrată, nitriți și aportul de fier heme și riscul de cancer mamar în postmenopauză în studiul privind dieta și sănătatea NIH-AARP . Int J Cancer. 2016 ; 138: 1609-1618. Google Scholar Crossref , Medline , ISI
13. Chan, JM, Gong, Z, Holly, EA, Bracci, premier. Modelele dietetice și riscul de apariție a cancerului pancreatic într-un studiu amplu privind controlul cazurilor în zona San Francisco Bay Area . Nutr Cancer. 2013 ; 65: 157-164 . Google Scholar Crossref , Medline , ISI
14. Miles, FL, Chang, SC, Morgenstern, H. Asociații de carne roșie și prelucrată cu supraviețuire în rândul pacienților cu cancere ale tractului aerodigestiv superior și plămânului . Nutr Res. 2016 ; 36: 620-626 . Google Scholar Crossref , Medline , ISI
15. Farvid, MS, Chen, WY, Michels, KB, Cho, E, Willett, WC, Eliassen, AH. Consumul de fructe și legume în adolescență și vârsta adultă și riscul de apariție a cancerului de sân: studiu de cohortă pe bază de populație . BMJ. 2016 ; 353: i2343 .Google Scholar Crossref , Medline
16. Yao, B, Yan, Y, Ye, X. Consumul de fructe și legume și riscul de cancer al vezicii urinare: o meta-analiză a răspunsului doză-răspuns a studiilor observaționale . Cancerul determină controlul. 2014 ; 25: 1645-1658 . Google Scholar Crossref , Medline , ISI
17. Kunzmann, AT, Coleman, HG, Huang, WY, Cantwell, MM, Kitahara, CM, Berndt, SI. Consumul de fructe și legume și riscul de apariție a cancerului colorectal și a adenoamelor recurente și recidive în studiul PLCO de depistare a cancerului . Int J Cancer. 2016 ; 138: 1851-1861 . Google Scholar Crossref , Medline , ISI
18. Bradbury, KE, Appleby, PN, Key, TJ. Consumul de fructe, legume și fibre în legătură cu riscul de cancer: concluziile cercetării europene prospective în domeniul cancerului și al nutriției (EPIC) . Am J Clin Nutr. 2014 ; 100 ( suppl 1 ): 394S – 398S . Google Scholar Crossref , Medline , ISI
19. Luo, Q, Asher, GN. Utilizarea complementară și alternativă a medicamentelor la un centru complex de cancer [publicat online la 4 mai 2016 ]. Integr Cancer Ther. doi: 10.1177 / 1534735416643384 . Google Scholar SAGE Journals , ISI
20. Richardson, MA, Sanders, T, Palmer, JL, Greisinger, A, Singletary, SE. Utilizarea complementară / alternativă a medicamentelor într-un centru complex de cancer și implicațiile pentru oncologie . J Clin Oncol. 2000 ; 18: 2505-2514 .Google Scholar Crossref , Medline , ISI
21. Morales-Oyarvide, V, Meyerhardt, JA, Ng, K. Vitamina D și activitatea fizică la pacienții cu cancer colorectal: dovezi epidemiologice și implicații terapeutice . Cancer J. 2016 ; 22: 223-231 . Google Scholar Crossref , Medline , ISI
22. Leach, HJ, Danyluk, JM, Nishimura, KC, Culos-Reed, SN. Beneficii de 24 versus 12 săptămâni de programare de exerciții fizice și wellness pentru femeile supuse tratamentului pentru cancerul de sân [publicat online 16 iunie 2016 ].Asistență pentru îngrijirea cancerului. doi: 10.1007 / s00520-016-3302-3 . Google Scholar Crossref , ISI
23. Abdel-Tawab, M, Werz, O, Schubert-Zsilavecz, M. Boswellia serrata : o evaluare globală a datelor in vitro, preclinice, farmacocinetice și clinice . Clin Pharmacokinet. 2011 ; 50: 349-369 . Google Scholar Crossref , Medline , ISI
24. Analiza clinică a siguranței și eficacității cremei pe bază de Boswellia pentru prevenirea leziunilor cutanate adjuvante în carcinomul mamar: un studiu randomizat, controlat cu placebo . Togni, S, Maramaldi, G, Bonetta, A, Giacomelli, L, Di Pierro. Eur Rev Med Pharmacol Sci. 2015 ; 19: 1338-1344 . Google Scholar Medline , ISI
25. Lalithakumari, K, Krishnaraju, AV, Sengupta, K, Subbaraju, GV, Chatterjee, A. Evaluarea siguranței și toxicologică a unui Boswellia serrata, acid 3-O-acetil-11 -ceto-b-boswellic extract (5-Loxin®) . Toxicol Mech Metode. 2006 ; 16: 199-226 . Google Scholar Crossref , Medline , ISI
26. Krishnaraju, AV, Sundararaju, D, Vamsikrishna, U. Evaluarea siguranței și toxicologică a Aflapin: un produs antiinflamator derivat de la Boswellia . Toxicol Mech Metode. 2010 ; 20: 556-563 . Google Scholar Crossref , Medline , ISI
27. Sengupta, K, Alluri, KV, Satish, AR. Un studiu dublu-orb, randomizat, controlat cu placebo privind eficacitatea și siguranța 5-Loxin® pentru tratamentul osteoartritei genunchiului . Arthritis Res Ther. 2008 ; 10: R85 . Google Scholar Crossref , Medline , ISI
28. Devi, PR, Adilaxmamma, K, Rao, GS, Srilatha, C, Raj, MA. Evaluarea siguranței extractului alcoolic din coaja de Boswellia ovalifoliolata la șobolani . Toxicol Int. 2012 ; 19: 115-120 . Google Scholar Crossref , Medline
29. Fung, KM, Suhail, MM, McClendon, B, Woolley, CL, Young, DG, Lin, HK. Gestionarea carcinomului bazocelular al pielii cu ajutorul uleiului esențial de tămâie ( Boswellia sacra ): un raport de caz . OA Altern Med. 2013 ; 1: 14 . Google Scholar Crossref
30. Mikhaeil, BR, Maatooq, GT, Badria, FA, Amer, MM. Chimia și activitatea imunomodulatoare a uleiului de tămâie . Z Naturforsch C. 2003 ; 58: 230-238 . Google Scholar Crossref , Medline

Răspunsul durabil al carcinomului cutanat cu celule scuamoase în urma injecțiilor cu peri-leziune în doze mari de extracte de album Viscum – un raport de caz

Abstract

fundal

Carcinomul cutanat cu celule scuamoase (CSCC) este un cancer comun la nivelul locului invaziv al pielii, care rareori metastazizează. Tratamentul de primă linie este excizia chirurgicală, care este, în majoritatea cazurilor, curativă. Viscum album extract (VAE) este un tratament pe scară largă tratamentul cancerului de plante cu efecte citotoxice , apoptotice și imunologice, dar nu a fost investigat în CSCC.

Prezentarea cazului

Un pacient în vârstă de 78 de ani, cu carcinom cutanat celule scuamoase CSCC diagnosticat histologic, a refuzat excizia chirurgicală și a fost tratat cu VAE cu doză mare de peri-leziune. După 10 luni de tratament cancer cu vasc, carcinom cutanat celule scuamoase  CSCC dispăruse clinic. Pacientul a fost fără recurență timp de 4 ani.

Concluzie

Cazul prezentat prezintă răspunsul clinic al unui carcinom cutanat celule scuamoase CSCC la injecțiile ViscumAlbumExtract cu doze mari de peri-leziune.Cercetări suplimentare privind

Introducere

CSCC carcinom cutanat celule scuamoase este al doilea  cel mai frecvent cancer piele după carcinomul bazocelular , cu o incidență crescândă.Este invaziv la nivel local, dar invazia perineurală și metastazele în ganglionii limfatici sau în alte organe sunt rare ( Madan et al., 2010 ). Majoritatea leziunilor sunt asimptomatice, deși pot apărea dureri, mâncărime sau sângerări recurente. Factorii de risc de mediu pentru carcinom cutanat celule scuamoase CSCC sunt expunerea UV cumulată, papilomavirusul uman , imunosupresia , medicamentele fotosensibilizante, factorii ocupaționali, expunerea la arsen și fumatul. Factorii personali de risc sunt genele masculine și pielea sensibilă la soare ( Madan et al., 2010 ).Factorii prognostici sunt starea bolii, dimensiunea orizontală și verticală, localizarea, trăsăturile histologice și imunosupresia în gazdă.

Tratamentul recomandat pentru majoritatea cazurilor carcinom cutanat celule scuamoase CSCC este excizia chirurgicală.  Crioterapia , electrochirurgia și radioterapia sunt uneori utilizate în leziuni mai superficiale și bine diferențiate histologic.În leziunile cu risc ridicat, chirurgia Moh prezintă cele mai bune rezultate privind recurența locală și apariția metastazelor ( Motley et al., 2009 ). Tratamentele locale cu diferiți agenți prezintă rezultate diverse în serii de cazuri și studii mici; reacțiile adverse sunt reacții cutanate locale precum eritemul , umflarea, descuamarea și sensibilitatea ( Madan et al., 2010 ). Dysregularea căilor de semnalizare în carcinom cutanat celule scuamoase CSCC este în curs de cercetare și poate duce la noi terapii vizate în viitor ( Rodust et al., 2009 ). Rata generală de vindecare după terapie este mai mare de 90% în primii 5 ani. Leziunile primare recidivă în aproximativ 8% din cazuri, metastazele apar în 5,5% ( Rowe et al., 1992 ), iar mortalitatea cauzată de carcinom cutanat celule scuamoase  CSCC este de aproximativ 1-2% ( Marks 1995 ). Pacienții cu leziuni primare prezintă un risc crescut (50%) de a dezvolta alte leziuni ale cancerului de piele în următorii 5 ani ( Karagas et al., 1992 ). Remisiunea spontană în CSCC carcinom cutanat celule scuamoase  este rară ( Chodorowski et al., 2007; O’Regan și Hirshberg 1993 ).

ViscumAlbum Extract sunt extracte apoase făcute din vâsc european , o plantă hemi-parazitară care crește pe arbori gazdă diferiți ( , mesteacăn, măr, stejar și altele). Utilizarea ViscumAlbum Extract VAE în tratamentul cancerului a fost pionieră în medicina antroposofică în anii 1920 și astăzi este utilizată pe scară largă în rândul pacienților cu cancer din Europa Centrală ( Molassiotis et al., 2005 ). Se administrează, de obicei subcutanat, în doze mici, în creștere încet, dar se utilizează ocazional doze mai mari și aplicări intra- sau peritumourale sau intravenoase , precum și instilații în cavitățile viscerale. Compușii izolați precum și extractele întregi de ViscumAlbum Extract VAE sunt citotoxice, induc apoptoza , acționează limfocite , granulocite , macrofage și celule NK , induc diferite citokine și prezintă proprietăți de stabilizare a ADN-ului ( Büssing 2000; Kienle și Kiene 2003a ).

Studiile clinice arată îmbunătățirea calității vieții ( Kienle și Kiene 2010 ) și efectul potențial asupra supraviețuirii ( Kienle și Kiene 2007 ).

 Remisiile tumorale au fost raportate ocazional după doze mari și aplicații locale ( Kienle și Kiene 2003b, 2007, Kirsch 2007, Orange și alții 2010, Seifert et al., 2007 ). 

Efectele secundare sunt reacțiile locale la nivelul pielii și simptomele asemănătoare gripei. Au fost raportate reacții alergice. 

În general, VAE este considerat sigur ( Kienle și Kiene 2003a, Olaku și White 2010, Stein 2000, Stein și Berg 2000 ) chiar și în doze mari ( Kienle et al., 2011 ).

Prezentarea cazului

Un pacient activ în vârstă de 78 de ani, cu antecedente medicale de boală cardiacă (infarct miocardic, chirurgie by-pass coronarian), a fost transferat la medicul general (GP) cu o leziune cutată de 11 mm × 7 mm ( placă hiperkeratotică cu descuamare). El a descoperit leziunea la marginea interioară a ochiului drept cu un an înainte, dar nu a simțit nici un disconfort. În departamentul de ambulatoriu dermatologic al spitalului universitar din apropiere (Fachklinik Hornheide, Münster), un carcinom cu celule scuamoase foarte diferențiate , cu o grosime maximă a tumorii verticale de 0,8 mm, a fost diagnosticat prin biopsie punch(clasificarea AJCC I fără caracteristici de risc înalt ( Farasat et al , 2011 )) ( figura 1 ).

Figura 1 . Biopsia tumorii pacientului (vedere medie de putere, 200 ×): atypia celulară în toate straturile epidermei, țesutul epidermal plasat liber în țesutul conjunctiv (subepidermic) cu pleomorfismul nucleelor, figurile mitotice și formarea nucleului gigant.

Excizia chirurgicală a fost propusă pacienților. Pacientul a refuzat intervenția chirurgicală din cauza localizării extrem de sensibile a tumorii și a antecedentelor sale medicale de boală de inimă. Practicianul său general a sugerat o terapie de injecție peri-lesională ViscumAlbum Extract VAE. Natura experimentală a acestei terapii și rezultatul incert al acesteia au fost discutate temeinic cu pacientul, precum și alte opțiuni de tratament, cum ar fi chirurgia și radioterapia .

S-au utilizat preparate de AbnobaVISCUM®. Acestea sunt clasificate prin autorizația de introducere pe piață în Germania în conformitate cu Ph. Eur. monografie 01/2008: 0765 EXTRACTE ca „alt extract”. „Alte extracte” sunt determinate de procesul de producție, cu specificări meticuloase care determină extracte farmaceutic comparabile. Pentru „alte extracte”, principiul terapeutic activ este întregul extract. Astfel, nu este permisă declararea unui anumit conținut al unui singur constituent; pentru componentele de asigurare a calității sunt măsurate în mod regulat într-un proces de analiză controlat și validat (orientarea ICH Q2 (R1)).

Tratamentul anticanceros a fost inițiat cu ViscumAlbum Extract VAE din frasin-arbore gazdă (AbnobaVISCUM® Fraxini, flacoane de 0,02-2 mg, 2 mg conțin circa 2 μg lectină de vâsc / ml, concentrațiile ML în doze mai mici sunt respective) ca acul fin peri-leziune pentru 24 de săptămânitabelul 1 ). În acest timp, dimensiunea tumorii a crescut lent.Deoarece nu au existat semne de remisiune în acest punct, preparatul ViscumAlbum Extract  VAE a fost modificat la ViscumAlbum Extract VAE din gazonul gazdă (AbnobaVISCUM® Betulae) în doze mai mari (flacoane de 2-20 mg, pentru detalii vezi Tabelul 2 ; 20 mg conțin circa 20 μg lecitină de vâsc / ml și 59 μg vâscotoxine / ml, concentrațiile în doze mai mici sunt respective), și după 4 săptămâni, s-a dezvoltat o leziune albă asupra leziunii. Alte 7 săptămâni mai târziu, scabul a căzut și leziunea a scăzut la <6 mm (diametrul cel mai mare). Douăzeci de săptămâni după schimbarea la doze mari de VAE betulae, situsul inițial al tumorii a arătat doar o zonă eritemică mică fără semne de creștere tumorală sau cicatrici. (Cursul leziunii este arătat în fotografii, luate la intervale de 2 luni: Fig. 2 a-d.) Departamentul dermatologic (Fachklinik Hornheide, Münster) a confirmat clinic remisia completă a tumorii. Biopsia pentru confirmarea histologică a remisiunii a fost refuzată de către pacient. Tratamentul cu ViscumAlbum Extract VAE a fost continuat cu injecții subcutanate în brațul superior (3 / săptămână în doze diferite: 2 mg, 0,2 mg, diluție înaltă D10), efectuată de soția pacientului la domiciliu; intervalele au fost incluse mai târziu (8 săptămâni de tratament urmate de 4 săptămâni de întrerupere, apoi 4 săptămâni de tratament cu 8 săptămâni de întrerupere etc.).

Tabelul 1 . Terapie VAE fraxini .

Săptămâna tratamentului VAE fraxini: injecții perilesionale pe săptămână a Observații la locul tumorii b (dimensiunea inițială a tumorii: 11 mm × 7 mm)
0,02 mg 0,2 mg a 2 mg
1 2
2 c
3-4 2 Nici o schimbare evidentă
5 d Înmuiere a pielii
6-8 2 pruritul
9-11 1
12 1
13 1
14-21 1
22 1 Prima fotografie ( figura 2a )
23 0
24 1
A
Flacoanele pentru injecție conțin 1 ml; dintre acestea, numai 0,1-0,5 ml au fost utilizate pentru fiecare injecție în funcție de doza de infiltrare tolerată de pacient.
b
În total, pe întreaga perioadă acoperită de acest tabel, dimensiunea tumorii a crescut lent.
c
Nu există oa doua injecție datorită umflăturii și înroșirii ca reacție la injectarea prealabilă.
d
Prima injecție de 0,02 mg, oa doua injecție de 0,02 / 0,2 mg (1: 1).

Tabelul 2 . Terapia cu VAE betulae, în urma terapiei cu VAE fraxini (vezi tabelul 1 ).

Săptămâna tratamentului VAE betulae: injecții perilezionale pe săptămână Observații la locul tumorii
2 mg a 20 mg a
1-2 1
3 1
4 1 Curățarea albă
5 b Curățare albă 5 mm × 8 mm;prescrierea de dimetindină
6 1
7 1 A doua fotografie ( figura 2 b)
8-10 1
11 1 Scabul a căzut; site tumoral <6 mm
12 1
13 0
14-15 1
16 1 A treia fotografie ( figura 2 c)
17 1
18 2
19 1
20 1 Nu există tumori palpabile, zona eritematoasă la locul anterior
21 0
22 1
23 1
24 0 A 4-a fotografie ( figura 2 d)
A
Din flacoanele indicate de 1 ml s-au utilizat numai 0,1-0,45 ml pentru fiecare injecție în funcție de doza de infiltrare tolerată de pacient.
b
Două injecții au fost aplicate în săptămâna 5, deoarece evoluția bolii a arătat efecte pozitive în săptămâna anterioară și, prin urmare, a fost luată în considerare o modificare a regimului la injecții de două ori pe săptămână.

Fig. 2 . Imagini ale tumorii pacientului. a: cu 3 săptămâni înainte de ViscumAlbum Extract VAE betulae; b: săptămâna 7 din ViscumAlbum Extract VAE betulae; c: săptămâna 16 din ViscumAlbum Extract VAE betulae; d: săptămâna 24 din ViscumAlbum Extract  VAE betulae.

Efectele secundare ale tratamentului au fost umflarea pielii la locul injectării începând cu aproximativ o jumătate de oră după aplicare și durează aproximativ 48 de ore, precum și mâncărime ocazionale ale feței și scalpului timp de câteva zile. Atunci când VAE ViscumAlbum Extract a fost utilizat la doze mai mari, umflarea periorbitală adeterminat restricția vizuală a ochiului drept. Dimetindenul (picături Fenistil®, 1-1,5 mg 3 × / zi) a fost prescris o dată pentru a controla mâncărimi.

În prezent, pacientul în vârstă de 84 de ani se află într-o stare bună de sănătate și își plimbă cu bicicleta 25-40 km pe zi. La o vizită recentă la un dermatolog, nu s-au observat clinic semne de recurență. Pacientul a fost foarte mulțumit de acest tip de tratament și a menționat că ar prefera această opțiune în cazul recurenței sau al altor apariții ale tumorii.

Terapii antecedente și concomitente

Pe lângă intervenția chirurgicală by-pass coronariană (vezi mai sus), pacientul a suferit o intervenție chirurgicală de înlocuire a șoldului pe șoldul drept după o fractură a femuralului. Boala sa cardiacă coronariană a fost tratată cu acid acetilsalicilic, metoprolol și stroful Oleum . Funcția miocardică nu a fost semnificativ redusă.

Nu a fost aplicată nici o terapie specifică tumorii în afară de ViscumAlbum Extract  VAE.

Discuţie

Cazul prezentat prezintă o remisie clinică completă a unui carcinom cutanat celule scuamoase CSCC cu risc scăzut în cadrul tratamentului  ViscumAlbum Extract VAE cu doză mare fără recurență în următorii 4 ani (până la publicare). Diagnosticul histologic al CSCC ( figura 1) a fost confirmat de doi dermatologi independenți . Deoarece remisiunea spontană a CSCC este rară și nu a fost utilizată nici o altă terapie specifică, presupunem că remisia a avut loc ca rezultat al injecțiilor VAE cu doze mari. Biopsia post-tratament a situsului tumoral nu a putut fi efectuată pentru a confirma remisia diagnosticată clinic a tumorii. Cu toate acestea, având în vedere urmărirea pe termen lung a pacientului fără semne de recurență, este foarte probabil să se obțină o remisiune completă a tumorii.

Se poate presupune dependența de doză din cauza lipsei de răspuns în doze mai mici și a reacțiilor cutanate locale puternice (înroșirea și umflarea) și a remisiunii tumorale în doze mari. Diferența de efect s-ar putea datora utilizării vascului cultivat pe arbori gazdă diferiți (Fraxinus vs. Betula), dar acest lucru pare mai puțin probabil deoarece compușii activi din preparatele utilizate sunt asemănătoare (comunicarea personală, Dr. Karin Schleisiek, Abnoba GmbH) .

Au fost raportate remisii tumorale cu reacții imunologice asociate cu doze mari de VAE, adesea injectate intraperitoneal sau peritumoral, la alte entități tumorale, cum ar fi carcinomul cu celule scuamoase din cavitatea bucală ( Scheffler și colab., 1996 ), celulele B cutanate primare ( Orange și colab., 2012 ), carcinomul de celule Merkel sau cancerul de sân ( Orange și colab., 2010 ) și alții ( Kienle și Kiene 2003a, 2007 ). Acestea au fost, de asemenea, observate în mod repetat în experimentele pe animale ( Büssing 2000; Kienle și Kiene 2003a ). Efectele antitumorale ale VAE aplicate local pot fi explicate prin potențialul lor puternic de inducere a citotoxicității și apoptozei și prin efectele stimulative imune (de exemplu, activarea celulelor care prezintă antigen, celulelor efectoare , inducerea citokinelor și altele) așa cum se observă in vitro și in vivo experimente ( Büssing 2000; Kienle și Kiene 2003a ). Totuși, sunt necesare studii suplimentare privind modul de acțiune in vivo al VAE în tumori, în special analize histologice și imunohistologice în timpul și după aplicarea locală a VAE cu doză mare.

Reacțiile cutanate locale, cum ar fi umflarea pielii înconjurătoare, precum și eritemul și mâncărimea, sunt bine cunoscutele efecte secundare ale VAE ( Kienle și colab., 2011 ) și sunt, de asemenea, observate după aplicarea altor terapii imunomodulatoare, cum ar fi anticorpii monoclonali sau imiquimod et al., 2009, Goodman și colab., 1990, Madan și colab., 2010 ). Apariția acestor efecte secundare în timpul tratamentului cu inhibitor al receptorului factorului de creștere epidermal pare să prezică un rezultat clinic mai bun ( Wacker și Nagrani 2007 ).

Această lucrare descrie un singur caz și nu au fost găsite alte cazuri la VAE în CSCC. Deoarece terapia primară a CSCC – excizia chirurgicală – este curativă în majoritatea cazurilor, cu puține riscuri, pacienții nu ar trebui să fie sfătuiți să utilizeze alternative. Deși CSCC are un prognostic relativ bun, poate continua să progreseze, să se infiltreze sau să metastasizeze dacă nu este tratat corespunzător, iar riscurile de întârziere sau de reținere a exciziei chirurgicale trebuie să fie atent balansate și discutate critic ( Mistry et al., 2010 ).Pot exista situații ca în cazul prezentat, cu o nevoie rezonabilă de tratament neinvaziv. Un mare interes a fost generat în căutarea opțiunilor de terapie neinvazivă ( Madan et al., 2010 ), iar cercetarea privind VAE în CSCC este, prin urmare, justificată.

Consimţământ

Consimțământul informat în scris a fost obținut de la pacient pentru publicarea raportului și a imaginilor însoțitoare. A citit versiunea finală a lucrării și a confirmat conținutul acesteia.

Conflictul de interese

Autorii declară că nu au un conflict de interese.

Contribuția autorului

PGW și GSK au contribuit la proiectarea rapoartelor de caz. GS a fost medicul responsabil care a furnizat informațiile pacientului și a aranjat documentația foto. PGW și HF au colectat și furnizat datele. PGW a fost autorul principal al lucrării, a avut acces deplin la toate datele și este garant. HF a oferit cunoștințe specifice în AM. GSK a supravegheat raportul și procesul de publicare.

Recunoasteri

Suntem recunoscători pentru Priv.-Doz. Dr. H.-J. Schulze, Fachklinik Hornheide, Münster, pentru fotografiile histologice și fondul Christophorus pentru sprijin financiar.

Răspunsul durabil al carcinomului cutanat cu celule scuamoase în urma injecțiilor cu peri-leziune în doze mari de extracte de album Viscum – un raport de caz
Sub licență Creative Commons
acces deschis

Referințe

Alessi și colab., 2009
SS Alessi, JA Sanches, WR Oliveira, MC Messina, ER Pimentel, NC Festa Tratamentul tumorilor cutanate cu cremă imiquimod topică 5%
Clinici (Sao Paulo), 64 (2009), pp. 961-966
Büssing, 2000
A. Büssing (Ed.), Mistletoe. Genul Viscum (2000)
pp. 1-265
Chodorowski și colab., 2007
Z. Chodorowski, JS Anand, M. Wisniewski, M. Madalinski, K. Wierzba, J. Wisniewski Regresia spontană a cancerului – revizuirea cazurilor din 1988 până în 2006
Przeglad Lekarski, 64 (2007), pp. 380-382
Engels și colab., 1998
DR Engel, BK Armstrong, A. Kricker, MG Winter, PJ Heenan, PL Randell Caracteristici demografice, factori de risc pigmentari și cutanat pentru carcinomul scuamos al pielii: un studiu de caz-control
International Journal of Cancer, 76 (1998), pp. 628-634
Farasat și colab., 2011
S. Farasat, SS Yu, VA Neel, KS Nehal, T. Lardaro, MC Mihm, DR Byrd, CM Balch, JA Califano, AY Chuang, WH Sharfman, JP Shah, P. Nghiem, CC Otley, AP Tufaro, TM Johnson , AJ Sober, NJ Liegeois Un nou ComitetComunitar American privind sistemul de stadializare a cancerului pentru carcinomul cutanat cu celule scuamoase: crearea și raționamentul pentru includerea caracteristicilor tumorale (T)
Jurnalul Academiei Americane de Dermatologie (2011)
Goodman și colab., 1990
GE Goodman, I. Hellstrom, L. Brodzinsky, C. Nicaise, B. Kulander, D. Hummel, KEHellstrom, faza I, de anticorp monoclonal murin L6 în cancerul de sân, colon, ovarian și plămân
Journal of Clinical Oncology, 8 (1990), pp. 1083-1092
Karagas și colab., 1992
MR Karagas, TA Stukel, ER Greenberg, JA Baron, LA Mott, RS Stern Riscul de carcinom bazocelular ulterior și de carcinom al celulelor scuamoase ale pielii la pacienții cu cancer de piele anteriori.Grupul de studiu privind prevenirea cancerului de piele
JAMA, 267 (1992), pag. 3305-3310
Kienle și colab., 2011
GS Kienle, R. Grugel, H. Kiene Siguranța dozelor mai mari de Viscum album L. la animale și oameni – revizuirea sistematică a modificărilor imune și a parametrilor de siguranță
BMC Medicină complementară și alternativă, 11 (2011), p. 72
Kienle și Kiene, 2003a
Kienle, GS, Kiene, H., 2003a. Mistel în der Oncologie – Fakten und konzeptionelle Grundlagen.
Kienle și Kiene, 2003b
GS Kienle, H. Kiene Wirksamkeitsbeurteilung der Misteltherapie
Metodologie und Einzelfälle, 1 (2003), pp. 433-490
Kienle și Kiene, 2007
GS Kienle, H. Kiene Terapia complementară a cancerului: o revizuire sistematică a studiilor clinice prospective privind extractele de vâsc antropozofic
European Journal of Medical Research, 12 (2007), pp. 103-119
Kienle și Kiene, 2010
GS Kienle, H. Kiene Influența extractelor Viscum album L. (vâsc european) asupra calității vieții la pacienții cu cancer: o revizuire sistematică a studiilor clinice controlate
Integrative Therapies of Cancer, 9 (2010), pp. 142-157
Kirsch, 2007
A. Kirsch Tratamentul cu succes al melanomului malign metastatic cu extract de album Viscum (Iscador M)
Journal of Alternative and Complementary Medicine, 13 (2007), pp. 443-445
Madan și colab., 2010
V. Madan, JT Lear, RM Szeimies Cancer de piele non-melanom
Lancet, 375 (2010), pp. 673-685
Marks, 1995
R. Marks Epidemiologia cancerului de piele non-melanom: cine, de ce și ce putem face în legătură cu acesta
Journal of Dermatology, 22 (1995), pp. 853-857
Mistry și colab., 2010
R. Mistry, B. Wademan, G. Avery, ST Tan Un caz de carcinom cu celule scuamoase misdiagnosticate datorită unui accident medical alternativ – timp pentru înăsprirea reglementării?
Noua Zeelandă Medical Journal, 123 (2010), pp. 61-67
Molassiotis și colab., 2005
A. Molassiotis, P. Fernadez-Ortega, D. Pud, G. Ozden, JA Scott, V. Panteli, A. Margulies, M. Browall, M. Magri, S. Selvekerova, E. Madsen, L. Milovics, I , Bruyns, G. Gudmundsdottir, S. Hummerston, AM Ahmad, N. Platin, N. Kearney, E. Patiraki Utilizarea medicamentelor complementare și alternative la pacienții cu cancer: un studiu european
Analele Oncologiei, 16 (2005), pp. 655-663
Motley și colab., 2009
RJ Motley, PW Preston, CM Lawrence Ghiduri multiprofesionale pentru managementul pacientului cu carcinom cu celule scuamoase cutanate primare
(2009)
O’Regan și Hirshberg, 1993
B. O’Regan, C. Hirshberg Remisiune spontană: o bibliografie adnotată
(1993)
Olaku și White, 2010
O. Olaku, JD White Terapia pe bază de plante folosită de pacienții cu cancer: o revizuire a literaturii de specialitate privind rapoartele de caz
Jurnalul European de Cancer (2010)
Orange și colab., 2010
M. Orange, M. Fonseca, A. Lace, B. von Laue, S. Geider Răspunsuri tumorale durabile după inducerea primelor doze mari cu extract de vâsc: două rapoarte de caz
Jurnalul European de Medicină Integrativă, 1 (2010), p. 227
Orange și alții, 2012
M. Regenerarea durabilă a limfomului cutanat primar cutanat în urma tratamentului cu vâsc de boală – două rapoarte de cazuri
Avansuri Globale în Sănătate și Medicină (2012), p. 1
Rodust și colab., 2009
PM Rodust, E. Stockfleth, C. Ulrich, M. Leverkus, J. Eberle Carcinom cu celule scuamoase induse de UV – un rol pentru căile de semnalizare antiapoptotice
British Journal of Dermatology, 161 (Suppl. 3) (2009), pp. 107-115
Rowe și colab., 1992
DE Rowe, RJ Carroll, CL Day Jr. Factorii prognostici pentru recurența locală, metastaze și rate de supraviețuire în carcinomul cu celule scuamoase ale pielii, urechii și buzelor. Implicații pentru selectarea modului de tratament
Jurnalul Academiei Americane de Dermatologie, 26 (1992), pp. 976-990
Scheffler și colab., 1996
A. Scheffler, H. Mast, S. Fischer, HR Metelmann Komplette Remission eines Mundhöhlenkarzinoms nach alleiniger Mistelbehandlung
(1996)
pp. 453-466
Seifert și colab., 2007
G. Seifert, C. Tautz, K. Seeger, G. Henze, A. Laengler Utilizarea terapeutică a vâscului pentru CD30 + tulburarea cutanată limfoproliferativă / papuloza limfomatoidă
Jurnalul Academiei Europene de Dermatologie și Venereologie, 21 (2007), pp. 558-560
Stein, 2000
GM Stein Toxicologia vascului și a componentelor acestuia
(2000)
pp. 183-194
Stein și Berg, 2000
GM Stein, PA Berg Efecte adverse în timpul terapiei cu extract de vâsc
(2000)
pp. 195-208
Wacker și Nagrani, 2007
B. Wacker, T. Nagrani Corelarea între evoluția erupțiilor cutanate și eficacitatea la pacienții tratați cu erlotinib inhibitor al receptorului tirozin kinazei factorului de creștere epidermal în două mari studii de fază III
Clinic de Cancer Research (2007)
1
Decedat 31.07.2008.

Itraconazol ca tratament pentru cancerul de prostată avansat: un studiu de fază II, randomizat, necomparativ, la bărbații cu cancer de prostată rezistent la castrare metastatică

Oncolog. 2013 februarie; 18 (2): 163–173.Publicat online 2013 ianuarie 22. 

doi:  10.1634 / theoncologist.2012-314 PMCID: PMC3579600 PMID: 23340005

Emmanuel S. Antonarakis , Elisabeth I. Heath , David C. Smith , Dana Rathkopf , Amanda L. Blackford , Daniel C. Danila , Serina King , Anja Frost , A. Seun Ajiboye , Ming Zhao , un Janet Mendonca , un Sushant K. Kachhap , Michelle A. Rudek , a și Michael A. Carducci

Informații despre autor 

Note despre articol 

Informații privind drepturile de autor și licență 

Disclaimer

Acest articol a fost citat de alte articole din PMC.

Date asociate

Materiale suplimentareMergi la:

Abstract

Fundal.

Medicamentul antifungic itraconazol inhibă angiogeneza și semnalizarea arici și întârzie creșterea tumorii la modelele de xenogrefă de cancer de prostată murin. Am efectuat un studiu de fază II, necomparativ, randomizat, evaluând eficacitatea antitumorală a două doze de itraconazol oral la bărbații cu cancer de prostată metastatic.

Pacienți și metode.

Am repartizat în mod aleatoriu 46 de bărbați cu cancer de prostată metastatic rezistent la castrare (CRPC) care nu au primit chimioterapie pentru a primi doze mici (200 mg / zi) sau doze mari (600 mg / zi) itraconazol până la progresia bolii sau toxicitate inacceptabilă. Obiectivul principal a fost rata de supraviețuire fără progresie (PPFS) a antigenului prostatic specific (PSA) la 24 de săptămâni; o rată de succes de 45% în ambele brațe a fost prespecificată ca fiind o semnificație clinică. Obiectivele secundare au inclus rata de supraviețuire fără progresie (PFS) și rata de răspuns PSA (criteriile Grupului de lucru pentru cancerul de prostată). Rezultatele exploratorii au inclus enumerarea celulelor tumorale circulante (CTC), măsurătorile serice ale androgenilor, precum și analize farmacocinetice și farmacodinamice.

Rezultate.

Brațul cu doză mare s-a înscris până la finalizare ( n = 29), dar brațul cu doză mică s-a închis devreme ( n = 17) din cauza unei reguli de inutilitate prespecificată. Ratele PPFS la 24 săptămâni au fost de 11,8% în brațul cu doză mică și 48,0% în brațul cu doză mare. Timpul mediu al SFP a fost de 11,9 săptămâni și, respectiv, de 35,9 săptămâni. Ratele de răspuns PSA au fost 0%, respectiv 14,3%. În plus, itraconazolul a avut efecte favorabile asupra numărului de CTC și a suprimat semnalizarea ariciului în probele de biopsie cutanată. Itraconazolul nu a redus nivelurile serice de testosteron sau sulfat de dehidroepiandrostendionă. Toxicitățile frecvente au inclus oboseală, greață, anorexie, erupții cutanate și un sindrom de hipokaliemie, hipertensiune și edem.

Concluzie.

Doza mare de itraconazol (600 mg / zi) are o activitate antitumorală modestă la bărbații cu CRPC metastatic care nu este mediată de suprimarea testosteronului.

Implicatii Practice :

Acest studiu a investigat două doze de medicament antifungic oral, itraconazolul, pentru a determina dacă are activitate antitumorală la bărbații cu cancer de prostată metastatic rezistent la castrare. Rezultatele au arătat că, deși doza mică de itraconazol (200 mg / zi) nu a avut efecte antitumorale semnificative, doza mare de itraconazol (600 mg / zi) a avut o anumită activitate la acești pacienți. Mai mult, efectele itraconazolului par să fie asociate cu inhibarea semnalizării Ariciului în biopsiile cutanate și nu au fost cauzate de suprimarea testosteronului. Prin urmare, itraconazolul poate fi o opțiune de tratament non-hormonală pentru pacienții cu cancer de prostată rezistent la castrare care doresc să prevină sau să întârzie utilizarea chimioterapiei. În timp ce itraconazolul nu este la fel de eficient ca alți agenți noi pentru cancerul de prostată avansat (de ex abirateronă, enzalutamidă), este un medicament generic care poate fi luat în considerare dacă costul acestor agenți mai noi este prohibitiv sau în părți ale lumii unde abirateronă și enzalutamidă pot să nu fie disponibile.Mergi la:

I ntroducere

Deși terapia cu deprivare de androgeni este o terapie inițială foarte eficientă pentru bărbații cu cancer de prostată avansat, toți pacienții vor progresa în cele din urmă către o stare cunoscută sub numele de cancer de prostată rezistent la castrare (CRPC), care este invariabil fatal. Până de curând, terapiile care prelungesc viața pentru pacienții cu CRPC metastatică erau limitate, constând doar din chimioterapia cu docetaxel [ 1 ]. În ultimii 2 ani, au fost adăugate trei modalități suplimentare în armamentarul nostru pentru CRPC metastatic: produsul de imunoterapie autolog sipuleucel-T [ 2 ], agentul de chimioterapie cabazitaxel [ 3 ] și noul inhibitor de androgen-biosinteză abirateronă [ 4 ]. Mai mult decât atât, doi agenți suplimentari (radiofarmaceutic radiofarmaceutic-223 pentru țintă) [ 5] și inhibitorul de semnalizare androgen enzalutamidă [ 6 ]) au fost raportate recent că extind supraviețuirea la acești pacienți. În ciuda acestor progrese, niciuna dintre aceste terapii nu este curativă, iar timpii de supraviețuire pentru bărbații cu CRPC metastatică rămân scurți (20-24 luni) [ 7 ]. În această lumină, noi ținte biologice continuă să fie explorate [ 8 ] pentru a extinde opțiunile de tratament pentru bărbații cu CRPC.

Dezvoltarea medicamentelor este un proces lung și costisitor, care necesită, în medie, 15 ani și 80 milioane USD pentru a aduce pe piață un singur medicament [ 9 ]. Pentru a crește eficiența acestui proces, a fost creată o bibliotecă de medicamente care conține> 3.000 de compuși existenți, permițând screeningul in vitro al medicamentelor vechi pentru funcții biologice noi [ 10 ]. Această bibliotecă de medicamente a fost examinată recent pentru agenți care pot inhiba angiogeneza, o țintă potențial importantă a terapiei împotriva cancerului de prostată [ 11 ]. Un „hit” neașteptat din acest ecran a fost agentul antifungic itraconazol, care s-a dovedit a inhiba proliferarea celulelor endoteliale in vitro (spre deosebire de alte antifungice azolice) [ 12 ] și a împiedica migrarea celulelor endoteliale și formarea tubului capilar [13 ]. Deși ținta sa antiangiogenă este incertă, un studiu a sugerat că itraconazolul inhibă ținta mamiferelor de rapamicină în celulele endoteliale prin afectarea traficului de colesterol [ 14 ]. In vivo, s-a constatat că itraconazolul inhibă neovascularizarea la un model de șoarece Matrigel ™ (BD Biosciences, San Diego, CA), întârzie creșterea tumorii într-un model de șoareci xenogrefă rezistent la castrare (22Rv1) și inhibă metastazele în AT6.3 model de șoarece cu cancer de prostată [ 12 ]. În mod curios, s-a descoperit că itraconazolul inhibă puternic semnalizarea Ariciului (Hh), o cale de dezvoltare care reglementează interacțiunile epiteliale-mezenchimale, supraviețuirea celulară și angiogeneza [ 15].]. În acest scop, studiile in vitro au arătat că itraconazolul a inhibat proliferarea liniei celulare Hh reporter Shh-Light2 prin antagonizarea Smoothened [ 16 ]. În plus, itraconazolul a indus inhibarea creșterii tumorii la un model de meduloblastom de șoarece (Ptch +/− p53 – / – ) cu supraactivare constitutivă a semnalizării Hh. În acest model de alogrefă, itraconazolul a modulat în jos expresia intratumorală a GLI1 , o genă țintă Hh [ 16 ].

Deoarece itraconazolul este deja aprobat de Administrația SUA pentru Alimente și Medicamente (FDA) ca agent antifungic la doze orale în intervalul 200-600 mg / zi [ 17 ], am efectuat un studiu de fază II care examinează eficacitatea antitumorală a două doze de itraconazol (200 mg / zi și 600 mg / zi) la bărbații cu CRPC metastatic. Acest studiu a fost determinat de activitatea clinică încurajatoare a altor agenți antiangiogeni la pacienții cu CRPC [ 18 ] și de alte date care sugerează că reglarea în sus a componentelor căii Hh poate conduce la CRPC [ 19 ]. În plus, costul itraconazolului generic este doar o fracțiune din cel al altor terapii noi pentru CRPC, cum ar fi abiraterona și enzalutamida.Mergi la:

P atienti și M etode

Pacienți

Populația noastră țintă a fost bărbații cu CRPC metastatic care nu primiseră chimioterapie citotoxică. Pacienților li s-a cerut să aibă adenocarcinom de prostată confirmat histologic, boală progresivă în ciuda „nivelurilor de castrare” a testosteronului seric (<50 ng / dL) și metastaze la distanță vizibile radiografic la tomografie computerizată (CT) sau scanări osoase de tehneziu-99. Pacienții trebuiau să aibă trei sau mai multe valori crescânde ale antigenului prostatic specific seric (PSA) la 4 săptămâni distanță, ultima valoare fiind ≥2,0 ng / ml, în conformitate cu liniile directoare ale Grupului de lucru pentru cancerul de prostată (PCWG) [ 20 ]. Alte criterii de eligibilitate au inclus vârsta> 18 ani, un scor al statutului de performanță al Grupului Cooperativ Oncologic Estic (ECOG) ≤2, o speranță de viață> 6 luni și funcția adecvată a rinichilor, ficatului și măduvei osoase.

Pacienții au fost excluși dacă au primit un antiandrogen oral în decurs de 6 săptămâni, au primit vreodată chimioterapie pentru CRPC metastatic, au luat corticosteroizi sistemici, au avut un sindrom de malabsorbție, au luat medicamente metabolizate de citocromul P450 (CYP) 3A4, au avut o tumoră malignă anterioară în decurs de 3 ani, a avut boli infecțioase, pulmonare sau cardiace majore, a avut insuficiență cardiacă congestivă simptomatică sau a avut un interval QT corectat> 450 msec la electrocardiografie. Tratamentul anterior cu ketoconazol a fost permis.

Comisiile de revizuire de la toate instituțiile au aprobat studiul, care a fost realizat în conformitate cu liniile directoare de bună practică clinică. Toți pacienții au acordat consimțământul scris în scris.

Design de studiu

Acesta a fost un studiu de fază II, necomparativ, deschis, randomizat, realizat la patru instituții ale consorțiului de studii clinice privind cancerul de prostată [ 21 ]. Pacienții au fost randomizați (1: 1) pentru a primi doze mici (200 mg / zi) sau doze mari (600 mg / zi) de itraconazol. Aceste doze au fost alese deoarece itraconazolul este deja aprobat de FDA ca agent antifungic la doze cuprinse între 200 și 600 mg / zi și deoarece datele din modelele animale au sugerat că, deși 200 mg ar putea fi suficiente pentru a inhiba angiogeneza, dozele ≥ 600 mg ar putea fi să fie necesară pentru a suprima semnalizarea Hh.

Itraconazolul a fost furnizat sub formă de capsule generice de 100 mg (Sandoz, Princeton, NJ). Pacienții alocați brațului cu doză mică au primit două capsule de 100 mg o dată pe zi; pacienții din brațul cu doze mari au primit trei capsule de 100 mg de două ori pe zi. Deoarece absorbția itraconazolului depinde de aciditatea gastrică, pacienții au fost instruiți să ia capsule de itraconazol cu ​​o băutură carbogazoasă și împreună cu alimente sau în termen de 30 de minute după masă. Pacienților nu li sa permis să ia concomitent antiacide, blocante ale histaminei sau inhibitori ai pompei de protoni. Tratamentul a continuat fie până la o toxicitate imposibil de administrat, sau până la progresia clinică sau radiografică. Important, tratamentul nu a fost întrerupt pentru creșterea PSA [ 20 ].

Evaluări

Evaluările clinice au inclus un examen fizic, măsurători ale semnelor vitale, evaluarea scorului ECOG, revizuirea medicamentelor concomitente, evaluări de laborator (studii chimice și hematologice) și revizuirea evenimentelor adverse și au fost efectuate la fiecare 4 săptămâni. Evaluările de eficacitate au inclus măsurarea serică a PSA la fiecare 4 săptămâni și CT (piept, abdomen și pelvis) și evaluări de scanare osoasă din tehnetiu-99 a întregului corp la fiecare 12 săptămâni.

Măsuri finale

Obiectivul principal a fost eliberarea de progresia PSA (rata de supraviețuire fără progresie PSA [PPFS] rate) la 24 de săptămâni după randomizare. Progresia PSA a fost definită ca o creștere de ≥25% a PSA de la nadir (și cu ≥2 ng / ml), necesitând confirmarea ≥ 4 săptămâni mai târziu (criterii PCWG) [ 20 ]. Deși rata PPFS nu este un surogat validat al beneficiului clinic, acest obiectiv a fost ales pentru a examina dovezile preliminare ale activității clinice în cadrul unui studiu de fază II mic. Un obiectiv secundar cheie, care ar putea fi considerat mai semnificativ clinic, a fost lipsa de progresie (rata de supraviețuire fără progresie [PFS]) la 24 de săptămâni. A fost definită progresia [ 20] ca progresie clinică (agravarea simptomelor legate de boală sau noi complicații legate de cancer), progresie radiografică (la CT, mărire ≥20% a diametrului sumar al leziunilor țintă ale țesuturilor moi conform Evaluării răspunsului în tumorile solide [RECIST] , versiunea 1.0 [ 22 ]; la scanarea osoasă, două sau mai multe leziuni osoase confirmate noi) sau deces, oricare dintre acestea a apărut mai întâi.

Obiectivele secundare au inclus durata mediană a PPFS, rata de răspuns PSA (≥ 50% scăderea PSA față de valoarea inițială, menținută timp de ≥ 4 săptămâni), cel mai bun răspuns PSA (procentul maxim de scădere PSA față de valoarea inițială), timpul PFS median și rata obiectivă de răspuns în softul măsurabil -leziuni tisulare (răspuns parțial, scăderea ≥30% a diametrului total al leziunilor țintă; boală progresivă, creștere ≥20% a diametrului sumar al leziunilor țintă sau a uneia sau mai multor leziuni noi; boală stabilă, modificarea diametrului sumă al țintei leziuni care nu îndeplinesc parametrii de mai sus; RECIST, versiunea 1.0 [ 22 ]). Un final final secundar a fost siguranța; evenimentele adverse au fost clasificate utilizând Criteriile comune de toxicitate pentru evenimente adverse de la Institutul Național al Cancerului, versiunea 3.0.

Analiza celulelor tumorale circulante

Probele de sânge (7,5 ml) pentru enumerarea celulelor tumorale circulante (CTC) au fost colectate la momentul inițial și după 4 săptămâni și 12 săptămâni de studiu și au fost analizate folosind sistemul CellSearch® (Veridex, Raritan, NJ), așa cum s-a descris anterior [ 23 ]. Rezultatele au fost exprimate ca număr de CTC pe 7,5 ml sânge.

Farmacocinetica și farmacodinamica

Farmacocinetica

Probele de plasmă au fost colectate la momentul inițial și înainte de administrarea itraconazolului (concentrație minimă [C min ]) și la 4 săptămâni și 12 săptămâni de studiu. Concentrațiile de Itraconazol și 4-hidroxiitraconazol au fost evaluate utilizând un test validat de cromatografie lichidă – spectrometrie de masă, în intervalul de 2-2.000 ng / ml.

Analiza axei suprarenale

Pentru a examina dacă itraconazolul a suprimat sau nu funcția corticală suprarenală, mai mulți hormoni ai axei suprarenale au fost evaluați la momentul inițial și după 4 săptămâni și 12 săptămâni în studiu: testosteron, sulfat de dehidroepiandrostendionă (DHEA-S), cortizol, aldosteron și hormonul adrenocorticotrop (ACTH) . Testosteronul seric și aldosteronul seric au fost măsurate utilizând un test de cromatografie lichidă – spectrometrie de masă. Folosind această metodă, limita inferioară de detectare a testosteronului este de 1 ng / dL. Nivelurile serice de DHEA-S și plasmă de ACTH au fost măsurate utilizând un test imunologic de chimioluminiscență. Cortizolul seric a fost măsurat utilizând o imunoanaliză enzimatică.

Nivelurile factorilor de creștere endotelială vasculară

Pentru a evalua efectele antiangiogene într-o analiză exploratorie, plasma a fost colectată pentru măsurarea factorului de creștere endotelial vascular (VEGF) la momentul inițial și după 4 săptămâni și 12 săptămâni de studiu. Concentrațiile totale de VEGF au fost măsurate utilizând testul imunosorbent legat de enzima Quantikine® (R&D Systems, Minneapolis, MN).

Analiza căii Hh

Deoarece semnalizarea Hh este prezentă în pielea și foliculii de păr, am examinat expresia ARNm GLI1 (un marker al activării căii Hh) folosind biopsii de 3 mm cu pumn de la piele cu păr obținute la momentul inițial și după 4 săptămâni și 12 săptămâni de studiu. ARN-ul a fost extras din specimene de biopsie cutanată, iar nivelurile de expresie ale GLI1 au fost evaluate prin reacția în lanț a polimerazei cu transcripție inversă în timp real (SABiosciences-Qiagen, Frederick, MD), așa cum s-a descris anterior [ 24 ].

Analize statistice

Pe baza studiilor anterioare [ 25], am estimat că până la 20% dintre pacienții cu CRPC metastatic care nu primiseră chimioterapie anterioară ar fi lipsiți de progresia PSA (așa cum s-a definit mai sus) după 24 de săptămâni de studiu. Am emis ipoteza că itraconazolul (la ambele niveluri de doză) ar preveni progresia PSA la 24 de săptămâni la ~ 45% dintre bărbați (adică am considerat că o îmbunătățire absolută de 25%> 20% este semnificativă din punct de vedere clinic). Douăzeci și nouă de pacienți pe braț ar acorda o putere de 83% pentru a detecta o îmbunătățire a ratei PPFS de 24 de săptămâni (obiectivul primar) de la 20% (controale istorice) la 45% folosind un α pe două fețe de 0,05. O rată de 45% a PPFS pe 24 de săptămâni în fiecare braț a fost predefinită pentru a constitui un succes (indicând demnitatea pentru studii suplimentare). Pentru a monitoriza inutilitatea tratamentului,ambele brațe aveau reguli de oprire precoce preconizate care au fost aplicate după nouă (o treime din total) și 15 (o jumătate din total) pacienți au putut fi evaluați pentru obiectivul primar. În fiecare braț, dacă ar fi mai puțin de doi dintre cei nouă bărbați care au atins obiectivul primar sau dacă ar fi mai puțin de patru din cei 15 bărbați care au atins obiectivul principal, atunci brațul respectiv s-ar închide pentru inutilitate. Aceste reguli de oprire au fost în concordanță cu observarea unei limite superioare a unui interval de încredere exact (90%) unilateral care a exclus rata ipoteză de succes de 45%.Aceste reguli de oprire au fost în concordanță cu respectarea unei limite superioare a unui interval de încredere exact (90%) unilateral care a exclus rata ipoteză de succes de 45%.Aceste reguli de oprire au fost în concordanță cu respectarea unei limite superioare a unui interval de încredere exact (90%) unilateral care a exclus rata ipoteză de succes de 45%.

Studiul nu a fost alimentat pentru a permite statistici inferențiale care compară brațele de tratament. Analiza Kaplan – Meier a fost utilizată pentru a estima obiectivele de timp până la eveniment și 95% IC. Caracteristicile inițiale ale pacienților au fost comparate între brațe folosind testul exact al lui Fisher, testul t Student sau testul de sumă de rang Wilcoxon ( valorile p sunt doar descriptive deoarece toate diferențele sunt rezultatul variației șansei induse de randomizare). Obiectivele farmacodinamice și farmacocinetice au fost raportate ca tendințe în timp folosind statistici descriptive; asocierile dintre aceste măsuri exploratorii și rezultatele clinice au fost căutate utilizând coeficientul de corelație Pearson ( r ).Mergi la:

R ezultate

Pacienți

Brațul cu doză mare a fost înscris până la finalizare (29 pacienți), în timp ce brațul cu doză mică a fost închis devreme din cauza inutilității după ce au fost înrolați 17 bărbați (în acest braț, au existat două succese în primii nouă pacienți și înscrierea a continuat până când 15 au fost evaluabili pentru obiectivul primar; la acel moment, au fost înrolați doi pacienți suplimentari, dar nu s-a mai realizat obiectivul primar) (Fig. 1). Caracteristicile inițiale ale pacienților au apărut în general echilibrate (tabelul 1); a existat o tendință către niveluri de bază mai scăzute ale PSA în brațul cu doză mică și o tendință către mai multe metastaze numai osoase în brațul cu doză mare. O treime din pacienții din ambele brațe au primit ketoconazol anterior. Durata mediană a tratamentului a fost de 11,9 săptămâni în brațul cu doză mică și de 23,6 săptămâni în brațul cu doză mare.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc9991112520001.jpg

Figura 1.

Diagrama consort.

Tabelul 1.

Caracteristici demografice și clinice de bază

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc00213-1252-t01.jpg

Abrevieri: ECOG, Eastern Cooperative Oncology Group; PSA, antigen specific prostatei.

Punct final principal

Toți cei 17 pacienți din brațul cu doză mică și 25 din 29 de pacienți din brațul cu doză mare (patru bărbați au ieșit din studiu înainte de 24 de săptămâni din cauza toxicității) au putut fi evaluați pentru obiectivul primar. În brațul cu doză mică, estimarea ratei PPFS pe 24 de săptămâni a fost de 11,8% (doi din 17 bărbați; IC 95%, 1,5% -36,4%), nereușind să atingă obiectivul primar. În schimb, brațul cu doze mari a atins obiectivul primar, demonstrând o estimare a ratei PPFS pe 24 de săptămâni de 48,0% (12 din 25 bărbați; IC 95%, 27,8% -68,7%).

Obiective secundare

Timpurile medii ale PPFS au fost de 11,9 săptămâni (IC 95%, 5,6-20,0 săptămâni) și 17,0 săptămâni (IC 95%, 12,4-32,0 săptămâni) în brațele cu doză mică și, respectiv, cu doze mari (Fig. 2A). Estimările ratei PFS pe 24 de săptămâni au fost de 18,8% (IC 95%, 6,8% –52,0%) și 61,6% (IC 95%, 46,1% –84,6%) în cele două brațe, respectiv. Timpul median al SFP a fost de 11,9 săptămâni (IC 95%, 11,9-28,1 săptămâni) și 35,9 săptămâni (IC 95%, 21,6-47,4 săptămâni) (Fig. 2B). Ratele de răspuns PSA (≥50% declin PSA) au fost 0% (95% CI, 0% –19,5%) și 14,3% (95% CI, 4,0% –32,7%) (Fig. 2C), respectiv. Dintre cei cu boală măsurabilă la momentul inițial, 7,7% (IC 95%, 1,8% –33,9%) și 11,1% (IC 95%, 3,4% –33,1%) dintre pacienții din cele două brațe au obținut un răspuns obiectiv parțial, respectiv (Fig. 2D). În cele din urmă, estimarea mediană a timpului de dublare a PSA (PSADT) a fost mai lungă în ambele brațe ale studiului după inițierea tratamentului, deși această modificare a fost semnificativă doar din punct de vedere statistic în brațul cu doză mare (PSADT median de bază, 2,4 luni; PSADT median în studiu, 7,7 luni ; diferență, +5,3 luni; p <.01) și nu în brațul cu doză mică (PSADT median de bază, 2,7 luni; PSADT median de studiu, 5,8 luni; diferență, +3,1 luni; p = .07).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc9991112520002.jpg

Figura 2.

Efectele clinice ale itraconazolului. (A): Curbele Kaplan-Meier ale PPFS la bărbații cărora li se administrează doze mici și doze mari de itraconazol. (B): Curbele Kaplan-Meier ale SFP în fiecare braț de tratament. (C): Parcele de cascadă care prezintă cele mai bune răspunsuri PSA în rândul bărbaților care primesc doze mici și doze mari de itraconazol. Asteriscul indică o valoare PSA tăiată. Tratamentul prealabil cu ketoconazol este indicat de barele de hash. (D): Graficele cascadei care prezintă cele mai bune răspunsuri obiective în leziunile măsurabile conform criteriilor de evaluare a răspunsului în tumorile solide, versiunea 1.0. Tratamentul prealabil cu ketoconazol este indicat de barele (și pumnalele).

Abrevieri: CI, interval de încredere; PFS, supraviețuire fără progresie; PPFS, supraviețuire fără progresie PSA; PSA, antigen specific prostatei.

Siguranță

Evenimentele adverse au fost în general mai frecvente în doza mare decât în ​​brațul cu doză mică (masa 2). Toxicitățile frecvente la ambele brațe au inclus oboseală, durere, greață și constipație. De asemenea, o constelație de evenimente adverse cuprinzând hipertensiune arterială, hipokaliemie și edem a fost de interes special, sugerând un sindrom de exces mineralocorticoid secundar (vezi evaluările axei suprarenalei de mai jos). Manifestările acestui sindrom au fost mai frecvente la brațul cu doze mari.

tabel 2.

Evenimente adverse

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc00213-1252-t02.jpg

Evenimentele adverse de gradul 3 din brațul cu doze mici au inclus oboseală (5,9%), anorexie (5,9%) și erupții cutanate (5,9%). Toxicitățile de gradul 3 în brațul cu doze mari au inclus hipokaliemie (10,3%), hipertensiune (6,9%) și erupții cutanate (3,4%). Nu au existat toxicități de gradul 4. Procentele de pacienți care au ieșit din studiu ca urmare a toxicităților au fost de 5,9% în brațul cu doză mică (un pacient a dezvoltat erupție cutanată) și 13,8% în brațul cu doză mare (un pacient a dezvoltat oboseală, un pacient a dezvoltat anorexie, unul pacientul a dezvoltat o erupție cutanată, iar un pacient a dezvoltat arterită temporală [nu este legată de medicamente]).

Enumerare CTC

Cincisprezece pacienți din brațul cu doză mică (88,2%) și 25 de pacienți din brațul cu doză mare (86,2%) au avut perechi de probe de sânge inițiale și post-tratament recoltate pentru enumerarea CTC. Treizeci și doi de bărbați au avut un număr favorabil de CTC (<5 CTC la 7,5 ml sânge); 96,9% dintre aceștia au păstrat numărul favorabil de CTC timp de 12 săptămâni. Opt bărbați au avut un număr de CTC de bază nefavorabil (≥ 5 CTC pe 7,5 ml sânge); cinci (62,5%) dintre aceștia s-au transformat în CTC favorabile, după tratament. Datele de la acei pacienți care convertesc de la numărul CTC nefavorabil la cel favorabil sunt prezentate aici: 28 → 3, 15 → 1, 7 → 0, 6 → 0 și 6 → 0 CTC pe 7,5 ml sânge.

Farmacocinetica și farmacodinamica

Farmacocinetica

Șaisprezece pacienți din brațul cu doză mică (94,1%) și 26 de pacienți din brațul cu doză mare (89,7%) au avut probe de plasmă inițiale și post-tratament asociate pentru analize farmacocinetice. Valorile medii ale concentrației plasmatice de itraconazol (C min ) au fost de 370,0 ng / ml (interval, 86,9-653,1 ng / ml) și 1,517,0 ng / ml (interval, 673,8-2,360,2 ng / ml) în brațele cu doze mici și mari, respectiv. Medii plasmatice de 4-Hidroxi C min Valorile au fost 723.5 ng / ml (interval, 289.2-1,157.8 ng / ml) și 2,630.8 ng / ml (interval, 1,036.0-4,225.6 ng / ml), respectiv. Au existat corelații semnificative între un nivel mai ridicat de itraconazol C min și atât o durată mai lungă de PPFS ( r = 0,56; p = .003), cât și o scădere mai mare a PSA ( r= 0,39; p = .03) (suplimentar online Fig. 1). Corelații semnificative statistic similare au fost observate cu 4-hidroxititraconazol (datele nu sunt prezentate).

Analiza axei suprarenale

Nici o doză mică, nici o doză mare de itraconazol nu au provocat suprimarea nivelului seric de testosteron sau DHEA-S. În mod neașteptat, doza mică și doza mare de itraconazol par să crească ușor testosteronul seric (Fig. 3A) și DHEA-S (Fig. 3B) niveluri, respectiv. În plus, doza mare (dar nu doza mică) de itraconazol a suprimat puternic aldosteronul seric (Fig. 3C) în timp ce crește ACTH plasmatic (Fig. 3D). Nu au existat efecte cu doza de itraconazol asupra cortizolului seric la 4 săptămâni sau 12 săptămâni (datele nu sunt prezentate).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc9991112520003.jpg

Deschideți într-o fereastră separatăFigura 3.

Efectele endocrine ale itraconazolului. (A): Efectul itraconazolului cu doze mici și mari asupra concentrațiilor serice de testosteron (datele sunt prezentate ca mediane și intervale intercuartile). (B): Efectul dozei mici și mari de itraconazol asupra concentrațiilor serice de DHEA-S. (C): Efectul dozei mici și mari de itraconazol asupra concentrațiilor serice de aldosteron. (D): Efectul dozei mici și mari de itraconazol asupra concentrațiilor plasmatice de ACTH.

Abrevieri: ACTH, hormon adrenocorticotrop; DHEA-S, dehidroepiandrostendion-sulfat.

Analiza VEGF

Doza mică de itraconazol nu a fost asociată cu o modificare a nivelului plasmatic al VEGF fie la 4 săptămâni ( p = .59), fie la 12 săptămâni ( p = .11). La fel, doza mare de itraconazol nu a fost asociată cu o modificare a nivelului VEGF la 4 săptămâni ( p = 0,72) sau 12 săptămâni ( p = 0,76).

Analiza căii Hh

Cincisprezece pacienți din brațul cu doză mică (88,2%) și 25 de pacienți din brațul cu doză mare (86,2%) au prezentat probe de biopsie cutanată inițială și post-tratament recoltate pentru analiza expresiei GLI1 . GLI1 a fost downmodulat la 33% și 68% dintre pacienții din brațele cu doze mici și, respectiv, (Fig. 4A). Procentul pacienților care au obținut o downmodulare dublă sau mai mare în GLI1 cu itraconazol a fost de 28% (11 din 40), comparativ cu 68% dintre pacienții cărora li sa administrat vismodegib (un antagonist puternic al căii Hh) în studiile anterioare [ 26 ]. Timpul mediu PPFS a fost mai lung la bărbații care au atins downmodulația GLI1 ( p = .028) (Fig. 4B) și a existat, de asemenea, o tendință spre un interval PFS mai lung la bărbații cu modulație descendentă GLI1 ( p = .128) (Fig. 4C). În cele din urmă, a existat o corelație semnificativă între o downmodulație GLI1 mai puternică și o scădere mai mare a PSA ( r = 0,38; p = 0,01) (Fig. 4D). Interesant este că toți cei cinci pacienți care au realizat conversii CTC favorabile au prezentat, de asemenea, o downmodulare a GLI1 .

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc999111252004a.jpg

Figura 4.

Modularea GLI1 de către itraconazol. (A): Graficele cascadei care prezintă modulația GLI1 în biopsiile cu pumn de piele, descrise ca o schimbare a pliurilor în expresia GLI post-tratament comparativ cu valorile inițiale. (B): Curbele Kaplan – Meier care descriu PPFS în funcție de starea modulației GLI1 . (C): Curbele Kaplan – Meier care descriu PFS în funcție de starea modulației GLI1 . (D): Scatterplot care arată asocierea dintre modulația GLI1 și schimbarea PSA.

Abrevieri: PFS, supraviețuire fără progresie; PPFS, supraviețuire fără progresie PSA; PSA, antigen specific prostatei.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este onc999111252004b.jpg

Deschideți într-o fereastră separatăFigura 4.

Continuat.Mergi la:

D iscutie

Acest studiu de fază II este primul care examinează itraconazolul ca agent antineoplazic în cancerul uman. Demonstrăm că, la bărbații cu chimioterapie metastatică-CRPC netratată, doza mică de itraconazol (200 mg / zi) nu are eficacitate antitumorală semnificativă, în timp ce doza mare de itraconazol (600 mg / zi) poate avea activitate clinică modestă, așa cum sugerează PPFS mai lungi și PFS ori decât în ​​datele istorice [ 25 ]. Important, durata PFS observată aici (35,9 săptămâni) este comparabilă cu estimările de timp PFS (interval, 30-40 săptămâni) ale altor agenți experimentali aprobați de FDA în această populație de pacienți (mitoxantronă, docetaxel, tasquinimod și cabozantinib) [ 1 , 18 , 27], deși timpul PFS nu este un surogat al beneficiului clinic. În special, activitatea itraconazolului nu pare a fi mediată de suprimarea testosteronului (deși nu a fost efectuată o analiză cuprinzătoare a axei androgenilor) și poate fi asociată cu modularea descendentă a semnalizării Hh. Alternativ, itraconazolul poate avea efecte benefice în afara țintei asupra altor ținte necunoscute.

Un alt antifungic azolic, ketoconazolul, a fost folosit pe etichetă de mai mulți ani ca terapie pentru CRPC. Ketoconazolul funcționează prin suprimarea sintezei de androgeni extragonadali [ 28 ] (inhibând neselectiv mai multe enzime CYP), dar prezintă o toxicitate semnificativă fără dovezi că prelungește durata de supraviețuire [ 29 ]. Cu toate acestea, sa demonstrat că inhibitorul selectiv al CYP17 abirateronă îmbunătățește rezultatele supraviețuirii la bărbații cu CRPC metastatic pretratat cu docetaxel [ 4].], rezultând în aprobarea FDA. Aici, demonstrăm că itraconazolul nu suprima testosteronul circulant sau nivelurile de DHEA-S (deși nivelurile de androstendionă și dihidrotestosteron nu au fost măsurate), sugerând un mecanism antitumoral alternativ sau suplimentar. Mai mult, itraconazolul pare să aibă activitate atât la pacienții netratați anterior cu ketoconazol, cât și la cei care nu au primit ketoconazol.

Angiogeneza tumorală și semnalizarea Hh sunt ambele implicate în creșterea, progresia și metastaza cancerului de prostată [ 15 , 30 ]. Deși blocarea fiecărei căi separat nu a reușit să producă noi terapii împotriva cancerului de prostată [ 26 , 31], inhibarea ambelor căi simultan cu itraconazolul reprezintă o abordare rațională. În acest studiu, nu am observat modularea nivelurilor circulante de VEGF, dar asta nu înseamnă neapărat că itraconazolul nu are efecte antiangiogene la om. Abilitatea noastră de a interoga angiogeneza a fost limitată de lipsa probelor de biopsie tumorală și pentru că am evaluat doar unul dintre mulți factori angiogeni circulanți (deși niciunul nu a fost în mod constant asociat cu beneficiul clinic al terapiilor antiangiogene). În plus, deși am observat downmodularea GLI1 în probele de biopsie a pielii, nu am interogat semnalizarea Hh în tumori; prin urmare, oferim doar dovezi indirecte că suprimarea căii Hh este un mecanism potențial de acțiune al itraconazolului. În cele din urmă, asocierea dintreModificarea descendentă a GLI1 și activitatea clinică a itraconazolului nu pot fi cauzale și pot reflecta pur și simplu un efect farmacodinamic care nu este legat de eficacitatea medicamentului. Cu toate acestea, rezultatele acestui studiu oferă impulsul de a examina alți inhibitori ai căii Hh mai puternici (de exemplu, vismodegib, LDE225) la bărbații cu CRPC.

Un interes deosebit a fost apariția unui sindrom de hipokaliemie, hipertensiune și edem într-o manieră dependentă de doză. Deși aceste manifestări sunt de obicei legate de hiperaldosteronism [ 32 ], nivelurile de aldosteron au fost puternic suprimate la pacienții noștri. Acest lucru crește posibilitatea apariției unui sindrom de exces mineralocorticoid secundar (cu precursori crescuți de aldosteron), așa cum sa raportat la pacienții tratați cu abirateronă [ 4 , 33]. În acest scop, am descoperit niveluri crescute de corticosteron și deoxicorticosteron la un pacient care a dezvoltat toate cele trei caracteristici ale acestui sindrom. Cu toate acestea, spre deosebire de abirateronă (și ketoconazol), itraconazolul nu a suprimat producția de cortizol și nu necesită suplimentarea cu glucocorticoizi. Într-adevăr, combinația de itraconazol și corticosteroizi este contraindicată și poate induce sindromul Cushing prin afectarea metabolismului corticosteroizilor de către CYP3A4 [ 34 ]. În cele din urmă, creșterile ușoare observate în nivelurile serice de testosteron și DHEA-S pot fi rezultatul creșterii ACTH în amonte, deși aceste creșteri ale nivelurilor de androgen au fost modeste.

În concluzie, acest studiu sugerează că doza mare de itraconazol (600 mg / zi) poate avea activitate antitumorală modestă la bărbații cu CRPC metastatică care ar putea fi asociată cu suprimarea căii Hh, deși un efect mediat de androgen nu poate fi exclus. Studiile în curs evaluează acum impactul itraconazolului ca agent antineoplazic la pacienții cu cancer pulmonar, cancer mamar și carcinom bazocelular. Studiile viitoare la pacienții cu cancer de prostată vor compara itraconazolul cu placebo la bărbații cu CRPC nemetastatic, având ca scop extinderea duratei de supraviețuire fără metastaze la această populație. În plus, sunt de asemenea planificate studii clinice care utilizează antagoniști Hh mai puternici (de exemplu, vismodegib, LDE225) la bărbați cu CRPC.

Consultați www.TheOncologist.com pentru materiale suplimentare disponibile online.Mergi la:

Material suplimentar

Date suplimentare:Faceți clic aici pentru a vizualiza.Mergi la:

O recunoaștere

Acest studiu a fost realizat în cadrul Departamentului Apărării / Fundației pentru Cancerul de Prostată Consorțiul Clinic pentru Probe de Cancer de Prostat (DOD / PCF-PCCTC). Mulțumim pacienților care s-au oferit voluntari să participe la acest studiu și familiilor lor. Suntem recunoscători tuturor membrilor personalului de studiu de la fiecare site, asistenților medicali de cercetare, personalului farmaciei și asistentei medicale principale Rana Sullivan.

Studiul a fost susținut de Commonwealth Foundation for Cancer Research (MAC), David H. Koch Charitable Foundation (MAC), a Conquer Cancer Foundation 2009 Young Investigator Award (ESA), DOD acordă W81XWH-09–1-0149 (MAC) și PC051385 (MAC), precum și nucleul de farmacologie analitică al Sidney Kimmel Comprehensive Cancer Center de la Johns Hopkins (NIH acordă P30 CA006973 și UL1 RR025005). Această publicație a fost posibilă prin numărul de subvenții UL1RR025005 de la Centrul Național pentru Resurse de Cercetare (NCRR), o componentă a Institutelor Naționale de Sănătate (NIH) și NIH Roadmap for Medical Research. Conținutul său este exclusiv responsabilitatea autorilor și nu reprezintă neapărat punctul de vedere oficial al NCRR sau NIH.Mergi la:

A utor C contribuții

Concepție / Design: Emmanuel S. Antonarakis, Amanda L. Blackford, Michelle A. Rudek, Michael A. Carducci

Furnizarea de materiale de studiu sau pacienți: Emmanuel S. Antonarakis, Elizabeth I. Heath, David C. Smith, Dana Rathkopf, Daniel C. Danila, Michael A. Carducci

Colectarea și / sau asamblarea datelor: Emmanuel S. Antonarakis, Elizabeth I. Heath, David C. Smith, Dana Rathkopf, Amanda L. Blackford, Daniel C. Danila, Serina King, Anja Frost, A. Seun Ajiboye, Ming Zhao, Janet Mendonca, Sushant A. Kachhap, Michelle A. Rudek, Michael A. Carducci

Analiza și interpretarea datelor: Emmanuel S. Antonarakis, Amanda L. Blackford, Daniel C. Danila, Anja Frost, A. Seun Ajiboye, Ming Zhao, Janet Mendonca, Sushant A. Kachhap, Michelle A. Rudek, Michael A. Carducci

Scriere manuscrisă: Emmanuel S. Antonarakis, Elizabeth I. Heath, David C. Smith, Dana Rathkopf, Amanda L. Blackford, Daniel C. Danila, Serina King, Anja Frost, A. Seun Ajiboye, Ming Zhao, Janet Mendonca, Sushant A Kachhap, Michelle A. Rudek, Michael A. Carducci

Aprobarea finală a manuscrisului: Emmanuel S. Antonarakis, Elizabeth I. Heath, David C. Smith, Dana Rathkopf, Amanda L. Blackford, Daniel C. Danila, Serina King, Anja Frost, A. Seun Ajiboye, Ming Zhao, Janet Mendonca, Sushant A. Kachhap, Michelle A. Rudek, Michael A. CarducciMergi la:

D isclosures

Autorii nu au indicat relații financiare.Mergi la:

R eferințe

1. Tannock IF, de Wit R, Berry WR și colab. Docetaxel plus prednison sau mitoxantronă plus prednison pentru cancerul de prostată avansat. N Engl J Med. 2004; 351 : 1502–1512. [ PubMed ] [ Google Scholar ]2. Kantoff PW, Higano CS, Shore ND și colab. Imunoterapie Sipuleucel-T pentru cancerul de prostată rezistent la castrare. N Engl J Med. 2010; 363 : 411–422. [ PubMed ] [ Google Scholar ]3. de Bono JS, Oudard S, Ozguroglu M, și colab. Prednison plus cabazitaxel sau mitoxantronă pentru cancerul de prostată metastatic rezistent la castrare care progresează după tratamentul cu docetaxel: Un studiu randomizat deschis. Lancet. 2010; 376 : 1147–1154. [ PubMed ] [ Google Scholar ]4. de Bono JS, Logothetis CJ, Molina A și colab. Abirateronă și creșterea supraviețuirii în cancerul de prostată metastatic. N Engl J Med. 2011; 364 : 1995–2005. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]5. Nilsson S, Franzén L, Parker C și colab. Radiu-223 vizat de os în cancerul de prostată simptomatic, refractar la hormoni: un studiu randomizat, multicentric, controlat cu placebo, de fază II. Lancet Oncol. 2007; 8 : 587–594. [ PubMed ] [ Google Scholar ]6. Scher HI, Fizazi K, Saad F și colab. Supraviețuire crescută cu enzalutamidă în cancerul de prostată după chimioterapie. N Engl J Med. 2012; 367 : 1187–1197. [ PubMed ] [ Google Scholar ]7. Antonarakis ES, Eisenberger MA. Extinderea opțiunilor de tratament pentru cancerul de prostată metastatic. N Engl J Med. 2011; 364 : 2055–2058. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]8. Hanahan D, Weinberg RA. Semne distinctive ale cancerului: generația următoare. Celula. 2011; 144 : 646-674. [ PubMed ] [ Google Scholar ]9. DiMasi JA, Hansen RW, Grabowski HG. Prețul inovației: noi estimări ale costurilor de dezvoltare a medicamentelor. J Health Econ. 2003; 22 : 151–185. [ PubMed ] [ Google Scholar ]10. Chong CR, Sullivan DJ., Jr Noi utilizări pentru droguri vechi. Natură. 2007; 448 : 645–646. [ PubMed ] [ Google Scholar ]11. Kluetz PG, Figg WD, Dahut WL. Inhibitori ai angiogenezei în tratamentul cancerului de prostată. Expert Opin Pharmacother. 2010; 11 : 233–247. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]12. Chong CR, Xu J, Lu J și colab. Inhibarea angiogenezei de către medicamentul antifungic itraconazol. ACS Chem Biol. 2007; 2 : 263–270. [ PubMed ] [ Google Scholar ]13. Aftab BT, Dobromilskaya I, Liu JO, și colab. Itraconazolul inhibă angiogeneza și creșterea tumorii în cancerul pulmonar cu celule mici. Cancer Res. 2011; 71 : 6764-6772. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]14. Xu J, Dang Y, Ren YR și colab. Traficul de colesterol este necesar pentru activarea mTOR în celulele endoteliale. Proc Natl Acad Sci US A. 2010; 107 : 4764–4769. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]15. Karhadkar SS, Bova GS, Abdallah N și colab. Semnalizarea arici în regenerarea prostatei, neoplazie și metastază. Natură. 2004; 431 : 707–712. [ PubMed ] [ Google Scholar ]16. Kim J, Tang JY, Gong R și colab. Itraconazolul, un antifungic utilizat frecvent, care inhibă activitatea căii Arici și creșterea cancerului. Celula cancerului. 2010; 17 : 388-399. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]17. Janssen-Ortho, Inc. Itraconazol prescribing information, 2001. [Accesat la 12 decembrie 2012]. Disponibil la http://www.accessdata.fda.gov/drugsatfda_docs/label/2009/020083s040s041s044lbl.pdf .18. Pili R, Häggman M, Stadler WM și colab. Studiu randomizat, dublu-orb, controlat placebo, de fază II, a tasquinimodului la bărbații cu cancer de prostată metastatic rezistent la castrate, cu simptome minime. J Clin Oncol. 2011; 29 : 4022–4028. [ PubMed ] [ Google Scholar ]19. Tzelepi V, Karlou M, Wen S și colab. Exprimarea componentelor căii Hedgehog în micromediul carcinomului de prostată: mutarea echilibrului către semnalizarea autocrină. Histopatologie. 2011; 58 : 1037-1047. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]20. Scher HI, Halabi S, Tannock I și colab. Proiectarea și punctele finale ale studiilor clinice pentru pacienții cu cancer de prostată progresiv și niveluri de testosteron castrat: Recomandări ale Grupului de lucru pentru studiile clinice privind cancerul de prostată. J Clin Oncol. 2008; 26 : 1148–1159. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]21. Morris MJ, Basch EM, Wilding G și colab. Consorțiul Departamentului Apărării pentru studiile clinice privind cancerul de prostată: un nou instrument pentru cercetarea clinică a cancerului de prostată. Cancer Clin Genitourin. 2009; 7 : 51–57. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]22. Therasse P, Arbuck SG, Eisenhauer EA și colab. Noi orientări pentru evaluarea răspunsului la tratament în tumorile solide. Organizația Europeană pentru Cercetarea și Tratamentul Cancerului, Institutul Național al Cancerului din Statele Unite, Institutul Național al Cancerului din Canada. J Natl Cancer Inst. 2000; 92 : 205–216. [ PubMed ] [ Google Scholar ]23. Shaffer DR, Leversha MA, Danila DC și colab. Analiza celulelor tumorale circulante la pacienții cu cancer de prostată progresiv rezistent la castrare. Clin Cancer Res. 2007; 13 : 2023–2029. [ PubMed ] [ Google Scholar ]24. Seifert AW, Zheng Z, Ormerod BK și colab. Ariciul sonic controlează creșterea organelor genitale externe prin reglarea cineticii ciclului celular. Nat Commun. 2010; 1 : 1-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]25. Carducci MA, Saad F, Abrahamsson PA și colab. Un studiu controlat randomizat de fază 3 privind eficacitatea și siguranța atrasentanului la bărbații cu cancer de prostată refractar la hormoni metastatici. Cancer. 2007; 110 : 1959–1966. [ PubMed ] [ Google Scholar ]26. LoRusso PM, Rudin CM, Reddy JC și colab. Studiu de fază I a inhibitorului căii arici vismodegib (GDC-0449) la pacienții cu tumori refractare, avansate local sau metastatice solide. Clin Cancer Res. 2011; 17 : 2502–2511. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]27. Smith DC, Smith MR, Sweeney C și colab. Cabozantinib la pacienții cu cancer de prostată avansat: rezultatele unui studiu de întrerupere randomizată de fază II. J Clin Oncol. 2012 [Epub înainte de tipărire] [ PubMed ] [ Google Scholar ]28. Trump DL, Havlin KH, Messing EM și colab. Doze mari de ketoconazol în cancerul de prostată hormon-refractar avansat: efecte endocrinologice și clinice. J Clin Oncol. 1989; 7 : 1093-1098. [ PubMed ] [ Google Scholar ]29. Small EJ, Halabi S, Dawson NA și colab. Retragerea antiandrogenului singur sau în asociere cu ketoconazol la pacienții cu cancer de prostată independent de androgen: Un studiu de fază III (CALGB 9583) J Clin Oncol. 2004; 22 : 1025-1033. [ PubMed ] [ Google Scholar ]30. Carmeliet P, Jain RK. Mecanisme moleculare și aplicații clinice ale angiogenezei. Natură. 2011; 473 : 298-307. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]31. Yu EM, Jain M, Aragon-Ching JB. Inhibitori ai angiogenezei în terapia cancerului de prostată. Discov Med. 2010; 10 : 521-530. [ PubMed ] [ Google Scholar ]32. Tomaschitz A, Pilz S, Ritz E și colab. Aldosteron și hipertensiune arterială. Nat Rev Endocrinol. 2010; 6 : 83–93. [ PubMed ] [ Google Scholar ]33. Attard G, Reid AH, Yap TA și colab. Studiul clinic de fază I a unui inhibitor selectiv al CYP17, acetat de abirateronă, confirmă faptul că cancerul de prostată rezistent la castrare rămâne de obicei condus de hormoni. J Clin Oncol. 2008; 26 : 4563–4571. [ PubMed ] [ Google Scholar ]34. Bolland MJ, Bagg W, Thomas MG și colab. Sindromul Cushing datorat interacțiunii dintre corticosteroizi și itraconazol. Ann Pharmacother. 2004; 38 : 46–49. [ PubMed ] [ Google Scholar ]


Articolele de la Oncologist sunt furnizate aici prin amabilitatea lui Wiley-Blackwell

medicamente cancer ovarian

Abstract

comentariul traducatorului : fiind vorba de medicatie chimica cu potentiale efecte secundare trebuie cantarite avantaje vs dezavantaje(efecte secundare) – de exemplu nu sunt fan statine si itraconazol pe cand metformina si ivermectina au profil siguranta si eficienta bun

Principala provocare în tratamentul cancerului ovarian este gestionarea recidivelor. În fața acestui scenariu, selecția terapiei se bazează pe mai mulți factori pentru a defini cea mai bună secvență de tratament. Terapiile țintă, cum ar fi inhibitorii bevacizumab și polimeraza (PARP), au îmbunătățit supraviețuirea pacientului. Cu toate acestea, în ciuda realizărilor lor, supraviețuirea cancerului ovarian rămâne slabă; aceste opțiuni terapeutice sunt foarte costisitoare și pot fi asociate cu potențiale efecte secundare. Recent, s-a demonstrat că, combinația de medicamente chimioterapeutice convenționale, reutilizate, ar putea fi o alternativă, prezentând rezultate bune pentru pacienți, cu puține efecte secundare și costuri reduse pentru instituțiile medicale. Scopul principal al acestei revizuiri este de a consolida importanța medicamentelor reutilizate ca alternative terapeutice și de a propune un model in vitro pentru a evalua valoarea terapeutică.Aici, am compilat cunoștințele actuale cu privire la cele mai promițătoare medicamente non-oncologice pentru tratamentul cancerului ovarian, concentrându-ne pe statine, metformină, bifosfonați, ivermectină, itraconazol și ritonavir. Discutăm consumul primar de droguri, mecanismele anticancer și aplicabilitatea în cancerul ovarian. În cele din urmă, propunem utilizarea acestor terapii pentru efectuarea testelor de eficacitate a medicamentelor în culturile ex vivo ale cancerului ovarian. Această abordare de testare personalizată ar putea fi crucială pentru validarea dovezilor existente care susțin utilizarea medicamentelor refolosite pentru tratamentul cancerului ovarian

Int J Mol Sci. 2020 oct; 21 (20): 7768.Publicat online 2020 octombrie 20. doi:  10.3390 / ijms21207768PMCID: PMC7656306PMID: 33092251

Reciclarea scopului medicamentelor vechi pentru tratarea cancerului ovarian

Mariana Nunes , 1, 2 Miguel Henriques Abreu , 2, 3 Carla Bartosch , 2, 4, 5 și Sara Ricardo 1, 2, 6, 7, *

Informații despre autor 

1 Grupul de diferențiere și cancer, Institutul pentru Cercetare și Inovare în Sănătate (i3S) al Universității din Porto / Institutul de Patologie Moleculară și Imunologie al Universității din Porto (Ipatimup), 4200-135 Porto, Portugalia; moc.liamg@2991senunarieviloanairam

2 Porto Comprehensive Cancer Center (PCCC), 4200-162 Porto, Portugalia; tp.opas@uerba_p (MHA); moc.oohay@hcsotrabalrac (CB)

3 Departamentul de Oncologie Medicală, Institutul Oncologic Portughez din Porto (IPOP), 4200-162 Porto, Portugalia

4 Departamentul de patologie, Institutul portughez de oncologie din Porto (IPOP), 4200-162 Porto, Portugalia

5 Cancer Biology & Epigenetics Group, Research Center – Portuguese Oncology Institute of Porto (CI-IPOP), 4200-162 Porto, Portugal

6 Facultatea de Medicină, Universitatea din Porto, 4200-319 Porto, Portugalia

7 Departamentul de Științe, Institutul Universitar de Științe ale Sănătății (IUCS), CESPU, CRL, 4585-116 Gandra, Portugalia* Corespondență: tp.pumitapi@odracirs ; Tel .: + 351-225-570-700

Note despre articol Informații privind drepturile de autor și licență Disclaimer

1. Introducere

Cancerul ovarian (OC) este principala cauză a mortalității prin cancer ginecologic la nivel mondial [ 1 , 2 ]. În Europa, 67.800 de femei sunt diagnosticate cu OC și 44.600 mor anual de această afecțiune malignă [ 3 ]. Subtipul cel mai răspândit, carcinomul seros de înaltă calitate (HGSC), este deosebit de letal, deoarece se dezvoltă rapid și adesea prezintă boală în stadiu avansat [ 4 , 5 , 6 ]. Opțiunile de tratament sunt limitate și implică, de obicei, chirurgia citoreductivă și chimioterapia pe bază de platină [ 4 , 5 , 6 , 7]. În timp ce mulți pacienți răspund inițial bine, aproximativ 75% dintre femei dezvoltă recurențe incurabile, contribuind la rate scăzute de supraviețuire care nu s-au schimbat substanțial în ultimii ani [ 8 ]. Principala provocare în OC este de a dezvălui o strategie terapeutică pentru a depăși chimiorezistența. Multe terapii vizate au fost aprobate pentru a trata OC, de exemplu, poli (ADP-riboză) polimerază (PARP) și inhibitori ai factorului de creștere endotelial vascular (VEGF); cu toate acestea, supraviețuirea mediană fără progresie (SFP) rămâne slabă [ 9 , 10 , 11 ]. Chiar și în cazul recăderii sensibile la platină și luând în considerare numai cei mai buni respondenți, adăugarea de bevacizumab sau inhibitori PARP (iPARP) se corelează cu o SFP nu mai mare de 21 de luni [ 12 ,13 , 14 , 15 , 16 ]. Aici, propunem o abordare alternativă bazată pe utilizarea medicamentelor non-oncologice pentru tratamentul OC. Acest concept, numit reutilizarea medicamentului, se bazează pe cunoștințele de farmacocinetică, farmacodinamică, identificarea țintei, biodisponibilitatea, profilurile de toxicitate, schemele de dozare recomandate și recunoașterea consecventă a efectelor adverse, ceea ce înseamnă că dezvoltarea indicațiilor oncologice poate începe în faza II a studiilor clinice. , făcând procesul de cercetare mai puțin consumator de timp și mai puțin costisitor [ 17 , 18 , 19 , 20]. Incorporarea medicamentelor non-oncologice pentru tratamentul cancerului este de obicei combinată cu agenți chimioterapeutici, terapii țintă sau alte medicamente reutilizate [ 21 ].

În contextul OC, multe medicamente non-oncologice au rezultate promițătoare in vitro și unele dintre ele sunt deja testate în studiile clinice. Acești compuși terapeutici includ medicamente antifungice (itraconazol), antilipidemice (statine), antidiabetice (metformină), antivirale (ritonavir), medicamente antiparazitare (ivermectină) și tratamentul osteoporozei (bifosfonați). În această revizuire, colectăm informații despre cele mai promițătoare strategii de reutilizare a medicamentelor pentru tratamentul OC și propunem o strategie pentru a testa aceste opțiuni terapeutice în probe derivate de pacienți.Mergi la:

2. Reutilizarea medicamentelor pentru tratamentul cancerului ovarian

2.1. Statine

Statinele sunt inhibitori ai 3-hidroxi-3-metilglutaril-coenzimei A reductazei (HMGCR), situată în amonte în calea mevalonatului, care este responsabilă pentru biosinteza colesterolului [ 22 , 23 , 24 ]. Principala utilizare clinică a statinelor este reducerea nivelului colesterolului plasmatic, fiind un tratament cheie în prevenirea bolilor cardiovasculare [ 25 , 26 , 27 , 28 , 29 ]. Statinele pot reduce, de asemenea, inflamația, influența expansiunea și remodelarea vasculară și pot inhiba coagularea și fibrinoliza [ 30 , 31 , 32 ].

Inhibarea HMGCR duce la o cascadă de inhibiție în proteinele din aval (de exemplu, geranil pirofosfat, farnesil pirofosfat și geranilgeranil pirofosfat), care joacă roluri importante în mai multe căi de semnalizare, cum ar fi traficul de membrane, motilitatea celulară, proliferarea, diferențierea și citoscheletul organizație [ 33 ]. HMGCR este considerat un oncogen metabolic, deoarece promovează creșterea tumorii și cooperează cu virusul sarcomului de șobolan (RAS) pentru a transforma celulele în teste de formare a coloniilor [ 34 ]. Studiile retrospective sugerează că statinele prezintă un efect antitumoral și sunt asociate cu un risc scăzut de recurență în mai multe neoplasme, inclusiv cancerele de sân și ovariene [ 26 , 35 , 36 ,37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 ].

În contextul OC, s-a demonstrat că statinele reduc proliferarea celulară și migrarea in vitro ducând la o întârziere în formarea tumorii și suprimă capacitatea metastatică in vivo [ 45 , 46 , 47 ]. Mai multe alte studii experimentale, folosind linii celulare OC și modele animale, demonstrează că statinele blochează biosinteza colesterolului conducând la apoptoză și diferențierea celulelor tumorale, proliferare, invazie, migrație, angiogeneză și metastază, prin activarea căilor de semnalizare multiple [ 35 , 36 , 46 , 48 , 49 , 50 , 51 , 52]. Martirosyan și colab., Au demonstrat că lovastatina declanșează apoptoza celulelor OC ca agent unic prin blocarea activității HMGCR (mecanism dependent de mevalonat) și sensibilizarea celulelor chemoresistante la doxorubicină prin blocarea pompelor de eflux de medicamente (mecanism independent de mevalonat) (figura 1) [ 35 ]. Un studiu recent efectuat de grupul Dr. Richardson a constatat că pitavastatina, o statină lipofilă cu un timp de înjumătățire lung, a fost capabilă să inhibe creșterea culturilor de celule OC bidimensionale (2D) și tridimensionale (3D) cu un profil rezistent la carboplatină, sugerând că pitavastatina are un mare potențial în tratarea tumorilor chemoresistante [ 53 ]. În plus, acest studiu a arătat că expresia ridicată a tipului sălbatic și a variantelor proteinei tumorale 53 ( TP53 ) a condus la o expresie crescută a HMGCR [ 53 ]. Această observație este deosebit de importantă în HGSC, unde nereglementarea TP53 este un eveniment aproape omniprezent [ 54 , 55 , 56], sugerând că o proporție semnificativă a pacienților cu OC ar putea beneficia de tratamentul cu pitavastatină [ 53 , 57 ].

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijms-21-07768-g001.jpg

Deschideți într-o fereastră separatăfigura 1

Mecanismul de acțiune al medicamentelor non-oncologice în cancerul ovarian (OC). Statinele inhibă 3-hidroxi-3-metilglutaril-coenzima A reductază (HMGCR) ducând la blocarea căii biosintetice a colesterolului, deși un mecanism dependent de mevalonat. Mai mult, statinele pot bloca pompele de eflux de medicamente printr-un mecanism independent de mevalonat. Bifosfonații blochează farnesil pirofosfatul sintazat, situat în aval de HMGCR, ducând la afectarea biosintezei colesterolului. Metformina inhibă semnalele de insulină și sinteza glucozei prin blocarea complexului I al lanțului respirator. Ritonavirul este un inhibitor de protează care inhibă producția de protein kinază B fosforilată (AKT) ducând la afectarea căii fosfatidilinozitol 3-kinaze (PI3K) -Akt. Itraconazolul poate inhiba Ariciul, ținta de rapamicină la mamifere (mTOR) și calea de semnalizare Wnt. În plus,itraconazolul poate inhiba angiogeneza și limfangiogeneza și poate promova supraexprimarea glicoproteinei P. Ivermectina interferează cu mai multe mecanisme celulare, inclusiv inhibarea proteinelor multirezistență (MDR), Akt / mTOR și modularea căilor de semnalizare Wnt, kinaza activată p21 (PAK-1) și proteina 1 asociată cu da (YAP1). Mai mult, ivermectina promovează creșterea nivelului de specii reactive intracelulare de oxigen (ROS), ducând la reglarea descendentă a genelor de tulpină. Adenozin difosfat (ADP); adenozin monofosfat (AMP); adenozin trifosfat (ATP); 3-Hidroxi-3-metilglutaril-coenzima A (HMG-CoA).și modularea căilor de semnalizare Wnt, kinaza activată p21 (PAK-1) și proteina 1 asociată cu da (YAP1). Mai mult, ivermectina promovează creșterea nivelului de specii de oxigen reactiv intracelular (ROS), ducând la reglarea descendentă a genelor de tulpină. Adenozin difosfat (ADP); adenozin monofosfat (AMP); adenozin trifosfat (ATP); 3-Hidroxi-3-metilglutaril-coenzima A (HMG-CoA).și modularea căilor de semnalizare Wnt, kinaza activată p21 (PAK-1) și proteina 1 asociată cu da (YAP1). Mai mult, ivermectina promovează creșterea nivelului de specii de oxigen reactiv intracelular (ROS), ducând la reglarea descendentă a genelor de tulpină. Adenozin difosfat (ADP); adenozin monofosfat (AMP); adenozin trifosfat (ATP); 3-Hidroxi-3-metilglutaril-coenzima A (HMG-CoA).

În ceea ce privește studiile de supraviețuire cancer ovarian OC, rata globală de supraviețuire (OS) la pacienții post diagnostici este semnificativ mai mare la utilizatorii de statine (raport de risc (HR)) = 0,63; 95% interval de încredere (IC) = 0,54-0,74 [ 58 ]; HR = 0,87; IC 95% = 0,80-0,95 [ 59 ]) comparativ cu non-utilizatori. Alte studii arată că utilizatorii de statine prezintă rate de mortalitate cauzate de toate cauzele și de mortalitate cauzată de cancer semnificativ mai mici (HR = 0,72; IC 95% = 0,56-0,93 [ 60 ]; HR = 0,85; IC 95% = 0,82-0,87 [ 61 ]) comparativ cu non-utilizatori. Un studiu recent a demonstrat că pacienții care au început un tratament cu statine după ce au fost diagnosticați cu OC au avut un risc semnificativ redus de mortalitate (HR ajustată = 0,81; IC 95% = 0,72-0,90) comparativ cu cei care nu au consumat, fiind asociați cu o supraviețuire îmbunătățită [62 ]. Alte câteva studii arată dovezi ale unei reduceri semnificative a riscului de OC în rândul consumatorilor de statine în comparație cu cei care nu utilizează [ 26 , 51 , 62 , 63 ].

De fapt, pentru 13 tipuri de cancer, sa observat o scădere a riscului de deces legat de cancer la utilizatorii de statine [ 61 ]. Efectele antitumorale ale statinelor au fost, de asemenea, descrise în diferite alte origini de cancer, de exemplu, cancerul endometrial (HR = 0,83; IC 95% = 0,69-1,01) [ 58 ], cancerul de sân (HR = 0,81; IC 95% = 0,68-0,96) [ 64 ], cancer colorectal (HR complet ajustat = 0,71; IC 95% = 0,61-0,84) [ 65 ] și cancer de prostată (HR = 0,76; IC 95% = 0,66-0,88) [ 66]. Aceste studii arată efectul statinelor pentru a preveni apariția cancerului.

Mai multe studii experimentale și observaționale sugerează că statinele ar putea prezenta proprietăți anticancerigene sau pot fi utilizate ca adjuvanți la opțiunile terapeutice actuale ale OC67 ]. În concordanță, studiile clinice în curs testează efectele diferitelor statine în tratamentul pacienților cu OC ( Tabelul S1 ). Eficacitatea statinelor a fost studiată pentru tratamentul cancerului ca monoterapie sau terapie combinatorie, ultima opțiune fiind cea mai eficientă47 , 68 , 69 , 70 , 71 , 72 ].

Statinele sunt unul dintre cele mai frecvent utilizate medicamente la nivel mondial pentru tratarea bolilor cardiovasculare. Rezultatele privind utilizarea sa în prevenirea / recurența OC și într-un cadru chimiorezistent sunt promițătoare, dar există multe lucruri de îmbunătățit în ceea ce privește tipul de statine, timpul de înjumătățire și doza.

2.2. Metformin

Metformina este utilizată în tratamentul diabetului de tip 2 deoarece induce anti-hiperglicemie, în principal prin scăderea rezistenței la insulină și blocarea glucozei-6-fosfatazei care reduce gluconeogeneza hepatică și inhibă reabsorbția gastro-intestinală a glucozei [ 73 , 74 , 75 , 76 ] . Metformina inhibă complexul lanțului respirator 1, induce o scădere a încărcăturii de energie celulară, activează absorbția glucozei prin promovarea translocării transportorului de glucoză de tip 4 la membrana plasmatică care mediază activarea ficatului kinază B1 și a adenozinei monofosfat-proteină kinază activată (AMPK) [ 75 , 76 , 77 , 78]. În consecință, concentrațiile de adenozin trifosfat celular (ATP) scad, iar creșterea atât a raporturilor de adenozin difosfat (ADP) / ATP, cât și a adenozin monofosfatului (AMP) / ATP declanșează AMPK care coordonează o gamă largă de răspunsuri compensatorii, de protecție și economisitoare de energie, conducând la o reducere a debitului hepatic de glucoză [ 75 , 76 , 77 , 78 ]. Metformina inhibă proliferarea celulară și semnalele insulinei, blochează sinteza proteinelor și a acizilor grași și prezintă proprietăți antiinflamatorii [ 79 , 80]. În plus, s-a raportat, de asemenea, că metformina are proprietăți antitumorale, deoarece inhibarea producției de glucoză va provoca modificări ale circuitelor metabolice și endocrine care schimbă unele procese celulare și moleculare care vor influența biologia cancerului provocând stres de oxidare și acid dezoxiribonucleic ( ADN) daune [ 17 , 79 , 81 ].

Au fost propuse multe mecanisme ale activității anti-cancer a metforminei. Unele studii sugerează că metformina modulează răspunsurile imunologice și / sau antiinflamatorii în tratamentul cancerului [ 82 , 83 ]. Alte studii demonstrează că metformina inhibă ținta rapamicinei la mamifere (mTOR) prin activarea AMPK, rezultând o proliferare redusă a celulelor canceroase [ 84 , 85 ]. Au fost propuse acțiuni metabolice legate de gluconeogeneză, funcția mitocondrială și metabolismul celular [ 86 , 87 ]. Metformina reduce respirația celulară prin inhibarea complexului 1 al lanțului respirator, limitând plasticitatea metabolică a celulei canceroase [ 73 , 88 ,89 ]. Cu toate acestea, celulele canceroase încearcă să compenseze suprimarea fosforilării oxidative prin îmbunătățirea glicolizei care este dependentă de p53 [ 89 ]. HGSC prezintă în mod normal absența p53 funcțional; prin urmare, celulele canceroase sunt incapabile să compenseze suprimarea indusă de metformină a metabolismului oxidativ [ 90 ]. În OC, metformina se raportează că inversează chemorezistența, evită tranziția mezenchimală epitelială (EMT), reduce migrația celulelor canceroase și metastazele [ 87 , 91 , 92 , 93 , 94]. De fapt, în acest context tumoral, mai multe studii demonstrează că metformina blochează creșterea celulelor, induce apoptoza, inhibă angiogeneza și răspândirea metastatică, potențează eficacitatea agenților chimioterapeutici și inversează chimiorezistența (figura 1) [ 77 , 86 , 92 , 95 , 96 , 97 , 98 , 99 , 100 , 101 , 102 , 103 ]. În plus, metformina, singură sau în combinație cu cisplatină, inhibă viabilitatea celulară și angiogeneza și induce apoptoza în liniile celulare OC [ 104 ]. Un alt studiu in vitro și in vivo a demonstrat că combinarea iPARP-urilor și a metforminei îmbunătățește efectele antitumorale indiferent de statutul de cancer de sân (BRCA) [ 105 ].

Studiile epidemiologice arată că rata mortalității cauzată de cancer este semnificativ mai mică la pacienții cu metformină și că rata de supraviețuire este îmbunătățită la multe tipuri de pacienți cu cancer, adică cancerele colorectale, pancreatice, mamare, hepatice și endometriale 106 , 107 ].

Un studiu recent a demonstrat că metformina a prelungit semnificativ OS (HR = 0,61; 95% CI = 0,48-0,77) și a redus riscul de recurență (HR = 0,50; 95% CI = 0,28-0,92) în cancerul endometrial [ 108 ]. În ceea ce privește cancerul endometrial, rezultatele au arătat că metformina amplifică efectele paclitaxelului prin blocarea căii de semnalizare mTOR [ 109 ]. Alte studii epidemiologice și meta-analize demonstrează că metformina reduce riscul de CO (raport impar) (0,61; IC 95% = 0,30-1,25 [110 ]; OD = 0,57; IC 95% = 0,16-1,99 [ 111 ]) și mortalitatea specifică OC [ 110 , 111 , 112 , 113 , 114 , 115 , 116 ]. În plus, SFP pe 5 ani a fost semnificativ mai bun pentru pacienții cu OC cu diabet de tip 2 care luau metformină (63%) comparativ cu utilizatorii altor medicamente hipoglicemiante (37%) și cei care nu consumau (23%) ( p = 0,03) [ 112]. Coroborând aceste rezultate, un alt studiu a demonstrat că rata de supraviețuire la 5 ani a fost semnificativ mai bună în grupul de utilizatori de metformină (67%) comparativ cu non-utilizatori (47%) și că metformina a rămas un predictor independent de supraviețuire (HR = 2,2; 95 % CI = 1,2-3,8) [ 115 ]. O meta-analiză recentă a demonstrat că utilizarea metforminei la pacienții OC post-diagnostici este asociată cu OS îmbunătățit (HR rezumat = 0,42; IC 95% = 0,31-0,56) și PFS (HR rezumat = 0,69; IC 95% = 0,45-1,07 ) indiferent de starea de diabet [ 117 ]. Mai multe alte studii retrospective au ajuns la concluzii similare, indicând faptul că pacienții cu cancer cu diabet tratați cu metformină au prezentat o povară de cancer substanțial mai mică decât pacienții cu diabet tratați cu alte medicamente antilipidemice [ 118].119 , 120 , 121 , 122 ]. Studiile in vivo demonstrează că metformina poate viza celulele stem ale cancerului ovarian (CSC) și, prin urmare, poate spori răspunsul la chimioterapie [ 103 , 123 ] propunând un mecanism de acțiune bazat pe țintirea CSC [ 92 , 103 , 124 , 125 , 126 , 127 , 128 ].

Un studiu clinic de fază II recent a arătat o SFP mediană de 18,0 luni (IÎ 95% = 14,0-21,6) cu o supraviețuire fără recidive la 18 luni de 59,3% (IÎ 95% = 38,6-70,5) și un OS median de 57,9 luni (IÎ 95% = 28,0-nu este estimabil) pentru utilizatorii de metformină la pacienții cu OC non-diabetici129 ]. Aceiași autori demonstrează că metformina este un agent de țintire CSC, deoarece tumorile ex vivo tratate cu metformină prezintă o scădere medie de 2,4 ori a celulelor ALDH + / CD133 + și o sensibilitate crescută la cisplatină comparativ cu celulele netratate cu metformină [ 129 ] .

Un studiu clinic de fază I testează efectul metforminei în combinație cu chimioterapia cu carboplatină-paclitaxel în OC avansat și evaluează siguranța și farmacocinetica [ 130 ]. În plus, se desfășoară un studiu randomizat de fază II pentru a evalua metformina ca terapie de întreținere în combinație cu chimioterapie standard la pacienții cu ovarian, trompa uterină sau cu cancer peritoneal primar în stadiul III-IV ( NCT02122185 ).

Studiul clinic în curs testează în prezent această opțiune terapeutică, setarea OC fiind determinantă pentru a dezvălui rolul metforminei în tratamentul OC ( Tabelul S1 ). Multe rezultate experimentale și epidemiologice subliniază utilitatea metforminei în managementul oncologic, sugerând rolul său potențial în tratamentul OC avansat, mai ales atunci când este combinat cu compuși de platină.

2.3. Bifosfonați

Bifosfonații (de exemplu, alendronatul și acidul zoledronic) sunt utilizate pe scară largă pentru tratarea osteoporozei prin inhibarea resorbției osoase prin scăderea activității osteoclastelor [ 131 , 132 ]. Bifosfonații blochează farnesil pirofosfatul sintază situat în aval decât HMGCR în calea mevalonat [ 133 ]. Farnesil pirofosfatul este o enzimă implicată în sinteza compușilor necesari pentru menținerea funcției osteoclaste, cum ar fi farnesil pirofosfatul și geranilgeranil pirofosfatul [ 134]. Bifosfonații au un efect în prevenirea complicațiilor clinice specifice ale metastazelor osoase (hipercalcemie, fracturi osoase și durere) și au o proprietate anti-metastatică și antitumorală suplimentară atunci când sunt combinate cu agenți chimioterapeutici care inhibă proliferarea și diseminarea tumorii [ 134 , 135 , 136 , 137 , 138 ]. Experimentele in vitro, folosind linii celulare de cancer de sân și de prostată, demonstrează că bifosfonații promovează apoptoza și blochează proliferarea celulară [ 139 , 140]. În plus, studiile care utilizează linii celulare OC și modele animale au arătat că bifosfonații au o activitate anti-proliferativă și pro-apoptotică prin inhibarea proliferării celulare și angiogeneză, inducerea apoptozei și activarea celulelor imune [ 141 , 142 , 143 , 144 , 145 , 146 ]. Un studiu recent a demonstrat că bifosfonații inhibă proliferarea liniilor celulare OC într-o manieră dependentă de concentrație in vitro și potențează o întârziere în formarea tumorii și o scădere a proliferării celulelor tumorale la modelele transgenice de șoarece OC (figura 1) [ 147 ]. Studiile au arătat că alendronatul, un medicament din clasa bifosfonaților, reduce invazia stromală, sarcina tumorală și ascita, sugerând că are efect antitumoral în OC [ 148 ]. Pe de altă parte, acidul zoledronic are o activitate anti-proliferativă și antiinvazivă și prezintă un potențial interesant de a întârzia recurențele în cancerele ovariene, endometriale și mamare, deoarece perturbă etapele relevante ale diseminării tumorii (adică invazia și formarea coloniei) [ 134 ].

Unele rapoarte au indicat faptul că bifosfonații prezintă proprietăți antitumorale în multe tipuri de cancer, de exemplu, pot inhiba apariția sânului (risc relativ (RR) = 0,87; IC 95% = 0,81-0,93) [ 149 ] și endometrial (RR) = 0,75; IC 95% = 0,60-0,94) [ 150 ] tipuri de cancer.

Un alt studiu epidemiologic a raportat că bifosfonații, administrați cu sau fără statine, sunt asociați cu un risc redus de OC [ 151 ]. În plus, s-a raportat că pacienții care utilizează bifosfonați prezintă un risc semnificativ redus de cancer ovarian (OR = 0,49; IC 95% = 0,26-0,93) și endometrial (OR = 0,39; IC 95% = 0,24-0,63) comparativ cu cancerele non- utilizatori [ 151 ].

Prin urmare, s-a demonstrat că bifosfonații prezintă un efect antitumoral și o capacitate de a întârzia recurențele în setarea OC; cu toate acestea, sunt necesare studii suplimentare pentru a evalua valoarea sa ca opțiune de tratament al cancerului.

2.4. Ivermectina

Ivermectina, un pesticid lactonic policiclic produs de bacteria S treptomyces avermitilis , este un agent antiparazitar cu spectru larg [ 152 ] care se leagă cu afinitate ridicată la canalul ionic de clorură operativă a acidului glutamic localizat în celulele nervoase și musculare la nevertebrate [ 153 , 154 ]. Această ligatură determină o permeabilitate crescută în membrana celulară pentru a permite ionilor de clorură să pătrundă în celule, rezultând hiperpolarizarea celulelor nervoase și musculare, care provoacă paralizia și dispariția paraziților [ 153 , 154 ].

Ivermectina este utilizată pe scară largă pentru tratarea oncocerciozei, a filariozei limfatice, a fortiloidiozei, a scabiei și a păduchilor de cap [ 155 ]. În plus, ivermectina poate prezenta și alte acțiuni terapeutice precum antibacteriene, antivirale și anticancer [ 156 ]. Ca agent anti-neoplazic, s-a demonstrat că ivermectina prezintă activitate antitumorală în diferite tipuri de cancer, cu accent pe cancerele ovariene, de colon și pulmonare, gliom, leucemie și melanom [ 157 , 158 , 159 , 160 , 161]. Diferite mecanisme pot explica această activitate, și anume inhibarea proteinelor cu rezistență la multe medicamente (MDR), modularea căilor de semnalizare a protein kinazei B (Akt) / mTOR și a factorului celulei Wnt / T (Wnt / TCF), degradarea kinazei p21-activate ( PAK-1) și reglarea descendentă a genelor de tulpină pentru a viza în mod preferențial populațiile CSC [ 158 , 159 , 161 , 162 , 163 , 164 , 165 , 166 , 167 ].

Un studiu recent in vitro și in vivo a demonstrat că ivermectina induce autofagia citostatică în celulele cancerului de sân legate de inhibarea expresiei PAK-1 ducând la o fosforilare redusă a Akt și blocarea căii de semnalizare Akt / mTOR care inhibă creșterea tumorii [ 163 , 168 ] . PAK-1 este exprimat anormal în diferite neoplasme, inclusiv cancer de sân, ovarian, pancreatic, de colon și de prostată și este implicat în creșterea celulelor tumorale și în dezvoltarea chimiorezistenței [ 163 , 166 ]. Hashimoto și colab. a demonstrat in vitro că ivermectina induce inactivarea creșterii celulelor OC care inhibă PAK-1 [ 158]. Un alt studiu recent a demonstrat că ivermectina vizează preferențial CSC-urile mamare prin creșterea nivelului speciilor de oxigen reactiv intracelular (ROS) asociate cu stresul oxidativ și deteriorarea ADN-ului [ 161 ]. În plus, s-a demonstrat că ivermectina ar putea scădea rezistența la mai multe medicamente în cancerul de sân și ar spori citotoxicitatea doxorubicinei și a paclitaxelului [ 169 ]. În celulele glioblastomului, ivermectina inhibă angiogeneza și dezactivează calea de semnalizare Akt / mTOR [ 166 ]. Mai mult, ivermectina inhibă semnificativ proliferarea și induce apoptoza în carcinomul cu celule renale multiple in vitro și întârzie semnificativ creșterea tumorii in vivo, prin inducerea disfuncției mitocondriale și a stresului oxidativ [ 170].]. Deoarece ivermectina este un compus care vizează proteina 1 asociată cu da (YAP1) [ 171 ], se anticipează că prezintă efecte antitumorale împotriva cancerelor ovariene, gastrice, colorectale și pulmonare, pentru care se consideră că o expresie ridicată a YAP1 este o indicator prognostic [ 172 , 173 , 174 , 175 , 176 ]. Ivermectina suprimă proliferarea celulelor cancerului gastric in vitro și in vivo prin inhibarea expresiei YAP1 într-o manieră concentrațională și dependentă de timp [ 177 ]. În leucemia mieloidă cronică, s-a demonstrat că ivermectina induce selectiv apoptoza prin disfuncție mitocondrială și inducerea stresului oxidativ [ 178 ].

În OC, rezultatele in vitro și in vivo arată că ivermectina are un efect antitumoral dependent de subunitatea carioferină beta 1 (KPNB1) și combinația de ivermectină și paclitaxel produce un efect sinergic decât fiecare medicament [ 179 ]. Pacienții OC cu expresie ridicată a KPNB1 prezintă o supraviețuire slabă, prin urmare, ivermectina reprezintă un candidat promițător pentru tratamentul combinator în OC. Recent, un studiu interesant sugerează că ivermectina poate folosi tratamente combinatorii OC, demonstrând că acest medicament a crescut semnificativ efectul inhibitor al cisplatinei prin suprimarea fosforilării moleculelor cheie în calea de semnalizare Akt / mTOR [ 180]. În același studiu, utilizând modele de șoareci cu xenogrefă OC, autorii au arătat că ivermectina singură inhibă creșterea tumorii și, în combinație cu cisplatina, inversează complet creșterea tumorii [ 180 ]. Coroborând aceste constatări, un alt studiu in vivo și vitro a demonstrat că ivermectina inversează chimiorezistența în celulele canceroase de leucemie mieloidă colorectală, mamară și cronică prin inhibarea receptorului factorului de creștere epidermică (EGFR) / kinazelor extracelulare cu reglare a semnalului (ERK) / Akt / factorului nuclear calea kappa B (NF-κB) (figura 1) [ 181 ].

Descoperirile anterioare demonstrează că ivermectina îmbunătățește eficacitatea anticanceroasă a medicamentelor chimioterapeutice, în special în celulele chimiorezistente. Astfel, ar trebui efectuate studii suplimentare cu ivermectină în combinație cu agenți chimioterapeutici pentru a valida utilizarea acesteia în tratamentul OC.

2.5. Itraconazol

Itraconazolul este un agent antifungic cu spectru larg care inhibă sinteza ergosterolului în membrana celulară fungică prin blocarea enzimei lanosterol 14a-demetilază, rezultând distrugerea membranei fungice [ 182 , 183 , 184 ]. Itraconazolul este utilizat pe scară largă pentru tratarea infecțiilor fungice, inclusiv aspergiloză, candidoză și histoplasmoză și profilaxia tulburărilor imunosupresive [ 184 , 185 ]. În plus, mai multe date experimentale și clinice arată rezultate promițătoare cu privire la activitatea antiangiogenă a itraconazolului și a fost refăcut ca agent anticancerigen în mai multe tipuri de cancer [ 184 , 186 , 187 ].

Itraconazolul vizează diferite mecanisme de oncobiologie, inclusiv inversarea chemoresistenței mediată de glicoproteina P, inhibarea căilor de semnalizare Hedgehog, mTOR și Wnt / β-catenină, inhibarea angiogenezei și limfangiogenezei [ 186 , 188 , 189 , 190 , 191 , 192 , 193 , 194 , 195 ]. Un studiu recent a demonstrat că itraconazolul este capabil să inhibe semnalizarea mTOR prin diferite mecanisme din amonte, de exemplu, activarea AMPK și inhibarea traficului de colesterol care îmbunătățește un efect anti-proliferativ și anti-angiogenic, ducând la o eficacitate crescută a medicamentului și la inversarea chemorezistenței [ 190].]. În plus, un studiu in vitro a arătat că itraconazolul are efecte anticanceroase asupra carcinomului cu celule scuamoase orale prin exprimarea proteinelor în reglarea descendentă a căii Hedgehog prin inhibarea proliferării și migrației celulare [ 196 ]. Un alt studiu in vitro asupra cancerului pancreatic a demonstrat că itraconazolul inhibă viabilitatea, induce apoptoza și suprima invazia și migrația prin factorul de creștere beta (TGF-β) / mamele afectate împotriva semnalizării omologului decapentaplegic 2/3 (SMAD2 / 3) [ 197 ]. În cancerul esofagian, s-a demonstrat că itraconazolul inhibă creșterea celulelor prin activarea semnalizării AMPK [ 198 , 199 ].

În contextul OC, un studiu recent a arătat un efect sinergic al combinării itraconazolului și paclitaxelului pentru a spori eficacitatea la modelele de xenogrefă și de xenogrefe derivate de la pacienți (PDX) derivate de la pacienții chimiorezistenți la OC [ 200 ]. Autorii au demonstrat că activitatea antiangiogenă a itraconazolului este atribuită capacității sale de a inhiba receptorul factorului de creștere endotelial vascular 2 (VEGFR2) și fosforilarea căilor ERK, arici și mTOR (figura 1) [ 200 ]. Acest studiu sugerează că combinarea itraconazolului și a paclitaxelului ar putea spori răspunsul chimioterapeutic la pacienții cu OC epitelial [ 200 ].

Mai multe studii demonstrează că tratamentul cu itraconazol, în combinație cu alți agenți terapeutici, este eficient în mai multe tipuri de cancer pentru creșterea eficacității medicamentului și pentru depășirea chimiorezistenței [ 201 , 202 , 203 , 204 , 205 ]. De fapt, s-a demonstrat că itraconazolul poate fi un agent terapeutic eficient pentru cancerele ovariene, mamare, prostatei, celulare bazale, pulmonare cu celule mici, endometriale, gastrointestinale, vezicale și pancreatice [ 186 , 187 , 188 , 202 , 203 , 205 , 206 , 207 , 208209 , 210 , 211 ]. În cazurile de cancer pulmonar pancreatic și non-cu celule mici, sa raportat o supraviețuire prelungită atunci când itraconazolul este administrat ca terapie de linia a doua202 , 208 ].

La pacienții cu OC care nu răspund la agenții de platină, administrarea de itraconazol combinată cu chimioterapia bazată pe taxan a îmbunătățit semnificativ PFS (HR = 0,24; p = 0,002) și supraviețuirea generală (HR = 0,27; p = 0,006) [ 203 ]. Unele rezultate demonstrează că tratamentul cu itraconazol este benefic pentru tratarea malignităților refractare, inclusiv a celulelor ovariene clare, a cancerului de sân triple-negativ, pancreatic și al tractului biliar [ 202 , 203209 , 212 ]. În plus, unele date din studiile preclinice și clinice indică faptul că itraconazolul este capabil să inverseze chimiorezistența paclitaxelului [ 213 , 214 , 215 ].

În prezent, unele studii clinice evaluează efectul itraconazolului ca cancer terapeutic în cancerul pulmonar cu celule mici ( NCT02357836 ), cancer esofagian ( NCT02749513 ), carcinom bazocelular ( NCT02120677 ) și OC ( Tabelul S1 ).

Datele disponibile din studiile preclinice și clinice indică faptul că itraconazolul poate inversa chimiorezistența paclitaxelului. Având în vedere că pacienții cu OC prezintă frecvent recurențe taxano-chemoresistante, sunt necesare mai multe studii experimentale care utilizează celule OC pentru a evalua în continuare această proprietate antineoplazică a acestui medicament antifungic.

2.6. Ritonavir

Ritonavirul este un inhibitor al proteazei aprobat în prezent pentru tratamentul infecției cu virusul imunodeficienței umane (HIV) pentru a controla sindromul imunodeficienței dobândite (SIDA) [ 216 ]. Terapia antiretrovirală foarte activă (HAART) este terapia combinată (de exemplu, inhibitori ai revers transcriptazei, cum ar fi inhibitori ai zidovudinei și proteazei, cum ar fi, ritonavir și nelfinavir) utilizată pentru tratarea pacienților cu infecție HIV [ 217 ] caracterizată printr-un risc crescut să dezvolte mai multe tipuri de tumori [ 217 , 218 , 219 ]. Interesant este faptul că unele studii au demonstrat că, la pacienții cu HIV tratați cu HAART [ 220 , 221 , 222 , 223], rata incidenței unor cancere este, de fapt, mai mică. Coroborând aceste constatări, rezultatele altor studii au raportat asocieri ale unui potențial impact anti-neoplazic al HAART [ 224 , 225 , 226 , 227 ]. S-a demonstrat că ritonavirul induce apoptoza celulelor tumorale limfoblastice incluzând limfom, leucemie mieloidă, fibrosarcom, mastocitom și sarcomul Kaposi [ 228 , 229 , 230 , 231 ]. Un studiu in vitro a demonstrat că ritonavirul are o activitate anti-proliferantă eficientă în celulele OC, inducând oprirea ciclului celular și apoptoza prin inhibarea căii AKT și fosforilarea retinoblastomului [ 217]. Ritonavir scade cantitatea de AKT fosforilată într-o manieră dependentă de doză, ceea ce inhibă calea fosfatidilinozitol 3-kinazei (PI3K) / Akt având efect antitumoral (figura 1). Alte rezultate în OC demonstrează că ritonavirul inhibă invazia și migrația și are un efect aditiv atunci când este combinat cu tratamentul cu paclitaxel [ 217 ].

Dovezile asupra acțiunii ritonavirului asupra celulelor canceroase sunt limitate și necesită o validare suplimentară. Cu toate acestea, aceste date existente demonstrează că ritonavirul are un potențial pentru tratamentul OC în combinație cu chimioterapia convențională.Mergi la:

3. Utilizarea modelelor Ex Vivo pentru a testa eficacitatea individuală de reutilizare a medicamentelor

Dezvoltarea modelelor de celule canceroase derivate de pacienți pentru efectuarea testelor de eficacitate a medicamentelor capabile să prezică răspunsurile la medicamente constituie un pas important către un tratament personalizat al cancerului. Aceste teste ar trebui să ia în considerare fenotipul, genotipul și fundalul expresiei proteinelor fiecărei tumoare a pacientului pentru a căuta medicamente eficiente în conformitate cu un profil individual al răspunsului la medicament. Determinarea profilului de chimiorezistență la fiecare pacient individual ar putea facilita descoperirea celui mai eficient medicament pentru repoziționare și tratamentul ar putea fi adaptat în consecință [ 232]. Au fost exploatate mai multe sisteme de modele ex vivo în aceste scopuri: (a) cultură monostrat 2D de celule disociate, inclusiv culturi primare și linii celulare; (b) culturi de tumori 3D, cuprinzând linii celulare și organoizi; (c) PDX; și (d) felii de țesut tumoral organotipic. Avantajele și dezavantajele fiecăruia dintre aceste sisteme au fost revizuite în altă parte [ 233 ]. În cadrul acestora, sistemele de cultură de celule canceroase derivate de pacienți se disting, fiind un model preclinic ușor de realizat, non-animal, pentru testele de eficacitate a medicamentelor capabile să ghideze deciziile clinice [ 234 ]. Într-adevăr, modelele 2D și 3D pot fi utilizate pentru screening-ul cu sensibilitate ridicată a medicamentelor, care au început să arate rezultate promițătoare cu rate de răspuns semnificativ mai mari la pacienții care urmează tratamente ghidate [ 235]. În mod specific, în OC epitelial, s-a demonstrat că modelele ex vivo recapitulează fidel caracteristicile tumorale fenotipice și genotipice [ 236 ]. Mai mult, rezultatele profilării medicamentelor folosind aceste modele OC au arătat sensibilitate la medicamente, cum ar fi, platina și iPARP-urile, care s-au corelat cu răspunsurile clinice ale pacienților [ 237 ]. De asemenea, modelele ex vivo sunt, de asemenea, potrivite pentru testarea reutilizării medicamentelor de mare viteză, după cum s-a demonstrat în alte tipuri de cancer [ 238 ]. În OC epitelial, reîncadrarea sistematică a medicamentelor pe baza unor indicii din testarea ex vivo a celulelor pacientului cu OC umane a început, de asemenea, să fie explorată cu rapoarte de caz ale pacienților care prezintă răspuns la medicamente care nu sunt aplicate de obicei [ 239 ].

Modelele de celule canceroase derivate de pacienți sunt cel mai frecvent stabilite din tumorile primare, dar pot fi derivate și din metastaze și celule tumorale circulante din sânge, revărsări sau alte fluide organice [ 240 ]. Alegerea probelor tumorale care urmează să fie utilizate pentru testarea medicamentelor poate fi crucială pentru a prezice cu exactitate răspunsul pacientului pe parcursul bolii cu impact asupra supraviețuirii. În acest sens, OC epitelial constituie un cadru particular dat fiind că calea sa principală de progresie se află în cavitatea peritoneală [ 241]. Celulele tumorale exfoliate din ovar sau trompa uterină sunt purtate de lichid peritoneal fiziologic și se diseminează prin cavitatea abdominală. Însămânțarea peritoneală extinsă de către celulele tumorale este adesea asociată cu ascită, care poate fi detectată la momentul diagnosticului și mai frecvent în stadii avansate [ 242 ]. Ascita malignă cuprinde un set de citokine, factori de creștere, celule mezoteliale, macrofage, limfocite și celule tumorale [ 243]. Accesibilitatea ușoară a cavității peritoneale face din ascită o sursă puternică de celule tumorale, potrivită pentru detectarea biomarkerilor prognostici și predictivi, precum și pentru a efectua teste ex vivo care ar putea stimula descoperirea abordărilor terapeutice personalizate. În absența ascitei, la diagnostic, țesutul tumoral pentru modelele ex-vivo poate fi colectat simultan cu prelevarea de probe în scopuri de diagnosticare a patologiei. În contextul recurenței fără ascită, biopsia pentru modelele ex-vivo ar trebui luată în considerare cu atenție de către medici împreună cu pacienții lor, deoarece aceasta este o procedură invazivă. Înființarea culturilor din celulele tumorale circulante din sânge, chiar dacă este dificilă, poate fi o alternativă.

Stabilirea de modele ex vivo din celule canceroase derivate din lichidul ascitic (Figura 2) a fost explorat ca model pentru depășirea unor limitări ale liniilor celulare puternic manipulate și potențarea unei dovezi de concept pentru testarea personalizată a eficacității medicamentelor [ 232 , 234 , 244 , 245 , 246 ]. O limitare a reutilizării medicamentelor este potența scăzută a compușilor afectați ca agenți unici, deoarece doza maximă tolerată este adesea subterapeutică în scopuri de tratament al cancerului [ 247]. În mod înțelept, cocktailurile combinate care utilizează medicamente chimioterapeutice și unul sau mai multe medicamente non-oncologice pot fi testate în celule canceroase derivate din lichid ascitic pentru a oferi o soluție terapeutică individualizată pacienților cu OC. Conceptul de reutilizare a medicamentelor aliniat la acest sistem de testare personalizat ar putea valida în continuare dovezile existente care susțin utilizarea acestor medicamente vechi pentru tratamentul cancerului.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este ijms-21-07768-g002.jpg

Deschideți într-o fereastră separatăFigura 2

Stabilirea de modele ex vivo din celule canceroase derivate din lichid ascitic pentru efectuarea testelor de eficacitate a medicamentelor. Combinația reutilizării medicamentelor (de exemplu, pitavastatină, metformină, bifosfonați, ivermectină, itraconazol și ritonavir) cu chimioterapie convențională (de exemplu, carboplatină și paclitaxel) poate avea beneficiile unei eficacități crescute și poate reduce riscul de eșec terapeutic. Eficacitatea abordărilor de reutilizare a medicamentelor pentru a viza sau sensibiliza celulele chimiorezistente la chimioterapia convențională poate fi validată în modele ex vivo stabilite. O diagramă schematică care demonstrează chimioterapia convențională în combinație cu compuși de refacere a medicamentelor care pot viza direct celula chimiorezistentă și tumora își pierde capacitatea de a genera noi celule canceroase,sau sensibilizează celulele chemoresistante pentru a perturba tulpina și a le face mai sensibile la chimioterapia convențională.Mergi la:

4. Concluzii

Mai mulți cercetători din întreaga lume investighează deja reciclarea scopului medicamentelor care nu au fost concepute inițial pentru tratamentul cancerului. Aceste terapii pot juca un rol important în chimioprevenția cancerului, în întârzierea recurenței și ca parteneri ai terapiilor vechi și noi, cum ar fi chimioterapia. Cu toate acestea, această strategie terapeutică se confruntă cu multe obstacole în ceea ce privește concurența cu dezvoltarea de noi medicamente și considerente legate de brevet. Multe dintre aceste dificultăți au dus la lipsa investițiilor din partea industriei farmaceutice care afectează dezvoltarea proiectelor de cercetare care ar putea valida în continuare dovezile științifice actuale. Redistribuirea medicamentelor va aduce beneficii în cele din urmă pacienților și țărilor cu venituri mici, cu sisteme de asistență medicală fragile și cu acces limitat la medicamente noi, scumpe. Prin urmare,cercetarea medicamentelor fără brevet ar trebui să aibă un sprijin financiar echitabil pentru a garanta o comparație exactă a rezultatelor dintre medicamentele noi și cele vechi în condițiile de cancer. În ceea ce privește OC, celulele tumorale prezente în lichidul ascitic constituie o oportunitate de a studia ex vivo eficacitatea medicamentelor într-un mod personalizat. Acest model are un mare potențial de a prezice efectul sinergic dintre chimioterapie și medicamentele de reutilizare, ducând la cel mai bun beneficiu pentru pacienții cu cancer.Mergi la:

Abrevieri

2DBidimensional
3DTridimensional
SIDASindromul imunodeficienței dobândite
ADPAdenozin difosfat
AKTProtein kinaza B.
AMPAdenozin monofosfat
AMPKProteina kinază activată
ATPAdenozin trifosfat
BRCACancer mamar
CIInterval confidențial
CSC-uriCelulele stem canceroase
ADNAcidul dezoxiribonucleic
EGFRReceptorul factorului de creștere epidermic
EMTTranziția epitelială-mezenchimală
ERKKinazele extracelulare cu reglare a semnalului
HAARTTerapie antiretrovirală foarte activă
HGSCCarcinom seros de înaltă calitate
HIVVirusul imunodeficienței umane
HMGCR3-Hidroxi-3-metilglutaril-coenzima A reductază
HRGrad de periculozitate
iPARP-uriInhibitori PARP
KPNB1Subunitatea carioferină beta 1
MDRProteine ​​multirezistente
mTORȚinta mamiferelor de rapamicină
NF-κBFactorul nuclear kappa B
OCCancer ovarian
ODRaportul de cote
OSSupraviețuirea generală
P53 / TP53Proteina tumorală
PAK-1P21 – kinază activată
PARPPoli (ADP-riboză) polimerază
PDXXenogrefă derivată de pacient
PFSSupraviețuire fără progresie
PI3K3-kinaze fosfatidilinozitol
SMAD2 / 3Mame împotriva omologului decapentaplegic 2/3
RASVirusul sarcomului de șobolan
ROSSpecii reactive de oxigen
RRRisc relativ
TGF-βTransformarea factorului de creștere beta
VEGFFactorul de creștere endotelial vascular
VEGFR2Receptorul factorului de creștere endotelial vascular 2
Wnt / TCFFactorul celulei Wnt / T
YAP1Proteina asociată cu da 1

Mergi la:

Materiale suplimentare

Următoarele sunt disponibile online la https://www.mdpi.com/1422-0067/21/20/7768/s1 .Faceți clic aici pentru fișier de date suplimentare. (12K, fermoar)Mergi la:

Contribuțiile autorului

Toți autorii au contribuit intelectual la cercetarea, redactarea și editarea manuscrisului. Toți autorii au citit și au acceptat versiunea publicată a manuscrisului.Mergi la:

Finanțarea

Acest manuscris a fost finanțat de HOPE: Îmbunătățirea supraviețuirii pacienților cu cancer ovarian – donația de la un pacient cu cancer ovarian și de proiectul PTDC / MEC-ONC / 29503/2017 al FCT (Fundația pentru Tehnologie).Mergi la:

Conflicte de interes

Autorii nu declară niciun conflict de interese.Mergi la:

Note de subsol

Nota editorului: MDPI rămâne neutru în ceea ce privește revendicările jurisdicționale din hărțile publicate și afilierile instituționale.Mergi la:

Referințe

1. Bray F., Ferlay J., Soerjomataram I., Siegel RL, Torre LA, Jemal A. Statistici globale asupra cancerului 2018: estimări Globocan ale incidenței și mortalității la nivel mondial pentru 36 de cancere în 185 de țări. CA Cancer J. Clin. 2018; 68 : 394–424. doi: 10.3322 / caac.21492. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Ferlay J., Colombet M., Soerjomataram I., Mathers C., Parkin DM, Pineros M., Znaor A., ​​Bray F. Estimarea incidenței și mortalității globale a cancerului în 2018: surse și metode Globocan. Int. J. Rac. 2019; 144 : 1941–1953. doi: 10.1002 / ijc.31937. [ PubMed ] [ CrossRef ] [ Google Scholar ]3. Ferlay JCM, Soerjomataram I., Dyba T., Randi G., Bettio M., Gavin A., Visser O., Bray F. Incidența cancerului și tiparele de mortalitate în Europa: estimări pentru 40 de țări și 25 de tipuri de cancer majore în 2018 . Eur. J. Cancer Clin. Oncol. 2018; 103 : 356–387. doi: 10.1016 / j.ejca.2018.07.005. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Kim A., Ueda Y., Naka T., Enomoto T. Strategii terapeutice în cancerul ovarian epitelial. J. Exp. Clin. Cancer Res. 2012; 31:14 . doi: 10.1186 / 1756-9966-31-14. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Cheng WF, Huang CY, Chang MC, Hu YH, Chiang YC, Chen YL, Hsieh CY, Chen CA Mezotelina ridicată se corelează cu chimiorezistență și supraviețuire slabă în carcinomul ovarian epitelial. Fr. J. Rac. 2009; 100 : 1144–1153. doi: 10.1038 / sj.bjc.6604964. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Griffiths CT, Fuller AF Management intensiv chirurgical și chimioterapeutic al cancerului ovarian avansat. Surg. Clin. N. Am. 1978; 58 : 131–142. doi: 10.1016 / S0039-6109 (16) 41440-4. [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Lheureux S., Gourley C., Vergote I., Oza AM Cancer ovarian epitelial. Lancet. 2019; 393 : 1240–1253. doi: 10.1016 / S0140-6736 (18) 32552-2. [ PubMed ] [ CrossRef ] [ Google Scholar ]8. Bowtell DD, Bohm S., Ahmed AA, Aspuria PJ, Bast RC, Jr., Beral V., Berek JS, Birrer MJ, Blagden S., Bookman MA, și colab. Repensarea cancerului ovarian ii: Reducerea mortalității prin cancer ovarian seros de înaltă calitate. Nat. Pr. Rac. 2015; 15 : 668-679. doi: 10.1038 / nrc4019. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Hille S., Rein DT, Riffelmann M., Neumann R., Sartorius J., Pfutzner A., ​​Kurbacher CM, Schondorf T., Breidenbach M. Medicamentele anticanceroase induc expresia genei mdr1 în cancerul ovarian recurent. Medicamente anticanceroase. 2006; 17 : 1041-1044. doi: 10.1097 / 01.cad.0000231480.07654.b5. [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Howlader NNA, Krapcho M., Miller D., Bishop K., Kosary CL, Yu M., Ruhl J., Tatalovich Z., Mariotto A., Lewis DR, și colab., Editori. Seer Cancer Statistics Review, 1975–2014, Institutul Național al Cancerului. Bethesda, md. [(accesat la 1 august 2020)];Disponibil online: Https://seer.Cancer.Gov/csr/1975_2014/11. Weidle UH, Birzele F., Kollmorgen G., Rueger R. Mecanisme și ținte implicate în diseminarea cancerului ovarian. Genomul cancerului. Proteom. 2016; 13 : 407–423. doi: 10.21873 / cgp.20004. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Aghajanian C., Blank SV, Goff BA, Judson PL, Teneriello MG, Husain A., Sovak MA, Yi J., Nycum LR Oceans: Un studiu randomizat, dublu-orb, controlat cu placebo, de fază III, de chimioterapie cu sau fără bevacizumab la pacienții cu cancer ovarian epitelial recurent sensibil la platină, peritoneal primar sau cancer al trompelor uterine. J. Clin. Oncol. 2012; 30 : 2039–2045. doi: 10.1200 / JCO.2012.42.0505. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Coleman RL, Brady MF, Herzog TJ, Sabbatini P., Armstrong DK, Walker JL, Kim BG, Fujiwara K., Tewari KS, O’Malley DM și colab. Chimioterapie cu bevacizumab și paclitaxel-carboplatină și citoreducție secundară în cancerul ovarian recurent, sensibil la platină (nrg studiu de grup oncologie / oncologie ginecologică gog-0213): Un studiu multicentric, deschis, randomizat, de fază 3. Lancet Oncol. 2017; 18 : 779–791. doi: 10.1016 / S1470-2045 (17) 30279-6. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Mirza MR, Monk BJ, Herrstedt J., Oza AM, Mahner S., Redondo A., Fabbro M., Ledermann JA, Lorusso D., Vergote I., și colab. Terapia de întreținere cu niraparib în cancerul ovarian recurent sensibil la platină. N. Engl. J. Med. 2016; 375 : 2154–2164. doi: 10.1056 / NEJMoa1611310. [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Coleman RL, Oza AM, Lorusso D., Aghajanian C., Oaknin A., Dean A., Colombo N., Weberpals JI, Clamp A., Scambia G., și colab. Tratamentul de întreținere cu Rucaparib pentru carcinomul ovarian recurent după răspunsul la terapia cu platină (ariel3): Un studiu randomizat, dublu-orb, controlat cu placebo, de fază 3. Lancet. 2017; 390 : 1949–1961. doi: 10.1016 / S0140-6736 (17) 32440-6. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Pujade-Lauraine E., Ledermann JA, Selle F., Gebski V., Penson RT, Oza AM, Korach J., Huzarski T., Poveda A., Pignata S., și colab. Comprimatele de Olaparib ca terapie de întreținere la pacienții cu cancer ovarian recidivat cu platină și mutație brca1 / 2 (solo2 / engot-ov21): un studiu dublu-orb, randomizat, controlat cu placebo, de fază 3. Lancet Oncol. 2017; 18 : 1274–1284. doi: 10.1016 / S1470-2045 (17) 30469-2. [ PubMed ] [ CrossRef ] [ Google Scholar ]17. Armando RG, Mengual Gomez DL, Gomez DE Noile medicamente nu sunt suficiente repoziționarea medicamentelor în oncologie: o actualizare. Int. J. Oncol. 2020; 56 : 651-684. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]18. Ashburn TT, Thor KB Repoziționarea medicamentelor: identificarea și dezvoltarea de noi utilizări pentru medicamentele existente. Nat. Rev. Drug Discov. 2004; 3 : 673-683. doi: 10.1038 / nrd1468. [ PubMed ] [ CrossRef ] [ Google Scholar ]19. Bertolini F., Sukhatme VP, Bouche G. Reutilizarea medicamentelor în oncologie – oportunități pentru pacienți și sisteme de sănătate. Nat. Pr. Clin. Oncol. 2015; 12 : 732–742. doi: 10.1038 / nrclinonc.2015.169. [ PubMed ] [ CrossRef ] [ Google Scholar ]20. Nowak-Sliwinska P., Scapozza L., Ruiz IAA Reutilizarea medicamentelor în oncologie: compuși, căi, fenotipuri și abordări computaționale pentru cancerul colorectal. Biochim. Biofizi. Acta Rev. Cancer. 2019; 1871 : 434-454. doi: 10.1016 / j.bbcan.2019.04.005. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Gunjan S., Sharma T., Yadav K., Chauhan BS, Singh SK, Siddiqi MI, Tripathi R. Derivați de artemisinină și trioxan sintetic declanșează moartea celulelor apoptotice în stadii asexuale ale plasmodiumului. Față. Infectează celula. Microbiol. 2018; 8 : 256. doi: 10.3389 / fcimb.2018.00256. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Goldstein JL, Brown MS Reglementarea căii mevalonate. Natură. 1990; 343 : 425-430. doi: 10.1038 / 343425a0. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Kaitin KI, DiMasi JA Inovație farmaceutică în secolul 21: noi aprobări de medicamente în primul deceniu, 2000-2009. Clin. Farmacol. Ther. 2011; 89 : 183–188. doi: 10.1038 / clpt.2010.286. [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Schachter M. Proprietățile chimice, farmacocinetice și farmacodinamice ale statinelor: o actualizare. Fundam. Clin. Farmacol. 2005; 19 : 117–125. doi: 10.1111 / j.1472-8206.2004.00299.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Padhy BM, Gupta YK Repoziționarea medicamentelor: Reinvestigarea medicamentelor existente pentru noi indicații terapeutice. J. Postgrad. Med. 2011; 57 : 153-160. doi: 10.4103 / 0022-3859.81870. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Akinwunmi B., Vitonis AF, Titus L., Terry KL, Cramer DW Statin terapia și asocierea cu riscul de cancer ovarian în studiul de control al cazului din Noua Anglie (nec). Int. J. Rac. 2019; 144 : 991–1000. doi: 10.1002 / ijc.31758. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davies JT, Delfino SF, Feinberg CE, Johnson MF, Nappi VL, Olinger JT, Schwab AP, Swanson HI Utilizările actuale și emergente ale statinelor în terapeutica clinică: o revizuire. Perspective lipidice. 2016; 9 : 13–29. doi: 10.4137 / LPI.S37450. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Knickelbine T., Lui M., Garberich R., Miedema MD, Strauss C., VanWormer JJ Hipercolesterolemia familială într-o populație ambulatorie mare: utilizarea statinelor, tratamentul optim și identificarea terapiilor medicale avansate. J. Clin. Lipidol. 2016; 10 : 1182–1187. doi: 10.1016 / j.jacl.2016.05.007. [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Pletcher MJ, Pignone M., Jarmul JA, Moran AE, Vittinghoff E., Newman T. Impactul populației și eficiența prescrierii statinelor orientate spre beneficiu față de risc pentru prevenirea primară a bolilor cardiovasculare. J. Am. Inimă conf. Univ. 2017; 6 : e004316. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]30. Fernandez-Sauze S., Grall D., Cseh B., Van Obberghen-Schilling E. Reglarea ansamblului matricei de fibronectină și morfogeneza capilară în celulele endoteliale de către gtpazele familiei rho. Exp. Rez. Celulare 2009; 315 : 2092–2104. doi: 10.1016 / j.yexcr.2009.03.017. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Mizuno Y., Jacob RF, Mason RP Inflamarea și dezvoltarea aterosclerozei. J. Ateroscler. Tromb. 2011; 18 : 351–358. doi: 10.5551 / jat.7591. [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Spuul P., Ciufici P., Veillat V., Leclercq A., Daubon T., Kramer IJ, Genot E. Importanța rhogtpazelor în formarea, caracteristicile și funcțiile invadosomilor. GTPaze mici. 2014; 5 : e28195. doi: 10.4161 / sgtp.28713. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Zeybek B., Costantine M., Kilic GS, Borahay MA Roluri terapeutice ale statinelor în ginecologie și obstetrică: dovezile actuale. Reprod. Știință. 2018; 25 : 802–817. doi: 10.1177 / 1933719117750751. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Clendening JW, Pandyra A., Boutros PC, El Ghamrasni S., Khosravi F., Trentin GA, Martirosyan A., Hakem A., Hakem R., Jurisica I., și colab. Disregularea căii mevalonate favorizează transformarea. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 2010; 107 : 15051-15056. doi: 10.1073 / pnas.0910258107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Martirosyan A., Clendening JW, Goard CA, Penn LZ Lovastatin induce apoptoza celulelor cancerului ovarian și se sinergizează cu doxorubicina: relevanță terapeutică potențială. Cancer BMC. 2010; 10 : 103. doi: 10.1186 / 1471-2407-10-103. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Robinson E., Nandi M., Wilkinson LL, Arrowsmith DM, Curtis AD, Richardson A. Evaluarea preclinică a statinelor ca tratament pentru cancerul ovarian. Ginecol. Oncol. 2013; 129 : 417-424. doi: 10.1016 / j.ygyno.2013.02.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Wong WW, Dimitroulakos J., Minden MD, Penn LZ Hmg-coa reductază inhibitori și celula malignă: familia statinelor de medicamente ca factori declanșatori ai apoptozei tumorale specifice. Leucemie. 2002; 16 : 508–519. doi: 10.1038 / sj.leu.2402476. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Jones HM, Fang Z., Sun W., Clark LH, Stine JE, Tran AQ, Sullivan SA, Gilliam TP, Zhou C., Bae-Jump VL Atorvastatin prezintă efecte anti-tumorigenice și anti-metastatice în cancerul ovarian în vitro. A.m. J. Cancer Res. 2017; 7 : 2478–2490. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]39. Pich C., Teiti I., Rochaix P., Mariame B., Couderc B., Favre G., Tilkin-Mariame AF Statins reduc dezvoltarea melanomului și metastaza prin supraexprimarea micii. Față. Immunol. 2013; 4 : 62. doi: 10.3389 / fimmu.2013.00062. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]40. Kidera Y., Tsubaki M., Yamazoe Y., Shoji K., Nakamura H., Ogaki M., Satou T., Itoh T., Isozaki M., Kaneko J., și colab. Reducerea metastazei pulmonare, a invaziei celulare și a aderenței în melanomul șoarecelui prin blocarea indusă de statină a căii protein kinazei care conține bobine înfășurate rho / rho. J. Exp. Clin. Cancer Res. 2010; 29 : 127. doi: 10.1186 / 1756-9966-29-127. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]41. Liu H., Wang Z., Li Y., Li W., Chen Y. Simvastatin previne proliferarea și metastazele osoase ale adenocarcinomului pulmonar in vitro și in vivo. Neoplasma. 2013; 60 : 240–246. doi: 10.4149 / neo_2013_032. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Yu X., Luo Y., Zhou Y., Zhang Q., Wang J., Wei N., Mi M., Zhu J., Wang B., Chang H., și colab. Supraexpresia Brca1 sensibilizează celulele canceroase la lovastatină prin reglarea căii ciclinei d1-cdk4-p21waf1 / cip1: analizează folosind o linie celulară de cancer de sân și un model de xenogrefă tumorală. Int. J. Oncol. 2008; 33 : 555-563. doi: 10.3892 / ijo_00000040. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Cao Z., Fan-Minogue H., Bellovin DI, Yevtodiyenko A., Arzeno J., Yang Q., Gambhir SS, Felsher DW Myc fosforilarea, activarea și potențialul tumorigenic în carcinomul hepatocelular sunt reglementate de hmg-coa reductază . Cancer Res. 2011; 71 : 2286-2297. doi: 10.1158 / 0008-5472.CAN-10-3367. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Sassano A., Statinele Platanias LC în supresia tumorii. Rac Lett. 2008; 260 : 11-19. doi: 10.1016 / j.canlet.2007.11.036. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Greenaway JB, Virtanen C., Osz K., Revay T., Hardy D., Shepherd T., DiMattia G., Petrik J. Creșterea tumorii ovariene este caracterizată prin semnarea genei căii mevalonate într-un model ortotopic, simgenic al epitelialului. cancer ovarian. Oncotarget. 2016; 7 : 47343–47365. doi: 10.18632 / oncotarget.10121. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]46. Kobayashi Y., Kashima H., Wu RC, Jung JG, Kuan JC, Gu J., Xuan J., Sokoll L., Visvanathan K., Shih Ie M., și colab. Antagonistul căii Mevalonat suprimă formarea de carcinom intraepitelial tubar seros și carcinom ovarian la modelele de șoareci. Clin. Cancer Res. 2015; 21 : 4652–4662. doi: 10.1158 / 1078-0432.CCR-14-3368. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Stine JE, Guo H., Sheng X., Han X., Schointuch MN, Gilliam TP, Gehrig PA, Zhou C., Bae-Jump VL. efecte tumorigene în cancerul ovarian. Oncotarget. 2016; 7 : 946–960. doi: 10.18632 / oncotarget.5834. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]48. Cuello FM, Kato SC, Díaz SD, Owen G. Efectele statinelor în cancer. Pr. Med. Chil. 2013; 141 : 227–236. [ PubMed ] [ Google Scholar ]49. Laezza C., Malfitano AM, Proto MC, Esposito I., Gazzerro P., Formisano P., Pisanti S., Santoro A., Caruso MG, Bifulco M. Inhibition of 3-hydroxy-3-methylglutaryl-coenzyme a activitatea reductazei și a farnesilării ras mediază efectele antitumorale ale anandamidei în celulele cancerului de sân uman. Endocr. Relat. Cancer. 2010; 17 : 495-503. doi: 10.1677 / ERC-10-0009. [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Horiuchi A., Kikuchi N., Osada R., Wang C., Hayashi A., Nikaido T., Konishi I. Supraexprimarea rhoa îmbunătățește diseminarea peritoneală: supresia rhoa cu lovastatină poate fi utilă pentru cancerul ovarian. Știința cancerului. 2008; 99 : 2532–2539. doi: 10.1111 / j.1349-7006.2008.00977.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]51. Liu H., Liang SL, Kumar S., Weyman CM, Liu W., Zhou A. Statinele induc apoptoza în celulele cancerului ovarian prin activarea jnk și îmbunătățirea expresiei bim. Cancer Chemother. Farmacol. 2009; 63 : 997–1005. doi: 10.1007 / s00280-008-0830-7. [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Matsuura M., Suzuki T., Suzuki M., Tanaka R., Ito E., Saito T. Reducerea mediată de statină a expresiei osteopontinei induce apoptoza și stoparea creșterii celulare în carcinomul ovarian clar. Oncol. Rep. 2011; 25 : 41–47. doi: 10.3892 / or_00001039. [ PubMed ] [ CrossRef ] [ Google Scholar ]53. de Wolf E., Abdullah MI, Jones SM, Menezes K., Moss DM, Drijfhout FP, Hart SR, Hoskins C., Stronach EA, Richardson A. Geranylgeraniol dietetic poate limita activitatea pitavastatinei ca potențial tratament pentru medicamente -cancer ovarian rezistent. Știință. Rep. 2017; 7 : 5410. doi: 10.1038 / s41598-017-05595-4. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]54. Bischof K., Knappskog S., Hjelle SM, Stefansson I., Woie K., Salvesen HB, Gjertsen BT, Bjorge L. Influența expresiei izoformei p53 asupra supraviețuirii în cancerele ovariene seroase de grad înalt. Știință. Rep. 2019; 9 : 5244. doi: 10.1038 / s41598-019-41706-z. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Kandoth C., McLellan MD, Vandin F., Ye K., Niu B., Lu C., Xie M., Zhang Q., McMichael JF, Wyczalkowski MA și colab. Peisaj mutațional și semnificație în cele 12 tipuri majore de cancer. Natură. 2013; 502 : 333–339. doi: 10.1038 / nature12634. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Patch AM, Christie EL, Etemadmoghadam D., Garsed DW, George J., Fereday S., Nones K., Cowin P., Alsop K., Bailey PJ și colab. Caracterizarea genomului întreg al cancerului ovarian chemoresistant. Natură. 2015; 521 : 489–494. doi: 10.1038 / nature14410. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Brennan DJ, Brandstedt J., Rexhepaj E., Foley M., Ponten F., Uhlen M., Gallagher WM, O’Connor DP, O’Herlihy C., Jirstrom K. Tumor-specific hmg-coar is a predictor independent al supraviețuirii fără recurență în cancerul ovarian epitelial. Cancer BMC. 2010; 10 : 125. doi: 10.1186 / 1471-2407-10-125. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Xie W., Ning L., Huang Y., Liu Y., Zhang W., Hu Y., Lang J., Yang J. Utilizarea statinei și rezultatele supraviețuirii în cancerele ginecologice endocrine: o revizuire sistematică și meta -analiză. Oncotarget. 2017; 8 : 41508-41517. doi: 10.18632 / oncotarget.17242. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Li X., Zhou J. Impactul utilizării statinelor postdiagnostice asupra mortalității prin cancer ovarian: o analiză sistematică și meta-analiză a studiilor observaționale. Fr. J. Clin. Farmacol. 2018; 84 : 1109–1120. doi: 10.1111 / bcp.13559. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Urpilainen E., Marttila M., Hautakoski A., Arffman M., Sund R., Ilanne-Parikka P., Arima R., Kangaskokko J., Puistola U., Laara E., și colab. Rolul metforminei și statinelor în incidența cancerului ovarian epitelial în diabetul de tip 2: un studiu de cohortă și caz-control imbricat. BJOG. 2018; 125 : 1001–1008. doi: 10.1111 / 1471-0528.15151. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Nielsen SF, Nordestgaard BG, Bojesen SE Statin utilizarea și reducerea mortalității legate de cancer. N. Engl. J. Med. 2012; 367 : 1792–1802. doi: 10.1056 / NEJMoa1201735. [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Couttenier A., ​​Lacroix O., Vaes E., Cardwell CR, De Schutter H., Robert A. Utilizarea statinei este asociată cu o supraviețuire îmbunătățită în cancerul ovarian: un studiu retrospectiv bazat pe populație. Plus unu. 2017; 12 : e0189233. doi: 10.1371 / journal.pone.0189233. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]63. Graaf MR, Beiderbeck AB, Egberts AC, Richel DJ, Guchelaar HJ Riscul de cancer la utilizatorii de statine. J. Clin. Oncol. 2004; 22 : 2388–2394. doi: 10.1200 / JCO.2004.02.027. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Smith A., Murphy L., Zgaga L., Barron TI, Bennett K. Utilizarea statinică pre-diagnosticată, starea ganglionilor limfatici și mortalitatea la femeile cu stadii i-iii de cancer mamar. Fr. J. Rac. 2017; 117 : 588-596. doi: 10.1038 / bjc.2017.227. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]65. Cardwell CR, Hicks BM, Hughes C., Murray LJ Statin utilizează după diagnosticul și supraviețuirea cancerului colorectal: Un studiu de cohortă bazat pe populație. J. Clin. Oncol. 2014; 32 : 3177-3183. doi: 10.1200 / JCO.2013.54.4569. [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Yu O., Eberg M., Benayoun S., Aprikian A., Batist G., Suissa S., Azoulay L. Utilizarea statinelor și riscul de deces la pacienții cu cancer de prostată. J. Clin. Oncol. 2014; 32 : 5-11. doi: 10.1200 / JCO.2013.49.4757. [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Vogel TJ, Goodman MT, Li AJ, Jeon CY Tratamentul cu statină este asociat cu supraviețuirea la o populație reprezentativă la nivel național a femeilor în vârstă cu cancer ovarian epitelial. Ginecol. Oncol. 2017; 146 : 340-345. doi: 10.1016 / j.ygyno.2017.05.009. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Knox JJ, Siu LL, Chen E., Dimitroulakos J., Kamel-Reid S., Moore MJ, Chin S., Irish J., LaFramboise S., Oza AM Un studiu de fază i cu administrare prelungită de lovastatină la pacienți cu carcinom cu celule scuamoase recurente sau metastatice al capului și gâtului sau al colului uterin. Euro. J. Rac. 2005; 41 : 523–530. doi: 10.1016 / j.ejca.2004.12.013. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kornblau SM, Banker DE, Stirewalt D., Shen D., Lemker E., Verstovsek S., Estrov Z., Faderl S., Cortes J., Beran M., și colab. Blocarea modificărilor defensive adaptive în absorbția și sinteza colesterolului în aml prin adăugarea de pravastatină la idarubicină + doză mare de ara-c: un studiu de fază 1. Sânge. 2007; 109 : 2999–3006. doi: 10.1182 / blood-2006-08-044446. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Minden MD, Dimitroulakos J., Nohynek D., Penn LZ Lovastatin a indus controlul creșterii celulelor blastice la un pacient în vârstă cu leucemie mieloblastică acută. Leuk. Limfom. 2001; 40 : 659-662. doi: 10.3109 / 10428190109097663. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Schmidmaier R., Baumann P., Bumeder I., Meinhardt G., Straka C., Emmerich B. Prima experiență clinică cu simvastatină pentru a depăși rezistența la medicamente în mielomul multiplu refractar. Euro. J. Haematol. 2007; 79 : 240–243. doi: 10.1111 / j.1600-0609.2007.00902.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]72. Van der Spek E., Bloem AC, van de Donk NW, Bogers LH, van der Griend R., Kramer MH, de Weerdt O., Wittebol S., Lokhorst HM Studiu de constatare a dozei de simvastatină cu doze mari combinat cu chimioterapie standard la pacienții cu mielom sau limfom recidivant sau refractar. Haematologica. 2006; 91 : 542–545. [ PubMed ] [ Google Scholar ]73. Cusi K., Consoli A., DeFronzo RA Efectele metabolice ale metforminei asupra metabolismului glucozei și lactatului în diabetul zaharat noninsulin-dependent. J. Clin. Endocrinol. Metab. 1996; 81 : 4059–4067. [ PubMed ] [ Google Scholar ]74. Mues C., Zhou J., Manolopoulos KN, Korsten P., Schmoll D., Klotz LO, Bornstein SR, Klein HH, Barthel A. Reglarea expresiei genei glucozei-6-fosfatazei prin insulină și metformină. Horm. Metab. Rez. 2009; 41 : 730–735. doi: 10.1055 / s-0029-1225360. [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Stephenne X., Foretz M., Taleux N., van der Zon GC, Sokal E., Hue L., Viollet B., Guigas B. Metformina activează proteina kinază activată de amplificator în hepatocitele umane primare prin scăderea stării energiei celulare . Diabetologia. 2011; 54 : 3101–3110. doi: 10.1007 / s00125-011-2311-5. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Viollet B., Guigas B., Sanz Garcia N., Leclerc J., Foretz M., Andreelli F. Mecanisme celulare și moleculare ale metforminei: O privire de ansamblu. Clin. Știință. 2012; 122 : 253–270. doi: 10.1042 / CS20110386. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Lee JO, Lee SK, Kim JH, Kim N., You GY, Moon JW, Kim SJ, Park SH, Kim HS Metformina reglează translocarea transportorului de glucoză 4 (glut4) prin cbl mediate de proteină kinază activată (ampk) / semnalizare capac în celule preadipocite 3t3-l1. J. Biol. Chem. 2012; 287 : 44121–44129. doi: 10.1074 / jbc.M112.361386. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Wheaton WW, Weinberg SE, Hamanaka RB, Soberanes S., Sullivan LB, Anso E., Glasauer A., ​​Dufour E., Mutlu GM, Budigner GS și colab. Metformina inhibă complexul mitocondrial i al celulelor canceroase pentru a reduce tumorogeneza. Elife. 2014; 3 : e02242. doi: 10.7554 / eLife.02242. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Pernicova I., Korbonits M. Metformin – mod de acțiune și implicații clinice pentru diabet și cancer. Nat. Pr. Endocrinol. 2014; 10 : 143–156. doi: 10.1038 / nrendo.2013.256. [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Pollak M. Insulina și familia receptorilor factorilor de creștere asemănători insulinei în neoplazie: o actualizare. Nat. Pr. Rac. 2012; 12 : 159–169. doi: 10.1038 / nrc3215. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Pollak MN Investigarea metforminei pentru prevenirea și tratamentul cancerului: sfârșitul începutului. Cancer Discov. 2012; 2 : 778–790. doi: 10.1158 / 2159-8290.CD-12-0263. [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Moiseeva O., Deschenes-Simard X., Pollak M., Ferbeyre G. Metformin, îmbătrânirea și cancerul. Îmbătrânirea Albany NY. 2013; 5 : 330–331. doi: 10.18632 / aging.100556. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]83. Pearce EL, Walsh MC, Cejas PJ, Harms GM, Shen H., Wang LS, Jones RG, Choi Y. Îmbunătățirea memoriei celulelor t cd8 prin modularea metabolismului acizilor grași. Natură. 2009; 460 : 103–107. doi: 10.1038 / nature08097. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Shaw RJ, Bardeesy N., Manning BD, Lopez L., Kosmatka M., DePinho RA, Cantley LC Supresorul tumorii lkb1 reglează negativ semnalizarea mtor. Celula cancerului. 2004; 6 : 91–99. doi: 10.1016 / j.ccr.2004.06.007. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Zakikhani M., Dowling RJ, Sonenberg N., Pollak MN Efectele adiponectinei și metforminei asupra neoplaziei de prostată și colon implică activarea proteinei kinazei activate de amplificator. Cancer Prev. Rez. 2008; 1 : 369-375. doi: 10.1158 / 1940-6207.CAPR-08-0081. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Lengyel E., Litchfield LM, Mitra AK, Nieman KM, Mukherjee A., Zhang Y., Johnson A., Bradaric M., Lee W., Romero IL Metformin inhibă creșterea cancerului ovarian și crește sensibilitatea la paclitaxel la modelele de șoarece . A.m. J. Obstet. Ginecol. 2015; 212 : 479.e1–479.e10. doi: 10.1016 / j.ajog.2014.10.026. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Liu X., Romero IL, Litchfield LM, Lengyel E., Locasale JW Metformin vizează metabolismul central al carbonului și dezvăluie cerințele mitocondriale în cancerele umane. Cell Metab. 2016; 24 : 728–739. doi: 10.1016 / j.cmet.2016.09.005. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]88. Gui DY, Sullivan LB, Luengo A., Hosios AM, Bush LN, Gitego N., Davidson SM, Freinkman E., Thomas CJ, Vander Heiden MG Environment dictează dependența de complexul mitocondrial i pentru producția de nad + și aspartat și determină cancerul sensibilitatea celulelor la metformină. Cell Metab. 2016; 24 : 716–727. doi: 10.1016 / j.cmet.2016.09.006. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]89. Kurelac I., Umesh Ganesh N., Iorio M., Porcelli AM, Gasparre G. Efectele multiforme ale metforminei asupra microambientului tumorii. Semin. Cell Dev. Biol. 2020; 98 : 90–97. doi: 10.1016 / j.semcdb.2019.05.010. [ PubMed ] [ CrossRef ] [ Google Scholar ]90. Li X., Li B., Ni Z., Zhou P., Wang B., He J., Xiong H., Yang F., Wu Y., Lyu X. și colab. Metformina face sinergie cu inhibitorul bcl-xl / bcl-2 abt-263 pentru a induce apoptoza în mod specific în celulele canceroase defecte p53. Mol. Cancer Ther. 2017; 16 : 1806–1818. doi: 10.1158 / 1535-7163.MCT-16-0763. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Galdieri L., Gatla H., Vancurova I., Vancura A. Activarea proteinei kinazei amplificate de metformină induce acetilarea proteinelor în celulele cancerului de prostată și ovarian. J. Biol. Chem. 2016; 291 : 25154–25166. doi: 10.1074 / jbc.M116.742247. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]92. Rattan R., Giri S., Hartmann LC, Shridhar V. Metformina atenuează creșterea celulelor cancerului ovarian într-o manieră dispensabilă de amp-kinază. J. Cell. Mol. Med. 2011; 15 : 166–178. doi: 10.1111 / j.1582-4934.2009.00954.x. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]93. Xie Y., Peng Z., Shi M., Ji M., Guo H., Shi H. Metformina combinată cu inhibitorul p38 mapk îmbunătățește sensibilitatea la cisplatină în cancerul ovarian rezistent la cisplatină. Mol. Med. Rep. 2014; 10 : 2346–2350. doi: 10.3892 / mmr.2014.2490. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]94. Zhang R., Zhang P., Wang H., Hou D., Li W., Xiao G., Li C. Efecte inhibitorii ale metforminei la concentrație scăzută asupra tranziției epiteliale-mezenchimale a cd44 (+) cd117 (+) celulele stem ale cancerului ovarian. Celulă stem. Rez. Ther. 2015; 6 : 262. doi: 10.1186 / s13287-015-0249-0. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]95. Yang C., Zhao N., Li D., Zou G., Chen Y. Metformina îmbunătățește sensibilitatea celulelor cancerului ovarian la agenții chimioterapeutici. Oncol. Lett. 2019; 18 : 2404–2411. doi: 10.3892 / ol.2019.10564. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]96. Du J., Shi HR, Ren F., Wang JL, Wu QH, Li X., Zhang RT Inhibarea căii de semnalizare igf inversează rezistența la cisplatină în celulele cancerului ovarian. Cancer BMC. 2017; 17 : 851. doi: 10.1186 / s12885-017-3840-1. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]97. Gotlieb WH, Saumet J., Beauchamp MC, Gu J., Lau S., Pollak MN, Bruchim I. Activitatea anti-neoplazică a metforminei in vitro în cancerul ovarian epitelial. Ginecol. Oncol. 2008; 110 : 246–250. doi: 10.1016 / j.ygyno.2008.04.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]98. Liu Y., Feng Y., Liu H., Wu J., Tang Y., Wang Q. Evaluarea în timp real a sensibilității la platină a culturii primare de la un pacient cu cancer ovarian cu metastază extinsă și efectul de îmbunătățire a sensibilității la platină de metformin. Oncol. Lett. 2018; 16 : 4253-4262. doi: 10.3892 / ol.2018.9223. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]99. Rattan R., Graham RP, Maguire JL, Giri S., Shridhar V. Metformina suprimă creșterea și metastaza cancerului ovarian cu îmbunătățirea citotoxicității cisplatinei in vivo. Neoplazie. 2011; 13 : 483–491. doi: 10.1593 / neo.11148. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]100. Wu B., Li S., Sheng L., Zhu J., Gu L., Shen H., La D., Hambly BD, Bao S., Di W. Metformin inhibă dezvoltarea și metastaza cancerului ovarian. Oncol. Rep. 2012; 28 : 903–908. doi: 10.3892 / or.2012.1890. [ PubMed ] [ CrossRef ] [ Google Scholar ]101. Yasmeen A., Beauchamp MC, Piura E., Segal E., Pollak M., Gotlieb WH Inducerea apoptozei de metformină în cancerul ovarian epitelial: Implicarea proteinelor familiei bcl-2. Ginecol. Oncol. 2011; 121 : 492–498. doi: 10.1016 / j.ygyno.2011.02.021. [ PubMed ] [ CrossRef ] [ Google Scholar ]102. Patel S., Kumar L., Singh N. Metformin și terapie pentru cancerul ovarian epitelial. Celula. Oncol. 2015; 38 : 365–375. doi: 10.1007 / s13402-015-0235-7. [ PubMed ] [ CrossRef ] [ Google Scholar ]103. Shank JJ, Yang K., Ghannam J., Cabrera L., Johnston CJ, Reynolds RK, Buckanovich RJ Metformin vizează celulele stem ale cancerului ovarian in vitro și in vivo. Ginecol. Oncol. 2012; 127 : 390–397. doi: 10.1016 / j.ygyno.2012.07.115. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]104. Dang JH, Jin ZJ, Liu XJ, Hu D., Wang J., Luo Y., Li LL Metformin în combinație cu cisplatin inhibă viabilitatea celulară și induce apoptoza celulelor cancerului ovarian uman prin inactivarea erk 1/2. Oncol. Lett. 2017; 14 : 7557-7564. doi: 10.3892 / ol.2017.7176. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]105. Hijaz M., Chhina J., Mert I., Taylor M., Dar S., Al-Wahab Z., Ali-Fehmi R., Buekers T., Munkarah AR, Rattan R. Evaluarea preclinică a olaparibului și metforminei combinație în cancerul ovarian de tip sălbatic brca1. Ginecol. Oncol. 2016; 142 : 323–331. doi: 10.1016 / j.ygyno.2016.06.005. [ PubMed ] [ CrossRef ] [ Google Scholar ]106. Franciosi M., Lucisano G., Lapice E., Strippoli GF, Pellegrini F., Nicolucci A. Terapia cu metformină și riscul de cancer la pacienții cu diabet de tip 2: revizuire sistematică. Plus unu. 2013; 8 : e71583. doi: 10.1371 / journal.pone.0071583. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]107. Noto H., Goto A., Tsujimoto T., Noda M. Riscul de cancer la pacienții diabetici tratați cu metformină: o revizuire sistematică și meta-analiză. Plus unu. 2012; 7 : e33411. doi: 10.1371 / journal.pone.0033411. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]108. Chu D., Wu J., Wang K., Zhao M., Wang C., Li L., Guo R. Efectul utilizării metforminei asupra riscului și prognosticului cancerului endometrial: o revizuire sistematică și meta-analiză. Cancer BMC. 2018; 18 : 438. doi: 10.1186 / s12885-018-4334-5. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]109. Hanna RK, Zhou C., Malloy KM, Sun L., Zhong Y., Gehrig PA, Bae-Jump VL Metformina potențează efectele paclitaxelului în celulele canceroase endometriale prin inhibarea proliferării celulare și modularea căii mtor. Ginecol. Oncol. 2012; 125 : 458–469. doi: 10.1016 / j.ygyno.2012.01.009. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]110. Bodmer M., Becker C., Meier C., Jick SS, Meier CR Utilizarea metforminei și riscul de cancer ovarian: o analiză caz-control. Ginecol. Oncol. 2011; 123 : 200–204. doi: 10.1016 / j.ygyno.2011.06.038. [ PubMed ] [ CrossRef ] [ Google Scholar ]111. Dilokthornsakul P., Chaiyakunapruk N., Termrungruanglert W., Pratoomsoot C., Saokaew S., Sruamsiri R. Efectele metforminei asupra cancerului ovarian: o revizuire sistematică. Int. J. Gynecol. Cancer. 2013; 23 : 1544–1551. doi: 10.1097 / IGC.0b013e3182a80a21. [ PubMed ] [ CrossRef ] [ Google Scholar ]112. Romero IL, McCormick A., McEwen KA, Park S., Karrison T., Yamada SD, Pannain S., Lengyel E. Relația utilizării diabetului de tip II și a metforminei cu progresia, supraviețuirea și chimiosensibilitatea cancerului ovarian. Obstet. Ginecol. 2012; 119 : 61–67. doi: 10.1097 / AOG.0b013e3182393ab3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]113. Shi J., Liu B., Wang H., Zhang T., Yang L. Asocierea utilizării metforminei cu incidența și prognosticul cancerului ovarian: O analiză sistematică și meta-analiză. Int. J. Gynecol. Cancer. 2019; 29 : 140–146. doi: 10.1136 / ijgc-2018-000060. [ PubMed ] [ CrossRef ] [ Google Scholar ]114. Wang SB, Lei KJ, Liu JP, Jia YM Utilizarea continuă a metforminei poate îmbunătăți supraviețuirea la pacienții diabetici de tip 2 cu cancer ovarian: Un studiu retrospectiv. Medicament. 2017; 96 : e7605. doi: 10.1097 / MD.0000000000007605. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]115. Kumar S., Meuter A., ​​Thapa P., Langstraat C., Giri S., Chien J., Rattan R., Cliby W., Shridhar V. Aportul de metformină este asociat cu o supraviețuire mai bună în cancerul ovarian: un caz -studiu de control. Cancer. 2013; 119 : 555-562. doi: 10.1002 / cncr.27706. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]116. Zhang ZJ, Li S. Valoarea prognostică a metforminei pentru pacienții cu cancer cu diabet concomitent: o analiză sistematică și meta-analiză. Obezitatea diabetului. Metab. 2014; 16 : 707–710. doi: 10.1111 / dom.12267. [ PubMed ] [ CrossRef ] [ Google Scholar ]117. Gong TT, Wu QJ, Lin B., Ruan SK, Kushima M., Takimoto M. Studii observaționale privind asocierea dintre utilizarea post-diagnostic a metforminei și supraviețuirea în cancerul ovarian: o revizuire sistematică și meta-analiză. Față. Oncol. 2019; 9 : 458. doi: 10.3389 / fonc.2019.00458. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]118. Evans JM, Donnelly LA, Emslie-Smith AM, Alessi DR, Morris AD Metformin și risc redus de cancer la pacienții cu diabet zaharat. BMJ. 2005; 330 : 1304-1305. doi: 10.1136 / bmj.38415.708634.F7. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]119. Gandini S., Puntoni M., Heckman-Stoddard BM, Dunn BK, Ford L., DeCensi A., Szabo E. Metformin și cancer și risc și mortalitate: o revizuire sistematică și meta-analiză luând în considerare prejudecățile și confuzii. Cancer Prev. Rez. 2014; 7 : 867–885. doi: 10.1158 / 1940-6207.CAPR-13-0424. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]120. Saraei P., Asadi I., Kakar MA, Moradi-Kor N. Efectele benefice ale metforminei asupra prevenirii și terapiei cancerului: o revizuire cuprinzătoare a progreselor recente. Administrarea cancerului. Rez. 2019; 11 : 3295–3313. doi: 10.2147 / CMAR.S200059. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]121. Yu H., Zhong X., Gao P., Shi J., Wu Z., Guo Z., Wang Z., Song Y. Efectul potențial al metforminei asupra cancerului: o revizuire umbrelă. Față. Endocrinol. 2019; 10 : 617. doi: 10.3389 / fendo.2019.00617. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]122. Zi F., Zi H., Li Y., He J., Shi Q., ​​Cai Z. Metformin și cancer: un medicament existent pentru prevenirea și terapia cancerului. Oncol. Lett. 2018; 15 : 683–690. doi: 10.3892 / ol.2017.7412. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]123. Bao B., Azmi AS, Ali S., Zaiem F., Sarkar FH Metformina poate funcționa ca agent anticancer prin țintirea celulelor stem canceroase: Semnificația biologică potențială a mirnelor asociate tumorii în cancerele de sân și pancreatice. Ann. Trad. Med. 2014; 2 : 59. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]124. Chae JW, Baek IH, Lee BY, Cho SK, Kwon KI Population pk / pd analysis of metformin using the signal transduction model. Fr. J. Clin. Farmacol. 2012; 74 : 815–823. doi: 10.1111 / j.1365-2125.2012.04260.x. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]125. Shackelford DB, Abt E., Gerken L., Vasquez DS, Seki A., Leblanc M., Wei L., Fishbein MC, Czernin J., Mischel PS, și colab. Inactivarea Lkb1 dictează răspunsul terapeutic al cancerului pulmonar fără celule mici la fenformina medicamentului pentru metabolism. Celula cancerului. 2013; 23 : 143–158. doi: 10.1016 / j.ccr.2012.12.008. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]126. Pierotti MA, Berrino F., Gariboldi M., Melani C., Mogavero A., Negri T., Pasanisi P., Pilotti S. Direcționarea metabolismului pentru tratamentul și prevenirea cancerului: Metformin, un medicament vechi cu efecte multifacetale . Oncogene. 2013; 32 : 1475–1487. doi: 10.1038 / onc.2012.181. [ PubMed ] [ CrossRef ] [ Google Scholar ]127. Eikawa S., Nishida M., Mizukami S., Yamazaki C., Nakayama E., Udono H. Efect antitumoral mediat imun de către medicamentul pentru diabetul de tip 2, metformin. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 2015; 112 : 1809–1814. doi: 10.1073 / pnas.1417636112. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]128. Del Barco S., Vazquez-Martin A., Cufi S., Oliveras-Ferraros C., Bosch-Barrera J., Joven J., Martin-Castillo B., Menendez JA Metformin: Multi-fateted protection against cancer. Oncotarget. 2011; 2 : 896–917. doi: 10.18632 / oncotarget.387. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]129. Brown JR, Chan DK, Shank JJ, Griffith KA, Fan H., Szulawski R., Yang K., Reynolds RK, Johnston C., McLean K., și colab. Studiu clinic de fază II a metforminei ca agent de țintire a celulelor stem de cancer în cancerul ovarian. JCI Insight. 2020; 5 : e133247. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]130. Broekman KE, Hof MAJ, Touw DJ, Gietema JA, Nijman HW, Lefrandt JD, Reyners AKL, Jalving M. Studiu de fază a metforminei în combinație cu chimioterapie carboplatină / paclitaxel la pacienții cu cancer ovarian epitelial avansat. Investi. Droguri noi. 2020; 38 : 1454–1462. doi: 10.1007 / s10637-020-00920-7. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]131. Mystakidou K., Katsouda E., Stathopoulou E., Vlahos L. Abordări pentru gestionarea metastazelor osoase din cancerul de sân: Rolul bifosfonaților. Tratamentul cancerului. Rev. 2005; 31 : 303-311. doi: 10.1016 / j.ctrv.2005.03.005. [ PubMed ] [ CrossRef ] [ Google Scholar ]132. Russell RG, Rogers MJ Bifosfonați: De la laborator la clinică și înapoi. Os. 1999; 25 : 97–106. doi: 10.1016 / S8756-3282 (99) 00116-7. [ PubMed ] [ CrossRef ] [ Google Scholar ]133. Gronich N., Rennert G. Dincolo de prevenirea aspirinei-cancerului cu statine, metformină și bifosfonați. Nat. Pr. Clin. Oncol. 2013; 10 : 625-642. doi: 10.1038 / nrclinonc.2013.169. [ PubMed ] [ CrossRef ] [ Google Scholar ]134. Muinelo-Romay L., Garcia D., Alonso-Alconada L., Vieito M., Carmona M., Martinez N., Aguin S., Abal M., Lopez-Lopez R. Acid zoledronic ca agent antimetastatic pentru diferite linii de celule tumorale umane. Anticancer Res. 2013; 33 : 5295–5300. [ PubMed ] [ Google Scholar ]135. Yuasa T., Kimura S., Ashihara E., Habuchi T., Maekawa T. Acid zoledronic – o multitudine de acțiuni anti-cancer. Curr. Med. Chem. 2007; 14 : 2126–2135. doi: 10.2174 / 092986707781389600. [ PubMed ] [ CrossRef ] [ Google Scholar ]136. Gnant M., Mlineritsch B., Schippinger W., Luschin-Ebengreuth G., Postlberger S., Menzel C., Jakesz R., Seifert M., Hubalek M., Bjelic-Radisic V., și colab. Terapia endocrină plus acidul zoledronic în cancerul de sân premenopauzal. N. Engl. J. Med. 2009; 360 : 679-691. doi: 10.1056 / NEJMoa0806285. [ PubMed ] [ CrossRef ] [ Google Scholar ]137. Coleman RE, Winter MC, Cameron D., Bell R., Dodwell D., Keane MM, Gil M., Ritchie D., Passos-Coelho JL, Wheatley D., și colab. Efectele adăugării acidului zoledronic la chimioterapia neoadjuvantă asupra răspunsului tumoral: dovezi exploratorii pentru activitatea antitumorală directă în cancerul de sân. Fr. J. Rac. 2010; 102 : 1099-1105. doi: 10.1038 / sj.bjc.6605604. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]138. Bosch-Barrera J., Merajver SD, Menendez JA, Van Poznak C. Activitatea antitumorală directă a acidului zoledronic: date preclinice și clinice. Clin. Trad. Oncol. 2011; 13 : 148–155. doi: 10.1007 / s12094-011-0634-9. [ PubMed ] [ CrossRef ] [ Google Scholar ]139. Senaratne SG, Colston KW Efecte directe ale bifosfonaților asupra celulelor cancerului de sân. Cancerul de sân Res. 2002; 4 : 18–23. doi: 10.1186 / bcr412. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]140. Dumon JC, Journe F., Kheddoumi N., Lagneaux L., Body JJ Efectele citostatice și apoptotice ale bifosfonaților asupra celulelor canceroase de prostată. Euro. Urol. 2004; 45 : 521-528. doi: 10.1016 / j.eururo.2003.12.012. discuția 528-529. [ PubMed ] [ CrossRef ] [ Google Scholar ]141. Sawada K., Morishige K., Tahara M., Kawagishi R., Ikebuchi Y., Tasaka K., Murata Y. Alendronatul inhibă migrația indusă de acid lizofosfatidic a celulelor cancerului ovarian uman prin atenuarea activării rho. Cancer Res. 2002; 62 : 6015–6020. [ PubMed ] [ Google Scholar ]142. Hirata J., Kikuchi Y., Kudoh K., Kita T., Seto H. Efectele inhibitoare ale bifosfonaților asupra proliferării liniilor celulare ale cancerului ovarian uman și a mecanismului. Med. Chem. 2006; 2 : 223-226. [ PubMed ] [ Google Scholar ]143. Nagasawa Y., Chen J., Hashimoto K. Proprietățile antiaritmice ale unei încărcări orale anterioare de amiodaronă în ligamentul coronarian canin in vivo / modelul aritmiei induse de reperfuzie: comparație cu alte medicamente antiaritmice de clasa III. J. Pharmacol. Știință. 2005; 97 : 393-399. doi: 10.1254 / jphs.FP0040512. [ PubMed ] [ CrossRef ] [ Google Scholar ]144. Knight LA, Kurbacher CM, Glaysher S., Fernando A., Reichelt R., Dexel S., Reinhold U., Cree IA. Cancer BMC. 2009; 9 : 38. doi: 10.1186 / 1471-2407-9-38. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]145. Karabulut B., Karaca B., Varol U., Muslu U., Cakar B., Atmaca H., Kisim A., Uzunoglu S., Uslu R. Îmbunătățirea efectului citotoxic și apoptotic în ovcar-3 și mdah-2774 celule cu acid retinoic all-trans și acid zoledronic: o paradigmă a tratamentului sinergic de țintire moleculară pentru cancerul ovarian. J. Exp. Clin. Cancer Res. 2010; 29 : 102. doi: 10.1186 / 1756-9966-29-102. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]146. Atmaca H., Gorumlu G., Karaca B., Degirmenci M., Tunali D., Cirak Y., Purcu DU, Uzunoglu S., Karabulut B., Sanli UA, și colab. Tratamentul combinat cu gossypol și acid zoledronic are ca rezultat inducerea sinergică a morții celulare și reglează moleculele angiogene din celulele cancerului ovarian. Euro. Cytokine Netw. 2009; 20 : 121–130. doi: 10.1684 / ecn.2009.0159. [ PubMed ] [ CrossRef ] [ Google Scholar ]147. Kobayashi Y., Kashima H., Rahmanto YS, Banno K., Yu Y., Matoba Y., Watanabe K., Iijima M., Takeda T., Kunitomi H., și colab. Repoziționarea medicamentului inhibitorilor căii mevalonate ca agenți antitumorali pentru cancerul ovarian. Oncotarget. 2017; 8 : 72147-72156. doi: 10.18632 / oncotarget.20046. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]148. Hashimoto K., Morishige K., Sawada K., Tahara M., Kawagishi R., Ikebuchi Y., Sakata M., Tasaka K., Murata Y. Alendronatul inhibă diseminarea intraperitoneală în modelul de cancer ovarian in vivo. Cancer Res. 2005; 65 : 540–545. [ PubMed ] [ Google Scholar ]149. Ou YJ, Chiu HF, Wong YH, Yang CC, Yang YH Utilizarea bifosfonatului și riscul de cancer mamar: o meta-analiză a studiilor observaționale. Farmacoepidemiol. Drug Saf. 2017; 26 : 1286–1295. doi: 10.1002 / pds.4302. [ PubMed ] [ CrossRef ] [ Google Scholar ]150. Ou YJ, Chiu HF, Wong YH, Yang YH Utilizarea bifosfonatului și riscul de cancer endometrial: o meta-analiză a studiilor observaționale. Farmacoepidemiol. Drug Saf. 2016; 25 : 1107–1115. doi: 10.1002 / pds.4075. [ PubMed ] [ CrossRef ] [ Google Scholar ]151. Rennert G., Rennert HS, Pinchev M., Lavie O. Efectul bifosfonaților asupra riscului apariției malignităților endometriale și ovariene. Ginecol. Oncol. 2014; 133 : 309-313. doi: 10.1016 / j.ygyno.2014.02.014. [ PubMed ] [ CrossRef ] [