Rezultatele căutări pentru: cervical

cancer cervical si vaccinare HPV

Buna ziua, ma numesc Aron Crawford. Am primit o doza de Gardasil in timp ce eram studenta si lucram la centrul de sanatate al Universității. Ei aveau contract încheiat pentru studiul, cercetarea si dezvoltarea produsului Gardasil. Am fost abordată de un specialist în sanatate din incintă  care mi-a spus:

– Știi, avem acest nou vaccin care va preveni posibilitatea sa dezvoltati cancer cervical, ai vrea să încerci?


Cu un an și jumătate, înainte de acest incident, am pierdut 3 membri apropiați, din familia mea, care au murit de cancer. Așa că acea întrebare a punctat exact frica mea, încât am spus da, sună bine. Am intrat în sala de examen și mi-au administrat injecția, apoi am continuat cu rutina din acea zi. Seara m-am întors in camera de cămin și am adormit, apoi m-am trezit în mijlocul nopții vomitand.

Eram asa de slaba ca nu puteam sa ma misc. Bratele si picioarele le simteam ca si cum ar fi cantarit 45 de tone, fiecare si ma simteam foarte rau, cu febra si…oh in cateva zile nodulii limfatici ai gatului, mai ales la ceafa se inflamasera foarte mult. Si amigdalele, in cele din urma. Cred ca trecuse o saptamana de la administrare, cand amigdalele s-au inflamat atat, incat au blocat caile respiratorii si a trebuit sa fiu dusa la camera de urgente.

De aici au pornit o serie de amigdalite (îmbolnăviri regulate) cam o dată pe luna. Lipseam câte 10 – 14 zile de la servici și facultate și am fost aproape să îmi pierd locul de muncă. Au fost 6 luni de îmbolnăviri constante și am ajus la operația de îndepărtare a amigdalelor.  Dupa acea ciclul menstrual s-a oprit total și stiam ca nu sunt însărcinată.

Am mers la analize si testele au aratat ca aveam Carcinom Neuroendocrin cervical de gradul III, sau cancer cervical de gradul 3.

Deci exact lucrul împotriva căruia am fost vacinata. Interesant este că, 3 luni inainte de incident, am facut analizele Papanicolau anuale, și fisa arăta că sunt complet sănătoasă. Analizele ieșiseră curate, deci intr-un interval de 9 luni am pornit de la clinic sanatoasa la cancer cervical de gradul 3 și amigdalita cronică, pana în punctul în care au trebuit  îndepărtate amigdalele. Mai mult, dacă deveneam entuziasmată sau furioasă și nivelul adrenalinei din corp creștea, leșinam imediat. Am dezvoltat alergii la diferite alimente, la care nu aveam alergie înainte. În urmatorul an și jumatate am trecut prin diferite proceduri de tratament pe cervix pentru cancerul cervical, asta se intampla dupa primul diagnostic, dupa care mi s-a facut laparoscopie. Dupa cateva luni din nou mi s-a pus al 2-lea diagnostic de cancer cervical, si alta laparoscopie. Dupa cateva luni, alt diagnostic de cancer cervical si in acel moment au indepartat intregul cervix. La cateva luni distanta am primit al 4-lea diagnostic de cancer chiar daca nu mai aveam cervix. In acel moment am spus: “Comunitatea medicala nu ma ajuta“. Oncologul meu imi spunea ca daca nu apelam la chimioterpie si radiatii voi muri, dar stiam din experienta cu cei 3 membrii ai familiei, pe care i-am pierdut ca ei au involuat cu radiațiile și chimioterapia nu a făcut decat mai mult rău. Așa că am refuzat și în ciuda faptului că îmi era foarte frică am început să investighez și să studiez si am gasit protocolul Garcian. Nu am respectat protocoalele intocmai, in schimb am facut propriul protocol: 42 de zile de post cu sucuri, clisme cu cafea, am inceput tot felul de terapii alternative ca: saune cu infrarosii, bai cu Magneziu, terapie cu oxigen hiperbaric. Au fost 6 luni de terpie alternativa constanta, si vreau sa spun, constanta. Apoi am mers iar pentru analize si cancerul disparuse. (Aplauze) … Multumesc! Am facut de fapt, acum știu, și vedem un mecanism impotriva acestei leziuni facute de vaccin – testosteronul. Nu sunt doctor, nici om de stiinta, deci nu pretind sa inteleg acel mecanism, dar am aplicat un lucru…foarte controversat. Am trecut prin trei runde de terapie cu testosteron si asta deoarece esterogenul hraneste cancerul. Nivelul esterogenilor trebuie sa scada (deci testosteronul scade nivelul de esterogen) si asta m-a ajutat foarte mult. Apoi am aflat despre mutatia genetica MTHFR, pentru care mi-am facut analize si testele au iesit pozitive, si atunci am inceput sa iau injectii cu vitamina B12 si m-am concentrat mult pe antiinflamatoare, pentru ca nu vroiam sa recidiveze cancerul. Deci, m-am concentrat mult pe o dieta antiinflamatoare. Am apelat la ceea ce acuma cunosc ca fiind Dieta Paleo, mancare organica, fara pesticide. Pesticidele hranesc cancerul.  Gardasyl contine L – Histidina care este un precursor al histaminei. Deci trebuie sa verific mereu, nivelul de histamina si trebuie sa am grija ce maninc, ceea ce este considerat sanatos. Avocado, banane, capsuni, nu pot manca, ori am voie dar cantitatea trebuie sa fie controlata, si trebuie sa fie urmate de cantitati mari de vitmaina C, quercitina etc.   De asemenea, o dieta antiinflamatoare consta in evitarea totala a glutenului, a lactozei, soia, pentru ca soia creste nivelul de estoerogeni. De asemenea fara carbohidrati, dar bogata in grasimi. Se evita zaharurile, acestea hranesc cancerul si produc inflamare. Carbohidratii se desfac in zaharuri. Grasimile, cel putin cele sanatoase, mult ulei de cocos, dau energie. Timp de 2 ani m-am simtit slabita, nu vroiam sa ma dau jos din pat, si o hrana bogata in grasimi m-a ajutat mult in a creste nivelul de energie si in plus ajuta la mentinerea sanatatii creierului.   Dieta bogata in Omega-3, deci foarte multe seminte de canepa, chia, apoi ceva ce ajuta la cresterea nivelului de histamina sunt exercitiile. Acestea cresc ritmul cardiac, si trebuie sa am grija ce fel de exercitii fac. Mai mult sportul si mersul pe jos. Am inceput sa evit foarte mult aluminiul, asa cum stim de la dr. Luis, prezentarea aluminiului si felul in care se leaga chimic. Am evitat fluorul si acidul folic, acesta opreste absorbtia folatului natural in corp. Este un efort continuu.   Mi-a fost administrat vaccinul in 2005 si din fericire, urasc sa spun din fericire, m-a salvat ca am luat doar o doza si daca sunt azi aici este pentru ca nu am primit a 2-a sau a 3-a doza. Asta pentru ca m-am imbolnavit imediat.    Este un efort continuu, trebuie sa fiu mereu cu un pas inainte. In ceea ce priveste cancerul, niciodata nu poti fi sigur. Acum sunt deja 10 ani, sau 11 de cand am primit acest vaccin si aproape 9 ani de cand nu mai am cancer. (Aplauze)

Intrebare din sala..

-Da odata cu indepartarea amigdalelor, de fapt ce s-a facut a fost ca le-au pastrat. Si cu indepartarea finala a cervixului au salvat si acel tesut, si l-am trimis unui patologist care le-a testat si testul a aratat prezenta HPV 16 si 18, amindoua ingrediente prezente in Gardasyl. Asa cum am mai spus, cu trei luni inainte de vaccin am fost declarata sanatoasa. Stiu ca fapt real ca acest vaccin a cauzat toate problemele acestea? Nu, dar stiu ca acel lucru impotriva caruia urma sa fiu protejata, este exact ce m-a afectat.  A fost o batalie lunga. Simt ca multe din ce am spus, au repetat ceea ce Carston a relatat despre fiica lui si cum s-a produs vindecarea ei. E evident ca da rezultate. Vreau ca orice victima a vaccinului HPV Gardasyl sa stie ca exista o speranta prin terapie, dieta si un stil de viata cat mai sanatos.

Intrebare din sala…

M-a intrebat daca stiu sigur ca a fost vaccinul, si daca m-am intors la acei cercetatori de la universitate, daca au spus ceva. Nu, eu vin dintr-un mediu conventional  in care nu te indoiesti de medici, ei stiu cel mai bine. Cand m-am imbolnavit si m-au intrebat daca am observat vreo schimbare, le-am spus ca s-ar putea sa fie vaccinul si mi-au spus: ,,O, nu e de la vaccin, e doar o viroza.” Nici o legatura cu virusii care tocmai ce mi-au fost injectati. Deci nu, nu am stiut cui sa spun depre vaccin, pentru ca nu am facut legatura imediat dupa.

Intrebare din sala…

Odata cu indepartarea amigdalelor, au fost facute analize pe tesut si au avut rezultat pozitiv pentru substantele care au fost prezente in injectie. Am fost surprinsa, apoi pe parcurs ce am aflat despre dieta antiinflamatorie si despre ceea ce cauzeaza inflamatii in corp, cand am studiat ingredientele. Nu am inceput cu vaccinul, ci cu alte produse farmaceutice si totuși, cum a spus Eileen, incet dar sigur realitatea m-a izbit in fata. Multumesc.

Cred ca mai este o intrebare aici in fața, a intrebat ce este clisma cu cafea?

-V-as spune sa cautati pe google, nu este placut sa vorbesc despre asta. Este o parte importanta din protocolul Garcian si are multe beneficii medicinale.

Mai avem o intrebare, domnul din fata. M-ati intrebat daca am primit compensatie? Nu am primit, pentru ca asa cum am spus mi-a luat mult timp pana sa fac legatura si nu am scris nici un raport, deci nu am cautat sa fiu despagubita. M-am concentrat mai mult sa fac public si sa incerc sa avertizez pe altii despre pericolele asociate acestui vaccin. Nu nici macar nu am aplicat.

Aplicarea intralesională și subcutanată a extractului Viscul album L. (European vâsc) în carcinomul cervical in situ

Abstract

Argumentare:

Carcinomul in situ (CSI) al colului uterin este o afecțiune premalignantă a epiteliului scuamos.Tratamentele standard sunt procedurile de excizie și ablație; pentru femeile cu margini pozitive, este recomandată histerectomia.

Preocupările pacientului:

O femeie peruană de vîrstă de 47 de ani, cu vaginită candidoasă recurentă, a fost diagnosticată cu colopervicită și metaplazie scuamoasă acum 8 ani, care nu au fost tratate.

Diagnosticele:

Pacientul a fost diagnosticat cu CSI după procedura de coninizare cervicală. Ea a refuzat histerectomia radicală și a optat pentru un tratament medical integrat.

intervenţii:

Ea a fost tratată cu injecții intralesiale și subcutanate Viscum album L. extract (VAE). VAE este un tratament pe scară largă a cancerului de plante cu efecte citotoxice, apoptoge și imunologice, dar nu a fost investigat în CSI de col uterin.

rezultate:

La sfârșitul lunii 5 a tratamentului, a fost observată remisia completă a CSI de col uterin. Pacientul este încă în remisie după 30 de luni (până la publicare).

Lecții:

Acesta este primul raport privind remisiunea completă a CSI de col uterin după injecția intralezională și subcutanată cu VAE. Studiile prospective ar trebui să evalueze în ce măsură efectul de tratament este reproductibil.

1. Introducere

Carcinomul in situ (CIS), ultimul grad de displazie observat înainte de cancerul invaziv, este definit ca neoplazie cervicală intraepitelială de gradul 3 (CIN 3). 1 ] CIN este o afecțiune premalignantă a epiteliului scuamos al colului uterin și poate fi de grad scăzut (gradul 1 [CIN 1]) sau de grad înalt (gradul 2 [CIN 2] și gradul 3 [CIN 3]). 2 ] CIN 3 se referă la modificări celulare atipice foarte severe, care cuprind mai mult de două treimi din grosimea epiteliului și includ leziuni cu grosime totală dar fără semne de invazie în stroma.

Mai mult de 83.000 de femei au fost diagnosticate cu cancer de col uterin și aproape 36.000 au murit din cauza acestei boli în Regiunea Americilor în 2012; conform Organizației Panamanale a Sănătății (PAHO), numărul de decese din America este estimat să crească cu 45% până în 2030. 3 ] Institutul Național al Bolilor Neoplazice (INEN) din Peru a raportat 1485 de cazuri noi de cancer de col uterin înregistrate în 2014, clasându-l cel mai mare pe lista cazurilor de cancer din țară. 4 ] Principalii 2 factori asociați cu dezvoltarea CIN de înaltă calitate și a cancerului de col uterin sunt subtipurile 16 și 18 ale papilomavirusului uman (HPV) și persistența virusului. Cofactorii esențiali sunt imunosupresia, fumatul de țigară și utilizarea pe termen lung a contraceptivelor orale. 5 ]

Rata de remisiune spontană pentru CIN 3 (displazie severă și CIS) este de 32% până la 47% și are o evoluție lentă pe parcursul mai multor ani. 6 ] Tratamentul standard pentru CIN de înaltă calitate include excizia (de exemplu, conizarea cervicală prin procedură de excizie electrosurgicală în buclă [LEEP]) și ablația zonei de transformare a colului uterin (o zonă anatomică care conține trecerea de la epiteliul scuamos al ectocervixului la epiteliul glandular al endocervixului). Histerectomia este o opțiune pentru femeile pentru care alt tratament nu a reușit sau care au CIN recurente. 1 ] Tratamentele de col uterin pot reduce riscul de cancer invaziv al colului uterin cu 95% în primii 8 ani după tratament, astfel încât CIN are o rată ridicată de vindecare atunci când întreaga leziune a fost excizată (margini negative). Pe de altă parte, studiile au demonstrat în mod constant că pacienții cu o marjă pozitivă după o procedură excizională a colului uterin prezintă un risc semnificativ mai mare pentru boala reziduală – determinată la histerectomie ulterioară sau cu excizie repetată – decât pacienții cu margini clare. 7 , 8 ]

Viscum album L. extract (VAE) este un extract apos de plante întregi, fabricat din vâsc european, o plantă hemi-parazitară care crește pe arbori gazdă diferit (de exemplu, cenușă, mesteacăn, măr, stejar). 9 ] Acesta conține compuși citotoxici și imunoactivi, inclusiv lectine de vasc (ML), viscotoxine și alte proteine ​​cu greutate moleculară scăzută, oligozaharide și polizaharide, flavonoide și acizi triterpenici. Activitatea antitumorală a ML, incluzând efectele profilactice, a fost legată de efectele lor puternice de inducere a apoptozei și imunostimulatoare. Acestea includ activarea in vivo și in vitro a monocitelor / macrofagelor, granulocitelor, celulelor naturale ucigașe, celulelor T, celulelor dendritice și inducerea unei varietăți de citokine. 10-12 ] Studiile clinice arată îmbunătățirea calității vieții și potențialele efecte benefice asupra supraviețuirii. 13 , 14 ] Studiile clinice se desfășoară în prezent în Suedia (NCT02948309), Statele Unite (NCT03051477) și Germania-Egipt (NCT02106572).

Într-un studiu prospectiv necontrolat, injecția VAE subcutanată a fost utilizată ca tratament neoadjuvant în CIN 1-3 cu HPV, ceea ce a condus la remisia parțială completă și 27% (determinată prin biopsie în cazul răspunsului complet). 15 ] Mai mult, autorii unui alt studiu care investighează VAE și interferonul alfa uman recombinant în CIN 1-2 au raportat o creștere a regresiei și o scădere semnificativă a ratelor de progresie. 16 ] Cu toate acestea, după cunoștințele noastre, nu s-au publicat studii privind utilizarea injectării intralesiale VAE în tratamentul CSI de col uterin. 17 ] Prin urmare, prezentăm următorul caz, raportat în conformitate cu orientările CARE (CAse Reporting). 18 ]

2. Prezentarea cazului

Un profesor peruvian de 47 de ani și o mamă care a avut o istorie de vaginită candidoasă recurentă au fost diagnosticate cu un CIN 2-3 de grad înalt și cu cervicită cronică prin biopsie. Cu opt ani în urmă, ea a fost diagnosticată cu colopervicită și metaplazie scuamoasă, care nu au fost tratate. La nouă luni după diagnosticul CIN 2-3, ea a suferit o conizie de col uterin care a indicat CIS cu leziune exo-endocervicală;conform raportului medical, leziunea nu a putut fi excizată în totalitate (marje pozitive). Trei luni mai târziu, o biopsie a indicat din nou CIS cu leziuni de extensie endocervică (Fig.1A A-B) .Histerectomia radicală a fost recomandată de ginecologul ei, totuși, pacientul a refuzat această intervenție.

An external file that holds a picture, illustration, etc.
Object name is medi-97-e13420-g001.jpg

AB: Biopsia cervicală a pacientului cu 2 săptămâni înainte de tratamentul cu VAE: Carcinomul cervical in situ.CD: Test citologic din Papanicolau după 9 săptămâni de tratament cu VAE: gradul neoplaziei intraepiteliale cervicale 1. VAE = extract de album Viscum .

 

Pacientul a venit la Centro Médico Antroposófico (CMA) din Lima-Peru, unde a fost evaluată și sa recomandat terapia cu injecții VAES intralesională și subcutanată. Tratamentul cu VAE a fost sugerat din cauza remisiunii pe termen lung a leziunilor maligne și premaligne și a rezultatelor promițătoare din studiile care au utilizat doze mari de VAE (intralezional, intravenos și intratumoral). 9,19-22 ]

Tratamentul a început cu aplicații VAE sub formă de doze treptate, de trei ori pe săptămână, din cenușă de copac gazdă (AbnobaVISCUM Fraxini 0,2 mg-2 mg, 2 mg conține aproximativ 2 μg lectină de vară / ml, concentrațiile ML în doza mai mică sunt respective). Injecțiile au fost aplicate în zona periumbilicală, prima dată de asistenta medicală și apoi de pacientul însuși. S-au aplicat injecții VAE intra-vasculare (AbnobaVISCUM Fraxini 20 mg, 1 ml pe flacon) cu ajutorul unui specul, începând din prima lună cu 1 flacon în săptămâna 1 și același în săptămâna 2 (tabelul 1).1 ). În săptămâna de aplicare intralezională, au fost administrate doar 2 cereri subcutanate. Din cauza provocărilor logistice, intervenția intralesională a fost întreruptă timp de 3 luni; injecțiile subcutanate au fost totuși continuate în această perioadă.

tabelul 1

Viscum album L. terapie de extracție: flacoane pe lună.

An external file that holds a picture, illustration, etc.
Object name is medi-97-e13420-g002.jpg

În luna a 2-a de tratament, testul Papanicolaou (Pap) al pacientului a indicat CIN 1 ( Fig.1C -D) .Doza de injecții subcutanate a fost continuu crescută și până în luna 3 pacientul a început să folosească fiole de 20 mg, între 3 și 4 luni, a primit ultima injecție intralezională (în special, în săptămânile 14, 15 și 16 din 2, 3 și 4 flacoane VAE de 20 mg, respectiv). a fost negativ pentru CIN, iar evaluarea colposcopiei a arătat un cervix normal (nu a fost raportată nici o cervicită), continuând astfel până când acest caz a fost raportat (36 luni după începerea tratamentului VAE). o săptămână Pentru tratamentul VAE și evoluția bolii Figura Figura 2 2 .

An external file that holds a picture, illustration, etc.
Object name is medi-97-e13420-g003.jpg

Cronologie: tratamentul VAE și evoluția bolii. PAP = Papanicolaou, Q = EORTC QLQ-C30, VAE = extract de album Viscum .

 

Efectele secundare ale tratamentului au fost umflarea și mâncărimi ocazionale ale pielii la locul injectării subcutanate. Atunci când s-au aplicat injecții VAE intralesiale, pacientul a simțit contracții uterine ușoare începând cu aproximativ 6 ore după aplicare și durează aproximativ 1 oră; ocazional, a fost raportată durere de cap ușoară. Pacientul a raportat în mod constant o calitate foarte bună a vieții, după cum sa arătat în răspunsurile sale la Organizația Europeană pentru Cercetarea și Tratamentul Cancerului pentru Calitatea Vieții (EORTC QLQ-C30) care a fost efectuată după remisiunea completă și până la testul final Papanicolau Fig. ( Fig.33).

An external file that holds a picture, illustration, etc.
Object name is medi-97-e13420-g004.jpg

Rezultatele EORTC QLQ-C30 ale stării sănătății globale și a stării funcționale a pacientului (scor 0: absență-100: plin).

2.1. Terapii antecedente și concomitente

Pacientul a raportat că suferă o mulțime de presiune și stres la locul de muncă. În caz contrar, ea a fost sănătoasă (greutate: 58 kg, înălțime: 1,67 m) și fără factori de risc specifici pentru CIN / CSI. A băut 1 până la 2 pahare de vin pe săptămână și a mâncat o dietă echilibrată. Aproape un an după începerea tratamentului cu VAE, pacientul a fost diagnosticat cu hipotiroidism subclinic (TSH = 4,08 UI / ml [0,35-2,5]), care a fost tratat cu remedii antroposofice: glanda tiroidă D5. Simptomele ei de oboseală și lipsa de concentrare au fost tratate cu Levico D3, Absinthium D1 / Resina Laricis D3 și Amara-Tropfen.Rezultatele analizei sale de laborator au arătat o reducere progresivă a TSH (ultimul rezultat: 3,01 UI / ml).În prezent, pacientul exprimă o vitalitate și o concentrare îmbunătățită.

După finalizarea și prezentarea articolului, pacientul a prezentat o colposcopie suplimentară, la un an după terminarea observării descrise mai sus. Era încă CIN 0 și continuă tratamentul.

2.2. Perspectiva pacientului

„Cred că trupul exprimă ceea ce o persoană nu aduce la conștiință, atunci corpul o face evidentă și o are sarcina de a o dizolva. M-au ajutat cu această sarcină. „

3. Discuție

Cazul prezentat prezintă o remisiune completă a CSI de col uterin (CIN 3) fără recurență în următoarele 30 de luni (până la publicare) după injectarea intralesională și subcutanată a VAE. Acest protocol de tratament a fost stabilit din cauza riscului ridicat și a probabilității de progresie datorată marjei pozitive de conizare și reapariției ridicate a vaginitei (după cum reiese din recomandarea ginecologului pacientului pentru o histerectomie).

Diagnosticul CSI de col uterin a fost confirmat prin histopatologie (biopsie cervicală). Deși rata de regresie spontană pentru CIN 3 (displazie severă și CIS) este de 32% până la 47%, studiile o descriu ca un proces lent care durează mai multe luni (aproximativ de la CIN 1 până la normal: 20-72 luni, CIN 2 până la normal: 24-72 de luni, nici o referință de la CIN 3 la normal). 6 ] În cazul acestui pacient, în luna 2 a tratamentului, ea a regresat la CIN 1 și a terminat luna 5 la normal. Nu a fost utilizată altă terapie tumorală specifică. Prin urmare, presupunem că remisia a avut loc ca urmare a injectărilor intralesiale și subcutane de VAE. Un test Papanicolau a fost efectuat după tratamentul intralezional, iar rezultatele citologice au confirmat remisiunea CIS.

Alte remisiuni tumorale au fost observate după doze mari și la administrarea locală de VAE la cancerele mamare și ginecologice (de exemplu, cancer ovarian, endometrial, cervical, vaginal, vulval și uterin), iar studiile au raportat un beneficiu statistic semnificativ în calitatea vieții la nivelul colului uterin la pacienții cu cancer tratați cu VAE. 13 , 17 ] Totuși, după părerea noastră, nu s-au publicat studii privind utilizarea injecției VAE intralesională în tratamentul CSI de col uterin.

CIN și cancerul de col uterin sunt sensibile la imunitate, având în vedere riscul cunoscut atât al infecției cu HPV, cât și al creșterii CIN cu creșterea gradului de imunosupresie. 23 ] În plus, cancerul de col uterin este una dintre cele mai frecvente malignități asociate sindromului imunodeficienței dobândite la femei. 24 ]VAE prezintă efecte imunostimulatoare puternice asupra sistemului imunitar innascut și adaptiv (activarea in vivo și in vitro a monocitelor / macrofagelor, granulocitelor, celulelor naturale ucigașe, celulelor T, celulelor dendritice și inducerea varietății de citokine, cum ar fi ca factor de stimulare a coloniilor de granulocite-macrofage [GM-CSF] de interleukină-1 [IL-1], IL-2, IL-4, IL-5, IL-6, IL-8, IL- , factorul de necroză tumorală α [TNF-α], interferonul γ [IFN-y]). 17 , 18 , 23 ] Prin urmare, presupunem că VAE a contribuit la remisiunea completă și pe termen lung descrisă în acest caz. Acest efect imunostimulator a fost, de asemenea, reflectat de o reducere a reaparitiei pacientului de vaginita candidata de cand pacientul a inceput tratamentul, deoarece se stie ca infectiile candidoge sunt mai frecvente la pacientii imunosupresati.25 ] Imunoterapia vaginitei candidale pentru prevenție și tratament este o abordare terapeutică care este în curs de investigare. Mai mult, remisia poate fi rezultatul efectelor citotoxice și apoptotice puternice ale VAE. Citotoxicitatea lectinelor este inhibată de proteinele serice și de anticorpi când este aplicată sistemic;prin urmare, aplicarea locală restricționată prin injecție intralezională poate, de asemenea, să contribuie la răspunsul clinic. 26 ] Ca parte a reacției imune intenționate, pacienții prezintă, de obicei, reacții cutanate locale, cum ar fi umflarea pielii înconjurătoare; eritemul și mâncărimea sunt efecte secundare cunoscute ale injecțiilor VAE subcutanate. Acest tip de reacție cutanată la un pacient în timpul tratamentului cu inhibitor al receptorului factorului de creștere epidermal prezice un rezultat clinic mai bun decât la pacienții care nu i-au dezvoltat și poate fi interpretat ca stimulare imună, similară cu cea provocată de tratamentul cu VAE. [27 ] Contracțiile ușoare uterine (bine tolerate de către pacient) au fost un răspuns normal la stimularea inflamatorie a colului uterin cu injecții VAE intralesiale care au provocat eliberarea de prostaglandine responsabile de contracții.

HPV este principalul agent etiologic al precancerului cervical și a cancerului, în special subtipurile 16 și 18, care sunt puternic asociate cu leziuni de grad înalt (50% până la 60% din cazuri). 28 ] Mai mult, infecțiile cu HPV, în special infecțiile persistente, sunt un factor de risc recunoscut pentru dezvoltarea leziunilor precanceroase (stadiul acestui pacient) și a cancerului invaziv. 29 ] Studiile recente au dezvăluit bazele moleculare ale tumorogenezei induse de HPV și interacțiunea cu sistemul imunitar gazdă. În prezent, vaccinurile HPV disponibile nu au un efect terapeutic asupra infecțiilor preexistente cu HPV sau a leziunilor asociate. Accentul este acum de a dezvolta un tratament care să poată monta un răspuns imunitar terapeutic împotriva celulelor infectate cu HPV. Considerăm că acest raport de caz contribuie la cunoașterea VAE în CIN și CSI cervical. Aceasta sugerează un beneficiu suplimentar pentru tratamentul lor, care ar trebui investigat în continuare. Până nu se indică altfel în studiile clinice, tratamentul standard trebuie să fie intervenția primară în cazurile de CIN și CIS de col uterin, cu VAE administrat ca terapie adjuvantă promițătoare.

4. Concluzii

Acesta este primul raport care arată remisia completă a SID după aplicarea intralesională și subcutanată a VAE. Studiile prospective ar trebui să evalueze dacă acest rezultat poate fi reprodus și să devină o opțiune de tratament de linia a doua pentru pacienții care refuză histerectomia.

Recunoasteri

Mulțumită lui César Vela-Velásquez, un patolog medical, care a furnizat imaginile histologice.

Contribuția autorului

Conceptualizare: María Reynel, Yván Villegas.

Cursarea datelor: María Reynel.

Supraveghere: Helmut Kiene, Paul G. Werthmann, Gunver S. Kienle.

Vizualizare: María Reynel, Helmut Kiene, Paul G. Werthmann, Gunver S. Kienle.

Scrierea – versiunea originală: María Reynel.

Scrierea – recenzie și editare: Yvan Villegas, Helmut Kiene, Paul G. Werthmann, Gunver S. Kienle

Marcia Reynel orcida: 0000-0002-3899-9708.

Note de subsol

Abrevieri: CIN = neoplazie intraepitelială cervicală, CIS = carcinom in situ, HPV = papilomavirus uman, IL = interleukină, ML = lectine de vîsc, Pap = Papanicolaou, VAE = Viscum album L. extract.

Aprobarea etică nu a fost necesară pentru acest tip de studiu. Consimțământul informat în scris a fost obținut de la pacient pentru publicarea acestui raport de caz și a oricăror imagini însoțitoare.

Autorii nu înregistrează conflicte de interese.

Referințe

[1] Montz FJ. Managementul neoplaziei intraepiteliale cervicale de grad înalt și a leziunii scuamoase intraepiteliale de grad scăzut și complicații potențiale . Clin Obstet Gynecol 2000; 43 : 394-409. PubMedGoogle Scholar ]
[2] Darragh TM, Colgan TJ, Thomas Cox J, și colab. Proiectul de standardizare a terminologiei scuamoase anogenitale pentru leziunile asociate HPV: recomandări de fond și consens din partea colegiului patologilor americani și a societății americane pentru colposcopie și patologie cervicală . Int J Gynecol Pathol 2013; 32: 76-115. PubMed ] Google Scholar ]
[3] Organizația de sănătate pan-americană. Cancerul de col uterin . Disponibil la: http://www.paho.org/hq/index.php?option=com_content&view=article&id=5420%3A2011-cervical-cancer&catid=1872%3Acancer&Itemid=3637&lang=ro (2016). Accesat în 23 ianuarie 2018. Google Scholar ]
[4] INEN. Casos de cancer înregistrat în en INEN, perioada 2000-2014 (ambos sexos) . Disponibil la: http://www.inen.sld.pe/portal/documentos/pdf/estadistica/datos_estadisticos/02062016_DATOS_EPIDEMIOLOGICOS%20INEN(2000-2014).pdf Accesat la 23 ianuarie 2018. Google Scholar ]
[5] Wright TC, Jr, Ellerbrock TV, Chiasson MA și colab. Neoplazia intraepitelială cervicală la femeile infectate cu virusul imunodeficienței umane: prevalența, factorii de risc și valabilitatea frotiurilor Papanicolaou. Studiul privind bolile de col uterin din New York . Obstet Gynecol 1994; 84 : 591-7. PubMed ] Google Scholar ]
[6] McCredie MR, Sharples KJ, Paul C. și colab. Istoricul natural al neoplaziei cervicale și riscul de cancer invaziv la femeile cu neoplazie intraepitelială cervicală 3: un studiu de cohortă retrospectiv . Lancet Oncol2008; 9 : 425-34. PubMed ] Google Scholar ]
[7] Ghaem-Maghami S, Sagi S, Majeed G. și colab. Excizia incompletă a neoplaziei intraepiteliale cervicale și riscul de eșec al tratamentului: o meta-analiză . Lancet Oncol 2007; 8 : 985-93. PubMed ] Google Scholar ]
[8] Mohamed-Noor K, Quinn MA, Tan J. Rezultatele după conization cuțit rece cu excizie completă și incompletă a epiteliului anormal: o revizuire a 699 de cazuri . Gynecol Oncol 1997; 67 : 34-8. PubMed ] Google Scholar ]
[9] Werthmann PG, Friesland H, Kienle GS. Răspunsul durabil al carcinomului cu celule scuamoase cutanate după injecții cu peri-leziuni cu doze mari de extracte de album Viscum – un raport de caz .Phytomedicine 2013; 20 : 324-7. PubMed ] Google Scholar ]
[10] Peumans WJ, Verhaert P, Pfüller U, și colab. Izolarea și caracterizarea parțială a unei mici lectine care leagă chitina de la vâsc ( Viscum album ) . FEBS Lett 1996; 396 : 261-5. PubMed ] Google Scholar ]
[11] Mueller EA, Anderer FA. O oligozaharidă de albumină Viscum care activează citotoxicitatea naturală umană este un inductor gamma interferon . Cancer Immunol Immunother 1990; 32 : 221-7. PubMed ] Google Scholar ]
[12] Orhan DD, Küpeli E, Yesilada E și colab. Activitatea antiinflamatorie și antinociceptivă a flavonoidelor izolate din Viscum album ssp. album . Z Naturforsch C 2006; 61 : 26-30. PubMed ] Google Scholar ]
[13] Kienle GS, Kiene H. Influența albumului Viscum album L (vâsc european) asupra calității vieții la pacienții cu cancer: o revizuire sistematică a studiilor clinice controlate . Integr Cancer Ther 2010; 9 : 142-57. PubMed ] Google Scholar ]
[14] Troger W, Galun D, ​​Reif M și colab. Viscum albumul [L] extrage terapia la pacienții cu cancer pancreatic la nivel local avansat sau metastatic: un studiu clinic randomizat privind supraviețuirea globală .Eur J Cancer 2013; 49 : 3788-97. PubMed ] Google Scholar ]
[15] Portalupi E. Tratament neoadjuvant în CIN legat de HPV cu preparat de vaselină (Iscador) . Disertație Universität Pavia 1991/1992 1995. Google Scholar ]
[16] Jach R, Basta A. Iscador QuS și interferonul alfa uman recombinant (Intron A) în neoplazia intraepitelială cervicală (CIN) . Przeglad Lekarski 1999; 56 : 86-8. PubMed ] Google Scholar ]
[17] Kienle GS, Glockmann A, Schink M și colab. Viscum album L. extracte în cancerele mamare și ginecologice: o revizuire sistematică a cercetărilor clinice și preclinice . J Exp Clin Cancer Res 2009; 28 : 79-111. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
[18] Gagnier JJ, Riley D, Altman DG și colab. Ghidul CARE: elaborarea orientărilor clinice bazate pe consens pe baza rapoartelor . Dtsch Arztebl Int 2013; 110 : 603-8. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
[19] Kienle GS, Mussler M, Fuchs D, și colab. Tratamentul vaselor intravenoase în îngrijirea cancerului integrat: un studiu calitativ care explorează procedurile, conceptele și observațiile medicilor specialiști .Comunicarea bazată pe dovezi Altern Med 2016; 2016 : 1-6. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
[20] Orange M, Lace A, Fonseca MP și colab. Regresia durabilă a limfomului primar cutanat cu celulă B în urma tratamentului cu vâsc, care determină febra – două rapoarte de caz . Global Adv Health Med 2012; 1 : 18-25. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
[21] Schad F, Atxner J, Buchwald D, și colab. Tratamentul cu vasculă intraorală (Viscum album L) la pacienții cu carcinom pancreatic inoperabil: o analiză retrospectivă . Integr Cancer Ther 2014; 13 : 332-40.PubMed ] Google Scholar ]
[22] von Schoen-Angerer T, Goyert A, Vagedes J, și colab. Dispariția unui polop avansat de colon adenomatos după injectarea intratumorală cu extract de Viscum album (european vâsc): un raport de caz . J Gastrointestinal Liver Dis 2014; 23 : 449-52. PubMed ] Google Scholar ]
[23] Ahdieh L, Muñoz A, Vlahov D și colab. Neoplazia cervicală și pozitivitatea repetată a infecției cu papilomavirus uman la femeile seropozitive și seronegative ale virusului imunodeficienței umane . Am J Epidemiol 2000; 151 : 1148-57. PubMed ] Google Scholar ]
[24] Maiman M, Fruchter RG, Clark M și colab. Tratamentul cancerului de col uterin ca boală care definește SIDA . Obstet Gynecol 1997; 89 : 76-80. PubMed ] Google Scholar ]
[25] Duerr A, Heilig CM, Meikle SF și colab. Incidența și candidoza vulvovaginală persistentă la femeile infectate cu virusul imunodeficienței umane: Factori de risc și severitate . Obstet Gynecol 2003; 101 : 548-56. PubMed ] Google Scholar ]
[26] Klingbeil MF, Xavier FC, Sardinha LR și colab. Efectele cyto -toxice ale vâscului ( Viscum album L.) în liniile celulare de carcinom cu celule scuamoase ale capului și gâtului . Oncol Rep 2013; 30 : 2316-22. PubMed ] Google Scholar ]
[27] Orditura M, De Vita F, Galizia G și colab. Corelația dintre eficacitatea și apariția erupțiilor cutanate după tratamentul cu inhibitorul receptorului pentru factorul de creștere epidermal cetuximab: o analiză retrospectivă a unei singure instituții . Oncology Rep 2009; 21 : 1023-8. PubMed ] Google Scholar ]
[28] Kaufman RH, Adam E, Icenogle J, et al. Relevanța screeningului papilomavirusului uman în managementul neoplaziei intraepiteliale cervicale . Am J Obstet Gynecol 1997; 176 : 87-92. PubMed ] Google Scholar ]
[29] Wright TC, Jr, Schiffman M. Adăugarea unui test pentru ADN-ul papilomavirus uman la screening-ul pentru cancerul cervical . N Engl J Med 2003; 348 : 489-90. PubMed ] Google Scholar ]

Articolele de la Medicină sunt oferite aici prin amabilitatea lui Wolters Kluwer Health

Influența deprivării /lipsirii parțiale și complete a glutaminei și glucozei asupra liniilor celulare tumorigene de sân și cervicale

Abstract

fundal

Datorită cerințelor lor proliferative ridicate, celulele tumorigene posedă sisteme metabolice modificate, în care celulele utilizează cantități mai mari de glutamină și glucoză. Aceste cerințe metabolice alternează interesul de a investiga efectele concentrațiilor fiziologice non-tumorigene ale glucozei și glutaminei asupra celulelor tumorigene, deoarece deprivarea fie are ca rezultat un răspuns canonic al aminoacidului în celula de mamifer.

metode

Influența expunerii pe termen scurt a celulelor tumorigene asupra corelării cantităților descrescătoare de glutamină și glucoză a fost demonstrată într-o linie celulară mamăra metastatică înalt glicolitică și o linie celulară de carcinom cervical. Ulterior, celulele s-au propagat în mediu conținând concentrații fiziologice tipice de glutamină 1 mM și glucoză 6 mM timp de 7 zile. Efectele asupra morfologiei au fost investigate prin contrastul polarizării-difuziei optice difuzate prin lumină optică. Citometria de flux a fost utilizată pentru a demonstra efectele înfometării de glutamină și glucoză asupra progresiei ciclului celular și a inducerii apoptozei. De asemenea, s-au efectuat fluorometri pentru a investiga efectele asupra inducției apoptozei intrinseci (mitocaptura), producerii de specii reactive de oxigen (diacetat de 2,7-diclorofluoresceină) și formării veziculei acide (acridină portocalie).

Rezultate

Datele morfologice sugerează că deprivarea de glutamină și glucoză a dus la reducerea densității celulare și a celulelor rotunjite. înrolarea prin glutamina si glucoză au dus, de asemenea, la o creștere a fazei G2M și a unui vârf sub-G1. Înfometarea completă a glutaminei și a glucozei a dus la reducerea potențialului membranei mitocondriale în ambele linii celulare, cu celule MDA-MB-231 afectate mai mult în comparație cu celulele HeLa. Mai mult, celulele infometate nu au putut fi salvate suficient prin propagare, deoarece celulele au avut o creștere a speciilor de oxigen reactiv, a compartimentelor acide și a formării vacuolelor.

Concluzie

Înfometarea de la glutamină și glucoză pentru perioade scurte a dus la scăderea densității celulare, a celulelor rotunjite și la inducerea apoptozei prin generarea de specii reactive de oxigen și disfuncția mitocondrială. În plus, linia celulară metastatică a reacționat mai profund la înfometarea cu glutamină și glucoză datorită naturii lor foarte glicolitice. Salvarea celulară satisfăcătoare nu a fost posibilă deoarece celulele au demonstrat stresul oxidativ și potențialul membranar mitocondrial depolarizat. Acest studiu contribuie la cunoașterea efectelor in vitro și a transducției de semnal a deprivării de glucoză și / sau l-glutamină în liniile celulare tumorigene.

Introducere

Țesutul tumorigen are alte activități metabolice în comparație cu țesutul diferențiat, neproliferativ. Aceste activități metabolice modificate exercitate de tumori sunt necesare pentru natura foarte proliferativă a țesutului transformat și tumorigen [ 1 ]. În celulele tumorigene, apare o schimbare de la producerea de adenozin trifosfat (ATP) prin fosforilare până la generare prin intermediul glicolizei, chiar și în prezența oxigenului [ 2 ]. Glicoliza aerobă asociată cu cancer care are ca rezultat producerea de acid lactic și piruvat a fost descrisă cu aproape 100 de ani în urmă și este cunoscută sub numele de efect Warburg [ 2,3 ]. Inițial sa raportat că efectul se datorează disfuncției mitocondriale, însă cercetările ulterioare indică faptul că celulele canceroase preferă catabolismul glucozei prin glicoliză față de fosforilarea oxidativă, chiar dacă mitocondriile sunt competente [ 3 ]. Din moment ce glucoza este utilizată în principal pentru glicoliză, glutamina este utilizată ca substrat al ciclului acidului tricarboxilic mitocondrial (TCA) și pentru sinteza nicotinamidei adenin dinucleotid fosfat (NADPH) și sinteza acizilor grași [ 4 ].

Pe lângă glicoliza, celulele tumorigene sunt de asemenea dependente de glutaminoliză pentru scopuri de proliferare. Glutaminoliza este definită ca conversia glutaminei în glutamat. Acest proces furnizează carbon și azot utilizate pentru producerea de precursori energetici, biosintetici și reductivi pentru celulele tumorigene [ 5 ]. Astfel, celulele tumorigene utilizează în mod clar cantități mai mari de glutamină și glucoză, comparativ cu celule non-tumorigene și senestive.

Glucoza și glutamina sunt cele mai importante elemente de construcție necesare pentru metabolismul și proliferarea ulterioară și procesele tumorigene1 ]. Totuși, datorită cerințelor metabolice în mare măsură diferite ale celulelor tumorigene, este de interes și de importanță să se investigheze efectele fiziologice ale concentrațiilor non-tumorigene ale glucozei și glutaminei asupra celulelor tumorigene. Acest lucru este deosebit de important deoarece deprivarea rezultă într-un răspuns canonic al aminoacidului (ASS) în celulele mamifere [ 6 ]. În plus, studiile de exprimare a genei efectuate pe tumori primare și metastatice au demonstrat că celulele metastatice sunt mai mult dependente de glicoliză în comparație cu fosforilarea oxidativă [ 7 ].

Acest studiu a investigat astfel influența corelării cantităților descendente de glutamină și glucoză asupra morfologiei, a potențialului membranei mitocondriale, a speciilor de oxigen reactiv (ROS) și a formării veziculelor acide după expuneri pe termen scurt (2 ore, 4 ore, 6 ore) receptorul de estrogen, receptorul metastatic negativ al celulei mamare și o linie celulară de carcinom cervical. În plus, după expunere, mediul a fost înlocuit cu mediu care conține o concentrație fiziologică tipică de glutamină și glucoză (1 mM și, respectiv, 6 mM), prin care celulele au fost lăsate să se prolifereze timp de 7 zile, după care a fost studiată și influența acestei expuneri.

materiale si metode

Linii celulare

Linia celulară de adenocarcinom cervical uman (HeLa) și o linie celulară de adenocarcinom mamar cu metastaze ridicate (MDA-MB-231) au fost alese pentru a demonstra efectele mediului care constă în stări metabolice variabile. Linia celulară HeLa a fost achiziționată prin intermediul Sterilab Services (Pty) Ltd, Johannesburg, Africa de Sud, din Colecția Americană a Culturilor de Țesuturi (ATCC), Maryland, Statele Unite ale Americii. Linia celulară HeLa este cea mai veche și cea mai distribuită linie celulară imortalizată care prezintă o creștere agresivă și se dublează în medie la fiecare 24 de ore [ 8 ]. Principala sursă de energie în celulele HeLa este mai degrabă glutamina decât glucoza, ceea ce demonstrează că fosforilarea oxidativă este preferențială pentru a genera ATP [ 9 ]. În plus, celulele HeLa sunt capabile să-și adapteze rețeaua, structura și funcția mitocondrială, în funcție de baza substratului, pentru a genera energie exclusiv din fosforilarea oxidativă prin remodelarea mitocondriilor sale [ 10 ].

Linia celulară MDA-MB-231 a fost furnizată de Microsep (Pty) Ltd Johannesburg, Africa de Sud. MDA-MB-231 este o linie de celule tumorale tumorale triple negative. Acest lucru indică faptul că celulele MDA-MB-231 nu exprimă receptori pentru hormoni steroizi (estrogen și progesteron), receptorul tirozin kinazei tip II (RTK) Her-2, dar posedă o reglare a citokeratinelor bazale și a răspunsului factorului de creștere epidermal [ 11-13 ]. Mai mult, linia celulară MDA-MB-231 este extrem de metastatică și prezintă activitate glicolitică crescută în condiții normoxice [ 14 ]. Celulele MDA-MB-231 utilizează în principal glicoliză, mai degrabă decât respirația mitocondrială, pentru a produce energia necesară pentru funcționarea și proliferarea celulelor [ 15 ]. În plus, celulele MDA-MB-231 conțin mitocondriile care prezintă mutații ale acidului deoxiribonucleic (ADN), ceea ce duce la scăderea metabolismului oxidativ [ 16 ].

Reactivi generali

(DMEM), precum și glucoză înaltă (25,52 mM, 4500 mg / l ), l- glutamină (4 mM) și piruvat de sodiu (1 mM de glucoză, l- glutamină și piruvat de sodiu) , 110 mg / l) conținând DMEM, bicarbonat, lglutamină, glucoză, tripsină, violet cristal, NaCI, KCI, KH2PO4 și Na2HP04, acridină portocalie și diacetat de 2,7dichlorofluoresceină (DCF-DA) au fost furnizate de Sigma Chemical Co. (St Louis, Statele Unite ale Americii). Serul de vițel fetal inactivat în căldură (FCS), baloane și plăci de culturi sterile sterile au fost obținute prin Sterilab Services (Kempton Park, Johannesburg, Africa de Sud). Penicilina, streptomicina și fungizona au fost achiziționate de la Highveld Biological Ltd (Pty). (Sandringham, Gauteng, Africa de Sud).

Proceduri generale de cultură celulară

Celulele s-au crescut și s-au menținut în baloane de cultură de țesut de 25 cm2 într-o atmosferă umidificată la 37 ° C, 5% C02 într-un incubator cu manșon de apă Forma Scientific (Ohio, Statele Unite ale Americii).Celulele au fost cultivate în DMEM cu glucoză 25,52 mM, l- glutamină 4 mM și piruvat de sodiu 1 mM suplimentat cu 10% ser fetal de vițel inactivat termic (56 ° C, 30 min), 100 U / ml penicilină G, 100 pg / ml streptomicină și fungizonă (250 μg / l). Mediile în funcție de starea metabolică au fost preparate 24 ore înainte de expunere și au fost autoclavate pentru a asigura sterilitatea.

Celulele au fost expuse la diferite condiții metabolice, după cum se descrie mai jos:

Control: DMEM cu glucoză 25,52 mM, l- glutamină 4 mM și piruvat de sodiu 1 mM suplimentat cu FCS inactivat termic 10% (56 ° C, 30 min), 100 U / ml penicilină G, 100 pg / ml streptomicină și fungizonă (250 pg / l).

Condiția experimentală 1: DMEM cu glucoză 6 mM, l- glutamină 1 mM și piruvat de sodiu 0 mM suplimentat cu FCS inactivat termic 10% (56 ° C, 30 min), 100 U / ml penicilină G, 100 ug / ml streptomicină și fungizonă (250 pg / l).

Condiția experimentală 2: DMEM cu glucoză 3 mM, l- glutamină 0,5 mM și piruvat de sodiu 0 mM suplimentat cu FCS inactivat termic 10% (56 ° C, 30 min), 100 U / ml penicilină G, 100 pg / ml streptomicină și fungizonă (250 pg / l).

Condiția experimentală 3: DMEM cu glucoză 0 mM, l- glutamină 0 mM și piruvat de sodiu 0 um suplimentat cu FCS inactivat termic 10% (56 ° C, 30 min), 100 U / ml penicilină G, 100 pg / ml streptomicină și fungizonă (250 pg / l).

Control pozitiv: Mediul de creștere care conține 0,1 pg / ml actinomicină D a fost utilizat drept control pozitiv pentru a induce moartea celulelor prin apoptoză.

Proceduri experimentale generale pentru expuneri pe termen scurt și experimente de recuperare:

Expunere pe termen scurt: Celulele au fost însămânțate la 500 000 de celule pe flacon de 25 cm2 sau 5000 celule / godeu în plăci cu microunde Nunc F96 (AEC-Amersham Soc (Ltd), Kyalami, Africa de Sud).După 24 de ore, celulele au fost expuse la diferite condiții metabolice timp de 2 ore, 4 ore și 6 ore. Ulterior, toate metodele experimentale s-au desfășurat așa cum este descris mai jos.

Experimentul de recuperare: Celulele au fost însămânțate la 60 000 de celule pe flacon de 25 cm2 sau 850 celule / godeu în plăci cu microunde Nunc F96 (AEC-Amersham Soc (Ltd), Kyalami, Africa de Sud).După 24 de ore, celulele au fost expuse la diferite condiții metabolice timp de 2 ore, 4 ore și 6 ore. Ulterior, celulele au fost spălate cu PBS și mediu a fost înlocuit cu DMEM conținând 6 mM glucoză și 1 mM glutamină. Mediul a fost ulterior înlocuit la fiecare 2 zile. Ulterior, toate metodele experimentale s-au desfășurat așa cum este descris mai jos.

Polarizare – contrast optic de interferență diferențial luminos

Contrastul de interferență diferențială difuză prin contrast polarizator (PlasDIC) este o metodă de contrast utilizată pentru vizualizarea morfologiei. PlasDIC afișează profilul de fază necesar, care este relativ la produsul grosimii secțiunii și diferența dintre indicele de refracție dintre mediul înconjurător și indicele mediu de refracție al cuarțului. PlasDIC are imagistică DIC de înaltă calitate a celulelor individuale, a clusterelor celulare și a celulelor individuale groase în vasele de culturi de celule plastice [ 16 , 17 ].PlasDIC s-a efectuat în conformitate cu Visagie și colab. 17 ].

Progresia ciclului celular și inducerea apoptozei

Citometria de flux a fost utilizată pentru a măsura conținutul de ADN al celulelor după expunerea la diferitele condiții metabolice și pentru a monitoriza efectul asupra progresiei ciclului celular [ 18 ]. Aceasta din urmă a fost realizată prin fixarea etanolului și colorarea cu iodură de propidiu care a fost realizată conform lui Mqoco și colab. 16 ]. Ciclul ciclului Fluorescența de iodură de propidiu a fost măsurată cu ajutorul citometrului de debit al sistemului de fluorescență (FACS) FC500 (Beckman Coulter South Africa (Pty) Ltd). Datele din cel puțin 10 000-30 000 de evenimente au fost analizate cu ajutorul softului CXP (Beckman Coulter South Africa (Pty) Ltd. (Pretoria, Gauteng, Africa de Sud) Distribuțiile ciclului celular au fost calculate cu Cyflogic 1.2.1 lansat 2008/11/19 (Perttu Terho & Cyflo Ltd) prin atribuirea conținutului relativ de ADN pe celulă la fracțiunile sub-G1, G1, S și G2M.

Potențialul membranei mitocondriale

O reducere a potențialului membranei mitocondriale este un indicator timpuriu al inducției apoptozei [ 19 ].Modificările în potențialul membranei mitocondriale au fost investigate folosind anticorpul mitocaptural BIOCOM biotech Pty (Ltd) (Clubview, Africa de Sud.) Mitocapture este un colorant cationic care se acumulează în mitocondriile celulelor sănătoase, însă Mitocapture nu este capabil să se acumuleze în mitocondriile celulele apoptotice datorită potențialului membranei mitocondriale modificate și prin urmare Mitocaptura rămâne în citoplasmă în forma sa monomerică (verde) [ 20 ]. După ce s-au urmat procedurile experimentale generale menționate mai sus, soluția diluată Mitocapture (amestecată conform instrucțiunilor furnizorilor) a fost au fost incubate timp de 60 de minute într-o atmosferă umidificată (37 ° C, 5% C02), probele fiind apoi incubate, fluorescența a fost măsurată la lungimea de undă de excitație de 485 nm și lungimea de undă de emisie de 520 nm utilizând fluorometria Departamentul de Farmacologie, Universitatea din Pretoria).

Generarea peroxidului de hidrogen

Generarea peroxidului de hidrogen a fost măsurată utilizând diacetat de 2, 7-diclorofluoresceină (DCFDA).DCFDA, o sondă nefluorescentă, care, după oxidare prin ROS și peroxizi, este transformată în DCF derivat puternic fluorescent [ 21 ]. După ce au fost urmate procedurile experimentale generale menționate mai sus, DCF-DA (200 pl, 10 uM) a fost pipetată la toate probele și apoi a fost incubată timp de 60 de minute într-o atmosferă umidificată (37 ° C, 5% CO2. la lungimea de undă de excitație de 485 nm și lungimea de undă de emisie de 520 nm utilizând fluorometria (Departamentul de Farmacologie, Universitatea din Pretoria).

Colorarea portocaliei de acridină

Acidina portocalie este un compus fluorescent lizosomotrop care se mișcă liber în membranele celulare atunci când este descărcat [ 22 ]. Cu toate acestea, acridina portocalie se acumulează în forma sa protonată în compartimentele acide și astfel servește ca un marker pentru organele veziculare acide, inclusiv vacuolele autofagice și lizozomii [ 22 ]. După ce s-au urmat procedurile experimentale generale menționate mai sus, s-a adăugat PBS conținând acridină portocală (200 pl, 5 mg / ml) la toate probele și probele au fost incubate timp de 60 de minute într-o atmosferă umidificată (37 ° C, 5% . Fluorescența a fost măsurată la lungimea de undă de excitație de 485 nm și lungimea de undă de emisie de 520 nm folosind fluorometria (Departamentul de Farmacologie, Universitatea din Pretoria).

Statistici

Au fost efectuate cel puțin trei experimente independente pentru toate tehnicile. Fiecare experiment independent fluorometric a avut o dimensiune a probei de 3. Valorile medii ale fiecărui experiment au fost reprezentate în bare grafice, cu barele T referindu-se la deviațiile standard. Valorile P <0,05 au fost considerate semnificative din punct de vedere statistic și au fost indicate printr-un asterisc (*). Datele privind progresia ciclului celular de la cel puțin 10 000-30 000 de evenimente au fost analizate utilizând software-ul CXP (Beckman Coulter Africa de Sud (Pty) Ltd. (Pretoria, Gauteng, Africa de Sud)).Distribuțiile ciclului celular au fost calculate cu Cyflogic 1.2.1 lansat în 2008/11/19 (Perttu Terho & Cyflo Ltd).

Rezultate

Degradarea glucozei și l- glutaminei duce la scăderea densității celulare și a celulelor rotunjite

Contrastul de interferență diferențială a difuziei optice difuzate prin contrastul polarizării (PlasDIC) a fost utilizat pentru a demonstra efectele deprivării glucozei și glutaminei asupra morfologiei liniei celulare epiteliale HeLa cervicală și a liniei celulare de celule mamare negative a receptorului estrogen metastatic.Deprivarea de glucoză și glutamină, indiferent de concentrațiile medii individuale, timp de 2 ore, a condus la o ușoară scădere a densității celulare în ambele linii celulare în comparație cu celulele propagate în mediu de creștere (Figura 1 ). Celulele erau încă atașate cu cele mai multe celule prezente în metafază.Celulele rotunjite și scintilate au fost de asemenea observate în celulele propagate în mediu cu glucoză 0-3 mM și glutamină 0-0,05 mM. În plus, cu cât sunt mai mici cantitățile de glucoză și glutamină, cu atât densitatea celulară este mai mică comparativ cu celulele propagate în mediul de creștere, ceea ce implică faptul că atât glucoza, cât și glutamina au roluri esențiale în proliferare și morfologie.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig1_HTML.jpg

Imaginile PlasDIC după expuneri pe termen scurt (2 ore, 4 ore, 6 ore) de foame de glutamină și de glucoză.Imaginile PlasDIC ale celulelor HeLa și MDA-MB-231 propagate în medii în funcție de starea metabolică și celule expuse actinomicinei D timp de 2 ore, 4 ore și 6 ore. Expunerea la DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 2 ore a dus la scăderea densității celulare. Expunerea la DMEM conținând glucoză 0 mM-3 mM și l -glutamină 0 mM-0,5 mM timp de 2 ore a determinat scăderea densității celulare și a celulelor scutite rotunjite. După 4 h, celulele propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină au prezentat o densitate scăzută a celulelor și celule rotunjite scrâșnite. Celulele propagate în mediu care conține cantități mici de glucoză și glutamină sau fără glucoză și glutamină timp de 4 ore au demonstrat densitatea celulară descrescătoare și numărul crescut de celule care apar rotunjite și scintilate în comparație cu celulele expuse la DMEM conținând 6 mM glucoză și 1 mM glutamină și celule propagate în mediu de creștere.Celulele propagate în DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 6 ore au demonstrat densitatea celulară scăzută și prezența unor celule rotunjite scrâșnite. Acesta din urmă a fost de asemenea observat cu celulele propagate în DMEM conținând glucoză 3 mM și l- glutamină 0,5 mM timp de 6 ore.Celulele propagate în DMEM conținând 0 mM glucoză și 0 mM glutamină timp de 6 ore au demonstrat, de asemenea, prezența unor celule rotunjite și scăderea densității celulare. Acesta din urmă a fost mai pronunțat în comparație cu celulele propagate în DMEM conținând glucoză 3-6 mM și mediu de creștere de l- glutamină 0,5-1 mM timp de 6 ore. După o expunere de 6 ore, celulele au fost în cea mai mare parte prezente în interfază cu celule încă atașate. Bara de scală în toate imaginile reprezintă 50 μm

PlasDIC a fost, de asemenea, utilizat pentru a demonstra deprivarea de glucoză și glutamină timp de 4 ore pe morfologia celulelor în celule HeLa și MDA-MB-231 (figura 1 ). După o expunere de 4 ore la DMEM conținând 6 mM glucoză și 1 mM glutamină, densitatea celulară este scăzută cu prezența unor celule rotunjite în ambele linii celulare. Alte reduceri la glucoză 3 mM și l- glutamină 0,5 mM însoțită de expunere timp de 4 ore au demonstrat scăderea densității celulare și a numărului crescut de celule rotunjite și scintilate. Deprivarea completă a glutaminei și a glucozei timp de 4 ore a dus la o reducere suplimentară a densității celulare, însoțită de prezența celulelor rotunjite și scutite. Cu toate acestea, toate celulele au rămas atașate după expunere și majoritatea celulelor au ocupat interfața. Mai mult, densitatea celulară a fost redusă mai proeminent după expunerea timp de 4 ore la mediul metabolic în comparație cu expunerea de 2 h.

Efectele deprivării glutaminei și glucozei asupra morfologiei au fost, de asemenea, investigate după 6 h (Figura 1 ). Celulele propagate în DMEM conținând glucoză 3-6 mM și l- glutamină 0,5-1 mM timp de 4 ore au demonstrat scăderea densității celulare și prezența unor celule rotunjite scrâșnite. Celulele propagate în mediu care nu conține glutamină și glucoză au demonstrat, de asemenea, prezența unor celule rotunjite și scăderea densității celulare. Acesta din urmă a fost mai pronunțat în comparație cu celulele propagate în DMEM conținând glucoză 3-6 mM și l- glutamină 0,5-1 mM. Ca și în cazul expunerilor timp de 2 ore și 4 ore, celulele au fost în cea mai mare parte prezente în interfaza cu celulele încă atașate.

Morfologia celulelor a fost, de asemenea, investigată în ceea ce privește posibilele recuperări și efectele pe termen lung ale concentrațiilor fiziologice tipice de glucoză și L-glutamină. Celulele HeLa și MDA-MB-231 au fost expuse în funcție de condiții metabolice variabile timp de 2 ore și 4 ore și 6 ore după care celulele au fost spălate și ulterior mediul a fost înlocuit cu DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 7 zile (Fig.2). Morfologia și densitatea celulară după 7 zile, prezentate cu celule scintite și formă alungită adesea însoțite de proeminențe de celule. Celulele MDA-MB-231 și HeLa propagate în mediu conținând 6 mM glucoză și 1 mM glutamină timp de 2 ore și 4 ore și lăsate 7 zile înainte de recuperare au demonstrat o dimensiune redusă a celulei și celulele MDA-MB-231 au fost alungite. Celulele propagate în DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 6 ore și lăsate 7 zile înainte de recuperare au demonstrat o dimensiune mai mare a dimensiunilor celulare și morfologia celulară alungită în ambele linii celulare. Celulele expuse la mediu care conține 0-0,5 mM L-glutamină și 3 mM glucoză au demonstrat, de asemenea, scăderea densității celulare și mărirea dimensiunii celulei în ambele linii celulare. Celulele MDA-MB-231 expuse la aceste condiții au demonstrat, de asemenea, celule alungite.Această tendință a devenit din ce în ce mai proeminentă, având o expunere crescută la ambele stări metabolice, atât cu cele două linii celulare, care au o morfologie alungită la 4 ore și 6 ore de expunere după 7 zile de recuperare, când au fost însoțite anterior cu celule neatasate.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig2_HTML.jpg

Salvarea nereușită a HeLa și MDA-MB-231 după 7 zile. Celulele HeLa și MDA-MB-231 propagate în mediu în starea metabolică timp de 2 ore, 4 ore și 6 ore, cu 7 zile în urmă, după care celulele au fost spălate și mediu a fost înlocuit cu DMEM conținând 6 mM glucoză și 1 mM glutamină . Efectele scăderii concentrațiilor de l-glutamină și glucoză au fost mai pronunțate la 7 zile după expunere în comparație cu cele din ziua expunerii.Efectele asupra densității celulare scăzute au fost, de asemenea, mai severe. Caracteristicile morfologice observate includ scăderea densității celulare, dimensiunea redusă a celulei și alungirea. Toate caracteristicile morfologice menționate mai sus au fost mai proeminente în DMEM conținând glucoză 0 mM și l- glutamină 0 mM în comparație cu celulele propagate în DMEM conținând glucoză 3 mM-6 mM și l -glutamină 0,5 mM-1 mM. Același lucru este valabil și pentru expunerile de 6 ore comparativ cu expunerile de 2 ore și 4 ore. Totuși, toate efectele menționate anterior au apărut mai devreme în linia celulară MDA-MB-213 în comparație cu linia de celule HeLa (mărire de 20x). Bara de scală în toate imaginile reprezintă 50 μm

Toate caracteristicile morfologice ale mărimii scurte a celulelor și alungirii au crescut cu cantități scăzute de L-glutamină și glucoză și perioade de expunere mai lungi. Totuși, toate efectele menționate anterior au apărut mai devreme în linia de celule MDA-MB-213 în comparație cu linia de celule HeLa care indică faptul că stările metabolice influențează linia celulară foarte metastatică mai proeminent. Mai mult, aceste date morfologice sugerează că există efecte de durată după ce celulele sunt lipsite de nutrienți, chiar și după ce mediul a fost înlocuit cu mediu care conține concentrații fiziologice ale nutrienților.

Dependența de glucoză dependentă de glucoză și deprivarea de l- glutamină determină apariția apoptozei și modificarea ciclului celular

Influența acestor medii diferite asupra progresiei ciclului celular a fost investigată utilizând fixarea etanolului, colorarea cu iodură de propidiu și citometria de curgere. Expunerea celulelor Hela și MDA-MB-231 la mediu conținând 6 mM glucoză și 1 mM glutamină a dus la creșterea numărului de celule în faza sub-G1, la scăderea numărului de celule care ocupă faza G1 și la un creșterea celulelor în faza G2M cu modificări nesemnificative statistic între expunere timp de 2 ore, 4 ore și 6 ore (tabelul 1 și figura 3 ).Schimbările în progresia ciclului celular au fost progresiv mai pronunțate atunci când celulele au fost expuse la mediu conținând cantități mai scăzute de glucoză și l- glutamină. În plus, influența mediilor în funcție de starea metabolică asupra progresiei ciclului celular a fost progresiv mai mare între diferite perioade de expunere atunci când mediul conține cantități descrescătoare de glucoză și l- glutamină.

tabelul 1

Histogramele de evoluție a ciclului histologic ale celulelor HeLa și MDA-MB-231 propagate în medii în funcție de starea metabolică pentru perioada de expunere adecvată (2 ore, 4 ore și 6 ore) (valoare P <0,05)

Probă Profil histogramă
Celulele HeLa s-au propagat în mediu de creștere timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figa_HTML.gif
Celulele HeLa s-au propagat în mediu de creștere timp de 4 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figb_HTML.gif
Celulele HeLa s-au propagat în mediu de creștere timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figc_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figd_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fige_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figf_HTML.gif
Celulele HeLa propagate în mediu conținând 3 mM glucoză și 0,5 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figg_HTML.gif
Celulele HeLa propagate în mediu conținând 3 mM glucoză și 0,5 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figh_HTML.gif
Celulele HeLa propagate în mediu care conține glucoză 3 mM și L-glutamină 0,5 mM timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figi_HTML.gif
Celulele HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 2 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figj_HTML.gif
Celule HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 4 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figk_HTML.gif
Celulele HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 6 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figl_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 2 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figm_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 4 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fign_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 6 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figo_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 2 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figp_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 4 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figq_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 6 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figr_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 2 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figs_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 4 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figt_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 6 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figu_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 2 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figv_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 4 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figw_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 0 mM și L-glutamină 0 mM timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figx_HTML.gif
Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig3_HTML.jpg

Progresia ciclului celular după expunerea parțială și completă la glutamină și glucoză pentru expuneri pe termen scurt și după 7 zile. Procentul de celule care ocupă fiecare fază a ciclului celular după ce celulele s-au propagat în mediu în funcție de starea metabolică pentru perioada de expunere adecvată (2 ore, 4 ore și 6 ore).Celulele Hela propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină au demonstrat o fracție crescută de sub-G1 și G2M. Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină au arătat de asemenea o fracție sub-G1 crescută. Celulele MDA-MB-231 și HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină au demonstrat o fracție crescută de sub-G1 și G2M.Celulele HeLa și MDA-MB-231 propagate în mediu care nu conține glucoză sau L-glutamină au demonstrat o creștere a numărului de celule apoptotice, iar celulele HeLa au prezentat de asemenea o creștere a fracției G2M. Efectele asupra ciclului celular și inducerea apoptozei în ziua 7 prin intermediul citometriei de curgere utilizând colorarea cu iodură de propidiu au arătat o inducție semnificativă a apoptozei în toate probele tratate.Celulele Hela- și MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină cu 7 zile înainte, de asemenea, au demonstrat o creștere a numărului de celule care ocupă faza S. Celulele MDA-MB-231 au prezentat, de asemenea, o creștere de 2 M. Celulele HeLa propagate în mediu care conține glucoză 3 mM și L-glutamină 0,5 mM s-au prezentat, de asemenea, cu o fracție G2M mărită. Celulele MDA-MB-231 propagate în DMEM conținând glucoză 0 mM-3 mM și l -glutamină 0 mM-0,5 mM au demonstrat un număr crescut de celule în faza S. Celulele Hela propagate în mediu care conține glucoză 0 mM și L-glutamină 0 mM timp de 2 ore și 4 ore au prezentat, de asemenea, o fază S crescută. Un asterisc (*) indică valoarea P <0,05

Expunerea la mediu conținând glucoză 3 mM și l- glutamină 0,5 mM în celule Hela timp de 2 ore a condus la 11% din celule fiind prezente în faza sub-G1, 63% în faza G1, 7% în faza S și 19% în faza G 2 M.Totuși, după 4 ore, 14% din celule s-au aflat în faza sub-G1, 48% în faza G1, 8% în faza S și 31% în faza G2M. După 6 ore de expunere, 15% dintre celule au fost în faza sub-G1, 34% în faza G1, 8% în faza S și 43% în faza G2M. Mediul de expunere care conține glucoză 3 mM și l- glutamină 0,5 mM în MDA-MB-231 timp de 2 ore a condus la prezența a 9% din celule în faza sub-G1, 46% în faza G1, 15% fază și 30% în faza G 2 M. După expunerea la mediu conținând 3 mM glucoză și 0,5 mM glutamină timp de 4 ore, 10% din celule au fost în faza Sub-G1, 59% în faza G1, 10% în faza S și 21% faza G2M. După 6 ore de expunere, 21% dintre celule au fost în faza sub-G1, 54% în faza G1, 10% în faza S și 16% în faza G2M.Aceste tendințe au continuat cu expunerea celulelor la mediu conținând glucoză 0 mM și l- glutamină 0 mM.

În plus, s-au investigat și efectele de salvare și pe termen lung ale concentrațiilor fiziologice de glucoză și L-glutamină. Aceasta s-a realizat prin expunerea liniilor celulare la mediu în funcție de diferite condiții metabolice pentru perioada corespunzătoare înainte ca celulele să fie spălate cu PBS și mediul a fost înlocuit cu glucoză 6 mM și 1 mM glutamină (mediu a fost înlocuit la fiecare 2 zile). Efectele asupra ciclului celular și inducerea apoptozei în ziua 7 sunt demonstrate în tabelul 2 și în figura 3 . Celulele care se referă la acest grup de expunere au prezentat date privind progresia ciclului celular care indică o inducere semnificativă a apoptozei. Fracțiunile sub-G1 au crescut cu scăderea cantităților de glucoză și l- glutamină și creșterea perioadelor de expunere (2 ore, 4 ore și 6 ore).

tabel 2

Histogramele de evoluție a ciclului histologic ale celulelor HeLa și MDA-MB-231 propagate în medii în funcție de starea metabolică pentru perioada de expunere adecvată (2 ore, 4 ore și 6 ore) cu 7 zile în urmă, care după spălarea celulelor și înlocuirea mediului cu condiția 1 mediu (valoare P<0,05)

Probă Profil histogramă
Celulele HeLa s-au propagat în mediu de creștere timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figy_HTML.gif
Celulele HeLa s-au propagat în mediu de creștere timp de 4 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figz_HTML.gif
Celulele HeLa s-au propagat în mediu de creștere timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figaa_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figab_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figac_HTML.gif
Celule HeLa propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 6 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figad_HTML.gif
Celulele HeLa propagate în mediu conținând 3 mM glucoză și 0,5 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figae_HTML.gif
Celulele HeLa propagate în mediu conținând 3 mM glucoză și 0,5 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figaf_HTML.gif
Celulele HeLa propagate în mediu care conține glucoză 3 mM și L-glutamină 0,5 mM timp de 6 ore Un fișier extern de îngrijire conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figag_HTML.gif
Celulele HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figah_HTML.gif
Celule HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figai_HTML.gif
Celulele HeLa propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 6 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figaj_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 2 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figak_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 4 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figal_HTML.gif
Celulele MDA-MB-231 propagate în mediu de creștere timp de 6 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figam_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 2 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figan_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 4 ore Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figao_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 6 mM glucoză și 1 mM L-glutamină timp de 6 ore Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figap_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figaq_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 4 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figar_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 3 mM și L-glutamină 0,5 mM timp de 6 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Denumirea obiectului este 13578_2015_30_Figas_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 2 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figat_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând 0 mM glucoză și 0 mM L-glutamină timp de 4 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Figau_HTML.gif
Celulele MDA-MB-231 propagate în mediu conținând glucoză 0 mM și L-glutamină 0 mM timp de 6 ore Un fișier extern de îngrijire deține o imagine, o ilustrație etc. Obiectul nume este 13578_2015_30_Figav_HTML.gif

Celulele Hela și MDA-MB-231 propagate în DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 7 zile au demonstrat atât o creștere a celulelor apoptotice (faza sub-G1), cât și o creștere a fazei S. Celulele MDA-MB-231 prezintă, de asemenea, o fază G2 M mărită atunci când sunt expuse la DMEM conținând glucoză 6 mM și l- glutamină 1 mM în întregime. Celulele Hela propagate în DMEM conținând glucoză 3 mM și l- glutamină 0,05 mM și lăsate la 7 zile de recuperare propagate în DMEM conținând glucoză 6 mM și l- glutamină 1 mM prezentată, de asemenea, cu un vârf apoptotic sub-G1 și o fază G2M mărită.Celulele MDA-MB-231 expuse la DMEM conținând glucoză 3 mM și l- glutamină 0,5 mM au prezentat o creștere foarte proeminentă în faza S. Toate creșterile menționate mai sus ale numărului de celule care ocupă respectivele faze ale ciclului celular au fost asociate cu o scădere corespunzătoare a celulelor care ocupă faza G1. Celulele HeLa expuse la DMEM care nu conține glucoză sau l- glutamină pentru perioade scurte de expunere și au permis o recuperare de 7 zile în DMEM conținând 6 mM glucoză și 1 mM glutamină au arătat o creștere a numărului de celule care ocupă faza S.MDA-MB-231 celule expuse la DMEM care nu conține glucoză sau l -glutamină pentru perioade de expunere scurtă și permis de 7 zile de recuperare în DMEM conținând 6 mM glucoză și 1 mM l -glutamină a dus la o creștere a numărului de celule în faza S ; cel mai proeminent în 2 h, urmat de 4 h și în final de 6 h însoțită de o creștere constantă a numărului de apoptoză (sub-G 1 ) celule și numărul de celule din G 1 faza.

Degradarea/lipsa glucozei și l- glutaminei duce la depolarizarea potențialului membranei mitocondriale

Acest studiu a investigat în continuare inducerea apoptozei prin demonstrarea efectului diferitelor condiții metabolice asupra potențialului membranei mitocondriale. Calea apoptotică intrinsecă implică pierderea potențialului de membrană mitocondrială rezultând eliberarea citocromului c și activarea ulterioară a caspazei [ 9 ]. Rezultatele au indicat că potențialul membranei mitocondriale a celulelor expuse la DMEM care nu conțin glucoză sau l -glutamină a fost afectată cel mai mult în ambele linii de celule (Fig. 4a și șib).b). În plus, celulele MDA-MB-231 au fost, de asemenea, mai afectate în general, în comparație cu celulele HeLa. Recuperarea și formarea de colonii după 7 zile de propagare în DMEM conținând 6 mM glucoză și 1 mM l -glutamină au indicat faptul că celulele MDA-MB-231 sunt în continuare afectate mai vizibil (Fig. 4c și șid).d ). Celulele HeLa au prezentat, de asemenea, un număr semnificativ de celule care posedă un potențial redus de membrană mitocondrială după expunerea la mediu care nu conține glucoză sau l-glutamină, chiar 7 zile după retragerea mediului și înlocuirea cu DMEM conținând 6 mM glucoză și 1 mM l-glutamină. MDA-MB-231 a fost afectată de orice variație a stării metabolice a mediei cu DMEM conținând glucoză 0-3 mM și l- glutamină 0-0,5 mM rezultând cel mai vizibil prezentat potențial al membranei mitocondriale reduse.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig4_HTML.jpg

Potențialul membranei potențialului mitocondrial, după expunerea parțială și completă la glutamină și glucoză, pentru expuneri pe termen scurt și după 7 zile. Potențialul membranei mitocondriale a celulelor HeLa ( a ) și a celulelor MDA-MB-231 ( b ) expuse la mediu constând în diferite condiții metabolice. Celule expuse la mediu care nu conține glucoză sau l- glutamină au fost singurele probe cu potențial redus de membrană mitocondrială care indică inducerea apoptozei. Fluorometria și mitocaptura au demonstrat că recuperarea nereușită și formarea coloniilor au demonstrat că linia de celule HeLa ( c ) a fost afectată mai puțin decât linia celulară MDA-MB-231 ( d ). S-au observat mici modificări la celulele HeLa expuse la DMEM conținând glucoză 3 mM-6 mM și l -glutamină 0,5 mM-1 mM. Cu toate acestea, celulele expuse la mediu conținând glucoză 0 mM și L-glutamină 0 mM au demonstrat o schimbare semnificativă statistic în potențialul membranei mitocondriale. Cu privire la liniile celulare MDA-MB-231, toate cele trei stări metabolice au afectat  potențiale celulare ale membranei mitocondriale expuse la DMEM conținând glucoză 0 mM-3 mM și l-glutamină 0 mM-0,5 mM cea mai proeminentă. Un asterisc (*) indică valoarea P <0,05

Restabilirea celulară nereușită demonstrează creșterea generării de peroxid de hidrogen

Producția de peroxid de hidrogen a fost determinată prin intermediul unui DCFDA care, după oxidare prin ROS și peroxizi, este transformat în DCF derivat puternic fluorescent [ 21 , 22 ]. Expunerea la diferite medii nu au schimbat producția de peroxid de hidrogen , în primele șase ore după expunere (Fig. 5a și și.b ). Totuși, rezultatele liniilor celulare au permis recuperarea după 7 zile după propagarea timp de 7 zile în DMEM conținând glucoză 6 mM și l- glutamină 1 mM au demonstrat că efectele diferitelor medii metabolice au afectat în continuare funcționarea celulară și producerea de ROS după înlocuirea cu DMEM conținând 6 mM glucoză și 1 mM 1-glutamină așa cum este indicat de creșterea producției ROS în toate liniile de celule expuse la medii metabolice variate (Fig. 5c și șid).d ). In linia de celule HeLa, producția ROS a crescut mai vizibil atunci când este expus la DMEM conținând glucoză 6 mM și 1 mM l -glutamină urmată de scăderea sumelor și glutamină conținând glucoză. Rezultatele au arătat, de asemenea, că celulele MDA-MB-231 propagate în mediu de creștere au produs cantități mai mari de ROS posibil datorită naturii lor înalt glicolitic și metastatic. Totuși, mediile metabolice au crescut, de asemenea, producția lor de ROS, cel mai vizibil prin DMEM conținând 3 mM glucoză și 0,05 mM l- glutamină .

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig5_HTML.jpg

Producția de peroxid de hidrogen după expunerea parțială și completă la glutamină și glucoză pentru expuneri pe termen scurt și după 7 zile. Generarea peroxidului de hidrogen în celulele HeLa ( a ) și MDA-MB-231 ( b ) după expunerea la medii care prezintă diferite condiții metabolice nu s-a schimbat în nici un fel semnificativ din punct de vedere statistic (valoare P > 0,05). În plus, recuperarea celulelor prin propagarea celulelor HeLa expuse ( c ) și MDA-MB-231 ( d ) în DMEM conținând 6 mM glucoză și 1 mM glutamină timp de 7 zile a fost nereușită și a demonstrat creșterea producției de peroxid de hidrogen. Un asterisc (*) indică valoarea P <0,05

Eșecul celulelor nereușite demonstrează creșterea colorării lizozomale

Acidina portocalie este un compus fluorescent lizosomotrop care se mișcă liber în membranele celulare atunci când este descărcat. Totuși, acridina portocalie se acumulează în compartimentele sale acide de formare protonată și servește astfel ca un marker pentru organele veziculare acide, incluzând vacuole autofagice și lizozomi [ 23 ]. Expunerea inițială de 6 h la mediu care constă din diferite stări metabolice nu au ca rezultat o colorație a crescut semnificativ lizozomale în oricare linie de celule (Fig. 6a și șib).b ). Celulele care au fost expuse la diferite stări metabolice, urmate de recuperarea timp de 7 zile în DMEM conținând 6 mM glucoză și 1 mM l-glutamină a demonstrat o colorare lizozomale crescută indică o creștere în compartimentele acide și formarea de vacuole (Fig. 6c și anddd ).

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 13578_2015_30_Fig6_HTML.jpg

Colorarea portocalie de acridină după înjunghierea parțială și completă a glutaminei și a glucozei pentru expuneri pe termen scurt și după 7 zile. Culoarea portocalie de acridină a celulelor HeLa ( a ) și MDA-MB-231 ( b ) după expunerea la medii care prezintă diferite condiții metabolice. Producția de portocale de acridină nu s-a schimbat în nici un fel semnificativ din punct de vedere statistic atunci când a fost expusă acestor condiții metabolice (valoare P > 0,05). Colorarea portocaliei de acridină și formarea coloniilor după 7 zile în celulele HeLa ( c ) și MDA-MB-231 ( d ). Rezultatele au demonstrat că deprivarea de glucoză și glutamină afectează zilele de funcționare a celulelor după expunere, fiind întreruptă cu toată expunerea la medii condiționate, ceea ce demonstrează o creștere a colorării acridinei portocalii, ceea ce sugerează o creștere a acidității. Un asterisc (*) indică valoarea P <0,05

Discuţie

Celulele canceroase exercită mai multe mutații genetice intrinseci (care afectează p53, MYC, AMPK, PI3K și HIF1) și răspunsuri extrinseci la mediul tumoral (hipoxie și aciditate). Acest lucru are ca rezultat un metabolism celular modificat, generând cantități mari de ATP, rezultând proliferarea sporită, sinteza macromoleculară crescută și echilibrul unei homeostaze redox delicate [ 2 ].

Multe celule tumorigene metabolizează cantități mult mai mari de glucoză decât lactatul în glicoliza aerobă. Acest lucru este cunoscut ca efectul Warburg și acest lucru apare chiar și în prezența respirației mitocondriale [ 24 ]. O sursă majoră de energie în metabolizarea celulară este glucoza care este metabolizată în piruvat în glicoliză și oxidată în continuare pentru a forma dioxid de carbon generând ATP în ciclul acidului tricarboxilic. Metabolismul glutaminei contribuie la precursorii biomasei deoarece este o sursă majoră de carbon și azot [ 25 ].

Acest studiu a investigat necesitatea de glucoză și l- glutamină în proliferarea și funcționarea celulelor(canceroase). Acest lucru a fost realizat prin demonstrarea efectelor mediilor cu stări metabolice diferite, care conțin concentrații scăzute de glucoză sau l- glutamină, într-o linie celulară de adenocarcinom cervical uman (HeLa) și o linie celulară de adenocarcinom mamar cu metastaze (MDA-MB-231) pe morfologie , progresia ciclului celular, generarea de peroxid de hidrogen și moartea celulară prin inducerea apoptozei și autofagiei.

Constatările morfologice demonstrează că scăderea cantităților de glucoză și l- glutamină în mediul de creștere a dus la scăderea densității celulare în ambele linii celulare. Aceste efecte au fost mai pronunțate la 7 zile după ce mediul de expunere a fost înlocuit cu mediu conținând 6 mM glucoză și 1 mM L-glutamină. Deoarece glucoza este o sursă esențială de carbon și energie necesară pentru supraviețuirea și proliferarea celulară, deprivarea glucozei are ca rezultat o eșec al inducției enzimelor glicolitice cu încetarea ulterioară a diviziunii celulare26 ]. De asemenea, s-a descoperit că privarea de glucoză induce citotoxicitatea în linia celulară de carcinom multirezistent (MCF-7 / ADR). În decurs de 10 minute, mai multe căi de semnalizare incluzând proteine ​​kinazele reglementate extracelular (ERK1 / 2), Lyn Kinase (o srcfamily kinase) și c-Jun kinaza N-terminală (JNK) au fost activate. Activarea ERK1 / 2 are ca rezultat generarea ulterioară a ROS crescută. ERK1 / 2 sunt membri ai familiei protein kinazei activate mitogen (MAPK) [ 27]. MAPK este responsabil pentru fosforilarea substraturilor nucleare, inclusiv factorii de transcripție reglementați redox ( c- Myc și c- fos) implicați în răspunsurile celulare la stresul oxidativ [ 28 ].

Date progresie celulare au sugerat ca privarea de glutamină și glucoză a dus la un G 2 M bloc după 2-6 h în linia de celule HeLa și 2-4 h în linia de celule MDA-MB-231 însoțit cu o inducere crescută a apoptozei în ambele linii celulare. Privarea de glucoză într – o linie de celule murine non-leukemic (32Dcl23), transformată 32Dcl23 linie celulară și linia celulară de fibrosarcom (KHT-C2-LP1) , de asemenea , a condus la intrerupere G 2 M  [ 29 , 30 ]. Mai mult, a fost larg raportat că rezultatele privării de glutamină în celulă intrerupe ciclu g1 în celulele netransformate. Privarea Glutamina într – o linie de celule umane hepatocarcinom (Hep3B) a condus la exprimarea semnificativă modificată a genelor legate de G 2Faza M și punctul de control al vătămării ADN, incluzând oprirea creșterii și AD 45-inducibil, gama (GADD45G) [ 31 ]. Abcouver și colab. [ 32 ] au raportat, de asemenea, că privarea de glutamină în celulele mamare carcinom ductal primar (TSE) și celulele epiteliale mamare (HBL) a dus la o creștere rapidă a transcripției GADD45 și a ADN-ului inductibil cu deteriorarea ADN 3 (GADD153). Ciclul celular de date progresie a demonstrat , de asemenea , un număr crescut de celule care ocupă G 2 faza M dupăe privarea de glutamină. stop celule tumorigene K-Ras-conduse in oricare faza S sau G 2M are loc  la privarea de glutamină32 , 33]. Glutamina sau deprivarea glucozei are ca rezultat, de asemenea, letalitatea sintetică a diferiților compuși specifici din faza celulară antitumorală. De exemplu, deprivarea de glutamină în asociere cu capecitabină sau paclitaxel a determinat moartea celulară îmbunătățită5 ]. Creșterea celulelor care ocupă G 1 fază după expunerea la medii de creștere conținând scăderea cantităților de glutamină și de glucoza sugerează inducerea apoptozei. Diferite rapoarte verifică inducerea apoptozei prin deprivarea de glucoză sau glutamină observată aici, incluzând celulele renale umane embrionare (HA1E) și linia celulară de fibroblaste embrionare de șoarece (NIH3T3)34 ].

În timpul căii apoptotice intrinseci, semnalizarea celulară de stres conduce la permeabilizarea membranei externe mitocondriale care rezultă în eliberarea citocromului c în activarea citosolului caspazei [ 31 ]. Acest lucru este susținut de rapoartele anterioare în care deprivarea de glucoză în celule FL5.12 hemapoietice, neutrofilele umane și de șobolan au dus la depolarizarea potențialului membranei mitocondriale [ 35 , 36 ]. Astfel, inducerea apoptozei a fost verificată prin constatări suplimentare de citometrie în flux care demonstrează că expunerea la mediul care conține glucoză scăzută și  cantitățile de l-glutamină au determinat o reducere a potențialului membranei mitocondriale. Studiile de ultrastructură mitocondrială au evidențiat faptul că înfometarea completă a glucozei timp de 6 h-9 h a dus la o fragmentare mitocondrială crescută, în timp ce reducerea glucozei sau a foametei complete cu glutamină a determinat alungirea mitocondrială. În același timp, înfometarea glucozei și a glutaminei conduce, de asemenea, la mitocondriile fuzionate [ 35]. Lipsa de glutamină în celulele carcinomului pulmonar uman (A549) a demonstrat mitocondriile dense fără alte modificări structurale mitocondriale anormale. Suplimentarea cu glutamină (1 mM) a determinat o creștere a numărului de mitocondrii însoțită de dimensiunea mitocondriilor mari. Pata potențial sensibilă cu clorometiltetrametilsamine (CMTMRos) în același studiu a demonstrat că deprivarea completă a glutaminei a dus la mitocondriile mai puțin rotunde și nu la fel de dens în jurul nucleului în comparație cu celulele cultivate în mediu conținând 1 mM glutamină. Mitocondria a avut în ambele condiții structuri filamentoase subțiri [ 36 ].

Eliberarea citochromului c este un alt semn distinctiv al căii apoptotice intrinseci și a fost observată după deprivarea de glutamină în celulele FL5.12, hibridoamele murine KB26.5 [ 37 , 38 ]. Un alt studiu a arătat că deprivarea de glutamină în linia celulară de hibridom murin (Sp20) conduce la eliberarea citocromului cși a SMAC / DIABLO însoțită de translocarea Bax la mitocondriile și activarea caspazei 9, care sunt toate caracteristicile căii intrinseci [ 39 ]. Mai mult, deprivarea de glutamină în fibroblastele transformate de myc a demonstrat că inhibarea bcl-2 și caspazei 9 a împiedicat moartea celulelor să verifice inducerea căii intrinseci [ 37]. Lipsirea de glutamină în celulele leucemiei limfoblastice CD4 + (clona CEM 13), celulele leukeumiei limfoblastice umane (CEM-CCRF) și celulele promileeloblaste umane (HL-60) au condus de asemenea la contracția și activarea receptorilor CD95 sugerând implicarea căilor extrinseci [ 40 ] .

Acest studiu a demonstrat că deprivarea de glucoză și l- glutamină a dus la creșterea producției de peroxid de hidrogen după o perioadă de recuperare de 7 zile în ambele linii celulare. Un mediu scăzut în glucoză are ca rezultat o fosforilare oxidativă crescută pentru aprovizionarea adecvată cu ATP; acest lucru ar conduce la o reducere suplimentară a etc(lanțul de transport al electronilor) cu ROS crescută ulterior. Creșterea ROS (peroxidul de hidrogen și superoxid) se datorează producției reduse de nicotinamidă adenină dinucleotidă și piruvat în sistemul fosfat de pentoză și respectiv în glicoliza [ 41 ].

Mai multe rapoarte au indicat de asemenea că privarea de glucoza cauzat de asemenea , producția crescută de peroxid de hidrogen în mai multe linii de celule , inclusiv chineză linie hamster de celule ovariene (CHO), linie de celule umane de carcinom hepatic (Hep2G), uman carcinomul pancreatic (PANC1) și fibroblaste umane [ 42 – 45 ]. Degradarea glucozei care are ca rezultat stresul oxidativ a crescut, de asemenea, asocierea dintre proteina asociată cu moartea 6 (DAXX), kinaza 1 de reglare a semnalelor de apoptoză (ASK1) și relocarea DAXX din nucleu în citoplasmă. Aceasta este importantă deoarece DAXX mediază recrutarea ASK1 la FAS necesară pentru apoptoza mediată de Fas. [ 44 ]. Owada și colab. [ 43] a demonstrat că creșterea peroxidului de hidrogen a rezultat din privarea glucozei în celulele Hep2G și PANC1 a demonstrat fosforilarea și activarea ulterioară AKT [ 43 , 45 ].

Concluzie

Acest studiu a demonstrat că expunerea la scăderea cantităților de glucoză sau l -glutamină a dus la scăderea densității celulare, G 2 M bloc și inducerea apoptozei în câteva ore. După 7 zile de a fi cultivate în DMEM conținând glucoză 6 mM și 1 mM l -glutamină efectele menționate mai sus sunt mai proeminente însoțită de o reducere a potențialului și creșterea colorația acridin orange membranei mitocondriale , în ambele linii celulare. În plus, linia celulară foarte glicolitică și metastatică a fost afectată mai mult în comparație cu linia celulară de carcinom cervical. Acest studiu contribuie astfel la cunoașterea efectelor in vitro și a transducției semnalului privarii de glucoză sau  de glutamină în liniile celulare tumorigene. Cercetările ulterioare sunt imperative, deoarece pot identifica noi obiective pentru chimioterapie în lupta continuă împotriva cancerului.

Logo-ul celbio

BioMed Central Biomed Central Web Site search submit a manuscript register this article Cell & Bioscience Journal Front Page
Cell Biosci . 2015; 5: 37.
Publicat online 2015 Jul 8. doi: 10.1186 / s13578-015-0030-1
PMCID: PMC4518607
PMID: 26225207
Influența deprivării /lipsirii parțiale și complete a glutaminei și glucozei asupra liniilor celulare tumorigene de sân și cervic

Recunoasteri

Acest studiu a fost susținut de subvenții acordate de Asociația pentru Cancer din Africa de Sud, Trustul Struwig Germeshuysen, RESCOM (Consiliul de Cercetare al Universității din Pretoria), Fundația de Cercetare Națională din Africa de Sud și Consiliul de Cercetare Medicală. L Liebenberg, EH Matthews și GE Mathews au asistat la obținerea unor fonduri suplimentare.

Note de subsol

Concurenți interesați

Autorii declară că nu există interese concurente.

Contribuțiile autorilor

TVM și MHV au fost implicate în proiectarea, interpretarea datelor și efectuarea experimentelor. MHV a făcut analiza statistică în acest proiect și a redactat manuscrisul. AMJ a fost implicat în planificarea acestui proiect, supravegherea proiectului și editarea manuscrisului. LL, EHM, GEM și AMJ au contribuit la planificarea și finanțarea necesare pentru acest proiect. GEM a asistat de asemenea la editarea manuscrisului. Toți autori au citit și au aprobat manuscrisul final.

Informații despre colaboratori

Michelle Helen Visagie, Telefon: +27 12 3192245, az.ca.pu@eigasiv.ellehcim .

Thandi Vuyelwa Mqoco, az.ca.pu@ocoqm.idnaht .

Leon Liebenberg, moc.xobloothcraeser@grebnebeill .

Edward Henry Mathews, moc.xobloothcraeser@swehtamhe .

George Edward Mathews, az.ca.uwn@64007202 .

Anna Margaretha Joubert, az.ca.pu@trebuoj.einna .

Referințe

1. Hensley CT, Wasti AT, BeBeradinis RJ. Glutamina și cancerul: biologie celulară, fiziologie și oportunități clinice. J Clin Invest. 2015; 123 : 3678-3694. doi: 10.1172 / JCI69600. Articol gratuit PMC ]PubMed ] [ CrossRef ]
2. Cairns RA, Harris IS, Mak TW. Reglarea metabolismului celulelor canceroase. Nat Rev Cancer. 2011;11 : 85-95. doi: 10.1038 / nrc2981. PubMed ] [ CrossRef ]
3. Shanware NP, Bray K, Abraham RT. Rețelele PI3K, metabolice și autofagice: parteneri interactivi în sănătatea și bolile celulare. Annu Rev Pharmacol Toxicol. 2013; 53 : 89-106. doi: 10.1146 / anurev-pharmtox-010611-134717. PubMed ] [ CrossRef ]
4. Lozy F, Karantza VG. Autofagia și metabolismul celulelor canceroase. Semin Cell Dev Biol. 2012; 23 : 395-401. doi: 10.1016 / j.semcdb.2012.01.005. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
5. Qie S, Liang D, Yin C, Gu W, Meng M, Wang C. și colab. Deprivarea de glutamină și epuizarea glucozei declanșează inhibarea creșterii prin reprogramarea expresiei genetice distincte. Ciclul celulei. 2012; 11 : 3679-3690. doi: 10,4161 / cc.21944. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
6. Kung HN, Marks JR, Chi JT. Glutamin sintetaza este un determinant genetic al independenței glutaminei specifice tipului celular în epiteliul mamar. PLoS Genet. 2011; 7 : e1002229. doi: 10.1371 / journal.pgen.1002229. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
7. Sottnik JL, Lori JC, Rose BJ, Thamm DH. Inhibarea glicolizei prin 2-deoxi-D-glucoză revine la fenotipul metastatic in vitro și in vivo. Clin Exp. Metastasis. 2011; 28 : 865-875. doi: 10.1007 / s10585-011-9417-5. PubMed ] [ CrossRef ]
8. Rahbari R, Sheahan T, Modele V, Collier P, Macfarlane C, Badge RM. Un nou marker retrotransposon L1 pentru identificarea liniei celulare HeLa. Biotechniques. 2009; 46 : 277-284. Articol gratuit PMC ] [ PubMed ]
9. Jose C, Bellance N, Rossignoi R. Alegerea dintre glicoliza și fosforilarea oxidativă: o dilemă a tumorii? Biochim Biophys Acta. 1807; 2011 : 552-561. PubMed ]
10. Rossignol R, Gilkerson R, Aggeler R, Yamagata K, Remington SJ, Capaldi RA. Substratul de energie modulează structura mitocondrială și capacitatea oxidativă în celulele canceroase. Cancer Res. 2014; 64 : 986-993. PubMed ]
11. Corkery B, Crown J, Clynes M, Donovan N. Receptorul factorului de creștere epidermal ca potențială țintă terapeutică în cancerul de sân triplă negativ. Ann Oncol. 2009; 20 : 862-867. doi: 10.1093 / anonc / mdn710. PubMed ] [ CrossRef ]
12. Sala DD, Wu Y, Domann FE, Spitz DR, Anderson ME. Activitatea mitocondrială a calciului uniporter este dispensabilă pentru supraviețuirea celulelor carcinomului mamar MDA-MB-231. Plus unu. 2014; 9 : e96866. doi: 10.1371 / journal.pone.0096866. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
13. Liu B, Fan Z, Edgerton SM, Deng XS, Alimova IN, Lind SE, și colab. Metforminul induce răspunsuri biologice și moleculare unice la celulele cu cancer triplă cu cancer de sân. Ciclul celulei. 2009; 8 : 2031-2040. doi: 10.4161 / cc.8.13.8814. PubMed ] [ CrossRef ]
14. Robey IF, Lien AD, Welsh SJ, Baggett BK, Gillies RJ. Factorul-1a și fenotipul glicolitic inductibil de hipoxie în tumori. Neoplazia. 2005; 7 : 324-330. doi: 10.1593 / neo.04430. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
15. Palorini R, Simonetto T, Cirulli C, Chiaradonna F. Inhibitorii complexului 1 mitocondrial și fosforilarea forțată oxidativă sinergiză în inducerea morții celulelor canceroase. Int J Cell Biol. 2013; doi: 10.1155 / 2013/243876. Articol gratuit PMC ] [ PubMed ]
16. Mqoco TV, Visagie MH, Albrecht C, Joubert AM. Interacțiunea celulară diferențială dintre extractele de fructosc de Sutherlandia asupra celulelor mamare tumorigene și non-tumorigene. S Afr J Bot. 2014; 90 : 59-67. doi: 10.1016 / j.sajb.2013.10.008. CrossRef ]
17. Visagie MH, Birkholtz LM, Joubert AM. Analogul 17-beta-estradiol inhibă proliferarea celulară prin apoptoza de inducție în liniile de celule mamare. Microsc Res Tech. 2014; 77 : 236-242. doi: 10.1002 / jemt.22334. PubMed ] [ CrossRef ]
18. Ekim B, Magnuson B, Acosta-Jaquez HA, Keller JA, Feener EP, Fingar DC. mTOR fosforilarea domeniului kinazei promovează semnalizarea mTORC1, creșterea celulelor și progresia ciclului celular.Mol Cell Biol. 2011; 31 : 2878-2801. doi: 10.1128 / MCB.05437-11. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
19. Yoon JC, Ling AJY, Isik M, Lee DD, Steinbaugh MJ, Sack LM și colab. GLTSCR2 / PICT1 leagă stresul mitocondrial și semnalizarea Myc. Proc Natl Acad Sci SUA A. 2014; 11 : 3781-3786. doi: 10.1073 / pnas.1400705111. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
20. Takai N, Ueda T, Nishida M, Nasu K, Nahara H. Bufalin induce inhibarea creșterii, stoparea ciclului celular și apoptoza în celulele cancerului endometrial și ovarian uman. Int J Mol Med. 2008; 21 : 637-643.PubMed ]
21. Costa A, Scholer-Dahirel A, Mechta-Grigoriou F. Rolul speciilor reactive de oxigen și al metabolismului asupra celulelor canceroase și a micro-mediului acestora. Semin Cancer Biol. 2014; 26 : 23-32. doi: 10.1016 / j.semcancer.2013.12.007. PubMed ] [ CrossRef ]
22. Yao ZF, Cao J, Xu LM, Sun XC, Kang J, Yang G și colab. Perfluoroctan sulfonatul blochează fluxul de autofagie și permeabilizarea membranelor lizozomale induse în celulele HepG2. Food Chem Toxicol. 2014; 67 : 96-104. doi: 10.1016 / j.fct.2014.02.017. PubMed ] [ CrossRef ]
23. Kusuzaki K, Murata H, Takeshita H, Hashiguchi S, Nozaki T, Emoto K, și colab. Situri de legare intracelulare a portocaliei acridine în celulele osteosarcomului vii. Anticancer Res. 2000; 20 : 971-975. PubMed ]
24. Koppenol WH, Bounds PL, Dang CV. Contribuțiile lui Otto Warburg la conceptele actuale ale metabolismului cancerului. Nat Rev Cancer. 2011; 11 : 325-337. doi: 10.1038 / nrc3038. PubMed ] [ CrossRef ]
25. Luntul SY, Vander Heiden MG. Glicoliza aerobă: satisfacerea cerințelor metabolice ale proliferării celulare. Annu Rev Cell Dev Biol. 2011; 27 : 441-464. doi: 10.1146 / anurev-cellbio-092910-154237. PubMed ] [ CrossRef ]
26. Marca K. Glicoliza aerobă prin proliferarea celulelor: protecția împotriva stresului oxidativ în detrimentul randamentului energetic. J Bioenerg Biomembr. 1997; 29 : 355-364. doi: 10.1023 / A: 1022498714522. PubMed ] [ CrossRef ]
27. Spitz DRS, Sim J, Didnour LA, Galforo SS, Lee YJ. Stresul oxidativ indus de deprivarea de glucoză în celulele tumorale umane: un defect fundamental al metabolismului. Ann NY Acad Sci. 2006; 899 : 349-362. doi: 10.1111 / j.1749-6632.2000.tb06199.x. PubMed ] [ CrossRef ]
28. Lee YJ, Galoforo SS, Berns CM, Chen JC, Davis BH, Sim JE, și colab. Citotoxicitatea indusă de deprivarea citocromului și modificările activării protein kinazei activate de mitogen sunt mediate de stresul oxidativ în celulele carcinomului de sân uman rezistent multidrog. J Biol Chem. 1998; 273 : 5294-5299. doi: 10.1074 / jbc.273.9.5294. PubMed ] [ CrossRef ]
29. Kansara M, Berridge MV. Oncogene modulează sensibilitatea celulară la apoptoza indusă de deprivarea glucozei. Anticancer Res. 2004; 24 : 2503-2510. PubMed ]
30. Schlappack OK, Zimmermann A, Hill RP. Glucozitatea și acidoza: efect asupra potențialului metastatic experimental, conținutului de ADN și rezistenței MTX a celulelor tumorale murine. Br J Cancer. 1991; 64 : 663-670. doi: 10.1038 / bjc.1991.378. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
31. Landes T, Martinu JC. Permeabilizarea membranei externe mitocondriale în timpul apoptozei: rolul fisiunii mitocondriale. Biochim Biophys Acta. 2011; 1813 : 540-5. doi: 10.1016 / j.bbccr.2011.01.021. PubMed ] [ CrossRef ]
32. Abcouwer SF, Schwarz C, Mequid RA. Îndepărtarea glutaminei induce expresia GADD45 și GADD153 în primul rând prin stabilizarea ARNm. J Biol Chem. 1999; 274 : 28645-28651. doi: 10.1074 / jbc.274.40.28645. PubMed ] [ CrossRef ]
33. Saqcena, S Mukhopadhyay S, Hosny C, Alhamed A, Chatterjee A, Foster DA. Blocarea intrării anelerotice a glutaminei în ciclul TCA sensibilizează celulele cancerigene K-Ras mutante la medicamentele citotoxice. Oncogene. 2014; doi: 10.1038 / onc.2014.207. Articol gratuit PMC ] [ PubMed]
34. Yuneva M. Găsirea unui „călcâi al lui Ahile” al cancerului. Ciclul celulei. 2008; 7 : 2083-2089. doi: 10,4161 / cc.7.14.6256. PubMed ] [ CrossRef ]
35. Rambold AS, Kostelecky B, Elia N, Lippincott-Swartz J. Formarea rețelei tubulare protejează mitocondriile de degradarea autofagozomală în timpul foametei nutritive. Proc Natl Acad Sci SUA A.2011; 108 (5): 101902-110195. Articol gratuit PMC ] [ PubMed ]
36. Ahmad S, White CW, Chang LY, Schneider BK, Allen CB. Glutamina protejează structura și funcția mitocondriilor în toxicitatea oxigenului. Am J Physiol. 2001; 280 (4): L779-L791. PubMed ]
37. Maldonado AC, Muñoz-Pinedo C. Moare pentru ceva de mâncare: modul în care celulele răspund la înfometare. Open Cell Sign J. 2011; 3 : 13-23.
38. Fuchs BC, Bode BP. Subliniind supraviețuirea: glutamina ca modulator apoptotic. J Surg Res. 2006;131 : 26-40. doi: 10.1016 / j.jss.2005.07.013. PubMed ] [ CrossRef ]
39. Paquette JC, Guérin PJ, Gauthier ER. Inducția rapidă a căii apoptotice intrinseci prin foamete de L-glutamină. J Cell Physiol. 2004; 202 : 912-921. doi: 10.1002 / jcp.20194. PubMed ] [ CrossRef ]
40. Fumarola C, Zerbini A, Guidotti GG. Contracția celulară mediată de deprivarea de glutamină determină semnalizarea și apoptoza receptorului CD95 independent de ligand. Moartea celulelor diferă. 2001; 8 : 1004-1013. doi: 10.1038 / sj.cdd.4400902. PubMed ] [ CrossRef ]
41. Blackburn RV, Spitz D, Liu X, Galoforo SS, Sim JE, Ridnour LA, și colab. Stresul oxidativ metabolic activează transducția semnalului și expresia genelor în timpul deprivării glucozei în celulele tumorale umane. Liber Radic Biol Med. 1999; 26 : 419-430. doi: 10.1016 / S0891-5849 (98) 00217-2. PubMed ] [ CrossRef ]
42. Lord-Fontaine S, Averill-Bates DA. Șocul de căldură inactivează protecția antioxidantă celulară împotriva peroxidului de hidrogen: protecția prin glucoză. Liber Radic Biol Med. 2002; 32 : 762-766. doi: 10.1016 / S0891-5849 (02) 00769-4. CrossRef ]
43. Owada S, Shimoda Y, Tsuchihara K, Esumi H. Rolul critic al H2O2 generat de NOX4 în timpul răspunsului celular la deprivarea glucozei. Plus unu. 2013; 8 : e56628. doi: 10.1371 / journal.pone.0056628. Articol gratuit PMC ] [ PubMed ] [ CrossRef ]
44. Song JJ, Lee YL. Catalaza, dar nu MNSOD, inhibă calea de transducție a semnalului ASK1-MEK-MAPK activată de glucoză și previne relocalizarea DAXX: peroxidul de hidrogen ca un important al doilea mesager al stresului oxidativ metabolic. J Cell Biochem. 2003; 90 : 304-314. doi: 10.1002 / jcb.10619. PubMed ] [ CrossRef ]
45. Aki T, Yamaguchi K, Fujimiya T, Mizukami Y. Fosfoinositida 3-kinaza accelerează moartea celulară autofagică în timpul deprivării glucozei în linia celulară H9c2 derivată de la cardiomiocit de șobolan.Oncogene. 2003; 22 : 8529-8535. doi: 10.1038 / sj.onc.1207197. PubMed ] [ CrossRef ]

Articolele de la Cell & Bioscience sunt oferite aici prin amabilitatea BioMed Central

https://www.ncbi.nlm.nih.gov/pubmed/26225207

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4518607/

Tratare naturala CANCER PERITONEAL, CERVICAL,GINECOLOGIC, COL-UTERIN, UTERIN, OVARIAN, melanom, carcinom celule scuamoase, sarcom

Tratamente naturale cancere PERITONEAL, CERVICAL,GINECOLOGIC, COL-UTERIN, UTERIN, OVARIAN, melanom, carcinom celule scuamoase, sarcom

PENTRU CEI BOLNAVI (si nu numai): SFINTELE TAINE : SPOVEDANIE, IMPARTASANIE SI MASLU MINIM!!!DES!

Pentru cei(le) ce prezinta doar simptome de cancer (sau vor sa stie care sunt acestea) sa citeasca rubrica Simptome de cancer (click aici).

Pentru cei(le) ce  doresc sa detecteze atat EFICIENT, PRECIS, cu mult timp (ani inainte de diagnostic) in mod NON – toxic – utilizand tehnici non-invazive , sa citeasca rubrica  Detectia  cancer alternativa (click aici) 

Urmatoarele linkuri va arata toate articolele/tratamentele cu referire specifica la aceste  cancere de pe blog:

https://tratamenteanticancer.wordpress.com/?s=peritoneal
https://tratamenteanticancer.wordpress.com/?s=cervical
https://tratamenteanticancer.wordpress.com/?s=col+uterin
https://tratamenteanticancer.wordpress.com/?s=ovarian
https://tratamenteanticancer.wordpress.com/?s=melanom
https://tratamenteanticancer.wordpress.com/?s=sarcom
https://tratamenteanticancer.wordpress.com/?s=celule+scuamoase

Introducere și prezentare generală

Cancerul cervical, peritoneal  – ovarian, cancerul de col uterin, cancerul uterin, carcinomul cu celule scuamoase , melanomul, diferite tipuri de sarcoame,  nu sunt similare cu alte tipuri de cancer.

Cele mai multe tipuri de cancer s-au răspândit prin divizarea celulelor canceroase , insa aceste tipuri de cancer s-au răspândit si altfel! Aceasta face ca aceste tipuri de cancer sa fie mai dificil de vindecat.

Continuă lectura

Efectele suplimentării genisteinei asupra metilării ADN la nivelul genomului și a expresiei genice la pacienții cu cancer de prostată localizat

Birdal Bilir , 1, 5 Nitya V. Sharma , Jeongseok Lee , Bato Hammarstrom , 2, 7 Aud Svindland , 3, 4 Omer Kucuk , 5, 6 și Carlos S. Moreno 1, 6

Genisteina [4 ‘, 5,7-trihidroxiizoflavonă sau 5,7-dihidroxi-3- (4-hidroxifenil) cromen-4-onă] este o formă de agliconă izoflavonoidă, derivată din plante, genistină (un glicozid) (Nayeem et. al., 2019 [ 16 ]; Sansai și colab., 2020 [ 20 ]). Genisteina se găsește în principal în plantele leguminoase, în special în soia împreună cu alte izoflavone importante, daidzeina și gliciteina (Kalaiselvan și colab., 2010 [ 12 ]). Alte surse de genisteină includ fasole, naut, legume, fructe, nuci, alimente pe bază de soia și suplimente de genisteină. De asemenea, s-a raportat că boabele de soia nefermentate conțin mai multă genisteină decât cele fermentate (Kuligowski și colab., 2017 [ 13 ]; Li și Zhang, 2017 [ 14]]). În plus, genisteina poate fi sintetizată prin introducerea genei IFS (gena izoflavonei sintază) în celulele de drojdie și liniile de orez, ceea ce duce la un conținut crescut de genisteină în orez (până la 30 de ori) (Spagnuolo și colab., 2015 [ 23 ]) .

1 Departamentul de patologie și medicină de laborator, Universitatea Emory, Atlanta, GA, SUA2 Departamentul de Urologie, Institutul de Cercetare a Cancerului, Spitalul Universitar Oslo3 Departamentul de Medicină Clinică, Universitatea din Oslo4 Departamentul de Patologie, Spitalul Universitar Oslo, Oslo, Norvegia5 Departamentul de hematologie și oncologie medicală6 Winship Cancer Institute, Emory University, Atlanta, GA, SUACorespondență cu: Dr. Carlos S. Moreno, Departamentul de patologie și medicină de laborator, Winship Cancer Institute, Emory University, Whitehead Research Building, camera 105J, 615 Michael Street, Atlanta, GA 30322, SUA, E-mail: ude.yrome@oneromcAdresa actuală: Departamentul de Medicină de Mediu și de Muncă, Spitalul Universitar Oslo, Oslo, NorvegiaAcest articol a fost citat de alte articole din PMC.Mergi la:

Abstract

Studiile epidemiologice au arătat că compușii dietetici au efecte semnificative asupra carcinogenezei prostatei. Dintre agenții dietetici, genisteina, izoflavona majoră din soia, prezintă un interes deosebit, deoarece consumul ridicat de produse din soia a fost asociat cu o incidență scăzută a cancerului de prostată, sugerând un rol preventiv al genisteinei în cancerul de prostată. În ciuda numeroaselor studii pentru a înțelege efectele genisteinei asupra cancerului de prostată, mecanismele de acțiune nu au fost pe deplin elucidate. Am investigat diferențele dintre nivelurile de metilare și expresie genică ale specimenelor de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie folosind Illumina HumanMethylation450 și Illumina HumanHT-12 v4 Expression BeadChip Microarrays Prezentul studiu a fost un studiu randomizat, controlat cu placebo,studiu clinic dublu-orb pe pacienți norvegieni care au primit zilnic 30 mg genisteină sau capsule placebo timp de 3-6 săptămâni înainte de prostatectomie. Modificările exprimării genei au fost validate prin PCR cantitativă (qPCR). Metilarea genomului întreg și profilarea expresiei au identificat site-uri metilate diferențial și au exprimat gene între grupurile placebo și genisteină. Genele reglementate diferențial au fost implicate în procesele de dezvoltare, markerii celulelor stem, proliferarea și reglarea transcripțională. Analiza îmbogățirii a sugerat reducerea generală a activității MYC și creșterea activității PTEN la pacienții tratați cu genisteină. Aceste descoperiri evidențiază efectele genisteinei asupra modificărilor globale în expresia genelor în cancerul de prostată și efectele sale asupra căilor moleculare implicate în tumorigeneză de prostată.Cuvinte cheie: genisteină, cancer de prostată, metilare ADN, expresie geneticăMergi la:

Introducere

Cancerul de prostată este cea mai frecvent diagnosticată afecțiune malignă și a doua cauză principală de deces prin cancer în rândul bărbaților din Statele Unite. Se estimează că aproximativ 180.890 de cazuri noi de cancer de prostată și 26.120 de decese cauzate de cancer de prostată au avut loc în SUA în 2016 ( 1 ). Factorii de risc comuni pentru cancerul de prostată sunt vârsta, rasa / etnia, geografia, istoricul familial și stilul de viață ( 2 ). În funcție de gravitatea bolii, opțiunile actuale de tratament pentru cancerul de prostată includ terapii unice sau o combinație de terapii, cum ar fi supravegherea activă, chirurgia, radioterapia, chimioterapia, terapia hormonală sau vaccinurile ( 3). Deși aceste intervenții au îmbunătățit semnificativ calitatea vieții pacienților și ratele globale de supraviețuire, tratamentul eficient al cancerului de prostată este încă limitat datorită provocărilor majore, cum ar fi eterogenitatea genetică, recurența tumorii (~ 30% din cazuri) și rezistența la medicamente chimioterapeutice convenționale ( 4 – 6 ). Prin urmare, este crucial să se dezvolte noi strategii preventive și terapeutice care au potențialul de a îmbunătăți rezultatele pentru pacienții cu cancer de prostată.

Studiile epidemiologice au arătat că există o diferență semnificativă în ratele de incidență și mortalitate ale cancerului de prostată între diferite țări, cu cele mai ridicate rate în SUA și țările europene și cele mai mici rate în țările asiatice, cum ar fi Japonia și China ( 7 , 8 ). Această variabilitate largă a ratelor de cancer de prostată între țări sugerează că mai mulți factori, inclusiv diferențele genetice, epigenetice și de mediu, joacă un rol cheie în etiologia bolii. În special, s-a demonstrat că imigranții asiatici din SUA au o incidență crescută a cancerului de prostată în comparație cu acei indivizi cu același background genetic care trăiesc în Asia, indicând faptul că factorii de mediu, în special dieta, sunt factorii determinanți majori ai incidenței cancerului de prostată (9 ). Una dintre diferențele dietetice remarcabile dintre țările asiatice și cele occidentale este cantitatea de consum de alimente pe bază de soia. Populațiile asiatice consumă cantități mari de alimente din soia, care sunt bogate în izoflavone (~ 2 g de izoflavone pe kg de soia proaspătă) ( 10 ). S-a demonstrat că concentrațiile plasmatice și de lichide prostatice ale izoflavonelor la bărbații asiatici sunt de 10 până la 100 de ori mai mari decât cele la bărbații occidentali, cu niveluri deosebit de ridicate ale genisteinei de izoflavonă ( 11 , 12 ). Un număr tot mai mare de studii bazate pe populație a demonstrat că aportul ridicat de izoflavone din soia este asociat cu un risc redus cu 25-30% de cancer de prostată ( 13 , 14 ).

Fiind principala izoflavonă biologic activă în dieta soia, genisteina a fost investigată pe larg pentru potențialul său chimiopreventiv în diferite tipuri de cancer, inclusiv în cancerul de prostată. Aportul zilnic mediu de genisteină la populațiile asiatice sa dovedit a fi de 20-80 mg, în timp ce este de 1-3 mg în SUA, susținând efectele protectoare ale genisteinei împotriva cancerului de prostată la bărbații asiatici ( 15 ). Genistein atinge concentrațiile plasmatice de 1-5 u , M 6-8 ore după ingestia de dieta bogata soia ( 11 , 16 ). Timpul de înjumătățire plasmatică al genisteinei a fost raportat la 7,9 ore la adulți. În plus, concentrațiile de izoflavone totale din soia din țesutul prostatei s-au arătat de ~ 6 ori mai mari decât nivelurile serice de izoflavone ( 17). Studiile de siguranță și farmacocinetice ale izoflavonelor din soia au demonstrat că s-a observat o toxicitate clinică minimă la subiecții sănătoși administrați cu izoflavone din soia purificate la doze care depășesc aporturile alimentare normale ( 18 ).

Datorită similarității sale structurale cu hormonul steroid 17β-estradiol, se leaga genisteina la receptorii de estrogen, ER-α și ER-β, cu o afinitate mai mare pentru ER-β, și acționează ca un modulator naturale selectiv al receptorului de estrogen ( 16 , 19 , 20 ). Genisteina își exercită efectele inhibitoare asupra celulelor canceroase de prostată prin reglarea în sus a expresiei ER-β, care are roluri anti-proliferative și pro-apoptotice în celulele prostatei ( 21 , 22 ). În plus față de activitățile sale estrogenice, genisteina reglează căile mediate de receptorul androgen (AR) în cancerul de prostată ( 23 , 24 ). De remarcat, s-a arătat că efectul inhibitor al genisteinei asupra expresiei AR este mediat și de ER-β (25 ). Mai multe alte mecanisme moleculare care stau la baza efectelor preventive ale genisteinei asupra cancerului de prostată includ inhibarea proliferării celulare prin inducerea opririi ciclului celular G1 și / sau G2 / M ( 26 – 28 ), angiogeneză ( 29 , 30 ) și metastază ( 31 – 33 ) și inducerea apoptozei ( 34 , 35 ). Genisteina își exercită efectele pleiotrope în contextul cancerului de prostată prin modularea mai multor căi de transducție a semnalului celular, cum ar fi IGF-1 ( 36 ), TGF-β ( 37 ), Wnt / β-catenină ( 36 ), NF-κB ( 38 ) , AKT și MAPK ( 39) semnalizare. Această modulare ar putea fi legată direct de receptorii nucleari sau modificarea stării de fosforilare a proteinelor de transducție a semnalului. În plus, genisteina inhibă activitățile tirozin kinazei ( 40 ) și prezintă proprietăți antioxidante ( 41 , 42 ) în celulele prostatei. Swami și colab. ( 43 ) au demonstrat că genisteina reduce progresia cancerului de prostată prin inhibarea sintezei și activității prostaglandinelor. De asemenea, sa raportat că genisteina are posibile efecte asupra deteriorării și reparării ADN-ului în celulele canceroase de prostată ( 42 ). Mai mult, genisteina inhibă metilarea ADN-ului ( 44 – 48 ) și modificările histonice ( 47 ,48 ) și reglează miARN ( 49 – 52 ) în cancerul de prostată. Este de interes că genisteina sa dovedit a spori eficacitatea radioterapiei și a chimioterapiei ( 53 , 54 ).

Deși au fost efectuate numeroase studii in vitro și in vivo pentru a înțelege efectele protectoare ale genisteinei împotriva cancerului de prostată, demonstrate prin studii epidemiologice, mecanismele moleculare care guvernează modul în care genisteina afectează patogeneza cancerului de prostată rămân în continuare evazive. Este de remarcat faptul că o provocare majoră este variabilitatea largă a efectelor genisteinei în funcție de doză, de forma de administrare sau de momentul și durata expunerii ( 55). În ciuda bogăției de studii efectuate pe linii celulare umane și modele animale, doar câteva studii clinice prospective randomizate au fost efectuate pentru a examina efectele moleculare ale genisteinei asupra cancerului de prostată. În studiul de față, după cunoștințele noastre pentru prima dată, am investigat efectele intervenției genisteinei asupra metilării globale și a modelelor de expresie genică la pacienții cu cancer de prostată localizat și am identificat ținte noi care sunt modulate diferențial prin suplimentarea cu genisteină, oferind alte perspective mecaniciste asupra efectelor genisteinei asupra carcinogenezei prostatei.Mergi la:

Materiale și metode

Subiecte

Probele de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie ( 56 ) au fost analizate pentru modificări globale în metilarea ADN și expresia genelor. Participanții au fost recrutați din ambulatoriul de la Departamentul de Urologie, Spitalul Universitar Oslo, Oslo, Norvegia în perioada aprilie 2007 – august 2008. Studiul a fost aprobat de Agenția Norvegiană pentru Medicamente, Comitetul Regional de Etică, Ombudsmanul pentru confidențialitate și Prostate Biobank la Spitalul Universitar Oslo, Aker.

Profilarea metilării la nivelul genomului

ADN-ul total a fost izolat din țesuturile de prostată înghețate folosind kitul DNeasy Blood and Tissue (Qiagen, Valencia, CA, SUA) conform instrucțiunilor producătorului. ADN-ul a fost supus nucleului de genomică integrată Emory pentru analiza metilării ADN-ului folosind Illumina HumanMethylation450 BeadChip Microarrays. Datele de metilare sunt disponibile pe GEO (numărul de acces GSE84749 ).

Profilarea expresiei la nivel de genom

ARN-ul total a fost extras din țesuturile de prostată înghețate folosind kitul de izolare miVNA mirVana (Life Technologies, Grand Island, NY, SUA), urmat de curățarea ARN folosind kitul RNeasy Mini (Qiagen). ARN-ul total a fost trimis la nucleul de genomică integrat Emory pentru analiza expresiei genice utilizând Illumina HumanHT-12 v4 Expression BeadChip Microarray. Datele despre microarray sunt disponibile pe GEO (numărul de acces GSE84748 ).

Analiza PCR cantitativă (qPCR)

ARN a fost transcris invers în ADNc folosind kitul de sinteză ADNc iScript (Bio-Rad Laboratories, Hercules, CA, SUA). Grundurile au fost proiectate folosind instrumentul Primer3. Secvențele primerilor sunt enumerate înTabelul I. qPCR a fost efectuat folosind iQ SYBR-Green Supermix (Bio-Rad Laboratories) pe un iCycler Bio-Rad conform protocoalelor producătorului. Gena β-actină umană, care s-a dovedit a fi o genă validă de referință pentru normalizarea qPCR în probe de țesut uman de cancer de prostată, a fost utilizată ca control intern în prezentul studiu ( 57 ). Ca calibrator s-a folosit o probă normală de țesut prostatic. Modificările relative ale datelor de exprimare a genei au fost analizate prin metoda 2 −ΔΔCT . S-au efectuat triplicate pentru fiecare probă. Datele sunt prezentate ca medie ± deviație standard.

Tabelul I

Secvențe ale primerilor utilizați în analiza PCR cantitativă.

Numele primarSecvență primară (5 ′ → 3 ′)
CKS2-FPTTAGTCTCCGGCGAGTTGTTG
CKS2-RPCATAACATGCCGGTACTCGT
JAG1-FPAGTCGTGCATGCTCCAATCG
JAG1-RPCCCCACACACACTTGGCTC
NOTCH3-FPGATGTGGACGAGTGTGCTGG
NOTCH3-RPCAGGCATGGGTTGGGGTC
MMP26-FPGGACTTTGTTGAGGGCTATTTCCA
MMP26-RPGGAGGTGTCGGACCCATCAG
HIF1A-FPCACCACAGGACAGTACAGGAT
HIF1A-RPCGTGCTGAATAATACCACTCACA
CDK6-FPGCTGACCAGCAGTACGAATG
CDK6-RPGCACACATCAAACAACCTGACC
CD24-FPCGCGGACTTTTCTTTTGGGG
CD24-RPACTGGAATAAATCTGCGTGGGT
AMACR-FPCCGTTCTGTGCTATGGTCCTG
AMACR-RPAGCCTTGGATTTTCCCGCTG
MYC-FPCCTACCCTCTCAACGACAGC
MYC-RPTTGTTCCTCCTCAGAGTCGC
SPP1-FPCAAACGCCGACCAAGGAAAA
SPP1-RPGGCCACAGCATCTGGGTATT
NEU1-FPCGCAGCTATGATGCCTGTGA
NEU1-RPGGTCAGGTTCACTCGGAACTC
ADCY4-FPCCTGGGACCAGGTGTCCTAT
ADCY4-RPCAAGATACAGCCCGAGGACC
β-actină-FPCACAGAGCCTCGCCTTTGCC
β-actină-RPTGACCCATGCCCACCATCAC

Analiza qPCR.

Analiza datelor

Analiza expresiei genice a fost efectuată utilizând modulul GenePattern ComparativeMarkerSelection ( 58 ) comparând tumorile tratate cu genisteină cu tumorile tratate cu placebo. Datele Illumina Microarray au fost filtrate pentru a include gene care au fost detectate (P <0,05) în cel puțin un grup experimental pentru a rezulta într-un set de date de 15918 gene pentru analiză. Modulul de selecție a markerului comparativ al GenePattern a fost utilizat pentru a calcula testele t-Student ale celor două fețe între grupuri cu 10.000 permutări pentru a calcula ratele de descoperire false. Sămânța aleatorie utilizată a fost 779948241. Clusterul ierarhic a fost realizat utilizând software-ul Cluster ( 59 ) și Java TreeView ( 60 ). Analiza microarray de metilare a fost efectuată în R utilizând modulul CpGassoc în Bioconductor ( 61). Datele de la sondele de 450K au fost filtrate la cele în care valoarea β maximă – minimă a fost> 0,2 pentru a rezulta sonde de 160K pentru analiza diferențială a metilării. CpGassoc a fost utilizat pentru a identifica 162 de sonde semnificative care au fost metilate diferențial. Trei sonde au fost metilate diferențial între probele tumorale tratate cu genisteină și probele tumorale tratate cu placebo, trei sonde au fost semnificative între probele tumorale tratate cu genisteină și probele normale și 156 au fost semnificativ diferite între probele tumorale tratate cu placebo și probele normale.

analize statistice

Testul U Mann-Whitney (cu două cozi) a fost utilizat pentru a determina diferențe semnificative între două grupuri de date. P <0,05 a fost considerat semnificativ statistic.Mergi la:

Rezultate

Caracteristici clinicopatologice

Am analizat probe de țesut prostatic dintr-un studiu anterior, care a fost un studiu clinic randomizat, controlat placebo, dublu-orb, de fază 2, pe pacienți norvegieni cu cancer de prostată localizat care au primit 30 mg genisteină sintetică sau capsule placebo zilnic timp de 3-6 săptămâni înainte de radical prostatectomie ( 56 ). Caracteristicile clinice și patologice ale cazurilor au fost descrise anterior ( 56 ). Disponibilitatea țesutului înghețat a limitat dimensiunea eșantionului în acest studiu și am investigat metilarea ADN și nivelurile de expresie genică a probelor de tumori de prostată de la 10 pacienți care au primit genisteină și 10 pacienți care au primit placebo. Au fost de asemenea analizate patru probe adiacente de țesut normal de prostată. Datele clinice pentru cei 20 de pacienți analizați aici sunt furnizate înTabelul II. Nu au existat diferențe semnificative statistic în ceea ce privește vârsta, nivelurile PSA serice și scorul Gleason între cele două grupuri de tratament.

Tabelul II

Date clinice pentru cei 20 de pacienți analizați în prezentul studiu.

TratamentID-ul pacientuluiGleasonSuma GleasonEtapăVârstăPSA
Genisteină (n = 10)13 + 4726812.0
73 + 4726810.9
83 + 362596.2
103 + 473a615.1
133 + 362587.6
144 + 373a648.5
174 + 482616.1
183 + 362576.0
193 + 362637.8
203 + 472687.9
Media (SD)6,7 (0,7)62,7 (4,2)7,8 (2,2)
Placebo (n = 10)243 + 362616.4
253 + 362574.2
263 + 473a689.9
274 + 482699.2
304 + 372555.1
333 + 362566.4
343 + 362637.6
353 + 473a605.7
383 + 472629.9
393 + 362667.0
Media (SD)6,6 (0,7)61,7 (4,9)7.1 (2.0)

Metilare diferențială în țesutul tratat cu genisteină în comparație cu țesutul tratat cu placebo

Profilurile de metilare a ADN-ului la nivelul genomului unui total de 24 de probe de prostată din țesuturi tumorale sau normale au fost generate folosind trusa Illumina HumanMethylation450 BeadChip. Starea de metilare a fiecărei probe a fost analizată pentru 485.577 de situri, acoperind 21.231 de gene. Am comparat profilurile de metilare ale probelor de tumori tratate cu genisteină cu cazurile tratate cu placebo. În general, modificările de metilare au fost modeste și nu a existat o genă metilată semnificativ diferențiat după corecție pentru testarea ipotezelor multiple. Cu toate acestea, valorile P necorectate au indicat faptul că RBM28 și CYTSBgenele au fost demetilate în probe tumorale tratate cu genisteină comparativ cu probele tratate cu placebo. Lipsa semnificației statistice s-a datorat probabil numărului mic de probe analizate în acest studiu. Am observat 156 de sonde cu metilare crescută semnificativ în țesuturile tumorale tratate cu placebo față de țesuturile normale care nu au fost semnificative între țesuturile tumorale tratate cu genisteină și țesuturile normale, sugerând că genisteina ar putea avea unele efecte de demetilare (disponibile la cerere). Aceste 156 de sonde corespundeau a cel puțin 92 de gene separate, inclusiv ADCY4 , ALOX12 , HAAO , LRRC4 , NEU1 , RAPGEFL1 și WNT7B (Tabelul III).

Tabelul III

Lista a 156 de sonde metilate diferențial (92 de gene).

ID țintăNumele geneiValoarea P (GT vs. PT)Valoarea P (GT vs. N)Valoarea P (PT vs. N)
cg00353923LRRC4; SND1nsns0,000214451
cg00420348EFCAB4Ansns0,000247793
cg00459232CD9nsns0,000270319
cg00494665nsns0,000274219
cg00506168PDXKnsns0,000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0,000393857
cg01228355CORINnsns0,000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0,000942104
cg01561916HAAOnsns0,00015216
cg01684881FZD2nsns0,000472597
cg01856645DMGDH; BHMT2nsns0,000876054
cg02072400nsns3.73E-05
cg02131967ASnsns0,000468338
cg02215070AKR1B1nsns0,000607743
cg02493798ALOX12nsns0,000106934
cg02534363NBEAL2nsns0,000263128
cg02659920EPS8L2nsns0,000563556
cg02665650ANKS1Ansns0,000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0,000993538
cg03119308RBM280,000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0,000320776
cg03452174RAB34nsns0,000820466
cg03456213C9orf3nsns0,000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0,000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

Deschideți într-o fereastră separată

GT, tumoare tratată cu genisteină; PT, tumoare tratată cu placebo; N, normal; NS, nu semnificativ.

Profilul expresiei genei se modifică după tratamentul cu genisteină

Pentru a identifica efectele moleculare ale genisteinei asupra nivelurilor de ARNm în cancerul de prostată, am comparat profilurile de expresie genică ale tumorilor tratate cu genisteină cu probele tratate cu placebo. Din nou, nu au existat probe exprimate diferențial care să rămână semnificative statistic după corecție pentru testarea ipotezelor multiple. Cu toate acestea, au existat 628 de sonde care au atins valori P semnificative nominal (disponibile la cerere). Gruparea ierarhică a acestui set de date a arătat o segregare puternică a pacienților cu și fără tratament cu genisteină (Fig. 1). Genele cu valori P semnificative nominal au inclus gene NOTCH3 , JAG1 , CKS2 , HIF1A , CDK6 , MYC , CD24 , AMACR , MMP26 și SPP1 (Tabelul IV). NEU1 și ADCY4 nu au atins semnificație nominală , dar a avut o tendință spre semnificație, și integrarea datelor de metilare cu nivelurile de expresie expresia genelor pereche de profile de date indicate au scăzut stare de metilare și crescute de ADCY4 si NEU1 gene in cazurile tratate genisteina.figura 1

Profilarea expresiei întregului genom al probelor de tumori tratate cu placebo sau genisteină. Gruparea ierarhică a modificărilor în expresia genelor pentru acele gene cu un P <0,05 nominal între probele genistein-tumorale și probele placebo-tumorale.

Tabelul IV

Gene cu expresie diferențială a genelor analizate prin qPCR.

Simbol genicExpresia genelor se schimbă
MicroarrayqPCR
CKS2−2,02−2,50
NOTCH31,722.08
HIF1A−1,63−1,80
CDK6−2,87−1,57
JAG11,916.00
NEU1 a1,771,50
ADCY4 a1,671,60
C-UL MEU−1,57−2.30
CD24−2,02−2,64
AMACR−1,95−2.14
MMPP26−2,78−2,84
SPP1−2,36−3.09

Modificările de pliuri sunt genisteină-tumoră / placebo-tumorăo stare de metilare a ADN-ului este corelată cu expresia genelor în NEU1 și ADCY4. qPCR, PCR cantitativă.

Validarea datelor microarray

Am investigat nivelurile de expresie a 12 gene selectate (Tabelul IV) în toate cele 24 de eșantioane analizate prin microarrays folosind qPCR și au observat că datele microarray au fost corelate cu rezultatele qPCR (Fig. 2). Creșterea nivelurilor de expresie qPCR ale genelor NOTCH3 și JAG1 în tumorile tratate cu genisteină comparativ cu tumorile tratate cu placebo au fost semnificative statistic prin testul U Mann-Whitney.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este IJO-51-01-0223-g01.jpg

Deschideți într-o fereastră separatăFigura 2

Analiza qPCR a nivelurilor de expresie a 12 gene din grupurile placebo și genisteină. Modificările de expresie ale genelor selectate din datele microarray au fost validate folosind qPCR. Datele sunt prezentate ca modificări ale pliurilor în raport cu probele de control. qPCR, PCR cantitativă.

Analiza îmbogățirii

Am efectuat analize de îmbogățire a genei pe cele 628 de sonde semnificative nominal care au fost exprimate diferențial între probele de genisteină și placebo (Tabelul V) folosind Analiza căii de ingeniozitate ( 62 ) și baza de cunoștințe DAVID ( 63). Valoarea P indică distribuția hipergeometrică Valorile P ale suprapunerii pentru seturile de gene și categoriile funcționale. FDR indică o rată de descoperire falsă, corectate valorile P ale suprapunerii. Scorul z de activare este o indicație a consistenței membrilor în sus și în jos reglementați ai unui set de gene, cum ar fi o funcție biologică (tabelul de sus) sau țintele unui regulator în amonte (tabelul de mijloc). Scorurile de activare z> 2 sau <−2 sunt semnificative statistic pentru consistența activării sau inhibării. Moleculele indică numărul de molecule din setul de 628 de sonde analizate care se suprapun cu o anumită categorie. Rețeaua mecanistică indică numărul total de gene țintă ale unui regulator în amonte, iar numărul de gene suprapuse este indicat între paranteze. Am observat îmbogățirea termenilor asociați cu angiogeneza, apoptoza, tranziția epitelială la mezenchimală,progresia tumorii și legarea PDGF. Analiza potențialelor regulatoare din amonte prin analiza IPA a sugerat că PTEN și PDGF au fost activate, în timp ce MYC, β-estradiol, receptorul glucocorticoid NR3C1 și interferon-γ au fost reprimate ca răspuns la tratamentul cu genisteină.

Tabelul V

Analiza îmbogățirii a 628 de sonde semnificative nominal exprimate diferențial între grupurile de genisteină și placebo.

AnalizăValoarea PActivare scor zNumărul de moleculeFuncţie
IPA5.92E-080,77318Progresia tumorii
IPA4.88E-071,01355Neoplasm abdominal
IPA1.09E-061.92728Diferențierea liniilor celulare tumorale
IPA1.34E-06−1.01719Tranziția epitelial-mezenchimală
IPA7.46E-062.41222Tumora neuroendocrină
IPA7.98E-052.05428Necroza tumorii
AnalizăValoarea P a suprapuneriiActivare scor zRețea mecanicistăRegulator în amonte
IPA3.85E-08−0,692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0,832144 (13)IFNG
IPA2.17E-061,608141 (16)PTEN
IPA4.59E-06−2.995133 (13)C-UL MEU
AnalizăFDRActivare scor zNumărul de moleculeTermen
DAVID7.90E-04N / A17GO: 0005840 ribozom
DAVID1.19E-02N / A34mitocondrie
DAVID2.00E-02N / A16GO: 0001568 dezvoltarea vaselor de sânge
DAVID1.77E-02N / A10GO: 0019838 legarea factorului de creștere
DAVID3.52E-02N / A7GO: 0008629 inducerea apoptozei prin semnale intracelulare
DAVID3.16E-02N / A4GO: 0048407 legarea factorului de creștere derivat din trombocite

Deschideți într-o fereastră separatăMergi la:

Discuţie

Din câte știm, prezentul studiu este primul care evidențiază efectele genisteinei asupra modificărilor globale ale metilării ADN și ale expresiei genice la pacienți dintr-un studiu clinic de genisteină în cancerul de prostată. Analiza integrativă a metilării genomului întreg și profilarea expresiei au identificat un număr de situri candidate metilate diferențial și au exprimat site-uri între grupurile placebo și genisteină. Cu toate acestea, diferențele dintre grupurile placebo și grupurile cu genisteină nu au fost semnificative statistic după corecție pentru testarea multiplelor ipoteze, posibil datorită numărului mic de cazuri din acest studiu. Deși modificările induse de genisteină nu sunt semnificative, aceste rezultate pot ajuta la elucidarea mecanismelor moleculare care stau la baza activităților genisteinei în cancerul de prostată.Matricile de metilare a ADN-ului la nivel de genom au arătat că un număr de gene, inclusivRBM28 și CYTSB , păreau a fi demetilate în probele tumorale tratate cu genisteină, comparativ cu probele din grupul placebo. Cu toate acestea, nu am observat modificări ale nivelurilor de expresie ale acestor gene. Printre genele exprimate diferențial identificate prin analiza microarray s-au numărat CKS2 , NOTCH3 , HIF1A , CDK6 , JAG1 , NEU1 , ADCY4 , MYC , CD24 , AMACR , MMP26 și SPP1. Datele microarray au fost confirmate prin analiza qPCR a acestor gene. Alte gene cu semnificație nominală prin microarray, dar care nu au fost testate de qPCR au inclus ZNF639 , CRIM1 , PGC și USP54 (disponibil la cerere).

Este interesant de remarcat faptul că statutul de metilare ADN – ul a fost corelat invers cu expresia genelor pentru NEU1 si ADCY4 gene, care a scazut de metilare și expresia crescută a ARNm în grupul genisteina comparativ cu grupul placebo. Descoperirea noastră care arată potențialul genisteinei pentru demetilarea ADN-ului este în concordanță cu datele raportate anterior care sugerează că genisteina acționează ca un inhibitor al DNMT, provocând astfel demetilarea insulelor CpG în promotorii genelor. De exemplu, s-a demonstrat că genisteina reactivează genele supresoare tumorale cu tăcere hipermetilată, inclusiv p16INK4a , receptorul de acid retinoic β ( RARβ ) și O 6-metilguanină metiltransferază ( MGMT), în celulele canceroase de prostată și esofag ( 46 ). Mai mult, genisteina a fost implicată în demetilarea promotorului WNT5a în celulele cancerului de colon ( 64 ). Una dintre genele care s-au dovedit a fi demetilate de genisteină în studiul de față este ADCY4, care este un membru al familiei adenilat ciclaselor, enzimele legate de membrană care catalizează formarea adenozinei monofosfat ciclic mesager secundar (AMPc) ( 65 ). În concordanță cu constatările noastre, s-a demonstrat recent că ADCY4 este un marker de metilare a ADN-ului care reprezintă evenimente epigenetice timpurii în tumorigeneză de prostată, susținând ipoteza noastră că genisteina poate inversa modelul metilării ADN-ului în ADCY4 în cancerul de prostată ( 66).). Cealaltă genă care a fost modulată prin intervenția genisteinei în prezentul studiu a fost NEU1, care este o sialidază lizozomală implicată în catabolismul glicoconjugatului și semnalizarea celulară, inclusiv răspunsurile imune și transducția semnalului mediată de receptorul elastinei ( 67 ). De fapt, NEU1 este esențial pentru desialilarea integrinei β4 și inhibarea FAK, ducând la suprimarea metastazelor hepatice în cancerul de colon ( 68 ). Kato și colab. ( 69 ) au raportat că supraexprimarea NEU1 a dus la suprimarea metastazelor pulmonare în melanom. În plus, suprimarea NEU1 de către miR-125b sa dovedit a promova migrația, invazia și metastaza în cancerele gastrice ( 70). Cu toate acestea, NEU1 poate avea, de asemenea, efecte pro-metastatice în cazurile de cancer pancreatic și ovarian ( 71 ) și, prin urmare, nu este pe deplin clar care ar putea fi impactul general al nivelurilor crescute de NEU1 în cancerul de prostată. Prin urmare, este important să se examineze modificările expresiei NEU1 la nivelul proteinelor și sunt necesare studii moleculare și celulare pentru a evalua consecințele funcționale ale modificărilor induse de reglarea ascendentă a NEU1 în celulele cancerului de prostată.

Dintre genele exprimate diferențial care au fost validate de qPCR, doar expresia mARN-urilor NOTCH3 și JAG1 au fost semnificativ mai mari în grupul cu genisteină comparativ cu grupul placebo de qPCR. Pe baza constatărilor noastre la nivel de ARNm, fără nici o confirmare la nivel proteic sau funcțional, ar fi speculativ să sugerăm că semnalizarea Notch poate juca un rol în mecanismul de acțiune al genisteinei asupra cancerului de prostată. NOTCH3 este important pentru EMT indus de TGFβ în cancerul de prostată ( 72 ) și este indus de hipoxie și contribuie la progresia cancerului de prostată ( 73 ). Ligandul Notch JAG1 este, de asemenea, asociat cu cancer de prostată mai agresiv ( 74 , 75 ), EMT și angiogeneză (76 ). Cu toate acestea, un rol de supresie tumorală a semnalizării Notch a fost raportat și în diferențierea neuroendocrină indusă de hipoxie a celulelor canceroase de prostată, precum și în alte tipuri de cancer, inclusiv cancerul vezicii urinare, tumorile maligne hematologice, gliomul, carcinomul tiroidian și cancerul pulmonar ( 77 – 82 ), indicând posibilitatea ca expresia crescută a NOTCH3 / JAG1 prin tratamentul cu genisteină să îmbunătățească rezultatele prin funcția sa de supresoare tumorală. Datele noastre sugerează că studii suplimentare pentru a delimita efectul genisteinei asupra căii de semnalizare Notch în cancerul de prostată pot fi justificate.

Analizele de îmbogățire a modificărilor ARNm induse de genisteină au indicat faptul că modificările subtile ale expresiei genice observate între probele de genisteină și placebo sunt în concordanță cu multe efecte raportate anterior ale genisteinei pe căile tumorale critice, inclusiv PTEN, PDGF, MYC, β-estradiol, receptor glucocorticoid și interferon- y ( 41 , 83 – 89 ). Genisteina pare să promoveze activitatea PTEN și inhibă activitatea MYC, în concordanță cu utilitatea sa potențială în îmbunătățirea rezultatelor în cancerul de prostată.

Pe scurt, rezultatele noastre indică faptul că intervenția genisteinei induce modularea mai multor gene, inclusiv NOTCH3 , JAG1 , ADCY4 și NEU1, sugerând că aceste gene pot avea potențialul de a fi ținte moleculare noi ale genisteinei în cancerul de prostată. Aceste gene sunt implicate în multe procese biologice critice, inclusiv ciclul celular, angiogeneza, răspunsul imun celular și transducția semnalului intracelular, oferind o perspectivă suplimentară asupra multiplelor căi moleculare implicate în tumorigeneză de prostată. Cu toate acestea, sunt necesare studii mecaniciste suplimentare pentru a investiga efectele genisteinei asupra reglării expresiei acestor gene la nivelul proteinelor și funcțiilor celulare. Aceste descoperiri pot contribui apoi la proiectarea de noi strategii pentru prevenirea și tratamentul cancerului de prostată. O avertisment al studiilor de profilare a expresiei genice este incapacitatea identificării mecanismelor de acțiune care sunt modulate la nivel post-transcripțional,sugerând posibilitatea ca genisteina să modifice procese celulare suplimentare. Un alt punct care trebuie făcut este momentul și durata expunerii la genisteină. Studiile de control al cazurilor au demonstrat că consumul ridicat de soia la începutul vieții (în timpul copilăriei și / sau adolescenței) este asociat cu o reducere de 25-60% a riscului de cancer mamar (90 , 91 ). În mod similar, aportul ridicat de soia la pubertate, perioada în care prostata suferă o creștere indusă de androgen, ar putea fi mai eficientă în prevenirea cancerului de prostată. O limitare a prezentului studiu este numărul mic de probe de pacienți. Alte studii clinice controlate randomizate de mari dimensiuni ar oferi rezultate mai definitive ale efectelor genisteinei asupra țesuturilor prostatei pacientului.Mergi la:

Mulțumiri

Prezentul studiu a fost susținut parțial de nucleul de genomică integrat Emory (EIGC), care este subvenționat de Grantul de asistență al Centrului de Cancer NCI P30CA138292 și de Școala de Medicină a Universității Emory și este una dintre facilitățile de bază integrate Emory. Acesta a fost susținut în continuare de un Premiu de Cercetare a Soia din cadrul Programului de Cercetare în Sănătate al Soia al United Soybean Board.Mergi la:

Referințe

1. Siegel RL, Miller KD, Jemal A. Statistici despre cancer, 2016. CA Cancer J Clin. 2016; 66 : 7–30. doi: 10.3322 / caac.21332. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Fapte și cifre despre cancerul de prostată 2016. American Cancer Society Inc; Atlanta, GA: 2016. [ Google Scholar ]3. Dunn MW, Kazer MW. Prezentare generală a cancerului de prostată. Semin Oncol Nurs. 2011; 27 : 241-250. doi: 10.1016 / j.soncn.2011.07.002. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Sartor AO. Progresia cancerului de prostată metastatic rezistent la castrate: impactul intervenției terapeutice în spațiul post-docetaxel. J Hematol Oncol. 2011; 4 : 18. doi: 10.1186 / 1756-8722-4-18. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W, III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, și colab. American Cancer Society ghiduri de îngrijire pentru supraviețuirea cancerului de prostată. CA Cancer J Clin. 2014; 64 : 225–249. doi: 10.3322 / caac.21234. [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, și colab. Sarcina de modificare a numărului de copii prezice recăderea cancerului de prostată. Proc Natl Acad Sci SUA. 2014; 111 : 11139–11144. doi: 10.1073 / pnas.1411446111. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Ferlay J, Bray F, Pisani P, Parkin DM. Globocan 2000: Incidența, mortalitatea și prevalența cancerului la nivel mondial. Presa IARC; Lyon: 2001. [ Google Scholar ]8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Statistici globale privind cancerul. CA Cancer J Clin. 2011; 61 : 69–90. doi: 10.3322 / caac.20107. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Kimura T. East întâlnește vestul: Diferențe etnice în epidemiologia cancerului de prostată între asiatici de est și caucazieni. Cancerul Chin J. 2012; 31 : 421-429. doi: 10.5732 / cjc.011.10324. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Reinli K, Block G. Conținutul de fitoestrogen din alimente – un compendiu al valorilor literaturii. Cancerul Nutr. 1996; 26 : 123–148. doi: 10.1080 / 01635589609514470. [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Adlercreutz H, Markkanen H, Watanabe S. Concentrații plasmatice de fitoestrogeni la bărbații japonezi. Lancet. 1993; 342 : 1209–1210. doi: 10.1016 / 0140-6736 (93) 92188-Y. [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S, Griffiths K. Lignans și izoflavonoizi în plasmă și lichid prostatic la bărbați: eșantioane din Portugalia, Hong Kong , și Regatul Unit. Prostata. 1997; 32 : 122–128. doi: 10.1002 / (SICI) 1097-0045 (19970701) 32: 2 <122 :: AID-PROS7> 3.0.CO; 2-O. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hwang YW, Kim SY, Jee SH, Kim YN, Nam CM. Consumul de alimente din soia și riscul de cancer de prostată: o meta-analiză a studiilor observaționale. Cancerul Nutr. 2009; 61 : 598-606. doi: 10.1080 / 01635580902825639. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Van Poppel H, Tombal B. Chimioprevenția cancerului de prostată cu substanțe nutritive și suplimente. Cancer Manag Res. 2011; 3 : 91–100. doi: 10.2147 / CMAR.S18503. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Barnes S, Peterson TG, Coward L. Justificare pentru utilizarea matricelor de soia care conțin genisteină în studiile de chemoprevenție pentru cancerul de sân și de prostată. J Cell Biochem (Suppl) 1995; S22 : 181–187. doi: 10.1002 / jcb.240590823. [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, și colab. Analiza farmacocinetică și farmacodinamică de fază I a izoflavonelor de soia neconjugate administrate persoanelor cu cancer. Biomarkeri de epidemiol pentru cancer Prev. 2003; 12 : 1213–1221. [ PubMed ] [ Google Scholar ]17. CD Gardner, Oelrich B, Liu JP, Feldman D, Franke AA, Brooks JD. Concentrațiile de izoflavonă din soia prostatică depășesc nivelurile serice după suplimentarea dietei. Prostata. 2009; 69 : 719–726. doi: 10.1002 / pros.20922. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA și colab. Siguranța și farmacocinetica izoflavonelor purificate din soia: Administrare cu doză unică la femeile aflate în postmenopauză. Sunt J Clin Nutr. 2002; 76 : 1126–1137. [ PubMed ] [ Google Scholar ]19. Yildiz F. Fitoestrogeni în alimente funcționale. CRC Press; Boca Raton, FL: 2005. https://doi.org/10.1201/9781420027594 . [ CrossRef ] [ Google Scholar ]20. Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M, Masamune Y. Interacțiunea fitoestrogenilor cu receptorii de estrogen alfa și beta. Biol Pharm Bull. 2001; 24 : 351–356. doi: 10.1248 / bpb.24.351. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Chang WY, Prins GS. Receptorul de estrogen-beta: Implicații pentru glanda prostatică. Prostata. 1999; 40 : 115–124. doi: 10.1002 / (SICI) 1097-0045 (19990701) 40: 2 <115 :: AID-PROS7> 3.0.CO; 2-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP, Gupta G. Mecanisme sinergice chimioprotectoare ale fitoestrogenilor dietetici într-o combinație selectă împotriva cancerului de prostată. J Nutr Biochem. 2011; 22 : 723–731. doi: 10.1016 / j.jnutbio.2010.06.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Wang J, Eltoum IE, Lamartiniere CA. Chimioprevenția genisteinei a cancerului de prostată la șoarecii TRAMP. J Cancer. 2007; 6 : 3. doi: 10.1186 / 1477-3163-6-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Davis JN, Kucuk O, Sarkar FH. Expresia antigenului specific prostatei este reglată transcripțional de genisteină în celulele cancerului de prostată. Mol Carcinog. 2002; 34 : 91–101. doi: 10.1002 / mc.10053. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Reglarea receptorilor de androgen prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgen este mediată de receptorul de estrogen beta. Eur Urol. 2004; 45 : 245–251. doi: 10.1016 / j.eururo.2003.09.001. discuție 251. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S, Hursting SD. Doza mică de genisteină induce inhibitori de kinază dependenți de ciclină și oprirea ciclului celular G (1) în celulele cancerului de prostată uman. Mol Carcinog. 2000; 29 : 92–102. doi: 10.1002 / 1098-2744 (200010) 29: 2 <92 :: AID-MC6> 3.0.CO; 2-Q. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Reglarea în sus a p21WAF1 indusă de genisteină, reglarea în jos a ciclinei B și inducerea apoptozei în celulele canceroase de prostată. Cancerul Nutr. 1998; 32 : 123–131. doi: 10.1080 / 01635589809514730. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH, Hillman GG. Genisteina inhibă activarea NF-kappaB indusă de radiații în celulele canceroase de prostată, promovând apoptoza și oprirea ciclului celular G2 / M. Cancer BMC. 2006; 6 : 107. doi: 10.1186 / 1471-2407-6-107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Li Y, Sarkar FH. Reglarea descendentă a invaziei și a genelor legate de angiogeneză identificate prin analiza microarray cDNA a celulelor canceroase de prostată PC3 tratate cu genisteină. Cancer Lett. 2002; 186 : 157–164. doi: 10.1016 / S0304-3835 (02) 00349-X. [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Guo Y, Wang S, Hoot DR, Clinton SK. Suprimarea interacțiunilor autocrine și paracrine mediate de VEGF între celulele cancerului de prostată și celulele endoteliale vasculare de către izoflavonele din soia. J Nutr Biochem. 2007; 18 : 408–417. doi: 10.1016 / j.jnutbio.2006.08.006. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Reglarea expresiei genelor și inhibarea metastazei osoase experimentale a cancerului de prostată de către genisteina dietetică. Neoplazie. 2004; 6 : 354–363. doi: 10.1593 / neo.03478. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY, He DL. Un nou efect anticanceros al genisteinei: inversarea tranziției mezenchimale epiteliale în celulele canceroase de prostată. Acta Pharmacol Sin. 2008; 29 : 1060–1068. doi: 10.1111 / j.1745-7254.2008.00831.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Kumi-Diaka JK, Hassanhi M, Merchant K, Horman V. Influența genisteinei izoflavonei pe expresia matricei metaloproteinazei-2 în celulele cancerului de prostată. J Med Food. 2006; 9 : 491–497. doi: 10.1089 / jmf.2006.9.491. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kazi A, Daniel KG, Smith DM, Kumar NB, Dou QP. Inhibarea activității proteazomului, un mecanism nou asociat cu capacitatea genisteinei de inducere a apoptozei celulare tumorale. Biochem Pharmacol. 2003; 66 : 965–976. doi: 10.1016 / S0006-2952 (03) 00414-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Kumi-Diaka J, Sanderson NA, Sala A. Rolul mediator al proteazei caspase-3 în mecanismul intracelular al apoptozei induse de genisteină în liniile celulare de carcinom prostatic uman, DU145 și LNCaP. Biol Cell. 2000; 92 : 595-604. doi: 10.1016 / S0248-4900 (00) 01109-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Lee J, Ju J, Park S, Hong SJ, Yoon S. Inhibarea semnalizării IGF-1 de către genisteină: Modularea expresiei E-cadherinei și reglarea descendentă a semnalizării β-cateninei în celulele cu cancer de prostată PC-3 hormon refractare. Cancerul Nutr. 2012; 64 : 153–162. doi: 10.1080 / 01635581.2012.630161. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Xu L, Bergan RC. Genisteina inhibă activarea matricei metaloproteinazei tip 2 și invazia celulelor cancerului de prostată prin blocarea factorului de creștere transformant activarea mediată de beta a căii proteinei kinazei 2-27-kDa proteinei șocului termic activat prin mitogen-activat kinază 2-27-kDa. Mol Pharmacol. 2006; 70 : 869–877. doi: 10.1124 / mol.106.023861. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Davis JN, Kucuk O, Sarkar FH. Genisteina inhibă activarea NF-kappaB în celulele canceroase de prostată. Cancerul Nutr. 1999; 35 : 167–174. doi: 10.1207 / S15327914NC352_11. [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Li Y, Sarkar FH. Inhibarea activării factorului nuclear kappaB în celulele PC3 de către genisteină este mediată prin calea de semnalizare Akt. Clin Cancer Res. 2002; 8 : 2369–2377. [ PubMed ] [ Google Scholar ]40. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y. Genistein, un inhibitor specific al protein kinazelor specifice tirozinei. J Biol Chem. 1987; 262 : 5592–5595. [ PubMed ] [ Google Scholar ]41. Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS, Ha J. Efectele antioxidante ale genisteinei sunt asociate cu activarea proteinei kinazei activate de AMP și inducerea PTEN în celulele canceroase de prostată . J Med Food. 2010; 13 : 815–820. doi: 10.1089 / jmf.2009.1359. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Raschke M, Rowland IR, Magee PJ, Pool-Zobel BL. Genisteina protejează celulele prostatei împotriva deteriorării ADN-ului induse de peroxidul de hidrogen și induce expresia genelor implicate în apărarea împotriva stresului oxidativ. Carcinogeneză. 2006; 27 : 2322–2330. doi: 10.1093 / carcin / bgl082. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM, Feldman D. Inhibarea sintezei și acțiunilor prostaglandinelor de către genisteină în celulele canceroase de prostată umane și de izoflavone din soia la pacienții cu cancer de prostată. Int J Rac. 2009; 124 : 2050–2059. doi: 10.1002 / ijc.24161. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L, Bernard-Gallon D. Metilarea ADN și fitoestrogeni din soia: Studiu cantitativ în liniile celulare umane de cancer de prostată DU-145 și PC-3. Epigenomica. 2011; 3 : 795–803. doi: 10.2217 / epi.11.103. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L și colab. Fitoestrogenii din soia modifică metilarea ADN a promotorului GSTP1, RASSF1A, EPH2 și BRCA1 în celulele cancerului de prostată. În Vivo. 2010; 24 : 393–400. [ PubMed ] [ Google Scholar ]46. Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang C. Inversarea hipermetilării și reactivării a 16 gene INK4a , RARbeta și MGMT de către genisteină și alte izoflavone din soia. Clin Cancer Res. 2005; 11 : 7033–7041. doi: 10.1158 / 1078-0432.CCR-05-0406. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV, Dahiya R. cancer de prostată. Cancer. 2010; 116 : 66–76. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M, Dahiya R. Acetilarea histonei mediată de genisteină și demetilarea activează genele supresoare tumorale din celulele cancerului de prostată. Int J Rac. 2008; 123 : 552-560. doi: 10.1002 / ijc.23590. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Li Y, Kong D, Ahmad A, Bao B, Dyson G, Sarkar FH. Dereglarea epigenetică a miR-29a și miR-1256 de către izoflavonă contribuie la inhibarea creșterii și invaziei celulelor canceroase de prostată. Epigenetica. 2012; 7 : 940–949. doi: 10.4161 / epi.21236. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ, Bernard-Gallon DJ. miARN exprimate diferențial în liniile celulare de cancer de prostată după tratamentul cu soia. În Vivo. 2011; 25 : 917–921. [ PubMed ] [ Google Scholar ]51. Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y, Dahiya R. MicroRNAs 221/222 și reglarea mediată de genisteină a genei supresoare tumorale ARHI în cancerul de prostată. Cancer Prev Res (Phila) 2011; 4 : 76–86. doi: 10.1158 / 1940-6207.CAPR-10-0167. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, ​​Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I și colab. Genisteina reglează în sus microRNA-574-3p supresor tumoral în cancerul de prostată. Plus unu. 2013; 8 : e58929. doi: 10.1371 / journal.pone.0058929. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J, Sarkar FH. Genisteina potențează efectul radiației asupra celulelor carcinomului de prostată. Clin Cancer Res. 2001; 7 : 382–390. [ PubMed ] [ Google Scholar ]54. Li Y, Kucuk O, Hussain M, Abrams J, Cher ML, Sarkar FH. Activitățile antitumorale și antimetastatice ale docetaxelului sunt îmbunătățite de genisteină prin reglarea osteoprotegerinei / receptorului activator al factorului nuclear-kappaB (RANK) / ligand RANK / semnalizarea MMP-9 în cancerul de prostată. Cancer Res. 2006; 66 : 4816–4825. doi: 10.1158 / 0008-5472.CAN-05-3752. [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, și colab. Genisteina și cancerul: starea actuală, provocările și direcțiile viitoare. Adv Nutr. 2015; 6 : 408–419. doi: 10.3945 / an.114.008052. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Katoh M. Rețea de WNT și alte cascade de semnalizare de reglementare în celule stem pluripotente și celule stem canceroase. Curr Pharm Biotechnol. 2011; 12 : 160–170. doi: 10.2174 / 138920111794295710. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV. Atât beta-actina, cât și GAPDH sunt gene de referință utile pentru normalizarea RT-PCR cantitativă în probe de țesut uman FFPE de cancer de prostată. Prostata. 2008; 68 : 1555–1560. doi: 10.1002 / pros.20815. [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006; 38 : 500-501. doi: 10.1038 / ng0506-500. [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci SUA. 1998; 95 : 14863–14868. doi: 10.1073 / pnas.95.25.14863. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Saldanha AJ. Java Treeview – vizualizare extensibilă a datelor micro-matrice. Bioinformatică. 2004; 20 : 3246–3248. doi: 10.1093 / bioinformatics / bth349. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Barfield RT, Kilaru V, Smith AK, Conneely KN. CpGassoc: O funcție R pentru analiza datelor despre microarray de metilare a ADN-ului. Bioinformatică. 2012; 28 : 1280–1281. doi: 10.1093 / bioinformatics / bts124. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Qiagen’s Ingenuity Pathway Analysishttp://www.qiagen.com/ingenuity .63. Dennis G, Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Baza de date pentru adnotare, vizualizare și descoperire integrată. Genomul Biol. 2003; 4 : 3. doi: 10.1186 / gb-2003-4-5-p3. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Wang Z, Chen H. Genisteinul crește expresia genelor prin demetilarea promotorului WNT5a în linia celulară de cancer de colon SW1116. Anticancer Res. 2010; 30 : 4537–4545. [ PubMed ] [ Google Scholar ]65. Gao BN, Gilman AG. Clonarea și exprimarea unei adenilil ciclaze distribuite pe scară largă (tip IV). Proc Natl Acad Sci SUA. 1991; 88 : 10178-10182. doi: 10.1073 / pnas.88.22.10178. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG, Freije D. Un panou de markeri de metilare a ADN-ului dezvăluie metilare extinsă în nucleele biopsiei prostatei histologice benigne de la pacienții cu cancer. Biomark Res. 2014; 2 : 25. doi: 10.1186 / s40364-014-0025-9. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Monti E, Bonten E, D’Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R, Tettamanti G. Sialidases in vertebrates: O familie de enzime adaptate pentru mai multe funcții celulare. Adv Carbohydr Chem Biochem. 2010; 64 : 403–479. doi: 10.1016 / S0065-2318 (10) 64007-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H, Miyagi T. Contribuția sialidazei NEU1 la suprimarea metastazelor celulelor canceroase ale colonului uman prin desialilarea integrinei beta4. Oncogene. 2009; 28 : 1218–1229. doi: 10.1038 / onc.2008.471. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S, Miyagi T. Supraexprimarea sialidazei de tip lizozomal conduce la suprimarea metastazelor asociate cu reversia fenotipului malign în celulele melanomului B16 murin. Int J Rac. 2001; 92 : 797–804. doi: 10.1002 / ijc.1268. [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W, Che X. MicroRNA-125b promovează invazia și metastaza cancerului gastric prin vizarea STARD13 și NEU1. Tumora Biol. 2016; 37 : 12141–12151. doi: 10.1007 / s13277-016-5094-y. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Haxho F, Neufeld RJ, Szewczuk MR. Neuraminidază-1: O țintă terapeutică nouă în tumorigeneză în mai multe etape. Oncotarget. 2016; 7 : 40860–40881. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H, Zhou Y. Notch3 este important pentru tranziția epitelial-mezenchimală indusă de TGF-β în osul cancerului pulmonar cu celule mici. metastază prin reglarea ZEB-1. Cancer Gene Ther. 2014; 21 : 364–372. doi: 10.1038 / cgt.2014.39. [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, și colab. Notch3 este activat de hipoxia cronică și contribuie la progresia cancerului de prostată uman. Int J Rac. 2013; 133 : 2577–2586. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, și colab. Corelarea Sprouty1 și Jagged1 cu celule agresive de cancer de prostată cu diferite sensibilități la privarea de androgen. J Cell Biochem. 2014; 115 : 1505-1515. doi: 10.1002 / jcb.24805. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A, Trindade A. Dinamica semnalizării crestăturii în prostata adultă sănătoasă și în dezvoltarea tumorilor de prostată. Prostata. 2016; 76 : 80–96. doi: 10.1002 / pros.23102. [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH, Duarte A. Endotelial Jagged1 promovează creșterea tumorilor solide atât prin funcții pro-angiogenice, cât și prin funcții angiocrine. Oncotarget. 2015; 6 : 24404–24423. doi: 10.18632 / oncotarget.4380. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, și colab. Semnalizarea prin crestături modulează diferențierea neuroendocrină indusă de hipoxie a celulelor cancerului de prostată uman. Mol Cancer Res. 2012; 10 : 230–238. doi: 10.1158 / 1541-7786.MCR-11-0296. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A, Klinakis A. Un nou rol de supresor tumoral pentru calea Notch în cancerul de vezică urinară. Nat Med. 2014; 20 : 1199–1205. doi: 10.1038 / nm.3678. [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Hernandez Tejada FN, Galvez Silva JR, Zweidler-McKay PA. Provocarea vizării crestăturii în tumorile maligne hematologice. Front Pediatr. 2014; 2 : 54. doi: 10.3389 / fped.2014.00054. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, și colab. O funcție de supresie tumorală pentru semnalizarea Notch în subtipurile tumorale din creier anterior. Celula cancerului. 2015; 28 : 730–742. doi: 10.1016 / j.ccell.2015.10.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB și colab. Rolul supresorului tumorii al Notch3 în carcinomul tiroidian medular, dezvăluit prin inducție genetică și farmacologică. Mol Cancer Ther. 2015; 14 : 499–512. doi: 10.1158 / 1535-7163.MCT-14-0073. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Semnalizarea prin crestături induce oprirea ciclului celular în celulele cu cancer pulmonar cu celule mici. Cancer Res. 2001; 61 : 3200–3205. [ PubMed ] [ Google Scholar ]83. Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX, Yang YM. Genisteina induce arestarea G2 / M în celulele canceroase gastrice prin creșterea expresiei PTEN supresoare tumorale. Cancerul Nutr. 2013; 65 : 1034–1041. doi: 10.1080 / 01635581.2013.810290. [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY, Chow NH. Romanul vizează anti-angiogeneza genisteinei pe celulele canceroase umane. Biochem Pharmacol. 2005; 69 : 307-318. doi: 10.1016 / j.bcp.2004.09.025. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Jagadeesh S, Kyo S, Banerjee PP. Genisteina reprimă activitatea telomerazei prin intermediul mecanismelor transcripționale și posttranslaționale în celulele canceroase de prostată umane. Cancer Res. 2006; 66 : 2107-2115. doi: 10.1158 / 0008-5472.CAN-05-2494. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genisteina crește expresia beta a receptorilor de estrogen în cancerul de prostată prin reducerea metilării sale promotor. J Steroid Biochem Mol Biol. 2015; 152 : 62-75. doi: 10.1016 / j.jsbmb.2015.04.018. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Whirledge S, Senbanjo LT, Cidlowski JA. Genisteina perturbă semnalizarea receptorilor glucocorticoizi în celulele Ishikawa endometriale uterine umane. Perspectiva sănătății Environ. 2015; 123 : 80-87. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]88. Bhamre S, Sahoo D, Tibshirani R, Dill DL, Brooks JD. Modificări ale expresiei genetice induse de genisteină în linia celulară de cancer de prostată LNCaP. Open Prostate Cancer J. 2010; 3 : 86–98. doi: 10.2174 / 1876822901003010086. [ CrossRef ] [ Google Scholar ]89. Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A, Vakili MA. Genisteina induce un efect imunomodulator de protecție la un model de șoarece de cancer de col uterin. Iran J Immunol. 2012; 9 : 119–127. [ PubMed ] [ Google Scholar ]90. Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN, Ziegler RG. Consumul de soia în copilărie și riscul de cancer mamar la femeile asiatice americane Biomarkeri de epidemiol pentru cancer Prev. 2009; 18 : 1050–1059. doi: 10.1158 / 1055-9965.EPI-08-0405. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W. Consumul de alimente din soia pentru adolescenți și adulți și riscul de cancer mamar: Rezultate din Studiul de sănătate al femeilor din Shanghai . Sunt J Clin Nutr. 2009; 89 : 1920–1926. doi: 10.3945 / ajcn.2008.27361. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Oncologie sunt furnizate aici prin amabilitatea Spandidos Publications

Baza farmacologică și noi perspective ale acțiunii quercetinului în ceea ce privește efectele sale anti-cancer

Si-Min Tang 1Xue-Ting Deng 1Jian Zhou cQuan-Peng Li cXian-Xiu Ge cLin Miao claAl doilea spital al oamenilor din Huai’an, Huai’an, ChinabCentrul medical pentru boli digestive, al doilea spital afiliat, Universitatea de medicină Nanjing, Nanjing, ChinacDepartamentul de endoscopie gastrointestinală, Universitatea de Medicină din Nanjing, Nanjing, China

Primit la 29 iulie 2019, revizuit la 14 octombrie 2019, acceptat la 26 octombrie 2019, disponibil online la 13 noiembrie 2019 .

https://doi.org/10.1016/j.biopha.2019.109604Obțineți drepturi și conținut

Sub Creative Commons licență acces deschis

Abstract

Quercetina este un fel de compuși flavonoizi care provine din natură și există pe scară largă în dieta zilnică. Studiile anterioare au descoperit că quercetina are multe efecte, cum ar fi antiinflamatorii, anti-oxidarea și anti-cancerul. Atât experimentele in vivo, cât și cele in vitro au demonstrat că quercetina poate exercita efecte antitumorale modificând progresia ciclului celular, inhibând proliferarea celulară, promovând apoptoza, inhibând angiogeneza și progresia metastazelor și afectând autofagia. Această revizuire rezumă dovezile pentru potențialul farmacologic și inhibarea quercetinei asupra cancerelor, susținând punctul de vedere că quercetina ar trebui considerată în mod adecvat ca un agent terapeutic împotriva diferitelor tipuri de cancer

1. Introducere

Cancerul reprezintă o amenințare gravă pentru sănătatea fizică și mentală a oamenilor, iar incidența și mortalitatea cancerului sunt mari la nivel global [ 1 , 2 ]. Potrivit GLOBOCAN, în 2012, aproximativ 14,1 milioane de pacienți din întreaga lume au fost diagnosticați nou cu cancer și 8,2 milioane de pacienți cu cancer au murit [ 3 ]. Pe lângă faptul că provoacă vătămări grave corpului pacientului, cancerul impune și o povară economică imensă asupra pacienților, iar sarcina asupra țărilor în curs de dezvoltare este în creștere [ 4 ]. Cancerul nu este o afecțiune limitată, determinată de o singură cauză, ci un tip de boală cu caracteristici similare [ 5]. Studiile anterioare au sugerat că markerii cancerului includ menținerea proliferării, evaziunea factorilor inhibitori ai creșterii, inhibarea morții celulare, nemurirea replicativă, angiogeneza și creșterea invaziei și metastazelor. Menținerea acestor șase funcții biologice se datorează diversității genetice cauzate de instabilitatea genomică [ 6 ].

În mod tradițional, tratamentul pentru cancer utilizează cele patru metode de intervenție chirurgicală, radioterapie, chimioterapie și imunoterapie singur sau în combinație [ 7 ]. Însoțită de utilizarea medicamentelor pentru chimioterapie, rezistența la medicamente cauzată de adaptarea celulelor canceroase la agenții chimioterapeutici este principalul motiv pentru obstrucționarea eficacității medicamentelor pentru chimioterapie [ 8 ]. Prin urmare, este necesară dezvoltarea medicamentelor adjuvante sau alternative. De secole, medicina chineză s-a dovedit că joacă un rol terapeutic în toate etapele cancerului, acordând prioritate distrugerii celulelor canceroase și prezentând efecte anticancerigene semnificative și poate îmbunătăți calitatea vieții pacienților cu cancer [ [9] ,  [ 10] ,  [11]]. Multe ingrediente din medicina tradițională chineză sunt extrase din plante naturale.

Quercetina (3,3 ′, 4 ′, 5,7-pentahidroxiflavona) este un compus care aparține familiei flavonoide. Este un produs natural în dieta umană și abundent sub formă de glicozid într-o varietate de plante, fructe și legume, cum ar fi ceapa, hrișca și broccoli. A fost adăugat la alimentele funcționale ca supliment alimentar comercial și poate juca un rol în prevenirea sau tratarea diferitelor boli, cum ar fi cancerul [ 12 ]. În ultimii ani, o mulțime de cercetări au confirmat că doza rezonabilă de quercetină are o varietate de funcții biologice, cum ar fi efectele antiinflamatoare, anti-oxidante și anti-canceroase [ 13 ].

Acest articol va rezuma activitatea anticancer a quercetinei pe mai multe tumori sistemice in vivo și in vitro și va evalua dovezile disponibile pentru a prezice posibilul efect inhibitor al quercetinei asupra cancerului uman pe baza mecanismului său anticancer.

2. Funcțiile farmacologice și biologice ale quercetinei

Quercetina este un fel de compus flavonoid pe care omul îl poate obține din alimente și plante. În comparație cu quercetina, forma conjugată a glicozidei quercetinei este mai bine absorbită. Quercetina este absorbită în principal în celulele intestinale sub formă de glicozide, hidrolizată în agliconă și intră în lumenul intestinal, iar mecanismul său poate fi legat de transportul glucozei. Procesul de transformare are loc în principal în intestine, iar unele se pot face în ficat și sânge. Quercetina și metaboliții săi sunt excretați în cea mai mare parte în intestin, iar o mică parte poate fi excretată în urină prin rinichi [ [14] ,  [15] ,  [16]]. Cele mai recente cercetări au arătat că microbiota intestinală joacă un rol important în generarea glicozidazelor și enzimelor, care pot transfera quercetina în molecule mai mici, mai ușor absorbite [ 17 , 18 ]. Quercetina poate fi metabolizată în derivați glucuronidați, metilați și sulfați [ 19 ].

Este bine cunoscut faptul că participarea deplină a quercetinei la reglarea metabolismului fierului are o semnificație biologică vitală. Quercetina poate reduce fierul cu valență ridicată pentru a inhiba oxidarea lipidelor și pentru a stinge producția de ROS catalizată prin fier [ 20 ]. Ca un antioxidant excelent in vitro, activitatea sa antioxidantă se manifestă în principal prin afectarea glutationului, a activității enzimei, a speciilor reactive de oxigen (ROS) și a reglării căilor de transducție a semnalului, precum NRFB, MAPK și AMPK [ 21 ]. Ca un agent eficient de eliminare a ROS, quercetina exercită efectele antioxidante prin activitatea de scavare a radicalilor liberi, reducând nivelul ROS și inhibând peroxidarea lipidelor [ 22 , 23]. Nu există nicio îndoială că quercetina poate avea, de asemenea, efecte antiinflamatorii puternice și poate reduce procesul inflamator [ 24 ]. Funcția antiinflamatoare funcționează în principal prin inhibarea eliberării citokinelor, scăderea producției de COX și LOX și menținerea stabilității mastocitelor [ [25] ,  [26] ,  [27] ]. Cercetătorii au descoperit că quercetina poate inhiba apariția fibrozei hepatice la șobolanii cu leziuni hepatice prin colestază prin reducerea expresiei TGF-β1 și a-SMA prin construirea modelului BDL și prevenirea stresului oxidativ [ 28 ]. În plus, derivații de quercetină joacă, de asemenea, funcții biologice importante, cu capacitate antioxidantă mai mare, efecte neuroprotectoare și activitate anticanceroasă puternică [[29] ,  [30] ,  [31] ,  [32] ].

Mai mult, au fost efectuate studii clinice ale quercetinei și nu s-au observat toxicitate sau efecte secundare ale quercetinei asupra populației [ 33 ]. Studiile clinice au demonstrat efectul inhibitor al quercetinei asupra inflamației și capacitatea sa de a inhiba riscul de cancer de prostată [ 34 , 35 ]. Studiile clinice de fază I au confirmat siguranța administrării intravenoase a quercetinei și au găsit dovezi ale activității sale antitumorale. Studiile clinice bazate pe quercetină au confirmat efectele scăderii tensiunii arteriale și ameliorării anemiei [ [36] ,  [37] ,  [38] ].

3. Activitatea terapeutică a quercetinei în cancer

Quercetina a demonstrat efecte benefice semnificative asupra multor boli. Datorită dozelor rezonabile de quercetină nu au efecte secundare toxice evidente asupra celulelor normale, tot mai mulți cercetători sunt atenți la efectul terapeutic al quercetinei asupra tumorilor. Numeroase studii au arătat că quercetina poate exercita funcții antitumorale într-o varietate de mecanisme și a fost confirmată în modele in vitro și in vivo ale diferitelor tumori, cu rezultate încurajatoare Quercetina previne semnificativ ciclul celular, promovează apoptoza și inhibă angiogeneza și metastazele în vitro ( Fig. 1 ). În studiile in vivo, concluziile indică faptul că doza selectată de quercetină este eficientă în inhibarea creșterii modelelor tumorale de xenogrefă.

Fig. 1

3.1. Studii in vitro

3.1.1. Efectul quercetinei asupra ciclului celular al celulelor canceroase

Ciclul celular este procesul de bază al diviziunii celulare și este în principal împărțit în patru faze: faza G1 (sinteza pre-ADN), faza S (faza de sinteză a ADN), faza G2 (faza de sinteză tardivă a ADN) și faza M (faza mitotică) ), care este reglementată în principal de ciclina, kinazele dependente de ciclină (CDK) și inhibitorul kinazei dependente de ciclină (CKI). Ciclul celular este reglementat în principal de calea de reglementare a rețelei pRb. Ciclina formează un complex cu CDK-ul său corespunzător, care fosforilează Rb și apoi eliberează E2F și cAb1. Ulterior, E2F intră în nucleu pentru a promova faza G1 în faza S pentru divizarea autonomiei celulare. În progresia ciclului celular, un tip de CKI, INK4 (inclusiv p15, p16, p18, p19) concurează cu ciclina D1 pentru legarea la CDK4 / CDK6, inhibând fosforilarea Rb și inhibând progresia ciclului celular.O altă cale importantă este reglementată în principal de p53, care induce expresia p21, GADD45 și Bax pentru a regla diviziunea ciclului celular [[39] ,  [40] ,  [41] ]. Cu toate acestea, în studiile de patogenie tumorală, s-au găsit o activitate anormală a ciclului celular și replicarea necontrolată a celulelor tumorale datorită expresiei anormale a ciclinelor.

În celula U937 de leucemie umană, s-a demonstrat că quercetina induce oprirea ciclului celular la G2 / M. Acumularea de G2 / M a fost odată cu scăderea ciclinei D, ciclinei E și E2F, iar nivelul ciclinei B a crescut în mod vizibil [ 42 ]. Rezultate similare s-au găsit și în carcinomul ovarian (SKOV3), odată cu scăderea ciclinei D1, celula a fost de asemenea arestată în fazele S și G2 / M [ 43 ]. În plus, quercetina poate induce, de asemenea, modificări în faza G0 / G1 a celulelor leucemiei limfocitare cronice 232B4 și a celulelor osteosarcomului HOS [ 44]. Există, de asemenea, numeroase studii privind reglarea căilor legate de p53 de către quercetină asupra progresiei ciclului celular tumoral. Studiul a constatat că quercetina poate induce presiunea ER și apoi poate promova eliberarea de p53, inhibând astfel activitatea CDK2, ciclinei A, ciclinei B, arestând astfel celulele cancerului de sân MCF-7 în faza S [ 45 ]. Într-un studiu realizat de o altă echipă de studiu asupra liniei celulare MDA-MB-453 a cancerului de sân, quercetina a indus oprirea fazei G2 / M în celulele MDA-MB-453. În acest studiu, au constatat, de asemenea, o creștere semnificativă a expresiei p53 [ 46 ].

În plus față de quercetin, derivații asociați cu quercetin pot afecta, de asemenea, progresia ciclului celular într-o varietate de moduri. În timp ce se află în liniile celulare de cancer de prostată PC-3 și DU-145, o anumită doză de tratament cu quercetin-6-C-beta-d-glucopiranozidă duce la stoparea ciclului celular în faza G0 / G1. Acest fenomen poate fi asociat cu reglarea descendentă a ciclinei E și D, PNCA și expresia proteinei Cdk-2 și expresia crescută a p21 și p27 [ 47 ]. Cercetătorii au găsit, de asemenea, un nou derivat O-alchilat al quercetinului, 7-O-Geranylquercetin, care ar putea aresta liniile celulare de cancer gastric SGC-7901 și MGC-803 la ciclul celular G2 / M [ 48 ] ( Tabelul 1 ).

Tabelul 1. Efectul quercetinului asupra opririi ciclului celular și a mecanismelor sale în diferite celule canceroase.

Tipul de cancerLinii telefoniceCiclul celuleiMecanismReferințe
LimfomU937G2 / M↑ ciclină B42 ]
↓ ciclină D și E, E2F1 și E2F2
Carcinom ovarianSKOV3S și ​​G2 / M↓ ciclină D143 ]
OsteosarcomU20SG0 / G1
Cancer mamarMDA-MB-453G2 / M↑ p5346 ]
Conserva gastricăSGC-7901, MGC-803G2 / M48 ]
Leucemie limfocitară cronică232B4G0 / G149 ]
Cancer de prostatăPC-3, DU-145G0 / G1↓ ciclină E și D, PNCA, Cdk-247 ]
↑ p21, p27
OsteosarcomHOSG1 / S↓ ciclină D144 ]
Cancer mamarMCF-7S↓ CDK2, ciclina A și B45 ]
↑ p53, p58

3.1.2. Efectul quercetinei asupra apoptozei celulelor canceroase

Apoptoza este programul sinuciderii celulare și este procesul prin care organismele elimină celulele inutile sau nesănătoase din corp. Acesta include în principal căile apoptotice intrinseci (numite și mitocondriale) și extrinseci (numite și receptorii morții) [ 50 ]. Calea intrinsecă este activată prin eliberarea mitocondrială a citocromului c (cit c), iar calea extrinsecă este declanșată de receptorii de moarte TRAILR și FAS, care împreună activează o serie de proteaze, inclusiv caspaza-3, -6, -7, -8 , -9 și -10 și, în cele din urmă, duce la moartea celulelor. Este deosebit de notoriu faptul că celulele tumorale evită apoptoza și apoi fac dezvoltarea tumorii. Prin urmare, declanșarea apoptozei celulelor tumorale a devenit o realizare majoră în terapia anticancer [ 51 ].

S-a demonstrat că quercetina poate afecta calea apoptotică și poate induce moartea celulelor tumorale. S-a demonstrat că o doză rezonabilă de quercetin crește expresia proteinelor pro-apoptotice și scade nivelul de expresie al proteinelor anti-apoptotice. Tratamentul cu quercetină poate induce celule de leucemie mieloidă acută HL-60, celule de melanom A375SM și apoptoză de celule de cancer ovarian A2780S [ [52] ,  [53] ,  [54] ]. Celulele stem canceroase joacă un rol cheie în progresia cancerului. Recent, s-a confirmat că quercetina poate induce și apoptoza celulelor stem de cancer gastric [ 55]. În timpul căii apoptotice intrinseci, quercetina activează caspaza-3, -8, -9, stimulează expresia Bax, Bad și reglează în jos proteinele anti-apoptotice, cum ar fi Bcl-XL, Bcl-2 și Mcl-1. În același timp, quercetina a crescut eliberarea citocromului c din mitocondrii în citoplasmă. Aceste rapoarte clarifică în continuare că apoptoza indusă de quercetin poate fi, de asemenea, direct legată de Bcl-2 [ 56 , 57 ]. În timpul procesului de apoptoză, TRAIL joacă un rol pozitiv. Moartea celulelor tumorale indusă de TRAIL este în mare parte apoptotică. Apoptoza căii extrinseci devine o țintă importantă în cercetarea anti-cancer, deoarece ucide predominant celulele tumorale și economisește celulele normale [ 51 ]. Quercetina influențează expresia TRAILR, FAS, TNFR1 etc. [ 58]. Poate coopera cu TRAIL pentru a induce apoptoza în cancerul pulmonar cu celule mici, cancerul de colon, gliomul și multe alte celule canceroase prin două căi, crescând expresia DR5 și inhibând expresia supraviețuitoare [ [59] ,  [60] ,  [61] ].

Glicozidele cu quercetină exercită, de asemenea, o funcție pro-apoptotică similară cu quercetina. Glicozidele cu quercetină au declanșat generarea ROS, au accelerat crearea citc și au reglementat expresia proteinelor asociate apoptozei, care eventual duc la apoptoza celulelor canceroase [ 48 ]. Glicozidele cu quercetină pot activa, de asemenea, apoptoza indusă de caspaza-3 în celulele HepG2 [ 62 ]. ( Tabelul 2 )

Tabelul 2. Efectul quercetinei asupra apoptozei celulare și mecanismele acesteia în diferite celule canceroase.

Tipul de cancerLinii telefoniceMecanismCalea semnuluiReferințe
MelanomA375SMCalea intrinsecă↓ bcl-2JNK / P38 MAPK52 ]
↑ bax
LeucemieHL-60↓ bcl-xlERK53 ]
↑ bax, bak
Cancer ovarianA2780S↓ bax, bcl-2, mcl-1, procaspase-3, 954 ]
↑ caspase-3, 9
Cancer gastricGCSC↓ bcl-2PI3K / AKT55 ]
↑ bax, caspase-3, 9
GliomaU87-MG, U251, A172, LN229Ambii↓ survivin, XIAPPI3K / AKT61 ]
↑ PARP, caspase-7, 8, 9
Cancer de plamaniH460Calea extrinsecă↑ caspase-3 și 8, FAS, TRAILR58 ]
Cancer de colonHT-2959 ]
Cancer de plamaniH460, A549↓ survivinAKT-SURVIVIN60 ]
↑ DR5

3.1.3. Efectul quercetinei asupra angiogenezei și metastazelor celulelor canceroase

Angiogeneza se referă la creșterea de noi capilare, al căror proces este mediat de factori de creștere, molecule de aderență, endostatină, etc. Angiogeneza disregulată este strâns legată de bolile neoplazice și afectează creșterea și metastaza tumorilor [ 63]. Angiogeneza tumorală este un proces complex în care celulele tumorale interacționează cu celulele endoteliale. Factorul de creștere endotelial vascular (VEGF) joacă un rol important de amorsare. VEGF este o moleculă cheie pentru creșterea și supraviețuirea celulelor endoteliale, poate promova proliferarea celulelor endoteliale, crește permeabilitatea vasculară, extravazarea fibrinei plasmatice, depunerea celulozei și poate provoca angiogeneza tumorii prin inducerea căii de semnalizare dependente de receptorul VEGF 2 (VEGFR2) [ 64 , 65 ].

Multe produse naturale pot inhiba angiogeneza tumorii prin diferite mecanisme [ [66] ,  [67] ,  [68] ]. Quercetina poate juca, de asemenea, un rol antitumoral prin inhibarea creșterii vaselor de sânge. În cazurile de cancer de prostată și de sân, quercetina vizează calea angiogenezei mediate de VEGFR-2, reprimă expresia factorului de reglare din aval AKT și limitează creșterea tumorii [ 69 , 70 ]. Quercetina poate limita, de asemenea, angiogeneza celulelor rezistente la medicamente și poate crește efectul medicamentelor anti-cancer [ [71] ,  [72] ,  [73] ].

Pentru majoritatea tumorilor maligne, angiogeneza este procesul inițial al metastazei tumorale. Densitatea micro-vaselor tumorale este legată de potențialul metastatic mai mare și de supraviețuirea slabă a tumorilor maligne. Neovascularizarea oferă nutriție și mediu de evacuare pentru creșterea celulelor tumorale. Celulele tumorale suferă o serie de căi circulante pentru a coloniza și a forma tumori secundare [ 74 , 75]. Pe lângă efectul său inhibitor asupra angiogenezei, quercetina poate inhiba și metastaza tumorii printr-o varietate de mecanisme moleculare. Tranziția epitelială-mezenchimală (EMT) este un proces important în metastaza cancerului. Procesul EMT implică reglarea descendentă a proteinelor de tip epitelial (de exemplu, E-cadherină, MUC1 etc.), precum și achiziționarea de markeri mezenchimali, inclusiv N-cadherină, Vimentină, Snail și așa mai departe [ 76]. Quercetina poate inhiba apariția EMT prin creșterea expresiei E-cadherinei și scăderea familiei de proteine ​​N-cadherină, Vimentină, Snail în multe tipuri de cancer. În plus, metaloproteinazele matriciale (MMP) sunt membri ai familiei de endopeptidază care remodelează matricea extracelulară zincată (ECM) care joacă un rol în mai multe etape ale cancerului. Studiile au arătat că MMP sunt implicate în principal în procesul de invazie și metastază a cancerului [ 77 , 78 ]. În cancerul colorectal, precum și în carcinomul cu celule scuamoase de cap și gât, quercetina poate inhiba, de asemenea, invazia și migrația celulelor tumorale prin reglarea expresiei MMPs [ 79 , 80 ].

Studiile au arătat că quercetina poate inhiba invazia și metastaza celulelor canceroase pulmonare prin inhibarea căii de activare Akt dependent de melc. După tratamentul cu quercetină, expresia proteinelor asociate N-cadherinei, vimentinei, ADAM9 și MMPs a fost semnificativ reglată în jos, iar expresia E-cadherinei a crescut semnificativ [ 81 ]. În liniile celulare de cancer colorectal, cercetătorii au folosit TGF-β1 pentru a induce EMT în celulele canceroase. Administrarea de quercetin poate inhiba Twist1 și regla expresia E-cadherinei pentru a inhiba EMT [ 82]. Quercetina poate inhiba nivelul MMP2 și MMP7 în celulele cancerului pancreatic PANC-1 și PATU-8988, care sunt strâns legate de procesul EMT. Cercetătorii au subliniat, de asemenea, că quercetina poate inhiba invazia și metastaza celulelor cancerului pancreatic prin inhibarea căii de semnalizare STAT3 și inversarea progresiei maligne induse de IL-6 [ 83 ]. Quercetina poate inhiba migrația celulelor melanomului indusă de HGF prin inhibarea activării c-Met și a acestuia în aval Gabl, FAK și PAK [ 84 ]. Mai mult, glicozidele cu quercetină pot inhiba, de asemenea, metastaza cancerului. Poate inhiba căile FAK și ERK1 / 2 și poate suprima vitalitatea migratorie în celulele cancerului pancreatic [ 85 ].

3.1.4. Efectul quercetinei asupra autofagiei celulelor canceroase

Autofagia este un proces în care celulele sintetizează noi macromolecule și ATP printr-o serie de reacții în condiții de înfometare și deficit de energie, menținând secvențial metabolismul normal și supraviețuirea celulelor. Formarea autofagozomilor este un pas cheie în autofagie și se bazează pe regulatorul pozitiv al complexului ATG1 / ULK, care constă din ATG1, ATG13 și ATG17. Și apoi se activează clasa Ⅲ PI3K complex, ATG5-12 conjugat cu 16 promovează alungirea membranelor autofagice, după ce s-a format markerul autofagozom LC3Ⅱ [ 86 ].

Studiile au constatat că dezvoltarea unor boli tumorale este strâns legată de autofagie și există modificări ale activității autofagiei în multe celule tumorale. În domeniul oncologiei, se crede că autofagia este inițial un inhibitor al dezvoltării tumorii, în timp ce mai multe cercetări sugerează că autofagia poate promova progresia tumorii [ 87 , 88 ]. S-au format tratamentul liniilor celulare de cancer gastric cu quercetină, vacuole autofagice și organite veziculare acide (AVO), LC3Ⅰ a fost transformat în LC3Ⅱ, care a fost recrutat în autofagozomi pentru activarea genelor autofagice și inițierea progresiei autofagiei protectoare în celulele cancerului gastric. Efectul autofagic protector al quercetinei asupra celulelor canceroase gastrice este prin inhibarea semnalizării Akt-mTOR și prin acumularea expresiei HIF-α [ 89]. Acumularea de LC3Ⅱ și formarea de AVO s-au găsit și în glioblastomul tratat cu quercetin și în liniile celulare de cancer de colon, toate acestea confirmând inducerea autofagiei de protecție a celulelor tumorale de către quercetin [ [90] ,  [91] ,  [92] ]. Cu toate acestea, pretratarea cu clorochină, un inhibitor al autofagiei, poate crește promovarea apoptozei și inhibarea proliferării de către quercetin [ 89 , 90 ].

3.2. Studii in vivo

S-a demonstrat că quercetina inhibă creșterea diferitelor tipuri de cancer în diferite modele de xenogrefe. Rata de supraviețuire a modelelor animale purtătoare de tumori a fost semnificativ crescută, iar volumul tumorii a fost redus dramatic după tratamentul cu quercetină. Efectul inhibitor al quercetinei asupra modelelor animale de xenogrefă se poate reflecta în promovarea apoptozei, inhibarea proliferării, angiogeneza și metastazele. ( Tabelul 3 )

Tabelul 3. Efectul quercetinei asupra metastazelor celulare în diferite celule canceroase.

Tipul de cancerLinii telefoniceMecanismCalea semnuluiReferințe
Conserva pulmonarăA549, HCC827↑ E-cadherinăAKT81 ]
↓ N-caderină,
vimentină, ADAM9, catepsină C, V și MMP1, 2, 7, 12
Cancer colorectalSW480↑ E-cadherină82 ]
↓ Twist1, vimentin
Cancer pancreaticPANC-1, PATU-8988↓ MMP2, MMP7STAT383 ]
MelanomA2058, A375HGF / c-Met84 ]

În modelele de xenogrefe de celule de cancer mamar și leucemie, diferite doze de quercetină pot promova apoptoza și ciclul celular prin inhibarea căii Akt / mTOR [ 98 , 100 ]. In vivo, efectul quercetinei asupra creșterii tumorii se poate manifesta și prin angiogeneza grefei și metastaze. Trombospondina-1 (TSP-1) este un factor anti-angiogenic descoperit anterior, care poate inhiba creșterea tumorii. Studii recente au descoperit că quercetina poate inhiba creșterea tumorii la șoarecii model de cancer de prostată prin reglarea în sus a expresiei TSP-1 [ 95 ]. În modelul șoarecilor BALB / c de cancer mamar, Zhao și colab. a constatat că tratat cu 34 mg / kg de quercetin poate inhiba, de asemenea, angiogeneza prin inhibarea căii calcineurină / NFAT [ 101]. Experimentele in vivo au confirmat, de asemenea, efectul inhibitor al quercetinei asupra metastazelor tumorale. Metastaza pulmonară colorectală a fost semnificativ redusă după tratamentul cu 50 mg / kg de quercetin [ 79 ]. Administrarea de quercetină inhibă, de asemenea, EMT prin afectarea căii de semnalizare EGFR și inhibarea expresiei VEGF [ 96 , 99 ]. Efectul inhibitor al quercetinei asupra creșterii tumorilor alogene a fost găsit și la modelele de celule tumorale precum cancerul pulmonar, cancerul pancreatic etc. În plus, quercetina poate coordona și activitatea antitumorală cu alți compuși [ 93 , 107 ]. De exemplu, vincristina și quercetina agenții lipozomali co-încapsulați pot crește eficacitatea terapeutică a tratamentului pentru cancerul de sân [ 107] ( Tabelul 4 ).

Tabelul 4. Doza și mecanismul de quercetin pentru a inhiba creșterea tumorii la modelele de xenogrefă.

DozaAdministrareOrganeAnimaleMecanismReferințe
Dieta de 0,4%poProstataȘoareci SCID(+) apoptoză, (-) proliferare93 ]
(-) Semnalizare AR și PI3K / Akt
150 mg / kgipProstataȘoareci(-) HSP7294 ]
25,50,75 mg / kgProstataȘoareci BALB / c(-) angiogeneză95 ]
(-) TSP-1
200 mg / kgpoProstataŞobolan(-) Calea EGFR96 ]
120 mg / kgipLeucemieȘoareci NOD / SCID(+) apoptoză, autofagie97 ]
120 mg / kgipLeucemieȘoareci NOD / SCID(+) apoptoză, autofagie98 ]
(+) Calea JNK / ERK MAPK
(-) Calea Akt / mTOR
50 mg / kgipSânȘoareci(-) metastaze, glicoliză99 ]
(-) VEGF, PKM2, pAKT / AKT
15,45 mg / kgipSânȘoareci SCIDInduceți oprirea ciclului celular100 ]
(-) Akt / mTOR
34 mg / kgipSânBALB / c(-) angiogeneză101 ]
(-) calea calcineurină / NFAT
50, 100, 200 mg / kgipSân, colonBALB / c(+) apoptoză102 ]
50 mg / kgipColonBALB / c(-) metastază79 ]
150 mg / kgIGFicatBALB / c103 ]
ipFicatBALB / c(+) apoptoză, (-) proliferare104 ]
30 mg / kgpoGastricȘoareci NOD / SCID105 ]
50 mg / kgipPlămânȘoareci Athymic(-) aurora B106 ]

4. Concluzie și opinia experților

Cancerul este o boală extrem de malignă. Pe baza stării sale actuale, este urgent să se exploreze un fel de medicament cu toxicitate mai mică, efecte secundare mai mici și medicament eficient pentru tratamentul cancerului sau terapia adjuvantă. Apariția și dezvoltarea tumorii implică mai multe legături, căi multiple și ținte multiple. Complexitatea interacțiunii dintre diferitele legături poate duce la reacții clinice, cum ar fi efect terapeutic limitat și efecte secundare mari. Ca produs natural, quercetina este un compus flavonoid și tratată cu o doză rezonabilă de quercetină este netoxică și are diferite efecte inhibitoare asupra diferitelor moduri de formare a tumorii. Un număr mare de experimente in vivo și in vitro au arătat că quercetina are un rol puternic în promovarea apoptozei, inhibarea metastazelor și capacitatea sa de a regla ciclul celular și angiogeneza tumorii.Quercetina poate influența dezvoltarea tumorii prin reglarea epigeneticii, care poate regla direct expresia miARN și nivelul de metilare a ADN-ului pentru a exercita efectul anticancer și pentru a spori sensibilitatea celulelor tumorale la chimioterapie [108 , 109 ]. Odată cu dezvoltarea studiilor clinice, marele potențial al quercetinei pentru tratamentul cancerului a fost confirmat în continuare. Cu toate acestea, există încă unele limitări în domeniul de aplicare și numărul de studii clinice implicate în studiile clinice actuale și sunt necesare studii clinice din ce în ce mai cuprinzătoare pentru a confirma efectele lor terapeutice asupra tumorilor și efectele pe care le produc.

Rezumatul revizuirii și evaluărilor literaturii anterioare, a chimioprevenției eficiente și a efectelor anticanceroase ale quercetinei au fost inițial confirmate. În viitor, se va aștepta ca quercetina să devină o potențială oportunitate de tratament pentru cancer.

Declarație de etică

Autorii nu au conflicte etice de dezvăluit.

Declarația de interes concurent

Autorii nu au conflicte de interese de declarat.

Mulțumiri

Această lucrare a fost susținută de Fundația Națională pentru Științe Naturale din China ( 81801105 ); Nanjing Medical University Science and Technology Development Key Project ( 2016NJMUZD031 )

Referințe

[1] AP Bhatt, MR Redinbo, SJ Bultman Rolul microbiomului în dezvoltarea și terapia cancerului CA Cancer J. Clin., 67 (2017), pp. 326-344 CrossRef View Record in Scopus Google Scholar [2] KA Cronin , AJ Lake, S. Scott, RL Sherman, AM Noone, N. Howlader, SJ Henley, RN Anderson, AU Firth, J. Ma, BA Kohler, A. Jemal Raport anual către națiune privind starea cancerului, partea I : statistici naționale despre cancer Cancer, 124 (2018), pp. 2785-2800 CrossRef View Record in Scopus Google Scholar [3] LA Torre, F. Bray, RL Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal Global statistici despre cancer, 2012CA Cancer J. Clin., 65 (2015), pp. 87-108 CrossRef View Record in Scopus Google Scholar [4] P. Vineis, CP Wild Global pattern de cancer: cauze și prevenție Lancet, 383 (2014), pp. 549 -557 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [5] L. Huminiecki, J. Horbanczuk Studiile genomice funcționale ale resveratrolului în ceea ce privește efectele sale anti-cancer Biotehnol. Adv. (2018) Google Scholar [6] D. Hanahan, RA Weinberg Caracteristici ale cancerului: următoarea generație Cell, 144 (2011), pp. 646-674 Articol Descărcare PDF Vizualizare înregistrare în ScopusGoogle Scholar [7] R. Baskar, KA Lee, R. Yeo, KW Yeoh Cancer și radioterapie: avansuri actuale și direcții viitoare Int. J. Med. Sci., 9 (2012), pp. 193-199 CrossRef View Record in Scopus Google Scholar [8] H. Wu, J. Xie, Q. Pan, B. Wang, D. Hu, X. Hu Agent anticancer shikonin este un inductor incompetent al rezistenței la medicamente împotriva cancerului PLoS One, 8 (2013), articolul e52706 CrossRef View Record in Scopus Google Scholar [9] VC Chung, X. Wu, EP Hui, ET Ziea, BF Ng, RS Ho, KK Tsoi, SY Wong, JC Wu Eficacitatea medicinei din plante din China pentru îngrijirea paliativă a cancerului: prezentare generală a recenziilor sistematice cu meta-analizeȘtiință. Rep., 5 (2015), p. 18111 View Record in Scopus Google Scholar [10] J. Xia, J. Chen, Z. Zhang, P. Song, W. Tang, N. Kokudo O hartă care descrie asocierea dintre componentele eficiente ale medicinei tradiționale chineze și căile de semnalizare în cancer celule in vitro și in vivo Drug Discov. Ther., 8 (2014), pp. 139-153 CrossRef Google Scholar [11] C.-Y. Wang, X.-Y. Bai, C.-H. Wang Medicina tradițională chineză: o resursă naturală prețuită pentru cercetarea și dezvoltarea medicamentelor împotriva cancerului Am. J. Chin. Med. (Gard City NY), 42 (2014), pp. 543-559 Vizualizare înregistrare în Scopus Google Scholar [12] AJ Vargas, R. BurdHormeză și sinergie: căi și mecanisme ale quercetinei în prevenirea și gestionarea cancerului Nutr. Rev., 68 (2010), pp. 418-428 CrossRef View Record in Scopus Google Scholar [13] Y. Li, J. Yao, C. Han, J. Yang, MT Chaudhry, S. Wang, H. Liu, Y. Yin Quercetin, inflamație și imunitate Nutrienți, 8 (2016), p. 167 Articol Descarcă PDF CrossRef View Record in Scopus Google Scholar [14] L. Zhang, M. Dong, X. Guangyong, T. Yuan, H. Tang, Y. Wang Metabolomics arată că acidul ferulic și quercetina din dietă modulează homeostazia metabolică la șobolani. J. Agric. Food Chem., 66 (2018), pp. 1723-1731 CrossRefVizualizați înregistrarea în Scopus Google Scholar [15] S. Andres, S. Pevny, R. Ziegenhagen, N. Bakhiya, B. Schafer, KI Hirsch-Ernst, A. Lampen Aspecte privind siguranța utilizării quercetinei ca supliment alimentar Mol. Nutr. Food Res., 62 (2018) Google Scholar [16] K. Kawabata, R. Mukai, A. Ishisaka Quercetin și polifenoli înrudiți: noi perspective și implicații pentru bioactivitatea și biodisponibilitatea lor Food Funct., 6 (2015), pp. 1399 -1417 Vizualizare înregistrare în Scopus Google Scholar [17] R. Santangelo, A. Silvestrini, C. Mancuso Ginsenoside, catechine, quercetin și gut microbiota: dovezi actuale ale interacțiunilor provocatoare Food Chem. Toxicol., 123 (2019), pp. 42-49Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [18] J. Xu, HB Chen, SL Li Înțelegerea mecanismelor moleculare ale interacțiunii dintre medicamentele pe bază de plante și microbiota intestinală Med. Rez. Rev., 37 (2017), pp. 1140-1185 CrossRef View Record in Scopus Google Scholar [19] G. D’Andrea Quercetin: Un flavonol cu ​​aplicații terapeutice multifacetate? Fitoterapia, 106 (2015), pp. 256-271 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [20] L. Xiao, G. Luo, Y. Tang, P. Yao Quercetina și metabolismul fierului: ce știm și ce Trebuie să știuFood Chem. Toxicol., 114 (2018), pp. 190-203 Articol Descărcați PDF Vizualizați înregistrarea în Scopus Google Scholar [21] D. Xu, MJ Hu, YQ Wang, YL Cui Activități antioxidante ale quercetinei și complexelor sale pentru aplicare medicamentoasă Molecule, 24 (2019) Google Scholar [22] AW Boots, GR Haenen, A. Bast Efecte ale quercetinei asupra sănătății: de la antioxidant la Eur nutraceutic . J. Pharmacol., 585 (2008), pp. 325-337 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [23] SO Abarikwu, AB Pant, EO FarombiAntioxidantul alimentar, quercetina, protejează cocultura cu celule germinale de sertoli de daunele oxidative induse de atrazină J. Biochem. Mol. Toxicol., 26 (2012), pp. 477-485 CrossRef View Record in Scopus Google Scholar [24] FJ Perez-Cano, M. Castell Flavonoide, inflamație și sistemul imunitar Nutrienți, 8 (2016) Google Scholar [25] HP Kim , I. Mani, L. Iversen, VA Ziboh Efectele flavonoidelor și biflavonoidelor care apar în mod natural asupra ciclooxigenazei și lipoxigenazei epidermice de la cobai Prostaglandinele Leukot. Esențial. Acizi grași, 58 (1998), pp. 17-24 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [26]JI Dower, JM Geleijnse, L. Gijsbers, C. Schalkwijk, D. Kromhout, PC Hollman Suplimentarea flavonoidelor pure epicatechina și quercetina afectează unii biomarkeri ai disfuncției endoteliale și inflamației la adulții (pre) hipertensivi: un dublu-orb randomizat, placebo -controlat, proces încrucișat J. Nutr., 145 (2015), pp. 1459-1463 CrossRef View Record in Scopus Google Scholar [27] A. Murakami, H. Ashida, J. Terao Prevenirea cancerului cu mai multe ținte prin quercetin Cancer Lett., 269 ​​(2008), pp. 315-325 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [28] M. KanterEfectul protector al quercetinei asupra leziunilor hepatice induse de obstrucția biliară la șobolani J. Mol. Histol., 41 (2010), pp. 395-402 CrossRef View Record in Scopus Google Scholar [29] J. Yuan, IL Wong, T. Jiang, SW Wang, T. Liu, BJ Wen, LM Chow, B. Wan Sheng Sinteza derivaților de quercetină metilată și activitățile lor de inversare pe celulele tumorale multirezistente mediate de P-gp și BCRP Eur. J. Med. Chem., 54 (2012), pp. 413-422 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [30] M. Iriti, R. Kubina, A. Cochis, R. Sorrentino, EM Varoni, A. Kabala-Dzik, B. Azzimonti, A. Dziedzic, L. Rimondini, RD WojtyczkaRutina, un glicozid Quercetin, restabilește chemosensibilitatea în celulele cancerului de sân uman Fitoter. Res., 31 (2017), pp. 1529-1538 CrossRef View Record in Scopus Google Scholar [31] SH Nile, AS Nile, YS Keum, K. Sharma Utilizarea glicozidelor de quercetin și quercetin din ceapă (Allium cepa L.) solid deșeuri ca antioxidanți, inhibitori ai ureazei și xantin oxidazei Food Chem., 235 (2017), pp. 119-126 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [32] KB Magalingam, A. Radhakrishnan, N. HaleagraharaEfecte protectoare ale glicozidelor quercetinice, rutinei și izoquercetrinei împotriva neurotoxicității induse de 6-hidroxidopamină (6-OHDA) în celulele feocromocitomului de șobolan (PC-12) Int. J. Imunopatol. Pharmacol., 29 (2016), pp. 30-39 CrossRef View Record in Scopus Google Scholar [33] L. Cialdella-Kam, DC Nieman, W. Sha, MP Meaney, AM Knab, RA Shanely Dose-response to 3 months a suplimentelor care conțin quercetină pe metabolit și profilul conjugat cu quercetină la adulți Br. J. Nutr., 109 (2013), pp. 1923-1933 View Record in Scopus Google Scholar [34] SE McCann, CB Ambrosone, KB Moysich, J. Brasure, JR Marshall, JL Freudenheim, GS Wilkinson, S. GrahamAporturile de nutrienți, alimente și fitochimicale selectate și riscul de cancer de prostată în vestul New York Nutr. Cancer, 53 (2005), pp. 33-41 CrossRef View Record in Scopus Google Scholar [35] DC Nieman, AS Williams, RA Shanely, F. Jin, SR McAnulty, NT Triplett, MD Austin, DA Henson Quercetin’s influence on Exercise performanță și biogeneză mitocondrială musculară Med. Știință. Sports Exerc., 42 (2010), pp. 338-345 Vizualizare înregistrare în Scopus Google Scholar [36] MM Kooshyar, PM Mozafari, M. Amirchaghmaghi, A. Pakfetrat, P. Karoos, MR Mohasel, H. Orafai, AA AzarianUn studiu clinic randomizat dublu orb controlat cu placebo al quercetinei în prevenirea și tratamentul mucozitei orale induse de chimioterapie J. Clin. Diagnostic. Res., 11 (2017), pp. ZC46-ZC50 Vizualizare înregistrare în Scopus Google Scholar [37] M. Zahedi, R. Ghiasvand, A. Feizi, G. Asgari, L. Darvish Quercetina îmbunătățește factorii de risc cardiovascular și biomarkerii inflamatori la femeile cu diabet de tip 2: un studiu clinic controlat randomizat dublu-orb Int. J. Prev. Med., 4 (2013), pp. 777-785 Vizualizare înregistrare în Scopus Google Scholar [38] DR Ferry, A. Smith, J. Malkhandi, DW Fyfe, PG deTakats, D. Anderson, J. Baker, DJ KerrStudiu clinic de fază I al quercetinei flavonoide: farmacocinetică și dovezi pentru inhibarea in vivo a tirozin kinazei Clin. Cancer Res., 2 (1996), pp. 659-668 Vizualizare înregistrare în Scopus Google Scholar [39] MS Park, A. Koff Prezentare generală a ciclului celular Curr. Protoc. Cell Biol., 8 (2001), p. 1Chapter 8 Articolul Descarcă PDF CrossRef Vezi record în Scopus Google Academic [40] M. Ingham, GK Schwartz terapeutica ciclu de celule provin de vârstă J. Clin. Oncol., 35 (2017), pp. 2949-2959 Vizualizare înregistrare în Scopus Google Scholar [41] T. Otto, P. Sicinski Proteinele ciclului celular ca ținte promițătoare în terapia canceruluiNat. Rev. Cancer, 17 (2017), pp. 93-115 CrossRef View Record in Scopus Google Scholar [42] TJ Lee, OH Kim, YH Kim, JH Lim, S. Kim, JW Park, TK Kwon Quercetin arestează G2 / M fază și induce moartea celulară dependentă de caspază în celulele U937 Cancer Lett., 240 (2006), pp. 234-242 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [43] D. Catanzaro, E. Ragazzi, C. Vianello, L Caparrotta, M. Montopoli Efectul quercetinei asupra ciclului celular și a expresiei ciclinei în carcinomul ovarian și liniile celulare de osteosarcom Nat. Prod. Commun., 10 (2015), pp. 1365-1368 Vizualizare înregistrare în Scopus Google Scholar [44]DK Suh, EJ Lee, HC Kim, JH Kim Inducerea arestării fazei G (1) / S și apoptoză prin quercetină în celulele osteosarcomului uman Arch. Pharm. Res., 33 (2010), pp. 781-785 CrossRef View Record in Scopus Google Scholar [45] CC Chou, JS Yang, HF Lu, SW Ip, C. Lo, CC Wu, JP Lin, NY Tang, JG Chung , MJ Chou, YH Teng, DR Chen Quercetin-mediate de ciclul celular de arestare și apoptoză implicând activarea unei cascade caspaza prin calea mitocondrială în cancerul de sân uman celulele MCF-7 Arch. Pharm. Res., 33 (2010), pp. 1181-1191 CrossRef View Record in Scopus Google Scholar [46] EJ Choi, SM Bae, WS AhnEfecte antiproliferative ale quercetinei prin stoparea ciclului celular și apoptoză în cancerul de sân celulele MDA-MB-453 celule Arch. Pharm. Res., 31 (2008), pp. 1281-1285 CrossRef View Record in Scopus Google Scholar [47] R. Hamidullah, KS Kumar, A. Saini, S. Kumar, E. Kumar, R. Ramakrishna, R. Maurya, N. Konwar Chattopadhyay, Quercetin-6-C-beta-D-glucopiranozidă, analogul natural al quercetinei prezintă activitate de cancer anti-prostată prin inhibarea căii Akt-mTOR prin receptorul de hidrocarburi aril Biochimie, 119 (2015), pp. 68-79 Vizualizare Înregistrare în Scopus Google Scholar [48] Y. Zhu, Y. Jiang, L. Shi, L. Du, X. Xu, E. Wang, Y. Sun, X. Guo, B. Zou, H. Wang, C. Wang, L. Sun, Y. Zhen7-O-Geranylquercetin induce apoptoza în celulele canceroase gastrice prin activarea căii de semnalizare mitocondrială mediată de ROS-MAPK Biomed. Pharmacother., 87 (2017), pp. 527-538 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [49] AA Gokbulut, E. Apohan, Y. Baran Resveratrol și apoptoza indusă de quercetin a celulelor 232B4 de leucemie limfocitară cronică umană prin activare of caspase-3 and cell cycle arrest Hematology, 18 (2013), pp. 144-150 Vizualizare înregistrare în Scopus Google Scholar [50] K. Fernald, M. Kurokawa Evadarea apoptozei în cancer Tendințe celulare Biol., 23 (2013), pp. 620-633 Articol Descărcare PDF Vizualizare înregistrare în ScopusGoogle Scholar [51] IM Ghobrial, TE Witzig, AA Adjei Targeting apoptosis pathways in cancer treatment CA Cancer J. Clin., 55 (2005), pp. 178-194 CrossRef View Record in Scopus Google Scholar [52] SH Kim, ES Yoo, JS Woo, SH Han, JH Lee, SH Jung, HJ Kim, JY Jung Antitumorale și efectele apoptotice ale quercetinei asupra celulelor melanomului uman care implică activarea semnalizării JNK / P38 MAPK Eur. J. Pharmacol., 860 (2019), articolul 172568 Articolul Descărcați PDF Vizualizați înregistrarea în Scopus Google Scholar [53] WJ Lee, M. Hsiao, JL Chang, SF Yang, TH Tseng, CW Cheng, JM Chow, KH Lin, YW Lin, CC Liu, LM Lee, MH ChienQuercetina induce apoptoza derivată mitocondrială prin activarea ERK reactivă mediată de specii de oxigen în celulele leucemiei HL-60 și arhiva xenogrefă . Toxicol., 89 (2015), pp. 1103-1117 CrossRef View Record in Scopus Google Scholar [54] X. Gao, B. Wang, X. Wei, K. Men, F. Zheng, Y. Zhou, Y. Zheng , M. Gou, M. Huang, G. Guo, N. Huang, Z. Qian, Y. Wei Efect anticancer și mecanismul quercetinei încapsulate polimerice pe cancer ovarian Nanoscală, 4 (2012), pp. 7021-7030 CrossRef Vedeți înregistrarea în Scopus Google Scholar [55] X. Shen, Y. Si, Z. Wang, J. Wang, Y. Guo, X. ZhangQuercetina inhibă creșterea celulelor stem de cancer gastric uman prin inducerea apoptozei mitocondriale dependente prin inhibarea PI3K / Akt semnalizare Int. J. Mol. Med., 38 (2016), pp. 619-626 CrossRef View Record in Scopus Google Scholar [56] A. Primikyri, N. Sayyad, G. Quilici, EI Vrettos, K. Lim, SW Chi, G. Musco, IP Gerothanassis, AG Tzakos Probarea interacțiunii unui quercetin bioconjugat cu Bcl-2 în celule vii de cancer uman cu spectroscopie RMN în celule FEBS Lett., 592 (2018), pp. 3367-3379 CrossRef View Record în Scopus Google Scholar [57]A. Primikyri, MV Chatziathanasiadou, E. Karali, E. Kostaras, MD Mantzaris, E. Hatzimichael, JS Shin, SW Chi, E. Briasoulis, E. Kolettas, IP Gerothanassis, AG Tzakos Legarea directă a proteinelor familiei Bcl-2 prin quercetina declanșează activitatea sa pro-apoptotică ACS Chem. Biol., 9 (2014), pp. 2737-2741 CrossRef View Record in Scopus Google Scholar [58] H. Youn, JC Jeong, YS Jeong, EJ Kim, SJ Um Quercetin potențează apoptoza prin inhibarea semnalizării factorului nuclear-kappaB în H460 celule canceroase pulmonare Biol. Pharm. Bull., 36 (2013), pp. 944-951 CrossRef View Record in Scopus Google Scholar [59] FH Psahoulia, KG Drosopoulos, L. Doubravska, L. Andera, A. PintzasQuercetina îmbunătățește apoptoza mediată de TRAIL în celulele cancerului de colon, inducând acumularea de receptori de moarte în plută lipidică Mol. Cancer Ther., 6 (2007), pp. 2591-2599 Vizualizare înregistrare în Scopus Google Scholar [60] W. Chen, X. Wang, J. Zhuang, L. Zhang, Y. Lin Inducerea receptorului de moarte 5 și suprimarea survivin contribuie la sensibilizarea citotoxicității induse de TRAIL de către quercetin în celulele cancerului pulmonar cu celule mici, carcinogeneză, 28 (2007), pp. 2114-2121 CrossRef View Record în Scopus Google Scholar [61] MD Siegelin, DE Reuss, A. Habel , A. Rami, A. von DeimlingQuercetina promovează degradarea supravieținei și, prin urmare, îmbunătățește apoptoza mediată de receptorii morții în celulele gliomului Neuro Oncol, 11 (2009), pp. 122-131 CrossRef View Record in Scopus Google Scholar [62] S. Sudan, HP Rupasinghe Quercetin-3- O-glucozidul induce inhibiția ADN umană a topoizomerazei II, oprirea ciclului celular și apoptoza în celulele carcinomului hepatocelular Anticancer Res., 34 (2014), pp. 1691-1699 Vizualizare înregistrare în Scopus Google Academic [63] J. Folkman Angiogenesis: an principiu de organizare pentru descoperirea drogurilor? Nat. Rev. Drug Discov., 6 (2007), pp. 273-286 CrossRef View Record în Scopus Google Scholar [64]ML Wong, A. Prawira, AH Kaye, CM Hovens Angiogeneza tumorii: mecanismul și implicațiile sale terapeutice în glioamele maligne J. Clin. Neurosci., 16 (2009), pp. 1119-1130 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [65] RH Adams, K. Alitalo Reglarea moleculară a angiogenezei și limfangiogenezei Nat. Pr. Mol. Cell Biol., 8 (2007), pp. 464-478 CrossRef View Record in Scopus Google Scholar [66] Y. Wang, W. Ma, W. Zheng Deguelin, un agent anti-tumorigen nou care vizează apoptoza, oprirea ciclului celular și anti-angiogeneză pentru chimioprevenția cancerului Mol. Clin. Oncol., 1 (2013), pp. 215-219 CrossRefVedeți înregistrarea în Scopus Google Scholar [67] B. Rashidi, M. Malekzadeh, M. Goodarzi, A. Masoudifar, H. Mirzaei Ceaiul verde și efectele sale anti-angiogeneză Biomed. Pharmacother., 89 (2017), pp. 949-956 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [68] O. Wahl, M. Oswald, L. Tretzel, E. Herres, J. Arend, T. Efferth Inhibition of angiogeneza tumorală de către anticorpi, molecule mici sintetice și produse naturale Curr. Med. Chem., 18 (2011), pp. 3136-3155 CrossRef View Record in Scopus Google Scholar [69]P. Pratheeshkumar, A. Budhraja, YO Son, X. Wang, Z. Zhang, S. Ding, L. Wang, A. Hitron, JC Lee, M. Xu, G. Chen, J. Luo, X. Shi Quercetin inhibă creșterea tumorii de prostată umană mediată de angiogeneză prin vizarea căilor de semnalizare reglate VEGFR-2 AKT / mTOR / P70S6K PLoS One, 7 (2012), articolul e47516 CrossRef View Record in Scopus Google Scholar [70] S. Balakrishnan, FA Bhat, P. Raja Singh, S. Mukherjee, P. Elumalai, S. Das, CR Patra, J. Arunakaran Quercetina conjugată cu nanoparticule de aur inhibă tranziția epitelial-mezenchimală, angiogeneza și invazivitatea prin calea mediată de EGFR / VEGFR-2 în cancerul de sân Cell Prolif., 49 (2016), pp. 678-697 CrossRef View Record în Scopus Google Scholar[71] SJ Oh, O. Kim, JS Lee, JA Kim, MR Kim, HS Choi, JH Shim, KW Kang, YC Kim Inhibarea angiogenezei prin quercetină în celulele cancerului de sân rezistente la tamoxifen Food Chem. Toxicol., 48 (2010), pp. 3227-3234 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [72] Q. Long, Y. Xie, Y. Huang, Q. Wu, H. Zhang, S. Xiong, Y Liu, L. Chen, Y. Wei, X. Zhao, C. Gong Inducerea apoptozei și inhibarea angiogenezei prin quercetina lipozomală PEGilată atât în ​​cancerele ovariene sensibile la cisplatină, cât și la cisplatina J. Biomed. Nanotechnol., 9 (2013), pp. 965-975 CrossRef View Record in Scopus Google Scholar [73]CS Lei, YC Hou, MH Pai, MT Lin, SL Yeh Efectele quercetinei combinate cu medicamente anticanceroase asupra factorilor asociați cu metastazele celulelor cancerului gastric: studii in vitro și in vivo J. Nutr. Biochem., 51 (2018), pp. 105-113 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [74] J. Folkman Rolul angiogenezei în creșterea tumorii și metastaza Semin. Oncol., 29 (2002), pp. 15-18 Article Download PDF View Record in Scopus Google Scholar [75] DR Bielenberg, BR Zetter Contribuția angiogenezei la procesul de metastază Cancer J., 21 (2015), pp. 267-273 Vizualizare înregistrare în ScopusGoogle Scholar [76] J. Dai, K. Liang, S. Zhao, W. Jia, Y. Liu, H. Wu, J. Lv, C. Cao, T. Chen, S. Zhuang, X. Hou, S Zhou, X. Zhang, XW Chen, Y. Huang, RP Xiao, YL Wang, T. Luo, J. Xiao, C. Wang Chimioproteomica dezvăluie că baicalina activează CPT1 hepatic pentru a ameliora obezitatea indusă de dietă și steatoza hepatică Proc Natl Acad Sci SUA, 115 (2018), pp. E5896-E5905 CrossRef View Record in Scopus Google Scholar [77] L. Yadav, N. Puri, V. Rastogi, P. Satpute, R. Ahmad, G. Kaur Matrix metaloproteinaze and Cancer – roluri în amenințare și terapie Asian Pacific J. Cancer Prev., 15 (2014), pp. 1085-1091 Vizualizare înregistrare în Scopus Google Scholar [78] A. Dufour, CM În generalLipsește ținta: matrice metaloproteinază antitargets în inflamație și cancer Trends Pharmacol. Sci., 34 (2013), pp. 233-242 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [79] JY Kee, YH Han, DS Kim, JG Mun, J. Park, MY Jeong, JY Um, SH Hong Inhibitory efectul quercetinei asupra metastazelor pulmonare colorectale prin inducerea apoptozei și suprimarea capacității metastatice Fitomedicină, 23 (2016), pp. 1680-1690 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [80] C.-HL Chien-Yi Chana, Ming -Fen Leeb, Chun-Yin HuangaQuercetina suprimă migrația celulară și invazia în capul și gâtul carcinomului cu celule scuamoase (HNSCC) BioMedicine, 6 (2016), pp. 10-15 Google Scholar [81] JH Chang, SL Lai, WS Chen, WY Hung, JM Chow, M Hsiao, WJ Lee, MH Chien Quercetin suprimă capacitatea metastatică a cancerului pulmonar prin inhibarea activării Akt dependente de melc și căi de expresie ADAM9 independente de melc Biochim Biophys Acta Mol Cell Res, 1864 (2017), pp. 1746-1758 Descărcare articol PDF Vedeți înregistrarea în Scopus Google Scholar [82] J. Feng, D. Song, S. Jiang, X. Yang, T. Ding, H. Zhang, J. Luo, J. Liao, Q. YinQuercetina limitează tranziția epitelial-mezenchimală indusă de TGF-beta1 prin inhibarea Twist1 și reglarea expresiei E-cadherinei Biochem. Biofizi. Rez. Commun., 498 (2018), pp. 132-138 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [83] D. Yu, T. Ye, Y. Xiang, Z. Shi, J. Zhang, B. Lou, F Zhang, B. Chen, M. Zhou Quercetin inhibă tranziția epitelial-mezenchimală, scade invazivitatea și metastazele și inversează tranziția epitelio-mezenchimală indusă de IL-6, exprimarea MMP prin inhibarea semnalizării STAT3 în celulele canceroase pancreatice Onco. Ther., 10 (2017), pp. 4719-4729 Vizualizare înregistrare în Scopus Google Scholar [84]HH Cao, CY Cheng, T. Su, XQ Fu, H. Guo, T. Li, AK Tse, HY Kwan, H. Yu, ZL Yu Quercetin inhibă semnalizarea HGF / c-Met și migrația și invazia celulelor melanomului stimulate de HGF Mol. Cancer, 14 (2015), p. 103 Vizualizare înregistrare în Scopus Google Scholar [85] J. Lee, J. Lee, SJ Kim, JH Kim Quercetin-3-O-glucozidă suprimă migrația celulelor de cancer pancreatic indusă de factorii de creștere deteriorați de tumori in vitro Oncol. Rep., 35 (2016), pp. 2473-2479 CrossRef View Record in Scopus Google Scholar [86] JH Hurley, LN Young Mechanisms of autophagy initiation Annu. Rev. Biochem., 86 (2017), pp. 225-244 CrossRef View Record în ScopusGoogle Scholar [87] E. White Rolul autofagiei în cancer J. Clin. Invest., 125 (2015), pp. 42-46 Vizualizare înregistrare în Scopus Google Scholar [88] JMM Levy, CG Towers, A. Thorburn Țintirea autofagiei în cancer Nat. Rev. Cancer, 17 (2017), pp. 528-542 CrossRef View Record in Scopus Google Scholar [89] K. Wang, R. Liu, J. Li, J. Mao, Y. Lei, J. Wu, J. Zeng, T. Zhang, H. Wu, L. Chen, C. Huang, Y. Wei Quercetin induce autofagia protectoare în celulele canceroase gastrice: implicarea Akt-mTOR- și a factorului indus de hipoxie 1α mediate de semnalizare Autofagie, 7 (2014 ), pp. 966-978 Vizualizare înregistrare în Scopus Google Scholar[90] H. Kim, JY Moon, KS Ahn, SK Cho Quercetin induce apoptoza mediată mitocondrială și autofagia de protecție în glioblastomul uman Celulele U373MG Oxid. Med. Celula. Longev., 2013 (2013), Articolul 596496 Vizualizare înregistrare în Scopus Google Scholar [91] FH Psahoulia, S. Moumtzi, ML Roberts, T. Sasazuki, S. Shirasawa, A. Pintzas Quercetin mediază degradarea preferențială a Ras oncogen și provoacă autofagie în celule de colon uman transformate în Ha-RAS Carcinogenesis, 28 (2007), pp. 1021-1031 CrossRef View Record în Scopus Google Scholar [92]Y. Bi, C. Shen, C. Li, Y. Liu, D. Gao, C. Shi, F. Peng, Z. Liu, B. Zhao, Z. Zheng, X. Wang, X. Hou, H. Liu, J. Wu, H. Zou, K. Wang, C. Zhong, J. Zhang, C. Shi, S. Zhao Inhibarea autofagiei indusă de quercetină într-un stadiu târziu îmbunătățește efectele citotoxice asupra celulelor gliomului Tumora Biol., 37 (2015), pp. 3549-3560 Google Scholar [93] P. Wang, JV Vadgama, JW Said, CE Magyar, N. Doan, D. Heber, SM Henning Inhibarea îmbunătățită a creșterii tumorilor xenogrefe ale cancerului de prostată prin combinarea quercetinei și verde ceai J. Nutr. Biochem., 25 (2014), pp. 73-80 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [94] A. Asea, G. Ara, BA Teicher, MA Stevenson, SK CalderwoodEfectele medicamentului flavonoid quercetin asupra răspunsului tumorilor de prostată umană la hipertermie in vitro și in vivo Int. J. Hyperthermia, 17 (2001), pp. 347-356 Vizualizare înregistrare în Scopus Google Scholar [95] F. Yang, X. Jiang, L. Song, H. Wang, Z. Mei, Z. Xu, N. Xing Quercetina inhibă angiogeneza prin reglarea ascendentă a trombospondinei-1 pentru a antagoniza creșterea celulei PC-3 a cancerului de prostată uman in vitro și in vivo Oncol. Rep., 35 (2016), pp. 1602-1610 CrossRef View Record in Scopus Google Scholar [96] AB Firdous, G. Sharmila, S. Balakrishnan, P. RajaSingh, S. Suganya, N. Srinivasan, J. ArunakaranQuercetina, un flavonoid dietetic natural, acționează ca agent chemopreventiv împotriva cancerului de prostată într-un model in vivo prin inhibarea căii de semnalizare EGFR Food Funct., 5 (2014), pp. 2632-2645 CrossRef View Record în Scopus Google Scholar [97] AK Calgarotto, V. Maso, GCF Junior, AE Nowill, PL Filho, J. Vassallo, STO Saad Activități antitumorale de Quercetin și ceai verde în xenogrefele de leucemie umană celule HL60 Sci. Rep., 8 (2018), p. 3459 Vizualizare înregistrare în Scopus Google Scholar [98] V. Maso, AK Calgarotto, GC Franchi Jr, AE Nowill, PL Filho, J. Vassallo, ST Saad Efecte multitarget ale quercetinului în leucemieCancer Prev. Rez. Phila. (Phila), 7 (2014), pp. 1240-1250 Vizualizați înregistrarea în Scopus Google Scholar [99] L. Jia, S. Huang, X. Yin, Y. Zan, Y. Guo, L. Han Quercetin suprimă mobilitatea a cancerului mamar prin suprimarea glicolizei prin inducerea autofagiei mediată de calea Akt-mTOR Life Sci. (2018) Google Scholar [100] A. Rivera Rivera, L. Castillo-Pichardo, Y. Gerena, S. Dharmawardhane Anti-cancer Cancer Potential of quercetin via Akt / AMPK / Mammalian target of rapamicin (mTOR) signaling cascade PLoS One , 11 (2016), articolul e0157251 CrossRef Google Scholar [101] X. Zhao, Q. Wang, S. Yang, C. Chen, X. Li, J. Liu, Z. Zou, D. CaiQuercetina inhibă angiogeneza prin țintirea calcineurinei în modelul xenogrefă al cancerului de sân uman Eur. J. Pharmacol., 781 (2016), pp. 60-68 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [102] M. Hashemzaei, A. Delarami Far, A. Yari, RE Heravi, K. Tabrizian, SM Taghdisi, SE Sadegh, K. Tsarouhas, D. Kouretas, G. Tzanakakis, D. Nikitovic, NY Anisimov, DA Spandidos, AM Tsatsakis, R. Rezaee Anticancer și efecte inducătoare de apoptoză ale quercetinei in vitro și in vivo Oncol. Rep., 38 (2017), pp. 819-828 CrossRef View Record in Scopus Google Scholar [103] H. Zou, YF Zheng, W. Ge, SB Wang, XZ MouEfecte sinergice antitumorale ale quercetinei și adenovirusului oncolitic care exprimă TRAIL în carcinomul hepatocelular uman Sci. Rep., 8 (2018), p. 2182 Vizualizare înregistrare în Scopus Google Scholar [104] J. Zhou, L. Fang, J. Liao, L. Li, W. Yao, Z. Xiong, X. Zhou Investigația efectului anticancer al quercetinei asupra celulelor HepG2 din vivo PLoS One, 12 (2017), articolul e0172838 CrossRef View Record in Scopus Google Scholar [105] HH Lee, S. Lee, YS Shin, M. Cho, H. Kang, H. Cho Efect anticancerigen al quercetinei în xenogrefă modele cu molecule de carcinom gastric uman asociat cu EBV , 21 (2016) Google Scholar [106]Z. Xingyu, M. Peijie, P. Dan, W. Youg, W. Daojun, C. Xinzheng, Z. Xijun, S. Yangrong Quercetin suprimă creșterea cancerului pulmonar vizând Aurora B kinaza Cancer Med., 5 (2016), pp. 3156-3165 CrossRef View Record in Scopus Google Scholar [107] MY Wong, GN Chiu Formularea lipozomică a vincristinei co-încapsulate și a activității antitumorale îmbunătățite cu quercetină într-un model de xenogrefă a tumorii mamare insensibile la trastuzumab , Nanomedicină, 7 (2011), pp. 834-840 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar [108] DH Kim, H. Khan, H. Ullah, STS Hassan, K. Smejkal, T. Efferth, MF Mahomoodally, S. Xu, S. Habtemariam, R. Filosa, R. Lagoa, KR RengasamyMicroRNA care vizează quercetina în tratamentul cancerului și chimioprotecția Pharmacol. Res., 147 (2019), articolul 104346 Articolul Descărcați PDF Vizualizați înregistrarea în Scopus Google Scholar [109] M. Kedhari Sundaram, A. Hussain, S. Haque, R. Raina, N. Afroze Quercetin modifică metilarea promotorului 5’CpG și reactivează diferite gene supresoare tumorale prin modularea semnelor epigenetice în celulele cancerului de col uterin uman J. Cell. Biochem., 120 (2019), pp. 18357-18369 CrossRef View Record in Scopus Google Scholar 1

Acești autori au contribuit în mod egal la această lucrare.

https://www.sciencedirect.com/science/article/pii/S0753332219352266

Vaccinurile anti-Covid SUNT CONTRAINDICATE GRAVIDELOR și mamelor care alăptează. Aflați aici DE CE. Opinia unui medic specialist adresată Societății de Obstetrică și Ginecologie din România

Incepând de astăzi în România are loc vaccinarea în masă a populației și cu vaccinul Moderna. Organizația Mondială a Sănătății nu a recomandat inițial gravidelor injectarea nici cu vaccinul Pfizer/BioNTech nici cu Moderna. Recomandare făcută și de Marea Britanie, care a lansat un AVERTISMENT PUBLIC gravidelor în cazul tuturor vaccinurilorDe data aceasta mașina de propagandă guvernamentală nu a mai umplut spațiul mediatic cu anunțuri de interes public pentru femeile însărcinate din România, pentru a le avertiza asupra riscurilor la care ar putea fi expuse ele și fătul. Și chiar bărbații, pentru că profesorul Vasile Astărăstoae, fost președinte al Colegiului Medicilor din România a avertizat într-o emisiune a lui Marius Tucă că vaccinurile nu pot fi recomandate nici unui membru al unei familii care dorește să aibă copii în această perioadă. Din păcate, după cum arată un material publicat în exclusivitate de ActiveNews, Societatea de Obstetrică și Ginecologie din România, a remis medicilor de specialitate din țară o serie de recomandări care sfidează realitatea științifică și pot pune în pericol mamele însărcinate și pruncii lor nenăscuți.

Realitatea este că vaccinurile anti-Covid nu au cum să nu prezinte o dilemă pentru femeile însărcinate responsabile, după cum scrie și prestigioasa revistă americană New Yorker, pentru simplul fapt că studiile companiilor producătoare de vaccinuri au exclus din teste gravidele. Aceasta cu toate că femeile aflate la vârsta de reproducere reprezintă o majoritate a lucrătorilor din prima linie, după cum a observat New Yorker într-o analiză pe această temă.

În interesul apărării sănătății mamelor însărcinate, doamna dr. Geanina Dragnea, medic primar de obstetrică-ginecologie la un cabinet privat din Pitești, a avut amabilitatea să ne remită un material pe care l-a trimis sub formă de sesizare prin e-mail în data de 24.01.2021 către Societatea Româna de Obstetrică și Ginecologie (SOGR) dar la care, însă, nu a primit nici un răspuns, motiv pentru care a considerat necesar să o transforme în avertizare publică pentru toți cei interesați. Prin aceasta sesizare, bine documentată, în care a atașat și bibliografia ce include evaluarea vaccinului Pfizer/NioNTech – Comirnaty de catre Agenția Europeană a Medicamentului, a cerut să fie remediate omisiunile /erorile de informare dintr-un document emis de SOGR în data de 15.01.2021, document intitulat „POZIȚIA SOCIETĂȚII DE OBSTETRICĂ ȘI GINECOLOGIE DIN ROMÂNIA (SOGR) FAȚĂ DE VACCINAREA COVID-19 A FEMEII GRAVIDE ȘI CARE ALĂPTEAZĂ”.

Doamna doctor nu a primit însă nici un răspuns din partea SOGR, după cum am spus. „Știm cu toții că vaccinarea anti-covid este promovată într-un mod agresiv, informației transmise lipsindu-i obiectivitatea, acuratețea științifică. Știm, în același timp, că femeile gravide sau cele care alaptează și copii sunt segmente ale populației care trebuie protejate în mod special. Promovarea abuzivă, neobiectivă, a vaccinului este făcută și de către medici prin materiale publicitare dar și prin conferințe care, în loc sa fie organizate sub formă de dezbatere, sunt mai degrabă sub formă de directive, în care medicului receptor trebuie să-i dispară simțul critic.”, ne-a transmis doamna doctor.

Împreună cu sesizarea sa, a atașat Poziția SOGR (PDF AICI), redată și de noi mai jos, recomandările din data de 26 ianuarie 2021 ale Ministerului Sănătății precum și broșura de informare trimisă către medicii de familie din România, broșură care prezintă aceleași omisiuni menționate de către doamna doctor și care se constituie mai mult într-o broșură de propagandă asemănătoare cu cea livrată preoților, în care se face din titlul afirmația falsă că vaccinurile sunt „sigure”. Nu sunt sigure. O spun chiar prospectele lor. Și nu au „doar câteva reacții adverse”, după cum a mințit opinia publică doctorașul de la Matei Balș Adrian Marinescu. Mai bine avea grijă de propriul spital decât să se lăfăie prin studiouri de televiziuni debitând enormități pe bandă. Poate acum erau 8 morți mai puțin din propriii bolnavi. În aceste condiții, în care nici măcar medicii nu sunt informați corect, cum ar putea ei sa consilieze pacientii?, se întreabă doamna doctor Geanina Dragnea. Prezentăm mai jos opinia sa de specialitate, cu mulțumiri.

În atenția SOCIETĂȚII DE OBSTETRICĂ ȘI GINECOLOGIE DIN ROMÂNIA (SOGR)Sesizare

Domnule Presedinte al SOGR,

Subsemnata Dragnea Geanina, medic primar obstetrica ginecologie, in urma primirii prin e-mail a pozitiei SROG asupra vaccinarii anti COVID a gravidelor si femeilor care alapteaza, as dori sa va sesizez cateva aspecte (legate in principal de vaccinul Comirnaty – pe care l-am studiat cred cu atentie, fiind si primul aparut in Romania). Mentionez ca am numerotat fiecare paragraf din documentul transmis de dumneavoastra si l-am atasat la sfarsitul sesizarii ca sa pot face cu mai multa usurinta  comentariile. Sper ca cele sesizate sa fie utile pentru remedierea omisiunilor din acest document care trebuie sa fie cat mai obiectiv si informativ si sa contribuie la imbunatatirea comunicarii informatiilor referitoare la vaccinarea anti-covid  intre SROG catre medicii obstetricieni  in aceste momente dificile pentru toti.

Paragraful 2 – informatiile oferite pacientelor trebuie sa fie    „echilibrate, balansate, nedirecționate”.  Exista un material informativ complet, obiectiv cu material bibliografic, oferit de SROG medicilor obstetricieni cu privire la siguranta si eficacitatea acestui vaccin in general si, in mod particular, pentru gravide si femeile care alapteaza? Cred ca un astfel de material este extrem de necesar pentru ca informatiile oferite pacientelor sa indeplineasca criteriile de mai sus, si nu sa fie obtinute din media. De asemenea, cred ca ar trebui ca pacientelor sa li se ofere spre citire macar prospectul vaccinului, pentru un consimtamant informat.

Paragraful 3 – afirmati ca exista „datele limitate încă de siguranță a vaccinului la gravide”. In studiile de faza 1,2,3 sarcina si alaptarea au fost criterii de excludere (1). Prin urmare nu se poate afirma ca datele referitoare la siguranta si eficacitatea vaccinului sunt „limitate”, ci ca lipsesc. Afirmatia „reacțiile adverse sunt aceleași ca în populația generală, și ca frecvență și ca intensitate” nu se poate astfel sustine. De asemenea, pozitia SROG fata de vaccinare fiind un document important, adresat medicilor, ar fi trebuit ca fiecare afirmatie din document sa fie sustinuta de date bibliografice, pentru ca am fost educati sa practicam medicina bazata pe dovezi. In ce priveste afirmatia ca eficacitatea vaccinului este de 95% (2), aceasta este incompleta daca nu se mentioneaza in acelasi timp ca cifrele sunt pentru preventia bolii COVID in general (ce poate varia de la minim simptomatica la forme severe) pe o perioada de urmarire medie de doar 1,5 luni! (3). In analiza separata a eficacitatii vaccinarii in preventia bolii COVID severe, s-a observat ca aceasta este de doar 66,5%; in plus, deoarece  numarul de cazuri de COVID sever a fost  foarte mic (3 in grupul nevaccinat si unul in cel vaccinat) nu s-a putut trage o concluzie semnificativa statistic asupra eficacitatii (4). Aceasta informatie importanta este omisa in mod constant atat in media dar si in prezentarile Colegiului Medicilor din Romania, ceea ce consider ca este un lucru neprofesionist. Cred ca toti suntem interesati in principal de eficacitatea vaccinului pentru prevenirea bolii severe in forme usoare si moderate de viroze respiratorii am mai avut si in trecut si nu a existat atata panica. In privinta acestui aspect, cred ca informatiile prezentate de medicii ce au sustinut conferinte si dezbateri televizate nu a fost obiectiva. De asemenea, in studiul clinic Pfizer, nu s-a putut trage o concluzie asupra eficacitatii vaccinului pentru persoanele ce au avut boala COVID inainte de inrolarea in studiu, deoarece, in cursul studiului, a fost inregistrat doar cate un caz de boala la 550 de participanti in ambele grupuri, atat  vaccinat cat si nevaccinat (5). Aceste rezultate ar putea sugera, asa cum afirma si EMA (3), ca boala COVID anterioara ofera cel putin o protectie partiala  pentru o noua infectare si ca eficacitatea vaccinarii poate fi  scazuta in aceste cazuri, iar raportul risc – beneficiu nu ar mai fi in favoarea vaccinarii. Avand in vedere ca in Romania, pana in prezent, s-au raportat peste 700000 de persoane pozitive, cred ca indicatiile de vaccinare trebuiau adaptate situatiei tarii noastre (de exemplu testarea prezentei anticorpilor inainte de vaccinare)

Paragraful 4 – cred ca mentionarea utilitatii vaccinarii gravidei pentru a preveni imbolnavirea membrilor familiei  este incorecta. Acestia, daca vor sa se protejeze, pot alege sa se vaccineze. Conform definitiei CDC a vaccinului – „Vaccine: A product that stimulates a person’s immune system to produce immunity to a specific disease, protecting the person from that disease” (6) – persoanele care doresc sa se protejeze se vaccineaza. In plus, in evaluarea EMA se noteaza ca, in urma studiului clinic, nu se poate afirma ca vaccinul ofera protectie pentru boala asimptomatica sau ca impiedica transmiterea virusului (8).

Paragraful 5 – alaptarea a fost un criteriu de excludere in studiul clinic; prin urmare nu exista date asupra sigurantei administrarii (1)

Paragraful 6 – reamintim ca alaptarea si sarcina au fost criterii de excludere in studiul clinic, prin urmare nu se poate afirma ca „vaccinarea la gravide este sigura”. Astfel, afirmatia pe care nu o agreati „nu este sigură vaccinarea la gravide” este pentru moment adevarata; aceasta poate fi insotita de informatia ca femeile gravide au fost excluse din studiul clinic. Aceasta precizare/informatie nu este  furnizata in pozitia SROG fata de vaccinare si nici in dezbaterile televizate sau in prezentarea CMR. Este important ca informatia transmisa catre medici si populatie sa fie obiectiva, corecta, completa.

Paragraful 7 – lipsesc datele bibliografice care sa sustina aceste afirmatii (ex. „Gravidele simptomatice cu boală Covid-19 sunt la un risc mai mare de a dezvolta forma severă decât femeile simptomatice Covid-19 care nu sunt gravide „). Fiind medici ne sunt utile sursele bibliografice pentru a le studia si personal, pentru a vedea daca sunt relevante statistic. Populatia de gravide are in componenta ei, in general, putine situatii care sa asocieze comorbiditati ce predispun la COVID sever, deoarece in marea majoritate a cazurilor o femeie care rationeaza alege sa devina gravida cand starea ei de sanatate este echilibrata. Datele din acest paragraf referitoare la siguranta administrarii vaccinului la gravide sunt fie insotite de promisiunea obtinerii lor in viitor, fie afirmate prin aproximare cu experienta altor vaccinuri – deci nu sunt o certitudine.  Pentru afirmatia „Studiile DART ale lui Pfizer-BioNtech sunt așteptate în scurt timp și sunt date preliminare că vor arăta aceeași lipsă de efecte adverse asupra reproducerii” exista informatii intr-o oarecare masura opuse  –  un studiu pe animale mentionat in evaluarea EMA la pagina 50 identifica un risc de doua ori mai mare de avort preimplantational, desi procentual este considerat ca nu depaseste riscul declarat in literatura, precum si un risc mic de malformatii ca: gastroschisis, malformatii ale gurii si maxilarului, de arc aortic de partea dreapta, de anomalii ale vertebrelor cervicale. (7).  

In plus fata de ce am sesizat pentru fiecare paragraf, as dori sa subliniez ca in acest document nu s-a mentionat ca:

– Vaccinul este aprobat conditionat de EMA/FDA

– Rezultatele finale ale studiului sunt disponibile in dec 2023  (8)

 – Exista posibile reactii adverse severe (pareza faciala, anafilaxie), precum si procente  deloc neglijabile de reactii usoare si moderate

– Studiul clinic Pfizer a considerat sarcina si alaptarea citeriu de excludere.

– Nu sunt disponibie date referitoare eficacitatea/siguranta pe termen lung a vaccinului, precum si nici despre riscul de boala agravata asociata vaccinului (VAED) si boala agravata respiratorie asociata vaccinului (VAERD), riscuri potentiale importante identificate in studiile anterioare pe vaccinuri anti SARS CoV1 si mentionate  de EMA (9).

Bibliografie:

1. Pag 68 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

2. PAG 95 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

3. Pag 96 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

4. Pag 89, 93, 96, 97 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

5. Pag 96 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

6. https://www.cdc.gov/vaccines/vac-gen/imz-basics.htm

7. Pag 50  https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

8. Pag 97  https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf9. Pag 115 https://www.ema.europa.eu/en/documents/assessment-report/comirnaty-epar-public-assessment-report_en.pdf

Cu stima,  
dr. Geanina Dragnea
24.01.2021   


POZIȚIA SOCIETĂȚII DE OBSTETRICĂ ȘI GINECOLOGIE DIN ROMÂNIA (SOGR)
FAȚĂ DE VACCINAREA COVID-19 A FEMEII GRAVIDE ȘI CARE ALĂPTEAZĂ  


15 ianuarie 2021

1.SOGR recomandă tuturor medicilor obstetricieni să discute pe larg cu pacientele lor gravide sau care alăptează aspectele subliniate în continuare în acest material.

2.Discuția trebuie să ofere informații echilibrate, balansate, nedirecționate, să prezinte într-un limbaj accesibil datele științifice și consensurile elaborate de grupurile internaționale de experți prezentate în continuare.  

3.Trebuie subliniat ce se știe sigur dar și ce nu se știe încă, explicând riscurile mamei și fătului în momentul îmbolnăvirii cu Covid-19 și severitatea bolii, eficiența vaccinului, datele limitate încă de siguranță a vaccinului la gravide și motivul acestei limitări. De asemenea, faptul că reacțiile adverse sunt aceleași ca în populația generală, și ca frecvență și ca intensitate.

4.Decizia de a se vaccina sau nu trebuie să rămână a pacientei, după ce a primit toate informațiile și răspunsurile la întrebările ei din partea obstetricianului. Trebuie să fie discutate și gradul de expunere al gravidei la locul de muncă, la domiciliu precum și măsura în care îmbolnăvirea ei pune la risc membrii familiei, și mai ales dacă aceștia au comorbiditățile cunoscute pentru Covid-19. Decizia legata de vaccinare trebuie să fie autonomă și asumată de gravidă sau de femeia care alăptează.

5.Gravidele sau femeile care alăptează care la finalul discuției aleg să nu se vaccineze trebuie susținute în decizia lor, la fel ca și cele vor dori să se vaccineze. Pentru prima categorie medicul trebuie să reitereze importanța prevenției îmbolnăvirii prin metodele foarte cunoscute: mască, distanțare, igienă, etc.

6.SOGR solicită autorităților să nu restricționeze accesul gravidelor sau femeilor care alăptează la vaccinarea Covid-19, așa cum nu este restricționat nici în UE sau SUA. De asemenea, solicităm nuanțarea mesajului de către cei aleși ca vectori de promovare, pentru a nu mai auzi cuvinte precum: „nu vaccinăm gravidele, nu este sigură vaccinarea la gravide, etc”7.Următoarele date sunt certificate de studiile științifice (date publicate sfârșit Decembrie 2020 – Ianuarie 2021):

a. Gravidele simptomatice cu boală Covid-19 sunt la un risc mai mare de a dezvolta forma severă decât femeile simptomatice Covid-19 care nu sunt gravide.

b. Deși riscul absolut pentru forma severă Covid-19 este mic, există un risc mai mare de internare în ATI, de necesitate de suport ventilator, ECMO și deces la gravidele simptomatice Covid-19 față de femeile Covid-19 simptomatice negravide.

c. Gravidele cu diabet, obezitate sunt la un risc și mai mare de boală Covid-19 formă severă decât gravidele fără aceste comorbidități.

d. Grupurile de experți internaționali (ACOG, CDC, JCVI, RCOG) sunt de acord că gravidele reprezintă o populație cu risc înalt, alături de pacienții cu cancer, obezitate, diabet, boli renale, cardiace, fibroză chistică, imunosupresie etc, toți dezvoltând forme severe de Covid-19; aceasta cu atât mai mult cu cât gravida are oricare dintre aceste comorbidități.

e. Cele două vaccinuri Covid-19 existente acum în România nu au fost testate pe gravide. De aceea nu există date specifice de siguranță pentru sarcină. Studiile DART (Data from Developmental and Reproductive Toxicity) elaborate de Moderna și publicate în 4 Decembrie 2020 arată lipsa oricăror efecte adverse asupra reproducerii și dezvoltării embrionare la șoarece. Studiile DART ale lui Pfizer-BioNtech sunt așteptate în scurt timp și sunt date preliminare că vor arăta aceeași lipsă de efecte adverse asupra reproducerii.  

f. Ținând cont de mecanismul de acțiune al acestor vaccinuri și de rezultatele studiilor clinice de fază II și III, este de așteptat ca eficiența și siguranța vaccinurilor la gravide să fie aceleași ca în cazul femeilor negravide (ACOG, 2021).

g. Sunt planificate să înceapă în SUA studii pe gravide încă din Ianuarie 2021.

h. Există doar un lot foarte mic de femei (voluntare în studiile clinice) care au rămas gravide accidental pe parcursul administrării vaccinului. Datele acestora sunt urmărite, dar nu au fost încă finalizate.  

i. Se așteaptă date de la cele 330.000 de gravide care lucrează în sistemul de sănătate SUA și care beneficiază de vaccinare prioritară în prezent. Se estimează că majoritatea se vor vaccina.

j. Numeroase vaccinuri se administrează în timpul sarcinii de zeci de ani (cele care nu conțin virus viu atenuat). De exemplu: vaccinul gripal, vaccinul DTPa (diftero-tetanopertussis) sunt adminstrate în sarcină și nu au fost descrise efecte adverse la mamă sau la făt. Vaccinurile Covid-19 au îndeplinit aceleași standarde înalte de siguranță în procesul aprobării lor ca și cele amintite mai sus.

Recomandările ACOG (21 Decembrie 2020):  

1. Nu există date că vaccinurile Covid-19 sunt contraindicate în sarcină. Gravidele trebuie să fie libere să decidă dacă se vaccinează sau nu.

2. Nu este necesară amânarea obținerii sarcinii după terminarea vaccinării cu ambele doze de vaccin.

3. Prin mecanismul lor de acțiune, se consideră că vaccinurile nu cresc riscul de infertilitate.

4. Dacă o femeie rămâne gravidă după prima doză, a 2-a doza trebuie administrată conform protocolului.

5. Testul de sarcină nu este necasar înainte de administrarea vaccinului.

6. Vaccinul antigripal și vaccinul DTPa trebuie făcute în sarcină la interval de minim 14 zile de la administrarea vaccinului Covid-19.

7. Imuoglobulina anti-D nu interferă cu răspunsul imun al vaccinului și trebuie facută în continuare conform protocolului.

Recomandările ABM (14 Decembrie 2020):

1. Femeile care alăptează nu au fost incluse în studiile clinice, dar datele sugerează că vaccinul nu trece în lapte și în orice caz nu poate acționa asupra nou-născutului. Dacă vaccinul Covid-19 este înghițit și nu injectat intramuscular, este supus digestiei și inactivat imediat.

2. O gravidă vaccinată Covid-19 în sarcină este foarte probabil să transmită anticorpi nou-născutului prin lapte și să îi ofere astfel acestuia o anumită imunitate, imunitate ce va fi crescută ulterior prin continuarea alăptării.

Recomandările RCOG, JCVI (30 Decembrie 2020):

1. Ca măsură de prevedere, nu este încă recomandată de rutină vaccinarea la gravide, din cauza lipsei de date. Cu toate acestea, este recomandat gravidelor clinic vulnerabile să discute opțiunea vaccinări cu medicul lor, deoarece comorbiditățile acestora le conferă un risc foarte crescut de a dezvolta complicații grave ale bolii Covid-19. De asemenea, gravidele care lucrează în sistemul medical sau de îngrijire socială trebuie să discute opțiunea vaccinării.

2. Nu există nici un risc cunoscut al vaccinării Covid-19 pentru femeile care alăptează.

3. Aceste recomandări se bazează pe situația de moment, până când datele clinice vor permite ca vaccinarea să fie recomandată de rutină tuturor gravidelor.

SOGR va updata actuala poziție pe măsură ce vor fi disponibile noi date stiintifice. SOGR își exprimă convingerea că un vaccin eficient în pandemia Covid-19 trebuie să fie un vaccin care să poată fi administrat și gravidelor. Până atunci, ne dorim o comunicare corectă a informației adresată pacientelor din partea membrilor noștri și din partea autorităților.

ACOG – American College of Obstetricians and GynecologistsCDC – Center of Diseases Control
JCVI – Joint Committee on Vaccination and Immunisation
ABM – Academy of Breastfeeding Medicine

Biroul Executiv SOGR
 
Președinte,
 
Prof. Univ. Dr. Radu Vlădăreanu

Imunoterapia psihoneuroendocrină a cancerului: evoluție istorică și rezultate clinice

Abstract

Prognosticul bolilor neoplazice depinde nu numai de caracteristicile biogenetice ale celulelor canceroase, ci și de răspunsul imunologic al pacienților, care pot influența caracteristicile biologice ale celulelor canceroase, precum și procesele angiogene. Mai mult decât atât, sistemul imunitar in vivo se află sub un regulament fiziologic psioneuroendocrin (PNE), mediatizat în principal de sistemul opioid cerebral și de glanda pineală. Mai detaliat, imunitatea anticancer este stimulată de melatonina hormonală pineală (MLT) și inhibată de sistemul opioid și anume printr-un receptor mu-opioid. Mai multe modificări care implică funcția endocrină pineală și sistemul opioid au fost descrise la pacienții cu cancer, care ar putea juca un rol în evoluția tumorii în sine. Prin urmare, corecția farmacologică a anomaliilor legate de evoluția cancerului ar putea contribui la controlul difuziei cancerului, și anume, deficiența endocrină pineală și hiperactivitatea sistemului opioid cerebral. De fapt, administrarea de doze farmacologice a singurului MLT a fost deja dovedită că prelungește supraviețuirea de un an la pacienții cu cancer metastatic necurabil. Rezultate mai bune pot fi obținute prin asocierea altor indoli pineali cu MLT, antagoniști mu-opioizi, canabinoizi, beta-carboline. Mai mult decât atât, aceste combinații de neuroendocrine pot fi asociate cu succes cu citokine antitumorale, cum ar fi interleukină (IL) -2 și IL-12, ca terapie pentru cancerul imun PNE, precum și cu PLANTE antitumorale, ca PNE-fitoterapie a cancerului în încercarea de a propune posibile tratamente anticanceroase, de asemenea, la pacienții cu cancer diseminat și care nu sunt tratabili conform oncologiei standard.

INTRODUCERE

Toate strategiile oncologice medicale disponibile până în prezent în tratamentul neoplasmelor umane au fost elaborate în încercarea de a contracara diseminarea cancerului printr-o inhibare a proliferării celulelor canceroase prin inducerea apoptozei prin blocarea proceselor angiogenetice, esențiale pentru malignitatea biologică tumorală . Cu toate acestea, trebuie remarcat faptul că creșterea tumorii nu depinde doar de caracteristicile genetice ale celulelor canceroase, ci și de starea imunitară a pacienților cu cancer. [ 1 , 2 , 3 ] Apoi, limita terapiilor convenționale anticanceroase disponibile până la acum, inclusiv cele mai recente terapii țintă, constă în excluderea importanței stării imune a bolnavilor de cancer în determinarea prognosticului lor. De fapt, un număr mare de modificări imune au fost descrise la pacienții cu cancer, care ar juca un rol în influențarea istoricului clinic al bolii neoplastice. [ 1 , 2 , 3 , 4 ] Mai mult, din cauza existenței unei reglementări neuroendocrine. a sistemului imunitar, așa cum se arată în progresele recente în cunoașterea imunologiei psioneuroendocrine (PNEI), [ 5 , 6 ] modificările imune asociate cancerului care au avut loc la începutul bolii ar putea fi datorate cel puțin în parte unei modificări controlul psihoneuroendocrinului (PNE) al răspunsului imun antitumoral. Apoi, cel puțin din punct de vedere teoretic, ar putea fi posibilă corectarea modificărilor imunitare legate de cancer, acționând asupra reglării PNE a sistemului imunitar.

Terapia cu PNE a cancerului constă în înlocuirea condițiilor psihoneuroimune ale stării de sănătate printr-o corecție farmacologică a modificărilor majore legate de progresia cancerului care implică reglarea neuroendocrine a imunității anticancerigene. Acest proiect este justificat de faptul că starea imunosupresivă legată de cancer ar depinde, cel puțin la începutul dezvoltării cancerului, de o modificare neuroendocrină modificată a sistemului imunitar, întrucât numai cu diseminarea cancerului, masa tumorii în sine poate produce substanțe imunosupresoare, cum ar fi interleukina IL-10 și factorul de creștere transformant (TGF) -beta, [ 7 ] care suprimă și mai mult funcția deja modificată a sistemului imunitar. Apoi, o corecție farmacologică a modificărilor neuroendocrine asociate cancerului implicate în controlul imunității antitumoare ar putea îmbunătăți imunitatea funcțională a pacienților cu cancer. Mai multe modificări neuroendocrine au fost descrise la pacienții cu cancer avansat, cum ar fi dispariția ritmului circadian cortizol în multe histotipuri tumorale [ 8 ] și niveluri anormal de mari de prolactină, și anume, în carcinoamele mamare și prostatei [ 9 ], dar principala evoluție a cancerului – deficiența neuroendocrină aferentă constă într-o scădere progresivă a producției nocturne de melatonină (MLT)10 ], care reprezintă cel mai investigat, dar nu singurul hormon indol, furnizat de activitatea anticanceră produsă de glanda pineală. 

Mecanismele acțiunii antitumorale ale MLT au fost bine cercetate, iar în prezent, MLT ar reprezenta singura moleculă existentă în natură, care este în măsură să inhibe fazele generale ale dezvoltării și evoluției cancerului, [ 11 , 12 , 13 , 14 , 15 ] constând din (1) existența unui statut imunosupresiv anterior datorat unui control neuroendocrin alterat al sistemului imunitar legat de stres și depresie; (2) transformarea malignă spontană sau indusă de carcinogen într-o singură celulă; (3) modificarea joncțiunilor intracelulare; (4) modificarea matricei intercelulare în urma unei modificări a joncțiunilor intercelulare, care stimulează angiogeneza; (5) invazia și diseminarea cancerului indusă de angiogeneză, cu producerea de tumori de substanțe imunosupresoare; (6) expresia tumorii a ligandului FAS, care poate induce apoptoza limfocitelor T care exprimă FAS.

metode

În acest articol de recenzie, am folosit cuvinte cheie, cum ar fi „MLT”, „neuroimunomodulare” sau „glandă pineală” în PubMed pentru a evalua posibile tratamente anticanceroase pentru pacienții cu cancer diseminat și care nu pot fi tratate conform oncologiei standard.

FIZIOPATOLOGIA IMUNITĂȚII ANTICANCERULUI

Se știe că distrugerea celulelor canceroase indusă de sistemul imunitar este mediată în principal de limfocitele citotoxice T (CD8 +) și, respectiv, de celulele NK (CD16 +), prin intermediul unui antigen specific și o citotoxicitate nespecifică a antigenului. [ 16 ] Celulele NK sunt stimulate în principal. de IL -2 eliberat de limfocitele T helper-1 (TH1) (CD4 +), în timp ce limfocitele T citotoxice (CD8 +) sunt anume sub un control stimulator eliberat de IL-12 produs de celulele dendritice. [ 17 ] Pe de altă parte, imunitatea anticancer este inhibată de activarea sistemului macrofag prin producerea de citokine supresive, cum ar fi limfocitele reglatoare IL-6 și T (CD4 + CD25 +), care contracarează imunitatea anticancer prin producerea de citokine imunosupresoare care inhibă secreția de atât IL-2 cât și IL-12, inclusiv TGF-beta și IL-10, sau printr-un contact direct între celule și celule. [ 18 , 19 , 20 ] Prin urmare, cunoașterea mecanismelor responsabile pentru imunitatea anticancer este esențială pentru identificarea care imunobiolog Modificările icale pot avea o semnificație prognostică în influențarea istoricului clinic al bolii neoplazice.

CONTROLUL PSIHONEUROENDOCRINULUI DE CREȘTEREA CANCERULUI ȘI IMUNITATEA ANTITUMORALA

De-a lungul istoriei îndelungate a războiului uman împotriva cancerului, au fost elaborate mai multe strategii experimentale pentru a promova debutul cancerului spontan și indus de cancerigen și pentru a stimula diseminarea cancerului la animalele purtătoare de tumori, cea mai importantă dintre ele fiind reprezentată de condițiile de stres [ 21 ] și prin pinealectomie. [ 22 ] Fiecare hormon, neurohormon și neurotransmițător poate influența potențial sistemul imunitar, dar descoperirile recente ale PNEI [ 23 , 24 , 25 ] au permis identificarea a trei structuri anatomice principale responsabile de reglarea fiziologică a PNE a răspunsurile imune, constând din sistemul opioid cerebral, sistemul cannabinergic cerebral și glanda pineală. Glanda pineală și sistemul cannabinergic ar constitui o axă funcțională [ 23 ], care joacă un rol important în stimularea imunității anticanceroase, și anume, prin promovarea directă a producției de IL-2 cu limfocite TH-1. [ 24 ] În schimb, opioidul creierului. sistemul poate inhiba răspunsul imunitar anticancer prin stimularea funcției imunosupresive a limfocitelor T reg. [ 25 ] Stare de stres – promovarea creșterii cancerului s-ar datora unei producții cronice îmbunătățite de cortizol, ale cărui efecte imunosupresoare sunt bine cunoscute și unei îmbunătățiri activitatea sistemului cerebral opioid [ 21 ], care poate fi abrogată prin administrarea de antagoniști mu-opioizi. Pe de altă parte, se știe, de mai bine de 50 de ani, că îndepărtarea chirurgicală a glandei pineale sau inhibarea farmacologică a acesteia poate spori frecvența tumorilor spontane sau induse de cancerigen [ 22 , 26 ] Efectul de promovare a pinealectomiei asupra  creșterii tumorii poate fi abrogată parțial doar prin administrarea de MLT [ 27 ], sugerând că hormonii pineali, altele decât MLT, sunt implicați în activitatea anticanceră a glandei pineale.28 ] Este confirmată importanța stării neuroendocrine a pacienților în evoluția cancerului. prin faptul că, în condiții experimentale, neutralizarea farmacologică a modificărilor asociate dezvoltării cancerului în neurotransmisie se poate opune debutului tumorii. [ 29 ] Prin urmare, modificările neuroendocrine legate de cancer nu ar reprezenta un simplu epifenomen, dar ar putea juca un rol fiziopatologic în cancer progresie.

DEFICIENȚA ENDOCRINĂ PINEALĂ ȘI PROGRESIA CANCERULUI

Cea mai frecventă modificare neuroendocrină care apare cu progresia cancerului este reprezentată de declinul progresiv al producției nocturne de MLT [ 30 ], cu o dispariție următoare a luminii fiziologice / a ritmului circadian întunecat. Din cauza activității sale antitumoare, deficiența de MLT legată de progresia cancerului [ 11 , 12 , 13 , 14 , 15 ] ar putea contribui cel puțin parțial la diseminarea tumorii. Scăderea progresivă a nivelului de sânge MLT ar depinde de producerea tumorii de enzimă indoleamină-2,3-dioxigenază [ 31 ], care poate induce o epuizare a triptofanului, adică esențială atât pentru sinteza MLT, cât și pentru imunitatea anticancer, deoarece deficitul de triptofan inhibă Limfocitele TH1 funcționează și stimulează activarea limfocitelor T reg, cu o suprimare a răspunsului imun anticancer. În plus, alterații histologice ale glandei pineale au fost deja descrise la pacienții care au murit din cauza cancerului încă de acum mai bine de 50 de ani. [ 32 ] Prin urmare, deficiența de MLT nu ar constitui singurul defect endocrin care apare în istoricul clinic al bolii neoplastice. De fapt, s-a dovedit că glanda pineală produce mai multe molecule naturale anticancerigene, altele decât MLT; în special, hormonul indolor 5-metoxitriptamină, care in vitro a părut să exercite o activitate antiproliferativă anticancerigentă superioară celei MLT în sine [ 33 ] și o mare varietate de beta-carboline, care pot juca atât efecte antitumoare cât și psihotrope în termeni. de expansiune a minții, cea mai activă dintre ele este 6-metoxi-1,2,3,4 tetrahidro-beta-carbolină, numită și pinolina sau pinealină. [ 34 ] În prezent, însă, singurele proprietăți anticanceroase bine investigate. sunt cele ale MLT. [ 11 , 12 , 13 , 14 , 15 ]

ISTORIA CLINICĂ A TERAPIEI PSIHONEUROENDOCRINE A CANCERULUI

Pe baza faptului că creșterea cancerului este inhibată de glanda pineală și este stimulată de sistemul opioid cerebral, și anume, prin activarea receptorilor mu-opioizi, [ 21 , 22 , 23 , 24 , 25 , 26 , 27 ] Terapia cu PNE a cancerului constă în administrarea de molecule neuroendocrine umane endogene furnizate de activitatea anticancerigene, datorită unei acțiuni antiproliferative directe și / sau a unei stimulări a imunității anticancer, în asociere cu strategiile farmacologice efectuate pentru a contracara suprimarea acestuia, cum ar fi utilizarea a naltrexonei antagoniste mu-opioide (NTX).

Din punct de vedere istoric, evoluția abordării PNE în terapia cancerului poate fi rezumată în 5 faze clinice principale consecutive, constând în

(1) administrarea orală a dozelor farmacologice de melatonina MLT în perioada întunecată a zilei [ 35 ]. după cum arată Bartsch și Bartsch [ 36 ] corespunzând perioadei zilnice a producției sale endogene maxime;

(2) administrarea altor hormoni indol antitumorali pineali în asociere cu MLT, și anume, 5-metoxi-triptamină (5-MTT) în faza ușoară a zilei, în încercarea de a reproduce farmacologic ritmul fiziologic / întunecat al ritmului glanda pineală; [ 37 ]

(3) administrarea antagonistului mu-opioid NTX pentru a bloca sistemul opioid, care joacă un rol stimulator în creșterea cancerului și unul inhibitor asupra imunității anticanceroase; [ 38 ]

(4) agoniști canabinoizi pentru combaterea hiperactivității legate de cancer a sistemului macrofag [ 39 ], care poate suprima imunitatea anticancer și poate stimula creșterea cancerului prin producerea factorilor de creștere a tumorilor și a moleculelor angiogene;

(5) administrarea de beta-carboline, cum ar fi pinolina.

Toate datele clinice sunt menționate la pacienți cu cancer metastatic care nu sunt tratabili, pentru care nu a fost disponibil niciun alt tratament antitumoral standard și cu speranță de viață <1 an.40 ] Mai mult, majoritatea studiilor au fost efectuate doar cu MLT și cu o doză farmacologică ușoară constând din 20 mg / zi în faza întunecată a zilei.35 , 40 ] MLT în doză zilnică de 20 mg a părut să inducă o durată de supraviețuire mai mare de 1 an la aproximativ 30% dintre pacienții cu cancer avansat cu speranță de viață <1 an , [ 35 ] în asociere cu o îmbunătățire a stării lor clinice, în special în tratamentul cașexiei, depresiei și trombocitopeniei. 

Efectul Antidepresiv și proprietățile trombopoietice ale MLT par să fie îmbunătățite printr-o administrare concomitentă a celuilalt indol pineal 5-MTT. [ 37 ] Mai mult, s-a demonstrat recent că activitatea anticanceră a MLT la om este un fenomen dependent de doză. întrucât MLT la 100 mg / zi a apărut că induce o stabilizare a bolii la pacienții cu cancer, care au progresat sub o doză de 20 mg și a determinat un timp de supraviețuire> 1 an la aproximativ 50% dintre pacienții cu speranță de viață <1 an,41 ] în asociere cu un procent de regresii tumorale obiective de aproximativ 10%, în timp ce acestea sunt extrem de rare la o doză de 20 mg / zi.

Dimpotrivă, rolul terapeutic al antagoniștilor mu-opioizi în terapia cancerului este încă controversat, deoarece au fost propuse două scheme diferite, constând în doze mici și doză mare NTX. [ 42 , 43 ]

Rezultatele clinice preliminare ar sugera administrarea concomitentă de doze mari de NTX poate spori activitatea anticanceră a MLT, cel puțin în tratamentul tumorilor cerebrale.44 ]

În ceea ce privește utilizarea clinică a canabinoizilor în terapia cancerului, aceasta este încă la început. Cu toate acestea, datele preliminare ar sugera că canabinoizii pot fi eficienți în terapia paliativă a tumorilor pentru a vindeca cachexia, anorexia, vărsăturile și, de asemenea, durerea în asociere cu opioidele. [ 45 ] Mai mult, datele preliminare par să arate că agoniștii canabinoizi pot crește eficacitatea MLT în terapia glioblastomului creierului. [ 44 ]

În sfârșit, administrarea de beta-carboline, cum ar fi pinolina, în asociere cu MLT și cu ceilalți indoli pinieni ar îmbunătăți și mai mult starea de conștiință a pacienților tratabili cu metastaze tratabile și a acestora modul (date nepublicate).

EVOLUȚII VIITOARE A TERAPIEI CANCERULUI PSIHONEUROENDOCRINE

Eficacitatea anticancer a unei abordări PNE în terapia cancerului poate fi îmbunătățită în continuare prin cel puțin două strategii principale, constând în asocierea acesteia cu citokine anticancerigene, și anume, cu IL-2 și IL-12, ca terapie cu cancer PNEI sau cu administrarea plantelor naturale anticanceroase și anume Aloe vera , Aloe Arborescens  , Myrrh ( Smirna )  ,  Magnolia  , Boswellia ( tamaie )  ,  Curcuma , Annona muricata ( Graviola )  ca fitoterapie PNE a tumorilor.

Principalele molecule anticanceroase sunt reprezentate de aloe-emodină pentru Aloe , Guggulsterone pentru Myrrh și Honokiol pentru Magnolia . [ 45 , 46 , 47 ] MLT pare să îmbunătățească eficacitatea antitumorală a IL-2 în doze mici în ceea ce privește atât răspunsul tumoral. și timpul de supraviețuire în ceea ce privește IL-2 singur [ 48 ], cu activitate potențială în majoritatea histotipurilor tumorale, în timp ce IL-2 este în general eficientă numai în tratamentul cancerului renal și a melanomului. Mai mult, în prezent, limfocitoza maximă obținută la tratament a fost obținută cu IL-2 plus IL-12 sub o modulație neuroendocrină cu MLT.49 ]

Pe același mod, eficacitatea antitumorală a MLT la pacienții tratabili cu tratament cu speranță de viață < Un an poate fi crescut prin administrarea concomitentă de Aloe , Myrrh , Magnolia și Boswellia , cu un procent mai mare de regresii tumorale și o supraviețuire de un an de aproximativ 50% dintre pacienți.50 ]

În cele din urmă, datorită rolului său imunoregulator fundamental, [ 5 , 6 ] MLT ar putea fi asociat cu succes cu imunoterapiile recente cu inhibitori ai punctului de control [ 51 ] pentru a pilota răspunsul imun într-un mod antitumoral, stimulând proliferarea limfocitelor și contracararea monocitelor care, în contrast, pot suprima imunitatea antitumorală, cu o creștere consecventă a raportului limfocite / monocite care reprezintă unul dintre cei mai simpli parametri clinici, capabili să prezică eficacitatea diferitelor terapii anticancerigene. [ 52 ]

Prin urmare, în concluzie, este posibil să se afirme că abordarea PNEI în terapia cancerului poate oferi noi strategii terapeutice la pacienții cu cancer diseminat, pentru care nu este disponibilă o altă terapie anticancer standard.

Sprijin financiar și sponsorizare

Zero.

Conflicte de interes

Autorii nu au conflicte de interese.

J Res Med Sci . 2017; 22: 45.
Publicat online 2017 aprilie 26. doi: 10.4103 / jrms.JRMS_255_16
PMCID: PMC5426095
PMID: 28567065

REFERINȚE

1. Riley V. Psychoneuroendocrine influențează imunocompetența și neoplazia. Ştiinţă. 1981; 212 : 1100–9. PubMed ] Google Scholar ]
2. Foon KA. Modificatori de răspuns biologic: noua imunoterapie. Cancer Res. 1989; 49 : 1621–39. PubMed ] Google Scholar ]
3. Lissoni P, Barni S, Rovelli F, Tancini G. Supraviețuire mai mică la pacienții cu cancer metastatic cu concentrații reduse de sânge de interleucină-2. Raport preliminar. Oncologie. 1991; 48 : 125–7. PubMed ] Google Scholar ]
4. Antoni MH. Psihoneuroendocrinologie și psioneuroimunologie a cancerului: Mecanisme plauzibile care merită urmărite? Creierul Behav Immun. 2003; 17 (Supliment 1): S84–91. PubMed ] Google Scholar ]
5. Maestroni GJ. Rolul imunoneuroendocrin al melatoninei. J Pineal Res. 1993; 14 : 1–10. PubMed ] Google Scholar ]
6. Lissoni P. Glanda pineală ca regulator central al rețelei de citokine. Neuro Endocrinol Lett. 1999; 20 : 343–9.