Rezultatele căutări pentru: enzime

Efectul coenzimei Q10, riboflavinei și niacinei asupra nivelurilor CEA și CA 15-3 serice la pacienții cu cancer de sân care urmează terapie cu tamoxifen

 2007 Feb; 30 (2): 367-70.
Efectul coenzimei Q10, riboflavinei și niacinei asupra nivelurilor CEA și CA 15-3 serice la pacienții cu cancer de sân care urmează terapie cu tamoxifen.

1
Departamentul de Biochimie Medicală, Dr. ALMP-GIBMS, Universitatea din Madras, Campusul Taramani și Departamentul de Oncologie Medicală, Spitalul Royapettah al Guvernului, Tamilnadu, India.

Abstract

La bolnavii de cancer de sân nu este tumora primară, ci metastazele acesteia în locurile îndepărtate care sunt principala cauză de deces.Markeri tumori de cancer de sân circulatori, cum ar fi antigenul carcinoembryonic (CEA) și antigenul carbohidrat 15-3 (CA 15-3) sunt indicatori de încredere ai unei recidive iminente, în care un nivel de creștere a markerului tumoral este asociat cu o probabilitate foarte mare de a dezvolta reapariția. În studiul de față, 84 de pacienți cu cancer de sân au fost randomizați pentru a primi un supliment zilnic de 100 mg coenzima Q10 (CoQ10), 10 mg riboflavină și 50 mg niacină (CoRN), o doză pe zi, împreună cu 10 mg tamoxifen (TAM) de două ori pe zi .Nivelurile serice CEA și CA 15-3 au fost crescute la pacienții cu cancer de sân netratat (grupa II), iar nivelul markerului lor tumoral a redus semnificativ la terapia cu tamoxifen mai mult de 1 an (grupul III). Pacienții din grupa III au suplimentat cu CoRN timp de 45 d(zile) (grupul IV) și 90 d (grupul V) împreună cu tamoxifenul au redus semnificativ nivelul CEA și CA 15-3. Acest studiu sugerează faptul că suplimentarea CoRN la pacienții cu cancer de sân împreună cu tamoxifen reduce nivelul markerului tumoral seric și, prin urmare, reduce riscul reapariției cancerului și metastazelor.

PMID: 
17268082 
DOI: 
10.1248 / bpb.30.367
[Indexat pentru MEDLINE] 

Text complet premkumar2007

O formulare a pro-enzimelor pancreatice oferă o eficacitate potentă anti-tumorală: un studiu pilot axat pe cancerul pancreatic și ovarian

Abstract

Enzimele proteolitice au demonstrat eficacitate în tratamentul cancerului. Prezentăm o combinație a celor două pro-enzime Trypsinogen și Chymotrypsinogen A cu eficacitate antitumorală in vitro și in vivo . A fost determinat un efect sinergic anti-tumoral pentru Trypsinogen și Chimotripsinogenul A la un raport 1: 6 (denumit PRP) utilizând 24 de linii celulare de cancer uman. Efectul antiangiogen al PRP a fost analizat prin formarea de tuburi bazate pe matrigel și prin teste de formare a capsulelor fibroase. Mai mult, au fost efectuate teste de invazie celulară și de vindecare a rănilor împreună cu determinarea qRT-PCR a markerilor de tranziție epitelial-mezenchimică (EMT) pe celule canceroase umane tratate cu PRP. În plus, au fost puse în aplicare studii farmacocinetice in vivo , iar eficacitatea antitumorală a PRP a fost studiată împotriva tumorilor ortotopice de cancer pancreatic și ovarian. Formularea PRP s-a dovedit a inhiba angiogeneza in vitro , creșterea tumorii, migrația celulelor canceroase și invazivitatea; și să fie un tratament anti-tumoral in vivo eficient și bine tolerat. În cele din urmă, eficacitatea clinică a unei formulări de supozitoare care conține atât pro-enzime pancreatice în contextul unei scheme speciale farmaceutice britanice a fost evaluată la pacienții cu cancer avansat. În consecință, PRP ar putea avea aplicații clinice oncologice relevante pentru tratamentul adenocarcinomului pancreatic avansat sau metastatic și a cancerului ovarian epitelial avansat.

Introducere

Cancerul este a doua cauză de deces în SUA. Potrivit Societății Americane de Cancer, 42% dintre bărbați și 37% dintre femei sunt expuși riscului de a dezvolta cancer în timpul vieții lor. Cancerul pancreatic reprezintă aproximativ 3% din toate cazurile de cancer din SUA și aproximativ 7% din decesele provocate de cancer, în timp ce cancerul ovarian se află pe locul cinci în decesele cauzate de cancer în rândul femeilor, ceea ce reprezintă mai multe decese decât orice alt cancer al sistemului reproducător feminin.Deoarece numai 10% din decesele provocate de cancer sunt cauzate de tumora primară, provocarea terapeutică este tumora metastatică sau secundară, care este generată de răspândirea celulelor canceroase inițiată de pierderea moleculelor de adeziune care țin tumora în țesutul inițial 1 . În anii următori, procesul de tranziție epitelial până la mezenchimie (EMT) a fost propus ca eveniment inițial pentru metastazarea tumorii 2 . De fapt, atunci când o celulă cancerică își pierde proprietățile epiteliale pentru a dobândi un fenotip mezenchimic, dobândește o șansă crescută de a migra către alte țesuturi 3 . Astfel, dezvoltarea de noi strategii terapeutice care modulează progresia EMT în celulele canceroase a devenit, în ultimii ani, o prioritate cu aplicabilitate clinică largă.

Deși aplicarea terapeutică a enzimelor pancreatice a fost propusă cu mai mult de 100 de ani în urmă 4 și combinația de enzime proteolitice a demonstrat eficacitate în tratamentul cancerului 5,6 , cele mai multe abordări se bazează pe combinația mai multor enzime proteolitice, ceea ce ar putea crește probabilitatea de nedorite și evenimente neprevăzute. Recent, am demonstrat că tratamentul celulelor canceroase umane cu Trypsinogen (T) și Chimotripsinogenul A (C) are ca rezultat o creștere a adeziunii celulare, o atenuare a câtorva markeri asociate cu EMT și o creștere a expresiei mai multor asocieri asociate diferențierii markeri, sugerând obținerea unui fenotip mai puțin malign 7 . În plus, studiile retrospective de cohortă clinică la pacienții cu cancer au demonstrat că terapia cu enzime pe cale orală a redus în mod semnificativ efectele secundare și simptome induse de tumori și terapie, cum ar fi greața, tulburările gastrointestinale, oboseala, pierderea în greutate și agitația și, (QoL) de pacienți cu cancer 8 – 10 .

Aici, prezentăm studii aprofundate in vitro și in vivo pentru a investiga eficacitatea antitumorală a unei formulări pro-enzime constând dintr-o combinație de Trypsinogen și Chymotrypsinogen A într-un raport sinergie. În primul rând, am testat efectul antiproliferativ pentru combinarea T și C în 24 de linii de celule canceroase și am determinat un raport sinergie pentru T și C (1: 6), care a fost definit ca PRP. În al doilea rând, am evaluat efectul antiangiogenic in vitro al acestei formulări, prin testul de formare a tubului cu agar moale și in vivo utilizând testul AngioChamber ™, care se bazează pe procesul fiziologic normal de vindecare a rănilor, pentru a promova formarea capsulelor fibroase în jurul o cameră de teflon care eliberează factorul de creștere 11 . În al treilea rând, pentru a analiza efectul anti-metastatic al tratamentului pro-enzimatic, am studiat efectul PRP în invazia celulară, migrarea celulelor și în modularea genelor legate de EMT în celulele cancerului pancreatic și ovarian. Mai mult, efectuăm un studiu farmacocinetic PRP in vivo și am evaluat eficacitatea anti-tumorală a PRP în modelele de cancer murinic. În acest scop, am tratat șoareci inoculați ortotopic cu celule de cancer ovarian uman A2780 sau cu celule tumorale pancreatice pancreatice de tip Pan02 cu PRP. În cele din urmă, raportăm aici eficacitatea clinică la 46 de pacienți cu boală malignă avansată de origine diferită, tratați cu o formulare rectală de pro-enzime pancreatice.

Rezultate

Determinarea raportului optim pro-enzimatic

În acest studiu, am determinat mai întâi concentrațiile inhibitorii jumătate maxime (IC50) ale tripsinogenului și chitomicroscopic A ca efect unic al unui articol de testare, într-un grup extins de 24 de linii celulare de cancer uman. Valorile IC50 ale tripsinogenului au constituit baza pentru calculul raporturilor de concentrație pentru combinația între Trypsinogen și Chymotrypsinogen A la 1: 1, 1: 2, 1: 4, 1: 6, 1: 8 și 1:10. La aceste rapoarte, proprietățile de inhibare a creșterii combinației au fost evaluate în 24 de linii de celule canceroase. Pe baza coeficienților de interacțiune medicamentoasă (CDI), combinația Trypsinogen plus Chymotrypsinogen A a demonstrat o inhibare mai mare a creșterii la raporturi de 1: 4, 1: 6 și 1: 8, comparativ cu raportul 1: 1 în toate liniile celulare testate, 786-O, G-361, BT-474 și celulele tumorale HL-60 (figura 1 , tabelul suplimentar S4 ). În final, s-a constatat că un raport T: C = 1: 6 al ambelor pro-enzime este optim și a fost utilizat pentru următoarele experimente. Tabelul suplimentar S5 rezumă valorile IC50 ale liniilor celulare utilizate pentru experimentele in vitro .

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig1_HTML.jpg

Determinarea coeficienței interacțiunii medicamentoase. Testele combinate de Trypsinogen și Chymotrypsinogen au fost realizate în rapoarte de 1: 1, 1: 2, 1: 4, 1: 6, 1: 8 și 1:10. Graficele reprezentative arată un raport optim sinergic pro-enzimatic al tripsinogenului cu chitomoplasinogenul ca 1: 6.

Eficacitatea antiangiogenă a formulării proenzimelor pancreatice

Pentru a determina dacă terapia enzimatică afectează angiogeneza, s-a utilizat un test de formare a tubului cu agar moale. Celulele endoteliale de control ale celulelor venei ombilicale de control (HUVEC) au fost organizate în clustere după 3 ore și au început să formeze structuri asemănătoare tubului după 5 ore, care au fost clar evidente după 24 de ore ( Fig.2A ). Dimpotrivă, HUVEC-urile tratate cu PRP au prezentat o reducere semnificativă a numărului și lungimii tuburilor capilare închise într-o manieră dependentă de concentrație, cu o dispariție totală a structurilor după tratamentul cu T / C 0,07 / 0,42 mg / ml (Figura 2A ) .Pentru a evalua dacă inhibarea formării structurilor tubulare asemănătoare ar putea fi determinată de moartea celulelor cauzată de tratamentul cu PRP, Kitul de Viabilitate / Citotoxicitate LIVE / DEAD a fost utilizat pentru a identifica celulele viabile. Așa cum s-a apreciat în figura 2B , atât celulele de control, cât și cele tratate cu PRP au prezentat o colorare verde, ceea ce indică faptul că inhibarea cordoanelor celulare a fost independentă de viabilitatea celulară.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig2_HTML.jpg

Testarea formării tubului de angiogeneză. A ) Imagini reprezentative de microscopie ușoară a HUVEC în analizele Matrigel ™. Celulele HUVEC au fost crescute pe Matrigel și după 5 ore și după 24 de ore de tratament cu T / C 0,035 / 0,21 (mg / ml) sau T / C 0,07 / 0,42 (mg / ml) a fost evaluată formarea structurilor capilare. B ) Testul de viabilitate celulară a fost efectuat prin măsurarea celulelor metabolice active colorate cu Calcein AM. Imaginile reprezentative fluorescente ale celulelor de control HUVEC (CTR) și celulelor tratate (T / C 0,07 / 0,42 mg / ml) după 24 h sunt arătate, unde celulele vii apar verde și apar celule moarte colorate cu homodimer-1 (EthD-1) roșu. Mărire originală 10x pentru toate panourile. C ) Numărul de structuri capilare asemănătoare măsurate după 24 de ore de cultură. Datele din 3 experimente independente efectuate în duplicat sunt exprimate ca medie ± SD (** P <0,01 vs. Control). D ) Greutatea medie a capsulei (g) de la șoareci cu AngioChambers ™ implantată fără βFGF1 și tratată cu Controlul vehiculului (Grupul 1), conținând βFGF1 și tratată cu Controlul vehiculului (Grupul 2) și conținând βFGF1 și tratată cu T / C (0,13 / 0,78 mg / kg administrate ip, într-un volum de dozare de 10 ml / kg) (Grupa 3) (** P <0,05).

Mai mult, cuantificarea numărului de structuri asemănătoare capilarului în diferite zone ale puțului a evidențiat o diferență dramatică și semnificativă între numărul de structuri formate de celulele netratate în comparație cu celulele tratate cu PRP (figura 2C ).

Efectul anti-angiogen al PRP a fost investigat suplimentar in vivo utilizând testul AngioChamber ™, un model utilizat pentru a evalua eficacitatea tratamentelor antiangiogene prin măsurarea formării capsulelor fibroase la șoareci. În această analiză, includerea bFGF în cameră susține inducerea dezvoltării vaselor de sânge și formarea unei capsule fibroase. AngioChambers ™ au fost excluse de la toți șoarecii post-mortem în ziua terminării, 24 de ore după tratamentul final (Ziua 5). Figura 2D arată că formarea capsulelor fibroase a fost semnificativ mai mare în grupul de control al vehiculului cu bFGF captat în cameră (Grupul 2, Controlul Inducției) decât în ​​grupul de control al vehiculului fără bFGF încărcat în cameră (grupul 1, Controlul de bază) (p < 0,05) indicând faptul că bFGF a stimulat în mod adecvat și semnificativ formarea capsulelor. Tratamentul cu PRP (Grupa 3) a determinat o reducere semnificativă a angiogenezei comparativ cu controlul de inducție (grupul 2), așa cum este indicat de diferența în greutatea capsulei (p <0,05) cu o inhibare a formării capsulelor fibroase de 57%. Astfel, PRP inhibă formarea capsulelor fibroase care prezintă efecte anti-angiogenice in vivo semnificative.

Efectul anti-invazie, anti-migrare și anti-EMT al PRP

Pentru a analiza efectul anti-metastatic in vitro al tratamentului pro-enzimatic, am studiat efectul PRP în invazia celulară, migrarea celulară și în modularea genelor legate de EMT în celulele canceroase. În primul rând, pentru a evalua efectul PRP asupra migrării celulare, un eveniment cheie în carcinogeneză, am efectuat un test de vindecare a rănilor pe cinci linii de celule canceroase diferite: BxPC3 și Mia Paca-2 pancreatice umane, celule A2780 ovariene umane, melanomul uman A375 și colon uman (HCT 116).Migrarea este definită ca mișcarea direcționată a celulelor pe un substrat, cum ar fi plăcile de plastic care apar pe suprafețe 2D. Aici arătăm că celulele netratate au migrat mai repede pentru a închide decalajul unei zgârieturi în monostratul celular decât celulele tratate cu PRP. PRP a redus semnificativ migrarea celulelor celulelor BxPC3 pancreatice și a comparat cu celulele martor chiar a lărgit lățimea plăgii, un model de migrare care a fost diferit în comparație cu celelalte linii celulare și că părea să fie specific celular ( Fig.3A) . Deși linia celulară tumorală ovariană A2780 nu crește, formând un monostrat omogen ca BxPC3, se poate observa că tratamentul PRP reduce semnificativ capacitatea celulelor ovariene de a migra (Figura 3B). Datele au arătat o inhibare semnificativă a migrării celulare, cu numai 23% din celulele migrate după 48 de ore de tratament cu PRP în comparație cu celulele martor care au atins 88% ( fig.3A și B ). Rezultate similare au fost obținute cu celule MIA PaCa-2, A375 și HCT 116, celulele tratate au prezentat valori ale migrării celulare de ordinul a 25-30% după 48 ore de tratament cu PRP, în timp ce celulele netratate treptat s-au mutat în celulă – regiune zero de zgâriere (figura 3C-E ).

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig3_HTML.jpg

Experimentul de vindecare a rănilor pentru a determina migrarea celulelor. Testele de vindecare a rănilor au fost efectuate la 0, 24 și 48 de ore în celule BxPC3, A2780, MIA PaCa-2, A375 și HCT 116 în celule tratate cu IC50 și celule netratate utilizate ca martori. A ) Imagini reprezentative cu microscop de contrast în fază care prezintă zona acoperită de celule la 0, 24 și 48 de ore după rănire. Mărire originală 10 ×. B ) Mărire originală 10 ×. B ) Migrarea celulelor a fost determinată de viteza celulelor care se deplasează spre zona zgâriată în timp utilizând software-ul ImageJ ™ ( * P <0,05 și ** P <0,01).

În al doilea rând, am testat efectul inhibitor al formulării pro-enzimatice asupra invaziei celulare a celulelor tumorale de colon și de pancreas. Invazia este definită ca o mișcare a celulelor printr-o matrice 3D extracelulară. Principiul acestui test se bazează pe două camere conținând medii separate printr-o membrană poroasă prin care celulele se transmigrează. Aici, am testat diferite concentrații de PRP (tabelul suplimentar S2 ) pe liniile celulare de cancer uman pancreatic MIA PaCa-2 și HCT-15. Interesant, PRP a prezentat o inhibare marcată și semnificativ dependentă de doză a invaziei în ambele linii celulare.Inhibarea totală a migrării celulare a fost obținută din concentrațiile de PRP de 0,015 / 0,093 mg / ml T / C și așa mai departe, cu celelalte concentrații crescătoare testate (Figura 4A ).

Un fișier extern care deține o imagine, o ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig4_HTML.jpg

Invazia celulară și analiza genelor legate de EMT. A ) testul de migrare 3D. Graficele reprezintă numărul de celule care transmigrează prin membrana poroasă după expunerea la concentrații crescătoare de PRP. Se utilizează PBS ca martor negativ și combretastatin ca control pozitiv. B ) expresia genelor legate de EMT.Analiza qRT-PCR a evidențiat creșterea expresiei E-cadherinei cu reducerea concomitentă semnificativă a expresiei N-cadherinei, Slug și vimentinei în celulele BxPC3. PRP nu a afectat în mod semnificativ vimentinul, dar a redus în mod semnificativ exprimarea N-cadherin și Slug și a crescut expresia E-cadherin în celule A2780. * P <0,05 și ** P <0,01). C ) Imagini confocale reprezentative ale expresiei E-cadherin și β-catenin în celulele tratate și controlate cu BxPC3 și A2780. Expresia E-cadherin și expresia β-catenină a fost detectată (în roșu), iar nucleele au fost contracarate cu DAPI (albastru). Mărire originală 40 ×.

Pentru a investiga dacă expunerea PRP are o posibilă reglementare în mecanismele transcripționale care conduc EMT în celulele canceroase, expresia genelor EMT a fost studiată în celulele cancerigene umane pancreatice BxPC3 și A2780 ( Fig.4B ). Indicatorii EMT în ambele celule BxPC3 și A2780 au fost afectați de tratamentul PRP la T / C 0,07 / 0,42 mg / ml. Figura 4B arată că tratamentul PRP a crescut expresia E-cadherinei (0,4 ori) (* P <0,05), în timp ce a redus expresiile de N-cadherin, Slug și vimentin (0,9, 0,5 și 0,6 ori, 0,01) în celule BxPC3. În adiție, PRP a modificat în mod semnificativ expresia E caderinei (0,9 ori) (** P <0,01) și a redus în mod semnificativ expresia N-cadherinei și Slug (0,4 și respectiv 0,6 ori) (** P < 0,01) și a indus o scădere ușoară, dar nu semnificativă, a expresiei vimentinei în celulele A2780. În cele din urmă, au fost efectuate analize de imunofluorescență pentru a confirma modificările expresiei genice.Imaginile confocale ale celulelor BxPC3 și A2780 imunostainate pentru a detecta expresia markerilor epiteliali E-cadherină și β-catenină au arătat o creștere a expresiei ambelor markeri în membrana celulară a celulelor tratate cu PRP în comparație cu celulele de control netratate ( Fig.4C ).

Studiu farmacocinetic PRP

Pentru a evalua farmacocinetica și distribuția de organe a Trypsinogen și Chymotrypsinogen A, șoarecii Nymph-Foxn nu femelă purtători de tumori au fost tratați cu Trypsinogen marcat cu IRDye® 800CW (5 mg / kg) plus tripsinogen (50 mg / kg) sau IRDye® 800 mg Chymotripsinogen A marcat cu CW (7 mg / kg), plus Chimotripsinogenul A neimologat (300 mg / kg). Animalele au fost eutanasiate la punctele de timp specificate post-doză, iar plasmă împreună cu omogenatele de organe a fost preparată, apoi imaginate prin intermediul sistemului de imagistică IVIS.

Fluorescența a fost măsurată în omogenatele de organe. Șoarecii tratați cu T marcat au prezentat un vârf de fluorescență în toate organele între 15 minute și 2 ore după doză. În timp ce șoarecii tratați cu C marcat au prezentat emisia maximă de fluorescență între 15 minute și 6 ore după doză. Pentru ambele valori cele mai ridicate au fost observate în rinichi și ficat ( fig.5A și B ). Nivelurile maxime ale ambelor tripsinogene marcate cu IRDye®800CW și ale chitomicroscopic A în plasmă de șoarece au apărut la 15 minute după administrarea dozei (7,5 și respectiv 72,2 μg / ml). Nivelurile atât ale proenzimelor marcate cu IRDye® 800CW au scăzut rapid după acest timp ( fig.5C și D ).

Un fișier extern care deține o imagine, ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig5_HTML.jpg

Studiu farmacocinetic. S-au citit fluorescență în omogenatele de organe de la șoareci tratați cu ( A ) IRGye® 800CW marcat cu tripsinogen (5 mg / kg) și tripsinogen (50 mg / kg) sau B cu chimotrispsinogen A marcat cu IRDye® 800CW și chitomizinogen A (300 mg / kg). C ) Nivele de trypsinogen marcat cu IRDye®800CW și ( D ) chitomicrosinogen A în plasmă de șoarece.

Eficacitatea antitumorală a PRP în modelele de șoareci orthotopici

Efectul formulării PRO-enzime PRP în doze diferite asupra greutății tumorale în tumorile pancreatice și ovare implantate ortotopic este reprezentat în fig.6. În grupul de control al tumorii pancreatice, un animal a fost eutanasiat în ziua a 6-a datorită unor semne clinice adverse care nu au legătură cu tratamentul și un alt animal a fost găsit mort datorită unor cauze necunoscute în ziua 23. Nu a existat o reducere semnificativă (* P <0,05) animale tratate timp de 26 zile cu Trypsinogen / Chimotripsinogen A la 83,3 / 500 mg / kg (30,2 mg, inhibare 85,9%) comparativ cu martor (PBS 214,8 mg), dar nu între Trypsinogen / Chimotripsinogen A la 27,5 / 165 mg / kg 196,5 mg, inhibare de 8,5%) și controlul (figura 6A ).

Un fișier extern care deține o imagine, ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig6_HTML.jpg

Activitatea antitumorală in vivo a PRP. A ) Imagini ale tumorilor excizate la terminarea studiului tumorilor pancreatice ortotropice. Greutatea medie a tumorii în ziua terminării după injectarea intravenoasă iv a PBS, T / C 27,5 / 165 (mg / kg) sau T / C 83,3 / 500 (mg / kg) ( * P <0,05). B ) Imagini ale tumorilor excizate la terminarea studiului tumorilor ovariene ortotropice. Greutatea medie a tumorii în ziua terminării după injectarea intravenoasă iv a PBS, T / C 9,1 / 54 (mg / kg) sau T / C 27,5 / 165 (mg / kg) ( * P <0,05).

Mai mult, șoarecii purtători de tumori ovariene ( Fig.6B ) au prezentat o reducere semnificativă (* P <0,05) a greutății medii a tumorii la animalele tratate timp de 21 de zile cu două doze diferite de Trypsinogen / Chimotripsinogen A, 9,1 / 54 mg / kg și 27,5 / 165 mg / kg, comparativ cu martor (PBS). Greutatea medie a tumorilor din grupul de control a fost de 2062,2 mg, în timp ce grupurile tratate au prezentat o greutate medie a tumorii de 1074,2 mg și, respectiv, 957,3, variind într-o inhibare a tumorii de 50% (52-46%).

Prezentare generală a studiilor clinice

Eficacitatea clinică a unei formulări de supozitoare care conține pro-enzime pancreatice bovine Trypsinogen și Chymotrypsinogen A a fost evaluată în contextul unei scheme speciale farmaceutice britanice. Efectele clinice au fost studiate la 46 de pacienți cu cancer metastatic avansat de origine diferită (prostată, mamar, ovarian, pancreatic, colorectal, stomac, pulmonar nemetal celular, cancer intestinal și melanom) după tratamentul cu o formulare rectală a ambelor enzime pancreatice . Nu s-au observat evenimente adverse grave sau grave legate de administrarea rectală. Pacienții nu au prezentat efecte secundare hematologice, așa cum se observă de obicei în regimurile chimioterapice clasice. Nu au fost observate reacții alergice după administrarea rectală de supozitoare. Pentru a evalua activitatea terapeutică a administrării rectale, supraviețuirea globală a pacienților aflați sub tratament a fost comparată cu speranța de viață atribuită unui pacient înainte de începerea tratamentului. Tabelul 1 prezintă lista pacienților tratați cu formularea pro-enzimatică pancreatică. Nouăsprezece dintre cei 46 de pacienți (41,3%) cu boli maligne avansate, majoritatea suferind de metastaze, au avut o durată de supraviețuire semnificativ mai mare decât durata de viață estimată, de fapt, pentru întregul set de tipuri de cancer, supraviețuirea medie (9,0 luni) semnificativ mai mare decât speranța medie de viață (5,6 luni).

tabelul 1

Prezentare generală a studiilor clinice. Pacienții care au prezentat prognoza speranței de viață (*).Pentru întregul set de tipuri de cancer, supraviețuirea medie (9,0 luni) a fost statistic semnificativ mai mare decât speranța medie de viață (5,6 luni). ANOVA cu o singură cale (α = 0,05, P <0,05).

Tipul de cancer  durata asteptata viata (luni) Supraviețuire ** (luni)
Carcinom pancreatic (n = 4) 2 8
4 *
7
4
Cancer ovarian (n = 7) 4 11
6 12
6 11
<12 38
<1 1
4 *
3 *
Cancerul de sân (n = 6) 6 9
6 *
2 *
12 *
<12 *
12 *
Colon Cancer rectal (n = 5) 6 *
6 *
12 *
6 40
12 *
Cancerul gastric (n = 2) 2 8
7
Cancerul de prostată (n = 8) 4 *
1 5
4 *
<12 *
12 14
12 *
12 *
12 *
Limfom non-Hodgkin (n = 1) 2 9
Mezoteliom (n = 1) 3 9
Melanomul (n = 2) 6 *
4
Tumorile neuro-endocrine (n = 1) 10 24
Vezică urinară (n = 2) *
12 *
NSCLS (n = 2) 3 5
6 *
Bowel (n = 2) <12 *
3
Carcinom cu celule mici (n = 1) <12 *
Cancerul renal (n = 1) *
Abdomen necunoscut primar (n = 1) <12 *

Deși numărul pacienților pe indicație de cancer este în mod natural destul de scăzut, 3 din 8 pacienți cu cancer de prostată și 5 din 11 pacienți cu cancer gastro-intestinal par să beneficieze în special de tratamentul cu supozitoarele pro-enzimatice.

Discuţie

Datele prezentate au fost relevante pentru adoptarea unei noi strategii în formularea unui preparat compus din prozime enzimele pancreatice (PRP) care s-au dovedit a reduce principalele caracteristici ale răspândirii cancerului. În acest context, angiogeneza, capacitatea de a forma noi vase de sânge reprezintă un pas critic în dezvoltarea tumorii prin care tumorile își stabilesc propria sânge 12 . Prin urmare, inhibarea angiogenezei va bloca una dintre cerințele fundamentale pentru creșterea tumorii, precum și răspândirea metastazelor tumorale în situsurile tumorale secundare. Am investigat activitatea anti-angiogenică in vitroa PRP utilizând testul de formare a tubului și testul de formare a tubului cu agar moale și in vivo cu analiza AngioChambers ™. Rezultatele au arătat că PRP inhibă formarea structurilor capilare asemănătoare HUVEC și suprimă formarea capsulelor fibroase conduse de bFGF capturat în AngioChambers TMimplantat subcutanat și ulterior prin stimularea VEGF endogenă. Factorii angiogenici, cum ar fi bFGF și VEGF, secretați de multe celule, inclusiv macrofage și celule canceroase, au demonstrat că joacă un rol important în progresia carcinomului pancreatic 13 și a altor tipuri tumorale 14-16 . Într-adevăr, bFGF stimulează toate etapele majore în cascada angiogenezei, așa cum se știe că este implicată în proliferarea, migrarea și diferențierea celulelor endoteliale 17 .

Un alt factor cheie în progresia cancerului este pierderea adeziunii celulelor celulare, care se corelează cu o capacitate crescută de migrare a celulelor și cu dobândirea proprietăților invazive de către celulele maligne, care suferă o schimbare morfologică care adaptează un aspect asemănător cu axul 18 . În plus, un test in vitro de vindecare a rănilor a arătat că capacitatea de migrație a celulelor cancerigene ovariene, de melanom și cancer de colon a fost suprimată după incubarea cu PRP. Mai mult, inhibarea potențialului de invazie celulară posedă cel mai probabil un potențial semnificativ de inhibare a metastazelor in vivo .

Pentru a înțelege mecanismele moleculare posibile care inhibă migrarea și invazia celulelor tratate cu PRP, a fost efectuată analiza qRT-PCR pentru a studia expresia genelor legate de EMT, un proces în care celulele epiteliale își pierd caracteristicile și se supun transdiferențierii celulelor mezenchimale motile. Dovezile sugerează că EMT este asociat cu metastaze și cu dobândirea de proprietăți chemorezistente în multe tipuri de cancer 19, inclusiv ovarian 20 și cancer pancreatic 21 . Într-adevăr, studiile anterioare au arătat că în timpul progresiei cancerului ovarian, EMT joacă un rol important în creșterea invaziei celulare, ceea ce duce la un rezultat slab al pacienților cu cancer ovarian 22 , 23 . În plus, studiile au constatat că EMT contribuie la rezistența la medicamente chimioterapeutice în cancerul pancreatic 24 și că mai mulți markeri EMT au fost, de asemenea, recunoscuți în cancerul pancreatic 25 , 26 . În acest studiu, demonstrăm că tratamentul cu PRP a promovat expresia genică a markerului epitelial E-cadherin și a scăzut expresia ambelor markeri mezenchimali, N-cadherin și vimentin. O trăsătură cheie a EMT este trecerea de la markeri epiteliali, cum ar fi E-cadherin și citokeratin la markeri mezenchimali cum ar fi N-cadherin, vitronectin 75 sau vimentin 27 , 28 . Aici arătăm că liniile celulare de cancer ovarian și pancreatic au prezentat o scădere semnificativă a expresiei N-cadherinei ca răspuns la tratamentul PRP. Aceasta este o observație foarte relevantă, deoarece reglarea în sus a N-caderinei este asociată cu un potențial crescut de migrație și invazie a celulelor cancerigene ovariene și pancreatice 29-31 . În plus, mai multe studii au evidențiat importanța semnalizării N-caderinei în progresia cancerului pancreatic 32 , 33 . S-a raportat că distrugerea N-cadherinei în celulele BxPC3 conduce la o exprimare crescută a E-cadherinei și a determinat, de asemenea, o reducere semnificativă a motilității liniei celulare BxPC3, sugerând că N-cadherina este un mediator cheie al procesului EMT în celulele pancreatice 28 .

În plus, expresia proteică a markerilor epitelii E-cadherin și β-catenin a fost mărită după tratamentul PRP și a apărut limitată la membrana celulară atunci când a fost analizată prin imunofluorescență. E-cadherina este o moleculă importantă de semnalizare în EMT în parte prin interacțiunea sa cu β-catenină 18 , de fapt, reducerea expresiei E-cadherin și β-catenin a fost asociată cu o diminuare a adeziunii celulare7. Mai mult decât atât, translocarea β-cateninei la nucleu și scăderea expresiei E-cadherinei sunt observate în diferite malignități umane asociate cu metastazarea 20 .

Mai mult, unul dintre genele puternic inhibat prin tratamentul cu PRP în ambele linii celulare BxPC3 și A2780 a fost Slug, un factor de transcripție care s-a dovedit a reprima E-cadherina și a reglat alte markeri EMT. Mai mult, s-a raportat că Slug este un inductor puternic al VEGF și prezintă efecte pro-angiogenice puternice 34 . De asemenea, Slug este asociat îndeaproape cu metastazele tumorale și angiogeneza în cancerul ovarian 35 și cu reglarea expresiei fascinei de proteină asociată cu actina, adesea foarte ridicată în tumorile maligne și recent sugerată ca o țintă marker sau terapeutică pentru cancerul pancreatic 36 . Prin urmare, datele noastre sugerează că PRP revine EMT în celulele canceroase.

Injecția intravenoasă a pro-enzimelor a determinat niveluri maxime detectabile în plasmă la 15-30 minute care au scăzut în prima oră și au fost încă prezente la niveluri scăzute după trei ore după administrarea dozei. Aceste observații sunt similare cu profilurile concentrației de timp găsite în studiile farmacocinetice anterioare cu potențiali agenți terapeutici pentru cancerele umane, incluzând pancreasul 37 , 38 și, de asemenea, în chimioterapeutica actuală utilizată în clinică, cum ar fi gemcitabina 39 . Mai mult, examinarea distribuției țesuturilor a demonstrat că proenzimele perfuzate în organe, incluzând inima, ficatul, splina, plămânul, rinichii și întregul tract gastrointestinal, au indicat o distribuție largă a țesuturilor pro-enzimelor 40 .

Am investigat în continuare modele de tumori ortotopice pentru a testa eficacitatea anti-tumorală a PRP utilizând celule tumorale umane (A2780) sau celule tumorale murine (Pan 02). Observațiile clinice au sugerat că mediul de organe poate influența răspunsul tumorilor la chimioterapie. De asemenea, implantarea ortotopică a celulelor tumorale umane în șoareci nudi oferă avantaje pentru studiul creșterii tumorale și a metastazelor 41 . În plus, Panc 02 s-a dovedit a fi o linie celulară de cancer pancreatic syngenetic adecvată pentru dezvoltarea tumorilor ortotopice în model murin imunocompetent, care imită îndeaproape cancerul pancreatic uman 42 . Unul dintre avantajele raportate ale modelelor ortotopice este acela că procesele de țintire care implică invazia locală (de exemplu, angiogeneza) pot fi efectuate la un loc mai relevant din punct de vedere clinic. Prin urmare, eficacitatea antitumorală a tratamentului zilnic cu Trypsinogen și Chimotripsinogenul A administrată în combinație ca o injecție iv singulară în două doze a fost evaluată împotriva celulelor cancerigene ovariene și pancreatice umane inoculate ortodic la șoareci femelici numi / nu șoareci C57BL / 6 femele, respectiv. În timp ce cele două doze testate au fost eficiente împotriva tumorilor ovariene ortotopice, numai doza mai mare testată a fost eficace în tumorile pancreatice. De remarcat, răspunsul slab al tumorilor pancreatice la terapiile disponibile este bine cunoscut 43 .

PRP nu numai că a demonstrat dimensiunea tumorii dicreazite, dar, de asemenea, s-a dovedit a fi un agent anti-cancer non-toxic deoarece nu au fost identificate evenimente adverse clinice legate de tratament. Luate împreună, formularea pro-enzimatică prezentată (PRP) inhibă în mod semnificativ tumori pancreatice și ovariene umane, atât entități tumorale bine vascularizate, cât și relativ rapide. Pentru ambele indicații, cancer pancreatic și ovarian, terapia clinică disponibilă este limitată și, prin urmare, prezintă indicații atractive pentru dezvoltarea clinică suplimentară a PRP.

În cele din urmă, în contextul unei scheme speciale britanice privind medicamentele, am evaluat eficacitatea clinică a unei formulări supozitoare, care conține tripsinogen, chimiotrypsinogen A și urme de α-amilază, la pacienți cu mai multe malignități diferite. A-amilaza a fost inclusă deoarece a făcut parte din extractele pancreatice brute care au fost utilizate în primele zile de terapie cu enzime, dar după evaluarea interacțiunii sinergice dintre tripsinogen, chitomoplasmogen și α-amilază s-a concluzionat că a-amilaza nu a contribuit la activitatea antitumorală a formulării.

Prin administrare rectală, tratamentul a fost bine tolerat de către pacienți și are avantajul că formularea este absorbită de către vasele de sânge ale rectului în circulație, evitând digestia enzimelor din duoden. Prin urmare, o formulare rectală conduce la o eficacitate îmbunătățită față de terapiile cu enzime orale actuale și ar reduce dozele mari utilizate în mod curent pentru aplicațiile orale 44 . Există unele controverse în literatura de specialitate cu privire la cantitatea de pro-enzime intacte care ajunge efectiv în fluxul sanguin atunci când se administrează pe cale orală, dar și rectal. În timp ce unii autori susțin că numai o mică fracțiune (0,002%) 45 sau chiar niciuna 46 nu este absorbită, o teorie alternativă sugerează că aceste enzime sunt stabile la nivel acid și sunt absorbite prin mucoasa gastrointestinală în fluxul sanguin ca parte a unui proces de reciclare enteropancreatică 47 . Mai mult, eficacitatea clinică a enzimei pancreatice rectale, după cum este evaluată prin timpul de supraviețuire prelungit în comparație cu speranța de viață estimată la începutul tratamentului, a fost evidentă la un număr de pacienți.

Rezumând, PRP se dovedește a fi un tratament anti-tumoral eficace și netoxic in vivo , capabil să inhibe angiogeneza și creșterea tumorii, migrarea celulelor canceroase și invazivitatea. Mai departe, o formulare de supozitoare conținând atât pro-enzime pancreatice a arătat o creștere a speranței de viață a pacienților cu cancer avansat. În consecință, PRP ar putea avea aplicații clinice oncologice relevante pentru tratamentul tumorilor solide cum ar fi adenocarcinomul pancreatic avansat și cancerul ovarian epitelial avansat.

Materiale si metode

Cultură de celule

Liniile de celule de cancer au fost obținute de la Colecția Americană de Cultură de Tip (ATCC) (Rockville, MD, USA). Tabelul suplimentar S1 prezintă liniile celulare utilizate și condițiile de creștere a culturii pentru fiecare dintre acestea. Toate celulele au fost cultivate la 37 ° C într-un incubator de cultură de celule umidificat furnizat cu 95% aer / 5% CO2.

Asigurarea îngrijirii animalelor

Procedurile care implică îngrijirea și utilizarea animalelor în studiu au fost revizuite și aprobate de către Comitetul de Stat pentru Medicină și Farmacie (IACUC) din Pennsylvania State College of Medicine. În timpul studiului, îngrijirea și utilizarea animalelor au fost efectuate în conformitate cu principiile enunțate în Ghidul pentru îngrijirea și utilizarea animalelor de laborator, ediția a 8- a , 2010 (Consiliul Național de Cercetare).

Teste de citotoxicitate in vitro și determinări ale interacțiunilor medicamentoase

Trypsinogenul (T) și Chitopripsinogenul A (C) s-au dizolvat în PBS, soluțiile stoc au fost sterilizate prin filtrare (0,22 pm) și pentru fiecare formula enzimatică stocurile au fost amestecate în combinațiile corespunzătoare. Pentru a determina citotoxicitatea in vitro (jumătate din concentrațiile inhibitorii maxime, IC50) și CDI, plăcile cu 96 de godeuri au fost însămânțate pentru fiecare linie celulară, s-au adăugat combinații pro-enzime la celule 24 ore după însămânțare și testate triplicat pentru fiecare linie celulară . La 72 de ore după adăugare, testul CellTiter-Blue® a fost efectuat pe toate plăcile conform instrucțiunilor producătorului.Pe scurt, 10 pl de CellTiter-Blue® s-au adăugat la fiecare godeu și s-au incubat cu celule timp de până la 4 ore. Fluorescența a fost măsurată utilizând un Fluorometru Spectramax Gemini XPS. Toate datele au fost înregistrate și introduse în foi de calcul Microsoft® Excel pentru interpretare. Datele colectate de la testele CelITiter-Blue® au fost reprezentate grafic ca curbele de răspuns la doză pentru IC 50 determinare și ca isobolograms pentru a evalua CDI.

Testul de formare a tubului Matrigel

Venă derivate ombilical celule endoteliale umane (HUVEC) au fost cultivate în mediu complet de creștere-2 AGE (Lonza, Basel, Elveția) , în condiții standard de cultură celulară de 37 ° C și 5% CO 2 . Celulele au fost utilizate între trecerile 4 și 5. Plăcile cu multiple godeuri (plăci cu 12 godeuri) au fost acoperite cu 300 pL Matrigel (Collaborative BD PharMingen, San Diego, CA) la 4 ° C și incubate timp de 30 de minute la 37 ° C. HUVEC (1,2 × 10 5celule / godeu) au fost adăugate la godeurile acoperite cu Matrigel în mediu de cultură complet. Formularea pro-enzimatică a fost adăugată după 20 de minute de însămânțare pe Matrigel la 2 concentrații, T / C: 0,035 / 0,21 mg / ml și T / C: 0,07 / 0,42 mg / ml. După 5 și 24 de ore de incubare, celulele au fost fotografiate în microscopie cu contrast de fază (Leica DM 5500B, Solms, Germania). Capacitatea celulelor de a forma capilare a fost examinată și a fost măsurat numărul de structuri capilare asemănătoare. Fiecare porțiune de cord dintre ramificații a fost considerată ca fiind o unitate capilară. Valorile medii ± deviația standard (SD) s-au obținut prin evaluarea a patru zone reprezentative din fiecare cultură din trei experimente independente.

Celuloza de viabilitate a culturii a fost realizată prin Kitul de Viabilitate / Citotoxicitate LIVE / DEAD (Molecular Probes), conform instrucțiunilor producătorului. Pe scurt, HUVEC (3 x 105 celule / godeu) au fost cultura în godeurile acoperite cu Matrigel în mediu de cultură complet. Formularea pro-enzimatică a fost adăugată după 20 de minute de însămânțare pe Matrigel la T / C: 0,07 / 0,42 mg / ml și viabilitatea celulară a fost testată după 24 de ore de cultură cu Calcein AM, o probă pentru activitatea de esterază intracelulară, , și homodimer-1 de etidiu, o sondă pentru pierderea integrității membranei plasmatice, care a marcat celule moarte. Celulele tratate cu metanol 70% au servit ca martori pentru celulele moarte (datele nu sunt prezentate). Imaginile au fost preluate prin microscopie confocală (Nikon Eclipse Ti-E A1, SUA) și analizate utilizând software-ul NIS-Elements.

Implantul și tratamentul AngioChamber ™

Camere de țesut poros Teflon (AngioChambers ™) 48 , 49au fost umplute în condiții sterile cu 0,8% agaroză conținând 20 UI / ml heparină, cu sau fără 4 ug / ml factor de creștere fibroblast bazic (bFGF). 30 de șoareci FvB de sex feminin au primit câte un AngioChamber ™ implantat subcutanat, cu sau fără factor de creștere fibroblastic bazic (bFGF). 30 de șoareci au fost implantate cu camere fără bFGF (grupa 1) și 20 de șoareci, implantate cu camere care conțin bFGF (grupurile 2 și 3), au fost randomizați prin masa corporală în 3 grupe de câte 10 șoareci (grupa 1, 2 și 3). Grupurile de control (grupurile 1 și 2) au primit o doză orală de NMP: PEG300 ca un vehicul de control și șoareci tratați (Grupa 3) au primit injecție intraperitoneală zilnică (ip) cu T / C: 0,13 / 0,78 mg / mL într-un volum de dozare 10 ml / kg. Animalele au fost tratate la 2 ore după ce șoarecii s-au recuperat din chirurgie pentru a implanta AngioChamber ™ în Ziua de studiu 0.AngioChambers ™ au fost excluse de la toți șoarecii post-mortem în ziua terminării, 24 de ore după tratamentul final (Ziua 5). Capsula fibroasă vascularizată care a fost formată în jurul fiecărei camere a fost îndepărtată cu grijă și greutatea umedă a fost înregistrată imediat. Inhibarea angiogenezei prin pro-enzime (%) a fost calculată folosind

% Inhibare = [( A – B ) / ( A – C ) x 100];
1

unde A este greutatea medie a capsulei de la șoareci cu factor de creștere implantat AngioChambers ™ și tratată cu Controlul vehiculului (Grupa 2), B este greutatea medie a capsulei de la șoareci cu agent de creștere implantat AngioChambers ™ și tratată cu proenzima (Grupa 3) și C este greutatea medie a capsulei de la șoareci cu AngioChambers ™ implantată fără factor de creștere și tratată cu Controlul vehiculului (Grupul 1).

Testul de vindecare a rănilor in vitro

Pancreatice (BxPC3 și Mia Paca-2), celule ovariene (A2780), melanom (A375) și colon (HCT 116) au fost însămânțate în plăci cu 6 godeuri și crescute până la confluență de 80%. Plăgile au fost create prin răzuirea celulelor monostrat cu un vârf de pipetă de 200 pl, iar celulele neaderente au fost spălate cu mediu. Celulele canceroase BxPC3 și A2780 au fost tratate cu T / C: 0,07 / 0,42, mg / ml, celulele canceroase Mia Paca-2 și HCT 116 au fost tratate cu T / C: 0,025 / 0,15 mg / ml și celulele canceroase A375 au fost tratate cu T / C: 0,035 / 0,21 mg / ml ,. La 0, 24 și 48 de ore după crearea rănilor, s-au observat celule tratate și de control ne-tratate, iar imaginile de migrare au fost captate cu un obiectiv de 10x într-o microscopie cu contrast de fază. Migrarea celulelor a fost determinată de viteza celulelor care se deplasează spre zona zgâriată. Software-ul ImageJ ™ a fost folosit pentru a cuantifica zona zgâriată.Toate experimentele au fost placate în godeuri triplicate și au fost efectuate de cel puțin trei ori.

Testul de invazie a celulelor Matrigel

Inserțiile de cultură celulară (mărimea porilor de 8 pm) au fost spălate de două ori cu mediu RPMI sau DMEM fără ser și introduse în godeurile unei plăci de cultură de celule cu 24 de godeuri. Utilizând vârfuri de pipetă reci, la fiecare inserție s-au adăugat 40 pl de Matrigel diluat 1:10 în mediu RPMI, balansând cu ușurință plăcuța pentru a distribui Matrigel uniform pe suprafața membranei. Matrigel a fost lăsat să se solidifice prin incubare peste noapte la 37 ° C. A doua zi, 7,5 x 10 4 MIA PaCa-2 celule în 200 pl de mediu DMEM suplimentat cu 0,1% BSA, sau 7,5 x 10 4 HCT 15 celule în 200 pl de mediu RPMI suplimentat cu 0,1% BSA, au fost adăugate la camera superioară a fiecărei inserții. Suspensiile celulare au conținut combinație pro-enzimă la opt concentrații (tabelul suplimentar S2) sau PBS (control netratat). Combretastatina A4 a fost utilizată ca un control al inhibării migrării celulare 50 la o concentrație finală de 250 nM. Fiecare probă a fost analizată în două exemplare. Mediul condiționat din celule U87-MG (500 pl) a fost utilizat ca chemoattractant în camera inferioară 51 , 52 . Celulele au fost lăsate să migreze prin matricea extracelulară timp de 24 de ore la 37 ° C. Celulele care nu migrează au fost îndepărtate din camera superioară cu un vârf de bumbac. Celulele de pe partea de jos a membranei au fost fixate în etanol 70% timp de 15 minute și colorate cu 10% colorare Giemsa filtrată timp de 1 oră la temperatura camerei. Migrarea a fost cuantificată prin numărarea celulelor în trei câmpuri de vedere la mărirea de 40x utilizând un microscop cu lumină inversă (Olympus).

Izolarea ARN și analiza cantitativă RT-PCR în timp real

A2780 și BxPC3 au fost crescute în plăci cu 6 godeuri și tratate de două ori cu PRP (T / C 0,07 / 0,42 mg / ml) în ziua 2 și în ziua 4. În ziua 5, ARN celular total a fost izolat folosind TriReagent (Sigma) utilizând setul pentru sistemul de transcriere inversă (Promega). PCR în timp real a fost realizat utilizând amestecul principal SYBR-Green PCR (Promega) conform recomandărilor producătorului. Reacțiile PCR s-au efectuat după cum urmează: o denaturare inițială la 95 ° C timp de 2 min, 40 cicluri de 95 ° C timp de 5 s și 60 ° C timp de 30 s și ciclu final de disociere de 60-95 ° C. Nivelurile de exprimare a genei au fost normalizate la valorile corespunzătoare GAPDH și sunt prezentate ca schimbare ori în raport cu valoarea probei de control. Celulele netratate au fost utilizate ca martor. Toate probele au fost efectuate în triplicat pentru fiecare genă. Grundurile utilizate sunt prezentate în tabelul suplimentarS3 .

Analiza imunohistochimică

A2780 și BxPC3 au fost crescute pe capace de sticlă și tratate de două ori cu PRP (T / C 0,07 / 0,42 mg / ml) în ziua 2 și în ziua 4. Pentru colorarea cu imunofluorescență probele au fost fixate cu 4% paraformaldehidă (PFA) min la RT. Celulele au fost blocate timp de 1 oră la temperatura camerei (RT) cu 5% BSA, 5% ser fetal bovin în PBS și apoi incubate cu E-Cadherin (SC-21791, St. Cruz) și β-catenină (SC-7963, , Cruz) peste noapte la 4 ° C. A doua zi, probele au fost spălate de trei ori cu PBS și incubate cu anticorpi secundari corespunzători (Santa Cruz) timp de 1 oră la RT, spălate de trei ori cu PBS și apoi montate cu mediu de montare și DAPI. Imaginile au fost preluate prin microscopie confocală (Nikon Eclipse Ti-E A1, SUA) și analizate utilizând software-ul NIS-Elements.

Studiu farmacocinetic

Conjugarea tripsinogenului și a chitomicroscopului A cu eticheta IRDye® 800CW a fost făcută în conformitate cu protocolul producătorului (biotehnologia LI-COR). Pe scurt, tripsinogenul și chitomicrosinogenul A s-au dizolvat la o soluție 1 mg / ml (greutate / volum) și s-a utilizat fosfat de potasiu 50 mM pentru a ajusta pH-ul la 8,5. Amestecul proteic și IRDye® 800CW a fost incubat timp de 2 ore la temperatura ambiantă. După filtrarea pe coloană pentru a îndepărta colorantul neconjugat și tamponul de schimb pentru soluție salină tamponată cu fosfat (PBS), pH 7,2, concentrația finală de proteină și gradul de etichetare (raportul colorant până la pro-enzimă) au fost determinate prin măsurarea absorbției la 280 și 780 nm. Produsul marcat a fost păstrat la 4 ° C până la utilizare.

Studiile de biodistribuție au fost efectuate pe șoareci nude-Foxnlnu femelă athymic non-tumorală (n = 3 per punct de timp). Se administrează (intravenos) combinația de pro-enzime etichetate și neetichetate IRDye® 800CW (la fiecare șoarece) la Trypsinogen marcat cu IRDye® 800CW (5 mg / kg) cu tripsinogen marcat cu 50 mg / kg IRDye® 800 CW 7 mg / kg) cu Chitomoprinogen A neimologat (300 mg / kg). Șoarecii au fost eutanasiați la punctele de timp predeterminate (0 min, 15 min, 30 min, 1 h, 2 hr, 6 ore, 12 ore, 24 ore și 48 ore după injectare) și organele pertinente (sânge prelucrate în plasmă, ficat, plămân, inimă, splină, tract gastrointestinal întreg și ambii rinichi) au fost excizate, omogenizate și înregistrate prin intermediul IVIS Lumina XR de la Perkin Elmer.Concentrațiile de proteine ​​marcate IRDye® 800CW (intensitatea fluorescenței / mg de proteină) au fost analizate la fiecare punct de timp pentru probele de plasmă și de omogenitate de organe.

Modele tumorale ortotopice in vivo

40 femele atimici nuzi-Foxn1 NU șoarecii au fost inoculați ortotopic (ovar dreapta) cu 1 x 10 6 A2780 celulele de cancer ovarian uman; și 40 femele / 6 șoareci C57BL au fost inoculați ortotopic (coada pancreasului) cu 1 x 10 6 celule tumorale pancreatice Pan02 șoarece. 10 animale din fiecare grupă au rămas netratate pentru evaluarea ratei de absorbție a tumorii. După 7 zile după inoculare (Ziua 0), animalele au fost randomizate în 3 seturi de 10 (grupul de tumori ovariene) și 3 seturi de 10 (grupul tumoral pancreatic).

A fost administrată o singură injecție de venei de coadă într-un volum de dozare de 10 ml / kg o dată pe zi pentru fiecare animal. Volumul de soluție de dozare administrat fiecărui animal a fost calculat și ajustat în funcție de greutatea corporală individuală măsurată imediat înainte de administrare. Tratamentele au început în ziua 0 și au fost administrate timp de 21 de zile consecutive. Animalele tumorale ovariene ortotrope au fost injectate cu PBS (Grupul 1) sau T / C la doze de 27,5 / 165 mg / kg (Grupa 2) și 83,3 / 500 mg / kg (Grupa 3). Animalele tumorale din pancreasul ortotropic au fost injectate cu PBS (Grupa 1) sau T / C la doze de 9,1 / 54 mg / kg (Grupa 2) și 27,5 / 165 mg / kg (Grupuri 3). La terminare, ovarul și pancreasul au fost excluse de la toate animalele cu tumoare intactă. Tumoarea a fost izolată, cântărită și apoi fotografiată.Modificarea procentuală a greutății medii a tumorii pentru grupurile tratate comparativ cu grupul martor a fost calculată utilizând:

Modificarea procentuală = ((Control mediu – Tratament mediu) / Control mediu) × 100.
2

„Special” tratament cu licența – formularea proenzimelor pancreatice

46 de pacienți cu boală malignă avansată de origine diferită au fost tratați zilnic cu o formulare rectală conținând 8,92 mg din fiecare dintre cele două enzime pancreatice și 1,78 mg α-amilază (A) pe supozitor. Studiul a fost efectuat în baza unei licențe britanice „Specials” la Clinica Dove, Hampshire, Marea Britanie pentru perioade de până la 14 luni. Specialități Regulamentul privind licența oferă un cadru legal pentru utilizarea unui medicament fără autorizație de introducere pe piață sau licență de produs de către un medic în vederea satisfacerii nevoilor speciale ale unui pacient pentru care este direct responsabil. Prin urmare, tratamentul în baza unei licențe speciale nu poate fi considerat un studiu clinic formal. Preocuparea informată a fost obținută de la toți pacienții înainte de tratament. Datele raportate au fost generate din notele pacientului deținute de Clinica Dove.

Fără criterii formale de includere și excludere, grupul de pacienți al acestui program de utilizare compasională a fost foarte eterogen. Majoritatea pacienților au fost diagnosticați cu cancere metastatice de diferite origini, inclusiv prostată (n = 8), sân (n = 6), ovarian (n = 7), pancreatice (n = 4), colo-rectale (n = 2), cancerul intestinal (n = 2), cancerul de colon (n = 2), melanomul (n = 2) limfom non-Hodgkin, mezoteliom, tumora neuro-endocrină, carcinom cu celule mici, cancer renal și abdomen necunoscut primar (toate n = 1). Pentru a evalua beneficiul tratamentului, supraviețuirea sub tratament a fost comparată cu speranța de viață individuală alocată înainte de începerea tratamentului.Aceasta speranta de viata a fost determinata pentru fiecare pacient avand in vedere i) data diagnosticului clinic, ii) varsta pacientului si comorbiditatile, iii) tratamente anterioare si modul in care acestea au fost tolerate, iv) sange standard si biomarkeri relevanti, v) scanari istorice , deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.

Calcule statistice

Diferențe semnificative au fost testate de One Way ANOVA. Ipotezele de analiză a varianței (homocedesență și normalitate) au fost testate și asigurate prin utilizarea seturilor de date transformate atunci când este necesar. Semnificația a fost acceptată la P <0,05 în toate cazurile.

Declarație privind disponibilitatea datelor

Seturile de date generate în timpul și / sau analizate în timpul studiului actual sunt disponibile de la autorul corespunzător, la cerere rezonabilă.

Logo-ul scirepului

About Editorial Board For Authors Scientific Reports
Sci Rep . 2017; 7: 13998.
Publicat online 2017 Oct 25 doi: 10.1038 / s41598-017-14571-x
PMCID: PMC5656641
PMID: 29070896
O formulare a pro-enzimelor pancreatice oferă o eficacitate potentă anti-tumorală: un studiu pilot axat pe cancerul pancreatic și ovarian
Macarena Perán , autorul corespunzător 1, 2 Elena López-Ruiz , 1, 2 María Ángel García , 2, 3, 4 Shorena Nadaraia-Hoke , 5 Ralf Brandt5 Juan A. Marchal , 2, 4, 6 și Julian Kenyon autorul corespunzător 7

Material suplimentar electronic

Recunoasteri

Autorii mulțumesc, de asemenea, cu recunoștință dr. Klaus Kutz pentru revizuirea atentă a manuscrisului.

Contribuțiile autorului

MP conceperea și proiectarea studiului, analiza și interpretarea datelor, redactarea articolului și aprobarea finală a manuscrisului depus. Concepția JK și proiectarea studiului, furnizarea datelor pacientului și aprobarea finală a manuscrisului depus. Colectarea, analiza și interpretarea datelor ELR, SNH și MAG. RB și JAM proiectarea studiului, analiza datelor și revizuirea articolului. Toți autori: aprobarea finală a manuscrisului depus.

notițe

Interese concurente

Dr. Julian Kenyon este fondatorul și directorul științific al companiei Propanc Pty Ltd și deține acțiuni în cadrul companiei. Propanc Pty Ltd a finanțat Universitatea din Jaen și vivoPharm LLC pentru a efectua această cercetare.

Note de subsol

Material suplimentar electronic

Informații suplimentare însoțesc această lucrare la 10.1038 / s41598-017-14571-x.

Nota editorului: Springer Nature rămâne neutră în ceea ce privește pretențiile jurisdicționale în hărțile publicate și afilierile instituționale.

Informații despre colaboratori

Macarena Perán, se.neaju@narepm .

Julian Kenyon, moc.cinilcevod@noyneknj .

Referințe

1. Reticker-Flynn NE, ș.a. O platformă de matrice extracelulară combinatorie identifică interacțiunile matricei extracelulare celulare care se corelează cu metastazele. Nat. Commun. 2012; 3 : 1122. doi: 10.1038 / ncomms2128. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
2. Thiery JP. Epilare-mezenchimale tranzitorii în progresia tumorii. Nat. Rev. Cancer. 2002; 2 : 442-454. doi: 10.1038 / nrc822. PubMed ] [ CrossRef ] Google Scholar ]
3. Kalluri R, Weinberg RA. Elementele de bază ale tranziției epitelio-mezenchimale. Journal of Clinical Investigation. 2009; 119 : 1420-1428. doi: 10.1172 / JCI39104. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
4. Jordão BP, Terra WR, Ribeiro AF, Lehane MJ, Ferreira C. Secreția de tripsină în midgutul midian Musca domestica: Un studiu biochimic și imunocitochimic. Insect Biochem. Mol. Biol. 1996; 26 : 337-346. doi: 10.1016 / 0965-1748 (95) 00084-4. CrossRef ] Google Scholar ]
5. Wald M, și colab. Amestecul de tripsină, chymotrypsin și papain reduce formarea metastazelor și extinde timpul de supraviețuire a șoarecilor C57Bl6 cu melanomul syngeneic B16. Cancer Chemother. Pharmacol.2001; 47 (Suppl): S16-S22. doi: 10.1007 / s002800170004. PubMed ] [ CrossRef ] Google Scholar ]
6. Saruc M, și colab. Extractul de enzime pancreatice îmbunătățește supraviețuirea în cancerul pancreatic murin. Pancreas. 2004; 28 : 401-412. doi: 10.1097 / 00006676-200405000-00009. PubMed ] [ CrossRef ] Google Scholar ]
7. Perán M, Marchal JA, García MA, Kenyon J, Tosh D. Tratamentul in vitro al liniilor celulare de carcinom cu enzimele (pro) pancreatice suprimă programul EMT și promovează diferențierea celulelor.Cell. Oncol. 2013; 36 : 289-301. doi: 10.1007 / s13402-013-0134-8. PubMed ] [ CrossRef ] Google Scholar ]
8. Sakalová A, et al. Studiu de cohortă retrografică a unei terapii aditive cu un preparat enzimatic oral la pacienți cu mielom multiplu. Cancer Chemother. Pharmacol. 2001; 47 (Suppl): S38-S44. PubMed ] Google Scholar ]
9. Beuth J, și colab. Impactul aplicării enzimelor orale complementare asupra rezultatelor tratamentului postoperator al pacienților cu cancer de sân – rezultate ale unui studiu de cohortă epidemiologic multicentric retroreflexiv. Cancer Chemother. Pharmacol. 2001; 47 (Suppl): S45-S54. doi: 10.1007 / s002800170009. PubMed ] [ CrossRef ] Google Scholar ]
10. Popiela T, Kulig J, Hanisch J, Bock PR. Influența unui tratament complementar cu enzimele orale asupra pacienților cu cancer colorectal – un studiu de cohortă epidemiologic retrolectiv. Cancer Chemother.Pharmacol. 2001; 47 (Suppl): S55-S63. doi: 10.1007 / s002800170010. PubMed ] [ CrossRef ] Google Scholar ]
11. Wood W, și colab. Rănirea rănilor recapitulează morfogeneza în embrionii Drosophila. Nat. Cell Biol.2002; 4 : 907-12. doi: 10.1038 / ncb875. PubMed ] [ CrossRef ] Google Scholar ]
12. Hanahan D, Weinberg RA. Semnele distinctive ale cancerului. Cell. 2000; 100 : 57-70. doi: 10.1016 / S0092-8674 (00) 81683-9. PubMed ] [ CrossRef ] Google Scholar ]
13. Yan C, și colab. Rinoplarea mediată de interferența ARN a VEGF și bFGF suprimă secreția de endostatină în celulele carcinomului pancreatic. Oncol. Lett. 2013; 5 : 1031-1035. Articolul gratuit PMC ]PubMed ] Google Scholar ]
14. Cao R și colab. Colaborarea colaborativă între FGF-2 și VEGF-C promovează limfangiogeneza și metastazarea. Proc. Natl. Acad. Sci. 2012; 109 : 15894-15899. doi: 10.1073 / pnas.1208324109.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
15. Marchal, J. a. și colab . Purificarea și extinderea pe termen lung a celulelor multipotent endoteliale, cu regenerare cardiovasculară potențială. Celulele stem și dezvoltarea 21 (2012). PubMed ]
16. Li D, și colab. Blocarea dublă a factorului de creștere endotelial vascular (VEGF) și a factorului de creștere fibroblastic bazic (FGF-2) prezintă efecte anti-angiogenice puternice. Cancer Lett. 2016; 377 : 164-173. doi: 10.1016 / j.canlet.2016.04.036. PubMed ] [ CrossRef ] Google Scholar ]
17. Pavcnik D, și colab. Evaluarea angiografică a altoirii arterei carotide cu grefele submucoase cu diametru mic prefabricat, cu mici intestine submucoase la ovine. Cardiovasc. Intervent. Radiol. 2009; 32 : 106-113. doi: 10.1007 / s00270-008-9449-7. PubMed ] [ CrossRef ] Google Scholar ]
18. Voulgari A, Pintzas A. Tranziția epitelială-mezenchimică în metastazele cancerului: mecanisme, markeri și strategii pentru a depăși rezistența medicamentului în clinică. Biochimica et Biophysica Acta – Recenzii despre cancer. 2009; 1796 : 75-90. doi: 10.1016 / j.bbcan.2009.03.002. PubMed ] [ CrossRef ] Google Scholar ]
19. Wan L, Pantel K, Kang Y. Metastaze tumorale: mișcări noi de cunoștințe biologice în clinică. Nat. Med.2013; 19 : 1450-1464. doi: 10.1038 / nm.3391. PubMed ] [ CrossRef ] Google Scholar ]
20. Vergara D, și colab. Epilare-mezenchimie în cancerul ovarian. Cancer Lett. 2010; 291 : 59-66. doi: 10.1016 / j.canlet.2009.09.017. PubMed ] [ CrossRef ] Google Scholar ]
21. Yuan Y, și colab. Supraexpresia YAP promovează tranziția epitelio-mezenchimică și rezistența la chimioterapie în celulele cancerigene pancreatice. Mol. Med. Rep. 2016; 13 : 237-242. doi: 10.3892 / mmr.2015.4550. PubMed ] [ CrossRef ] Google Scholar ]
22. Parikh A, și colab. microRNA-181a are un rol critic în progresia cancerului ovarian prin reglarea tranziției epitelio-mezenchimale. Nat. Commun. 2014; 5 : 2977. doi: 10.1038 / ncomms3977.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
23. Adham SAI și colab. Vizualizarea imunohistologică în corelația dintre markerii neuropilin-1 și markerii de tranziție mezenchimală epitelială în cancerul ovarian epitelial. J. Histochem. Cytochem. 2014; 62 : 619-31. doi: 10.1369 / 0022155414538821. PubMed ] [ CrossRef ] Google Scholar ]
24. Arumugam T, și colab. Tranziția epitelială la mezenchimie contribuie la rezistența la medicament în cancerul pancreatic. Cancer Res. 2009; 69 : 5820-5828. doi: 10.1158 / 0008-5472.CAN-08-2819.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
25. Yamada S și colab. Tranziția epitelio-mezenchimală prezice prognosticul cancerului pancreatic. Surg.(Statele Unite ale Americii) 2013; 154 : 946-954. PubMed ] Google Scholar ]
26. Cates JMM, și colab. Etichete de tranziție mezenchimale epiteliale-mezenchimale în adenocarcinomul ductal pancreatic. Pancreas. 2009; 38 : e1-e6. doi: 10.1097 / MPA.0b013e3181878b7f.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
27. Cavallaro U, Christofori G. Aderența celulară și semnalizarea de către cadherine și Ig-CAM în cancer.Nat. Rev. Cancer. 2004; 4 : 118-132. doi: 10.1038 / nrc1276. PubMed ] [ CrossRef ] Google Scholar ]
28. Rachagani S, și colab. MUC4 potențează invazia și metastazarea celulelor cancerigene pancreatice prin stabilizarea receptorului factorului de creștere fibroblast 1. Carcinogeneză. 2012; 33 : 1953-1964. doi: 10.1093 / carcin / bgs225. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
29. Alaee M, Danesh G, Pasdar M. Plakoglobin Reduce in vitro creșterea, migrarea și invazia celulelor canceroase ovariene care exprimă N-Cadherin și p53 mutant. Plus unu. 2016; 11 : e0154323. doi: 10.1371 / journal.pone.0154323. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
30. Suyama K, Shapiro I, Guttman M, Hazan RB. O cale de semnalizare care conduce la metastaze este controlată de N-caderină și de receptorul FGF. Cancer Cell. 2002; 2 : 301-314. doi: 10.1016 / S1535-6108 (02) 00150-2. PubMed ] [ CrossRef ] Google Scholar ]
31. Nakajima S, și colab. Exprimarea N-cadherinei și tranziția epitelială-mezenchimică în carcinomul pancreatic. Clin. Cancer Res. 2004; 10 : 4125-4133. doi: 10.1158 / 1078-0432.CCR-0578-03. PubMed ] [ CrossRef ] Google Scholar ]
32. Chiang KC, și colab. Analogul vitaminei D, MART-10, reprima potențialul metastazelor prin reducerea reglării tranziției epitelio-mezenchimale în celulele cancerului pancreatic. Cancer Lett. 2014; 354 : 235-244. doi: 10.1016 / j.canlet.2014.08.019. PubMed ] [ CrossRef ] Google Scholar ]
33. Li W, și colab. Resveratrol inhibă tranziția epitelio-mezenchimică a celulelor cancerului pancreatic prin suprimarea căii PI-3K / Akt / NF-κB. Curr Med Chem. 2013; 20 : 4185-4194. doi: 10.2174 / 09298673113209990251. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
34. Huang TS, și colab. O angiogeneză indusă de estrogen favorizează adenomioza prin activarea axei Slug-VEGF în celule epiteliale endometriale. J. Cell. Mol. Med. 2014; 18 : 1358-1371. doi: 10.1111 / jcmm.12300. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
35. Guo W, și colab. Slug și Sox9 determină în mod cooperativ starea mamară a celulelor stem. Cell. 2012;148 : 1015-1028. doi: 10.1016 / j.cell.2012.02.008. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
36. Li, A. și colab . Fascinul este reglementat de slug, promovează progresia cancerului pancreatic la șoareci și este asociat cu rezultatele pacientului. Gastroenterologie 146 (2014). Articol gratuit PMC ] [ PubMed ]
37. Zhang X, și colab. Evaluarea preclinică a eficacității anticanceroase și a proprietăților farmacologice ale FBA-TPQ, un nou analog sintetic de makaluvamin. Mar. Drugs. 2012; 10 : 1138-1155. doi: 10.3390 / md10051138. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
38. Yang M, și colab. Compusul natural sulforaphena, ca un nou reactiv anticanceros, care vizează calea de semnalizare PI3K-AKT în cancerul pulmonar. Oncotarget. 2016; 7 : 76656-76666.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
39. Wang H, Li M, Rinehart JJ, Zhang R. Pre-tratamentul cu dexametazonă crește activitatea antitumorală a carboplatinei și gemcitabinei la șoareci purtători de xenogranți ai cancerului uman: activitatea in vivo , farmacocinetica și implicațiile clinice pentru chimioterapia cancerului. Clin. Cancer Res. 2004; 10 : 1633-1644. doi: 10.1158 / 1078-0432.CCR-0829-3. PubMed ] [ CrossRef ] Google Scholar ]
40. Wang, W. și colab . KCN1, un agent anticancer sintetic de sinteză noi: activități in vitro și cancer in vitro anti-pancreatic și farmacologie preclinică. PLoS One 7 (2012). Articol gratuit PMC ] [ PubMed ]
41. Talmadge JE, Singh RK, Fidler IJ, Raz A. Modele pentru a evalua strategiile terapeutice noi și convenționale pentru cancer. A.m. J. Pathol. 2007; 170 : 793-804. doi: 10.2353 / ajpath.2007.060929.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
42. Partecke LI, și colab. Un model murine ortotopic orginologic de adenocarcinom pancreatic la șoarecele C57 / BL6 utilizând liniile celulare Panc02 și 6606PDA. Euro. Surg. 2011; 47 (2): 98-107. PubMed ] Google Scholar ]
43. Ding XZ, Tong WG, Adrian TE. Ciclooxigenazele și lipoxigenazele ca ținte potențiale pentru tratamentul cancerului pancreatic. Pancreatology. 2001; 1 : 291-299. doi: 10.1159 / 000055827. PubMed ] [ CrossRef ] Google Scholar ]
44. Liebow C, Rothman SS. Circulația enteropancreatică a enzimelor digestive. Știință (80-). 1975; 189 : 472-474. doi: 10.1126 / science.1154022. PubMed ] [ CrossRef ] Google Scholar ]
45. Ziv E, Lior O, Kidron M. Absorbția proteinei prin peretele intestinal. Un model cantitativ. Biochem.Pharmacol. 1987; 36 : 1035-1039. doi: 10.1016 / 0006-2952 (87) 90411-4. PubMed ] [ CrossRef ] Google Scholar ]
46. Gewert K, Holowachuk S, Rippe C, Gregory P, Pierzynowski S. Nivelele enzimelor din sânge nu sunt afectate de administrarea orală a preparatului enzimatic pancreatic (Creon 10,000) la porcii insuficienți ai pancreasului. Pancreas. 2004; 28 : 80-88. doi: 10.1097 / 00006676-200401000-00013. PubMed ] [ CrossRef ] Google Scholar ]
47. Rothman S, Liebow C, Isenman L. Conservarea enzimelor digestive. Physiol. Rev. 2002; 82 : 1-18. doi: 10.1152 / physrev.00022.2001. PubMed ] [ CrossRef ] Google Scholar ]
48. Wood JM, și colab. PTK787 / ZK 222584, un inhibitor roman și potențial al factorului de creștere vascular endotelial tirozin kinazei, afectează răspunsurile induse de factorul de creștere endotelial vascular și creșterea tumorilor după administrarea orală. Cancer Research. 2000; 60 (8): 2178-2189. PubMed ] Google Scholar ]
49. Wallis, NG Activitatea antiangiogenă a inhibitorilor derivați din fragmentul METAP2. Analele Oncologiei . 23 (Supliment 1), i26-i44 (2012).
50. Weixin L, și colab. Combretastatina A4 reglează proliferarea, migrarea, invazia și apoptoza celulelor canceroase tiroidiene prin calea de semnalizare PI3K / Akt. Med. Sci. Monit. 2016; 22 : 4911-4917. doi: 10.12659 / MSM.898545. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
51. Annabi B, și colab. Hipoxia promovează migrația celulară derivată din maduva osoasă și formarea tubului. Celule stem. 2003; 21 : 337-347. doi: 10.1634 / stemcells.21-3-337. PubMed ] [ CrossRef ] Google Scholar ]
52. Ichigotani Y, Yokozaki S, Fukuda Y, Hamaguchi M, Matsuda S. Exprimarea forțată a NESH suprimă motilitatea și diseminarea metastatică a celulelor maligne. Cancer Res. 2002; 62 : 2215-2219. PubMed ] Google Scholar ]

Articolele din rapoartele științifice sunt furnizate aici prin amabilitatea Nature Publishing Group

Impactul aplicării enzimelor orale complementare asupra rezultatelor tratamentului postoperator al pacienților cu cancer de sân – rezultatele unui studiu epidemiologic multicentric de cohortă retrolectivă.

Abstract

SCOP:

[corectat] Pentru a evalua impactul tratamentului postoperator cu un preparat de enzimă orală (OE) administrat complementar unei terapii antineoplazice la pacienții cu cancer mamar.

METODE:

Proiectarea acestui studiu epidemiologic a reprezentat o analiză retrospectivă a cohortei cu grupuri paralele. Proiectarea și desfășurarea studiului au fost efectuate conform standardelor actuale pentru studiile clinice prospective, controlate. O cohortă de 2339 de pacienți cu cancer mamar supuși intervenției chirurgicale și terapie radio, chimică sau hormonală au fost studiate în 216 de centre. Din cei 2.339 de pacienți, 1.283 au primit tratament complementar cu OE și 1.056 nu au primit OE. Pacienții cu alte medicamente complementare au fost excluși, iar analiza finală a fost efectuată cu datele de la 649 de pacienți, dintre care 239 (37%) au fost tratați suplimentar cu OE (grupă de test) și 410 (63%) fără OE (grupul de control). Timpul mediu de urmărire pentru grupul de testare a fost de 485 de zile, iar pentru grupul de control 213 de zile. Obiectivul primar al studiului a fost de a determina dacă tratamentul complementar cu OE poate reduce semnele și simptomele asociate cu boala sau terapia (simptome gastro-intestinale, simptome mentale, dispnee, dureri de cap, durere tumorală, cașexie, afecțiuni ale pielii, infecții și efecte secundare asociate cu terapia antineoplazică) la pacienții cu cancer mamar. Dezechilibrele pentru efectele cauzale (covariate) au fost ajustate prin scorul de propulsie. Analiza rezultatelor a fost efectuată prin estimarea regresiei liniare între schimbarea scorului simptomului și scorul de propensitate cu toate datele și utilizarea acestei linii de regresie pentru a calcula modificarea scorului simptomului care ar fi de așteptat pentru fiecare pacient. Evenimentele asociate tumorii (recurență, metastaze și deces) au fost evaluate în funcție de numărul de evenimente observate și de timpul până la eveniment. Siguranța tratamentului cu OE a fost analizată în funcție de numărul și severitatea evenimentelor adverse, durata, tratamentul și rezultatul acestora.

REZULTATE:

Pentru toate simptomele, cu excepția durerii tumorale, îmbunătățirea medie ajustată a scorurilor simptomelor a fost mai mare în grupul de testare decât în ​​grupul de control. Diferența ajustată a fost statistic semnificativă pentru toate simptomele, cu excepția durerii și infecțiilor tumorale. Rezultatele arată că semnele și simptomele asociate cu boala și terapia asociate la pacienții cu terapie complementară cu OE în timpul tratamentului postoperator au fost semnificativ mai mici. Pentru 75% din grupul de testare și 55% din grupul de control, medicul a înregistrat „fără semne și simptome”. O reducere clară a efectelor secundare ale radioterapiei și chimioterapiei a fost documentată în 74% din grupul de testare și 55% din grupul de control. Analiza supraviețuirii, recurenței și metastazelor a demonstrat un număr redus de evenimente în grupul de testare. Au existat dovezi ale unei influențe benefice a OE la timp până la eveniment, deși timpul mediu de observare a fost prea scurt la acești pacienți cu cancer de sân pentru a trage concluzii definitive. Componenta de siguranță a fost evaluată la 98% din grupul de testare și la 76% din grupul de control ca fiind „foarte bun” sau „bun”. În eșantionul total de 2339 de pacienți, rata reacțiilor adverse asociate cu OE a fost de 3,2%. Toate reacțiile adverse au fost simptome gastro-intestinale ușoare până la moderate.

CONCLUZIE:

Tratamentul complementar al pacienților cu cancer de sân cu OE îmbunătățește calitatea vieții prin reducerea semnelor și simptomelor bolii și a efectelor secundare ale terapiilor antineoplazice adjuvante. Această analiză epidemiologică de cohorta epidemiologică oferă dovezi că pacienții pot beneficia de asemenea de o prelungire a timpului până la eveniment pentru recurența cancerului, metastazarea și supraviețuirea. OE a fost în general bine tolerată.

PMID: 
11561873
 2001 Jul; 47 Suppl: S45-54.
Impactul aplicării enzimelor orale complementare asupra rezultatelor tratamentului postoperator al pacienților cu cancer de sân – rezultatele unui studiu epidemiologic multicentric de cohortă retrolectivă.

1
Institutul de Evaluare Stiintifica a Naturopatiei, Universitatea din Köln, Köln, Germania.

Influența unui tratament complementar cu enzimele orale asupra pacienților cu cancer colorectal – un studiu de cohortă epidemiologic retrolectiv.

Abstract

SCOP:

Pentru a evalua impactul tratamentului postoperator cu un preparat de enzimă orală (OE) administrat complementar unei terapii antineoplazice la pacienții cu toate stadiile de cancer colorectal.

METODE:

Proiectarea acestui studiu epidemiologic a reprezentat o analiză retrospectivă a cohortei cu grupuri paralele. Proiectarea și desfășurarea studiului au fost efectuate conform standardelor actuale pentru studiile clinice prospective, controlate. În cazul unui grup de 1242 pacienți cu cancer colorectal (documentați în 213 de centre), 616 au beneficiat de tratament complementar cu OE (numai 182 OE, 405 alte medicamente complementare, 29 de violatori) și 626 nu au primit OE (numai 368 de control, medicamente complementare, 29 violatori ai protocolului). Din cei 1.162 de pacienți care au suferit o intervenție chirurgicală primară, 526 au primit chimioterapie adjuvantă și 218 radioterapii. Timpul mediu de urmărire pentru grupul OE a fost de 9,2 luni și pentru grupul de control 6,1 luni. Criteriul principal de testare a eficacității pentru tratamentul cu OE a fost dimensiunea efectului multivariat al modificărilor semnelor și simptomelor asociate bolii și terapiei (greață, vărsături, modificări ale apetitului, dureri de stomac sau tulburări de stomac, oboseală, depresie, memorie față de momentul inițial) sau tulburări de concentrare, tulburări de somn, amețeli, iritabilitate, dispnee în repaus, dispnee în timpul activității, dureri de cap, durere tumorală, cașexie, afecțiuni ale pielii și infecții). Evenimentele legate de tumori, de exemplu, deces, au fost evaluate prin numărul de evenimente observate și timpul până la eveniment. Siguranța tratamentului cu OE a fost analizată în ceea ce privește numărul și severitatea evenimentelor adverse, durata, tratamentul și rezultatul acestora.

REZULTATE:

O reducere semnificativă a semnelor și simptomelor asociate bolii a fost observată la pacienții tratați numai cu OE, dar nu la cei care au primit OE în plus față de alte tratamente complementare. Reacțiile adverse la chemo- și radioterapie au fost diminuate la toți pacienții tratați cu OE. Analiza supraviețuirii nu a demonstrat un număr redus de decese în grupul OE. Cu toate acestea, s-a demonstrat o tendință de prelungire a supraviețuirii, în special în cazul pacienților cu stadiu Dukes D, în subgrupul care primește OE în plus față de alte tratamente complementare. Au fost observate tendințe similare, dar mai puțin pronunțate, pentru stadiile bolii Dukes B și C. În grupul OE, 21 din 616 pacienți (3,4%) au prezentat reacții adverse asociate cu OE, toate acestea fiind simptome gastro-intestinale ușoare până la moderate.

CONCLUZIE:

Tratamentul complementar al pacienților cu cancer colorectal cu enzime orale OE îmbunătățește calitatea vieții prin reducerea atât a semnelor și a simptomelor bolii, cât și a reacțiilor adverse asociate cu terapiile antineoplazice adjuvante. Această analiză epidemiologică de cohortă retrospectivă furnizează dovezi că pacienții pot beneficia, de asemenea, de o prelungire a timpului de supraviețuire. OE au fost în general bine tolerate.

PMID: 
11561874

Evaluarea tratamentului cu enzime proteolitice pancreatice a adenocarcinomului pancreasului, cu suport pentru nutriție și detoxifiere.

Din punct de vedere istoric, doze mari de enzime proteolitice, alături de alimentație, suplimente nutritive și proceduri de detoxifiere au fost folosite în tratamente cancer alternative pentru a trata toate formele de cancer, fără studii clinice formale care să susțină utilizarea lor. 

Un studiu clinic prospectiv pilot cu durata de 2 ani a fost utilizat pentru evaluarea supraviețuirii pacienților care sufereau de adenocarcinom pancreatic inoperabil în stadiul II-IV tratați cu doze mari de enzime pancreatice ingerate oral, suplimente nutritive, „detoxifiere „, precum și o dietă ecologică. 

Din ianuarie 1993 până în aprilie 1996 în practica privată a autorilor, au fost incluși în studiu 10 pacienți cu adenocarcinom pancreatic inoperabil, biopsie dovedită. După ce un pacient a renunțat, un pacient al 11-lea a fost adăugat la studiu (cu toate acestea, toate cele 11 sunt considerate în tabela de date). Pacienții au urmat tratamentul la domiciliu, sub supravegherea autorilor.

 Începând cu 12 ianuarie 1999, din 11 pacienți au intrat în studiu, 9 (81%) au supraviețuit un an, 5 (45%) au supraviețuit doi ani, iar în acest moment 4 au supraviețuit trei ani. Doi pacienți trăiesc și se descurcă bine: unul la trei ani și celălalt la patru ani. Aceste rezultate sunt mult peste supraviețuirea de 25% la un an și supraviețuirea de 10% la doi ani pentru toate stadiile de adenocarcinom pancreatic raportate în Baza Națională a Cancerului SUA din 1995.

Acest studiu pilot sugerează că o terapie nutrițională agresivă cu doze mari de enzime pancreatice a dus la o supraviețuire semnificativ crescută peste ceea ce ar fi de așteptat în mod normal pentru pacienții cu adenocarcinom pancreatic inoperabil.

Observații cu privire la

PMID: 10368805 
DOI: 10.1207 / S15327914NC330201

https://www.ncbi.nlm.nih.gov/pubmed/10368805

integral/complet:

Dă clic pentru a accesa cc-0423.pdf

Nutr Cancer. 1999; 33 (2): 117-24.
Evaluarea tratamentului cu enzime proteolitice pancreatice a adenocarcinomului pancreasului, cu suport pentru nutriție și detoxifiere.

Chimioterapie sprijinită metabolic pentru gestionarea cancerului de sân în stadiul final: un răspuns complet și durabil

Mehmet Salih İyikesiciAbdul Kadir SlocumNasha WintersMiriam KalamianThomas N. Seyfried


Publicat: 26 aprilie 2021 (vezi istoricul)

DOI: 10.7759 / cureus.14686

Citați acest articol ca: İyikesici M, Slocum A, Winters N și colab. (26 aprilie 2021) Chimioterapie sprijinită metabolic pentru gestionarea cancerului de sân în stadiul final: un răspuns complet și durabil. Cureus 13 (4): e14686. doi: 10.7759 / cureus.14686


Abstract

Cancerul de sân reprezintă morbiditate și mortalitate semnificativă la nivel mondial. În prezent, opțiunile de tratament în cancerul de sân metastatic constau în chimioterapie, împreună cu terapii endocrine, cu radiații și / sau biologice. Deși progresele în management au îmbunătățit duratele globale de supraviețuire, opțiunile de tratament pentru femeile cu boală în stadiul final sunt în mare parte limitate la îngrijirea de susținere.

Aici, prezentăm un raport de caz care evidențiază răspunsul unei femei premenopauzale în vârstă de 47 de ani, cu cancer de sân în stadiul final (T4N3M1) tratată cu chimioterapie susținută metabolic (MSCT), dietă ketogenică (KD), hipertermie (HT) și oxigenoterapie hiperbară (HBOT). Pacientul a observat pentru prima dată o masă mamară dreaptă la sfârșitul anului 2016, care a fost inițial evaluată și exclusă ca chist. Ulcerarea pielii a fost observată în regiunea chistului suspectat în mai 2017. Ultrasunetele bilaterale ulterioare de sân au identificat mase în ambii sâni și un ganglion limfatic axilar drept. Diagnosticul după biopsie a fost de gradul 3, receptor de estrogen pozitiv (ER +), receptor de progesteron pozitiv (PR +), factor de creștere epidermic uman receptor 2 negativ (HER2-), carcinom ductal invaziv al sânului. Inițial,pacienta a refuzat să primească chimioterapie convențională din cauza potențialului său de efecte secundare și toxicitate, dar a solicitat tratament medical în august 2018, după o progresie extinsă a bolii și deteriorarea stării generale de sănătate. La reevaluare, pacienta a fost considerată neeligibilă pentru tratamentul convențional din cauza bolii sale avansate în stadiul final, a stării de performanță slabă (scorul Eastern Cooperative Oncology Group: 3) și a simptomelor respiratorii avansate. Explorând alte opțiuni, pacientul a fost internat la Centrul de Oncologie ChemoTermia, Istanbul, Turcia în noiembrie 2018. În acel moment, pacientul cântărea 38 kg (indicele de masă corporală: 18,1 kg / m2 ) și a avut o boală metastatică extinsă, cu leziuni la nivelul creierului, plămânilor, mediastinului, ficatului, abdomenului și oaselor, care au fost detectate prin imagistica prin rezonanță magnetică a creierului (cu contrast) și tomografie cu emisie de fluor-oxigenglucoză-pozitroni (18F) -tomografie computerizata. 

Pacientul a primit un protocol de tratament de șase luni format din MSCT, KD, HT și HBOT, care a eliminat toate leziunile detectabile. Răspunsul terapeutic a fost susținut timp de doi ani, cu un tratament de întreținere care cuprinde KD, suplimente alimentare și medicamente reutilizate. Acest raport unic de caz prezintă dovezi ale unui răspuns complet și durabil la un protocol de tratament care combină MSCT și o nouă terapie metabolică la un pacient cu cancer de sân în stadiu final.

Introducere

Cancerul de sân este al doilea cel mai frecvent cancer la nivel mondial, cu aproape 2,1 milioane de pacienți noi diagnosticați în 2018 la nivel global [1] . Este a patra cauză principală de decese cauzate de cancer la nivel mondial (627.000 de decese) și principala cauză de mortalitate cauzată de cancer la femei [1]. Cancerul de sân este o boală eterogenă cu mai multe subtipuri biologic distincte. În general, include următoarele trei subgrupuri biologice: (1) expresie imunohistochimică a receptorului de estrogen (ER), (2) amplificarea receptorului 2 al factorului de creștere epidermică uman (HER2) (cu sau fără expresie ER) și (3) ) cancere care nu exprimă ER și HER2 sau receptorul de progesteron (PR). În ciuda îmbunătățirilor tehnologice pentru depistarea precoce, aproximativ 5% – 7% dintre femeile diagnosticate cu cancer de sân au boli metastatice în momentul primei prezentări. În plus, aproximativ 30% dintre femeile diagnosticate inițial cu stadiu incipient, cancer de sân nonmetastatic, dezvoltă ulterior o boală metastatică la distanță în ciuda tratamentului.

Strategia de tratament pentru cancerul de sân diferă în funcție de tipul histologic, gradul tumorii, biologia tumorii, stadiul bolii și factorii clinici. De obicei, tratamentul include o combinație de intervenții chirurgicale, radioterapie, terapie endocrină și chimioterapie. Majoritatea femeilor cu cancer mamar în stadiu incipient primesc în general terapii locale care implică intervenții chirurgicale cu sau fără radioterapie ulterioară. Terapia sistemică adjuvantă este adesea prescrisă pentru a minimiza riscul de recurență. În prezent, stâlpul tratamentului pentru pacienții cu cancer de sân metastatic implică terapii sistemice cuprinzând chimioterapie, terapie endocrină și / sau terapii biologice împreună cu îngrijiri medicale de susținere.

În ultimele decenii, au existat unele progrese în tratamentul sistemic al cancerului de sân, inclusiv noi terapii citotoxice, terapii endocrine și terapii care vizează HER2. În ciuda acestor opțiuni de tratament suplimentare, supraviețuirea mediană globală (OS) la pacienții cu cancer de sân metastatic rămâne scăzută la aproximativ trei ani. Din păcate, supraviețuirea nu poate depăși câteva luni în unele cazuri de boală agresivă [2] .

Warburg a constatat inițial că fermentația aerobă este o caracteristică comună a majorității cancerelor [3] . Observația sa a fost confirmată în majoritatea cazurilor de cancer maligne și este acum denumită „efectul Warburg”. Disregularea metabolică în celulele canceroase se caracterizează cel mai adesea prin dependența de glucoză și producția crescută de lactat. Ambele modificări au fost asociate cu disfuncție mitocondrială [4-5] . Acest metabolism anormal al energiei este evident în scanările de tomografie cu emisie de fluorodioxiglucoză (FDG) -positron (PET), tehnica preferată de imagistică esențială pentru diagnosticarea și urmărirea protocoalelor utilizate în majoritatea cancerelor sistemice, inclusiv în cancerul de sân.

Recent, mai multe studii s-au concentrat pe direcționarea aberațiilor metabolice specifice celulelor canceroase, ceea ce a condus la dezvoltarea de noi aplicații de chimioterapie, și anume, chimioterapia cu susținere metabolică (MSCT) [6-12].. În practică, MSCT urmează un repaus de 14 ore începând seara precedentă și administrarea de doze farmaceutice de insulină obișnuită înainte de administrarea chimioterapiei. Această strategie urmărește creșterea eficacității medicamentelor chimioterapeutice prin următoarele două mecanisme: inducerea hipoglicemiei ușoare, conducând la stres metabolic acut în celulele canceroase și creșterea permeabilității membranei. Aceasta este o nouă aplicație a chimioterapiei care exploatează slăbiciunea metabolică a celulelor canceroase direct înainte de aplicarea medicamentelor chimioterapeutice. Deoarece se știe că mutațiile reduc flexibilitatea metabolică a celulelor canceroase, acest factor de stres suplimentar poate spori efectul terapeutic al chimioterapiei [13]. Dependența de glucoză a celulelor canceroase formează, de asemenea, rațiunea adoptării unei diete care scade nivelul de glucoză circulant. O dietă ketogenică (KD) cu conținut ridicat de grăsimi, cu conținut scăzut de carbohidrați, reduce nivelul glicemiei în timp ce crește simultan nivelul cetonelor din sânge. Foarte important, corpurile cetonice servesc ca metabolit energetic alternativ la glucoză în celulele normale, dar nu și în celulele canceroase din cauza anomaliilor numărului, structurii și funcției mitocondriilor celulelor canceroase [14] . Administrarea corectă a unei KD poate fi terapeutică pentru orice cancer care a reglementat în mod suplimentar utilizarea glucozei pentru energie [8-13, 15] .

Alte modalități de tratament metabolic prezintă, de asemenea, un potențial mare atunci când sunt utilizate concomitent cu KD și MSCT. Hipertermia (HT) are un efect citotoxic direct, exploatând sensibilitatea la căldură a celulelor canceroase prin creșterea temperaturii țesutului tratat la 42 ° C sau mai mult. HT poate crește, de asemenea, eficacitatea chimioterapiei și radioterapiei prin sensibilizarea celulelor canceroase la aceste terapii [7-12, 16] . Terapia cu oxigen hiperbaric (HBOT) poate viza celulele canceroase prin creșterea stresului oxidativ. Hipoxia tumorală crește dependența glicolitică a celulelor canceroase, promovând în același timp rezistența la chimioterapie și radioterapie. Consecințele nefavorabile ale hipoxiei pot fi contracarate prin administrarea de oxigen la presiuni ridicate, rezultând o mai bună oxigenare a țesuturilor [17].. HBOT crește stresul oxidativ în special în celulele tumorale; atunci când este utilizat în asociere cu chimioterapie și radioterapie, crește eficacitatea terapeutică în diferite tumori maligne [8-12, 16, 18] .

Pe baza acestor dovezi, am emis ipoteza că MSCT, KD, HT și HBOT ar putea fi combinate în mod eficient pentru a viza mai multe căi metabolice suprapuse și vulnerabilități ale celulelor canceroase. Aici, descriem un caz de cancer de sân metastatic în stadiul final în care pacientul a fost considerat neeligibil pentru continuarea tratamentului standard de îngrijire. Arătăm că acest pacient a obținut un răspuns complet și durabil la MSCT.

Prezentarea cazului

O femeie aflată în premenopauză, în vârstă de 45 de ani, fără comorbidități identificate, a observat o masă mamară dreaptă la sfârșitul anului 2016, care a fost ulterior evaluată și exclusă ca chist de către un medic în timpul consultației. În acel moment, ea cântărea 54 kg cu un indice de masă corporală (IMC) de 22,5 kg / m 2 .

În mai 2017, a fost tratată pentru o ulcerație a pielii în regiunea chistă a sânului drept la un spital din apropierea casei sale din Ohio, SUA. Chistul a fost drenat și sa constatat că este infectat cu Staphylococcus aureus. De asemenea, ea a prezentat un nodul palpabil în apropierea leziunii cutanate. O mamografie bilaterală din 4 mai 2017 a identificat o masă de 1,6 cm în sânul medial drept cu legarea pielii. Ecografia mamară bilaterală a identificat mase în ambii sâni și un ganglion limfatic axilar drept. O biopsie cu pumn a leziunii cutanate a fost efectuată pe 11 mai 2017, care a demonstrat un carcinom ductal invaziv de gradul 3 care implică dermul, epiderma și spațiile limfatice dermice. ER și PR au fost puternic pozitive (> 95%), iar HER2 a fost negativ în imunohistochimie (1+). Pacienta a primit antibiotice pentru infecția ei și i s-a oferit chimioterapie convențională, pe care a refuzat-o din cauza potențialului de chimioterapie pentru efecte secundare și toxicitate. În martie 2018, după confirmarea clinică și radiologică a progresiei bolii,a primit radioterapie la Universitatea din California, Los Angeles pentru controlul local al bolilor. Evaluarea ulterioară în iunie 2018 utilizând scanarea tomografiei computerizate (PET-CT) cu corp întreg (18F) -FDG-PET a identificat o boală metastatică răspândită. Limfadenopatia avidă prin FDG (LAP) a fost detectată în gâtul inferior stâng și regiunea supraclaviculară. Cancerul de sân local avansat a fost sugerat pe baza constatărilor unei leziuni ulcerative mari cu hipermetabolism intens în îngroșarea neregulată a țesuturilor moi care implică aspectul medial al ambilor sâni. Implicarea musculaturii pectorale adiacente drepte și invazia directă a sternului au fost domeniile de interes. Au fost, de asemenea, luate în considerare posibilitatea unor procese inflamatorii / infecțioase suprapuse (inclusiv osteomielita sternului) și modificări postradiate.Numeroase alte leziuni avide de FDG atât la sâni, cât și la țesuturile moi ale peretelui toracic erau suspectate a fi metastaze și / sau leziuni primare multifocale. Au fost, de asemenea, depistate metastaze pulmonare (și posibil pleurale) avide de FDG și LAP metastatic extins. Au fost identificate leziuni hepatice metastatice avid FDG multiple și adenopatie portacavală în abdomen și pelvis, împreună cu metastaze osoase multifocale în scheletul axial și apendicular. În iulie 2018, a fost efectuată o nouă biopsie de bază cu ecografie pe axilarul stâng al sânului, care a documentat în continuare boala metastatică pe scară largă. Dovezile carcinomului mamar invaziv de gradul 2 (ER (+), PR (+) și HER2 (-)) cu caracteristici ductale și lobulare mixte au fost în concordanță cu biopsia sa inițială din mai 2017.O scanare CT de urmărire în august 2018 a confirmat progresia semnificativă și pe intervale largi a bolii metastatice la mai multe locuri preidentificate. O creștere a intervalului în mărimea revărsatului pericardic a cauzat îngustarea ambelor atrii, în special a atriilor stângi. În urma acestui raport sumbru, pacientul a fost supus ecocardiografiei pentru a evalua fiziologia tamponării, care sa raportat că se corelează cu rezultatele scanării PET-CT. Pericardiocenteza a fost efectuată cu drenarea ulterioară a 360-ml de lichid serosanguinos. Pacientul a fost ulterior considerat neeligibil pentru terapie convențională ulterioară din cauza bolii sale avansate în stadiu final, a stării de performanță slabă (scorul Eastern Cooperative Oncology Group [ECOG]: 3) și a simptomelor respiratorii avansate. Ea a obținut o a doua opinie și a fost informată că prognosticul ei așteptat a fost mai mic de o lună.Pacienta a căutat alte opțiuni de tratament și a fost internată în cele din urmă la Centrul de Oncologie ChemoTermia, Istanbul, Turcia la 5 noiembrie 2018. La internare, greutatea ei a fost de 38 kg (IMC: 18,1 kg / m2 ). Au fost observate, de asemenea, o stare slabă de performanță (scor ECOG: 3) și o infecție recentă a tractului respirator înrăutățit. Ea a fost supusă unei evaluări clinice obiective și a documentării stării sale, care a inclus imagistica prin rezonanță magnetică (RMN) a creierului cu contrast, CT FDG-PET întreg corp și o evaluare detaliată de laborator (Figurile 1 – 3). RMN a relevat o leziune malignă de 8 mm în lobul occipital stâng. Scanarea FDG-PET / CT a reconfirmat boala metastatică pe scară largă cu progresia în comparație cu scanarea anterioară. Rezultatele de laborator au arătat funcția renală normală, o ușoară creștere a nivelului enzimei hepatice și un nivel ridicat de proteine ​​C reactive de 119 mg / ml. Markerii tumorali au fost crescuți cu antigenul carcinoembrionar și antigenul cancerului 15-3 din 45,6 ng / ml și respectiv 527 U / ml.

T1-imagine-cu-rezonanță-magnetică-axială-creier-ponderată-cu-contrast-datată-5 noiembrie-2018
Figura 1: Imagine de rezonanță magnetică a creierului axial ponderată T1 cu contrast datată 5 noiembrie 2018
T1-imagine-cu-rezonanță-magnetică-coronariană-creier-ponderată-cu-contrast-datată-5 noiembrie-2018
Figura 2: Imagine de rezonanță magnetică a creierului coronar ponderată T1 cu contrast datată 5 noiembrie 2018
Imagine de rezonanță magnetică-creier-FLAIR-cerebrală-datată-5 noiembrie-2018-unde-o-leziune-de-dimensiune-aproximativ-8-mm-cu-îmbunătățire-contrast-periferică-în-corelație-cu-a -leziunea-metastatică-se-vede-la-zona-cornului-occipital-stâng-posterior-posterior
Figura 3: Imagine de rezonanță magnetică cerebrală FLAIR coronariană din data de 5 noiembrie 2018 în care se observă o leziune de aproximativ 8 mm cu îmbunătățirea contrastului periferic în corelație cu o leziune metastatică în zona posterioară a cornului occipital stâng

FLAIR: recuperare inversiune atenuată de fluid

Scanarea întregului corp (18F) -FDG-PET-CT efectuată înainte de tratament pe 5 noiembrie 2018 a arătat leziuni metastatice multiple pe scară largă în plămâni, mediastin, ficat, abdomen și oase (Figura 4 , Video 1 ).

Whole-body- (18F) -FDG-PET / CT-scan-done-before-treatment-on-November-5-2018 -ficat, -abdomen-și-oase.
Figura 4: Scanarea întregului corp (18F) -FDG-PET / CT efectuată înainte de tratament la 5 noiembrie 2018, care prezintă leziuni metastatice multiple pe scară largă la plămâni, mediastin, ficat, abdomen și oase.

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizatăhttps://www.youtube.com/embed/bD2StUtnDak?rel=0&showinfo=0

Video 1: Video de fuziune coronară a întregului corp (18F) -FDG-PET / CT scanat înainte de tratament pe 5 noiembrie 2018

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizată

În urma acestei evaluări fizice, biochimice și radiologice detaliate care confirmă o boală generalizată în stadiu final cu prognostic slab (<1 lună), pacientul a primit consiliere cu privire la potențialele efecte secundare și complicațiile tratamentului. După acordarea în scris a consimțământului informat, pacientul a început tratamentul la clinica noastră pe 7 noiembrie 2018.

Chimioterapie susținută metabolic

Premedicația a constat din 45,5 mg maleat de feniramină, 0,25 mg clorhidrat de palonosetron și insulină obișnuită (Humulin® R) în doze cuprinse între 5 și 10 UI pentru a obține hipoglicemie ușoară, definită ca niveluri de glucoză din sânge de aproximativ 50 – 60 mg / dl ( în conformitate cu protocoalele MSCT) [6-12]. Pacientul a primit 17 sesiuni de tratament în fiecare sesiune după 14 ore de post. Nivelurile de glucoză din sânge ale pacientului au fost măsurate prin testarea stick-ului degetelor la internare, iar glucoza din sânge a fost ajustată la nivelul de pretratare ușor hipoglicemiant vizat cu administrare de insulină. Medicul curant și asistenta au monitorizat îndeaproape nivelurile de glucoză din sânge ale pacientului și au evaluat-o pentru simptomele clinice ale hipoglicemiei. Nivelurile sale de glucoză în sânge la jeun la admitere au variat între 67 și 88 mg / dL, în timp ce glicemia sa efectuat înaintea tratamentului a variat între 51 și 58 mg / dL. Un regim de chimioterapie compus din gemcitabina (600 mg / m 2 ), zona carboplatin sub curba 2, și paclitaxel (60 mg / m 2) a fost inițiată la atingerea nivelului vizat de glucoză din sânge. Această combinație de medicamente a fost livrată în prima și a opta zi a unui ciclu de 21 de zile. Concomitent cu acest tratament, 4 mg de acid zoledronic au fost eliberate la fiecare 28 de zile pentru a trata leziunile osoase metastatice.

Dieta ketogenică, hipertermie și oxigenoterapie hiperbară

Pacientul a fost sfătuit să adopte o dietă bogată în grăsimi și în mod semnificativ limitată în carbohidrați, modelând o KD. Ea și îngrijitorul ei au fost informați în detaliu cu privire la ce alimente să includă și care alimente ar trebui să fie strict evitate. Ea a fost îndrumată să modifice mesele familiare prin eliminarea boabelor și reducerea zaharurilor și a amidonului dens, încorporând în același timp mai multe grăsimi. Având în vedere că cancerul ei era ER +, i s-a recomandat să limiteze produsele lactate bogate în grăsimi, care sunt contraindicate în cazurile de cancer sensibile la estrogeni. La fiecare vizită, o evaluare a nivelului de glucoză din sânge al pacientului și o revizuire a dosarelor de hrană ale îngrijitorului au oferit dovezi ale conformității continue a pacientului cu principiile KD, iar la fiecare vizită s-au făcut îmbunătățiri suplimentare ale planului dietetic. Împreună cu fiecare tratament MSCT, pacientul a primit și HT local și HBOT:două sesiuni din fiecare – una din fiecare în aceeași zi ca MSCT și una din fiecare în ziua următoare MSCT.

Pentru fiecare sesiune HT de 60 de minute, a fost folosit un dispozitiv OncoTherm EHY-3010 HT (OncoTherm, Troisdorf, Germania) pentru a crește treptat temperatura regiunii tumorale. Dispozitivul OncoTherm utilizează tehnologia de electrohipertermie modulată pentru a crește selectiv presiunea metabolică asupra țesutului tumoral, fără a afecta negativ țesuturile normale din jur, inclusiv pielea. Un electrod mobil de 30 × 40 cm a fost folosit pentru ședințele de HT și a fost plasat începând din regiunea supraclaviculară și acoperind regiunea toracică și abdomenul superior, inclusiv ficatul, vizând atât tumora primară, cât și leziunile supraclaviculare, toracice și metastatice hepatice. . Obiectivul HT a fost dublu: (1) obținerea unei temperaturi a țesutului tumoral mai mare de 43 ° C la locul tumorii, deoarece această temperatură este raportată a fi citotoxică,și (2) pentru a crește circulația sângelui în regiunea tumorală, care, la rândul său, este de așteptat să îmbunătățească administrarea de medicamente chimioterapice. Dispozitivul a utilizat estimări indirecte ale temperaturii pe baza energiei aplicate: estimarea indirectă a căldurii pentru sesiunile HT locale ale acestui pacient a variat între 44,1 ° C și 45,6 ° C.

Pentru fiecare sesiune de 60 de minute HBOT, a fost utilizată o cameră de oxigen hiperbară Quamvis 320® (OxyHealth, Santa Fe Springs, CA, SUA). Aceasta este o cameră cu pereți moi, cu un diametru de 32 inci atunci când este umflată. Camera a fost presurizat cu ajutorul unui compresor de aer curat , care filtreaza aerul la 0.01 pm și 10 L / min O 2 concentrator pentru a produce o presiune de 1,5 atmosfere absolute.

Protocolul de tratament al pacientului care conține MSCT, KD, HT și HBOT a fost început împreună cu antibiotice perfuzabile pe 7 noiembrie 2018. Pe 9 noiembrie, a fost internată cu afecțiuni respiratorii. Pe 10 noiembrie, în urma înrăutățirii funcției sale respiratorii, dovadă a nivelurilor scăzute de saturație a oxigenului din sânge de 50% – 60%, a fost intubată pentru un sprijin medical eficient și transferată la unitatea de terapie intensivă. La internarea în unitatea de terapie intensivă, cultura ei de tampon rectal a fost pozitivă pentru Enterococcusul rezistent la vancomicină. În urma protocolului de spital de rutină, ea a fost mutată în izolare în unitatea de terapie intensivă, iar tratamentul ei a fost ajustat în consecință. Ea a primit suport ventilator mecanic timp de cinci zile, împreună cu îngrijire de susținere perfuzională și antibioterapie. Ea a fost extubată pe 15 noiembrie și transferată de la secția de terapie intensivă la secția de medicină internă, unde îngrijirea perfuzabilă și terapia cu antibiotice au fost continuate timp de încă cinci zile. Pacientul a fost externat din îngrijirea spitalului internat pe 19 noiembrie cu semne vitale stabile și o saturație de oxigen de 98% la aerul din cameră. Tratamentul ei a fost reluat ca ambulator la clinica noastră în aceeași zi. După finalizarea celui de-al patrulea ciclu de tratament, o scanare PET-CT a răspunsului la tratament a fost efectuată pe 16 ianuarie 2019.Scanarea PET-CT a dezvăluit următoarele constatări: nicio absorbție patologică de FDG la nivelul capului și gâtului; Absorbția FDG la ambele zone supraclaviculare în limite fiziologice; LAP hipermetabolică de 14 mm (valoare standardizată a absorbției (SUV): 4 – 5) la axila stângă și fără leziune de masă cu absorbție FDG în zonele parenchimatoase ale sânului drept și stâng. Scanarea toracelui, în comparație cu scanarea sa anterioară, a dezvăluit mai puțini noduli și mai mici, fără absorbția FDG. S-a observat lichid pleural liber care acoperă 3 cm în dreapta și 2,5 cm în stânga. În regiunile mediastinale și ilare, nu au fost evidente ganglioni limfatici cu absorbție patologică de FDG. Nodulii identificați anterior în parenchimul hepatic au fost din nou evidenți în scanarea abdominală, cu o reducere semnificativă a activității metabolice și a dimensiunii, cu cel mai mare nodul măsurând 3,2 cm la segmentul 8 (SUV: 3-4).Modificări sclerotice fără absorbție FDG au fost observate în scanarea sistemului osos. Pe scurt, scanarea a documentat un răspuns la tratament la toate site-urile. Absorbția FDG de densitate redusă la nodulii din ficat și un LAP axilar stâng au indicat un răspuns parțial la aceste locuri cu un răspuns complet la tratament la toate celelalte leziuni (Figura5 , Video 2 ).

Whole-body- (18F) -FDG-PET-CT-scan-done-done-after-four-cycles-of-MSCT, -KD, -HT, -and-HBOT-treatment- (16 ianuarie -2019) - prezentarea-unui-răspuns-parțial-la-tratamentul-leziunilor-hepatice-metastatice-și-LAP-axilare-stânga-și-răspuns-complet-la-tratament-la-toate-celelalte-leziuni
Figura 5: Scanarea întregului corp (18F) -FDG-PET-CT efectuată după patru cicluri de tratament MSCT, KD, HT și HBOT (16 ianuarie 2019) care arată un răspuns parțial la tratamentul leziunilor hepatice metastatice și LAP axilar stâng și răspuns complet la tratament la toate celelalte leziuni

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizată; HBOT: oxigenoterapie hiperbară; HT: hipertermie; KD: dietă ketogenică; MSCT: chimioterapie susținută metabolichttps://www.youtube.com/embed/IpgC0hmoOSk?rel=0&showinfo=0

Video 2: video de fuziune coronară a întregului corp (18F) -FDG-PET-CT scanat după patru cicluri de tratament MSCT, KD, HT și HBOT pe 16 ianuarie 2019

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizată; HBOT: oxigenoterapie hiperbară; HT: hipertermie; KD: dietă ketogenică; MSCT: chimioterapie susținută metabolic

În urma scanării PET-CT din 16 ianuarie 2019, pacientul a continuat cu același protocol de tratament pentru încă cinci cicluri de tratament. O scanare PET-CT de urmărire și un RMN de contrast al creierului au fost efectuate pe 25 aprilie 2019, pentru evaluarea răspunsului la tratament. Comparativ cu scanarea din ianuarie, scanarea din aprilie a dezvăluit că mai mulți noduli din ficat nu mai prezintă absorbție malignă de FDG. În mod similar, activitatea hipermetabolică observată anterior în LAP axilar stâng nu mai era evidentă. Scanarea RMN a creierului din aprilie a arătat un răspuns complet la tratament, fără dovezi ale unei leziuni maligne de 8 mm documentate anterior în RMN de pretratament din noiembrie 2018. În rezumat, rapoartele de scanare din aprilie au indicat un răspuns complet la tratament pentru toate leziunile fără dovezi de boală activă (Fig6 – 9 , Video 3 ).

Imagine-cu-rezonanță-magnetică-creier-axială-ponderată-T1 cu contrast-pe-25 aprilie-2019
Figura 6: Imagine de rezonanță magnetică a creierului axial ponderată T1 cu contrast pe 25 aprilie 2019
T1-imagine-cu-rezonanță-magnetică-coronariană-creier-ponderată-cu-contrast-pe-25 aprilie-2019
Figura 7: Imagine de rezonanță magnetică a creierului coronar ponderat T1 cu contrast pe 25 aprilie 2019
Coronal-FLAIR-imagine-rezonanță-magnetică-cerebrală-pe-25 aprilie-2019-cu-aceleași-secvențe-ca-ale-creierului-RMN-efectuate-pe-5 noiembrie, - 2018-dezvăluie-o-leziune-de-dimensiune-aproximativ-8-mm-cu-îmbunătățire-contrast-periferică-în-corelație-cu-o-leziune-metastatică-care-nu-a-mai-fost-la-stânga- occipital-corn-zona-posterioară
Figura 8: Imaginea de rezonanță magnetică cerebrală FLAIR coronariană la 25 aprilie 2019 cu aceleași secvențe ca și cea a RMN creierului efectuată la 5 noiembrie 2018 relevă o leziune de aproximativ 8 mm cu îmbunătățirea contrastului periferic în corelație cu o leziune metastatică care nu mai era în zona posterioară a cornului occipital stâng

FLAIR: recuperare inversiune atenuată de fluid

Whole-body- (18F) -FDG-PET-CT-scan-done-made-on-April-25, -2019-after-nine-cycles-of-MSCT, -KD, -HT, -and-HBOT-treatment- care arată-absorbția-FDG-patologică, -indicativ-a-unui-răspuns-complet
Figura 9: Scanarea întregului corp (18F) -FDG-PET-CT efectuată la 25 aprilie 2019 după nouă cicluri de tratament MSCT, KD, HT și HBOT care nu prezintă absorbție patologică FDG, indicativ al unui răspuns complet

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizată; HBOT: oxigenoterapie hiperbară; HT: hipertermie; KD: dietă ketogenică; MSCT: chimioterapie susținută metabolichttps://www.youtube.com/embed/fW3_PhFsdFE?rel=0&showinfo=0

Video 3: Video de fuziune coronară a întregului corp (18F) -FDG-PET-CT scanat efectuat la 25 aprilie 2019 după nouă cicluri de tratament MSCT, KD, HT și HBOT

(18F) -FDG-PET / CT: tomografie cu emisie de pozitroni 18F-fluorodeoxiglucoză / tomografie computerizată; HBOT: oxigenoterapie hiperbară; HT: hipertermie; KD: dietă ketogenică; MSCT: chimioterapie susținută metabolic

După tratament și înainte de a se întoarce acasă în Ohio, pacientul a fost sfătuit să continue KD, împreună cu medicamentele prescrise anterior (metformină, doxiciclină, meloxicam, capecitabină, rivaroxaban) și suplimente alimentare (ciuperci medicinale, curcumină, quercetină, acid alfa-lipoic, seleniu, ciulin de lapte, resveratrol) ca terapie de întreținere de urmărire. Până în prezent (doi ani), ea a continuat cu protocolul de întreținere recomandat în Ohio. Scanări de urmărire de rutină (PET / CT și RMN) și teste de laborator au fost efectuate și evaluate de un oncolog medical local cu unele lacune din cauza limitărilor impuse de COVID-19. Cea mai recentă scanare PET / CT și testele de laborator au fost efectuate în martie 2021 și au indicat stabilitate fără dovezi de boală recurentă. Calitatea vieții pacientului s-a îmbunătățit,și a reușit să reia munca semnificativă cu normă întreagă începând cu 1 mai 2019.

Discuţie

Aici, raportăm cazul unei femei în vârstă de 47 de ani, din Ohio, SUA, cu cancer de sân în stadiul IV (T4N3M1) de gradul 3, ER +, PR + și HER2 – care a avut metastaze la creier, plămâni, mediastin, ficat , abdomen și oase, care nu a fost eligibil pentru tratamentul convențional standard din cauza bolii avansate, a stării de performanță slabe și a speranței de viață mai mici de o lună. A fost admisă la Centrul de Oncologie ChemoTermia, Istanbul, Turcia, unde a primit MSCT, KD, HT și HBOT, împreună cu medicamente de susținere și suplimente alimentare, rezultând un răspuns complet și durabil la tratament, care durează doi ani în prezent. Descoperirile noastre susțin potențialul beneficiu al integrării unei combinații de modalități care vizează multiple vulnerabilități ale celulelor tumorale cu medicamente chimioterapeutice standard administrate folosind protocolul nostru non-standard MSCT.Am emis ipoteza că eficacitatea și tolerabilitatea medicamentelor chimioterapeutice standard ar fi îmbunătățite atunci când sunt administrate în timpul postului și cu terapie potențată cu insulină, combinate cu alte terapii cu toxicitate scăzută care vizează vulnerabilitățile metabolice ale celulelor canceroase. Având ca obiectiv regresia bolii, acest pacient a reușit să obțină un răspuns complet și durabil la tratamentul administrat. În plus, calitatea vieții pacientului a fost îmbunătățită după fiecare ciclu de tratament, iar starea ei de performanță a fost ECOG 0-1 la finalizarea tratamentului în Istanbul.Având ca obiectiv regresia bolii, acest pacient a reușit să obțină un răspuns complet și durabil la tratamentul administrat. În plus, calitatea vieții pacientului a fost îmbunătățită după fiecare ciclu de tratament, iar starea ei de performanță a fost ECOG 0-1 la finalizarea tratamentului în Istanbul.Având ca obiectiv regresia bolii, acest pacient a reușit să obțină un răspuns complet și durabil la tratamentul administrat. În plus, calitatea vieții pacientului a fost îmbunătățită după fiecare ciclu de tratament, iar starea ei de performanță a fost ECOG 0-1 la finalizarea tratamentului în Istanbul.

Studiile anterioare cu regimuri MSCT care au raportat, de asemenea, constatări încurajatoare la pacienții cu diferite tipuri de tumori maligne includ cinci serii de cazuri retrospective [6, 9-12]  și două rapoarte de caz [7-8] . Un studiu recent a evaluat eficacitatea și tolerabilitatea tratamentului săptămânal combinat cu carboplatină / paclitaxel administrat într-o manieră susținută metabolic la pacienții cu carcinom pulmonar metastatic cu celule mici (NSCLC), raportând OS mediu de 42,9 luni comparativ cu timpii de supraviețuire cu tratament convențional standard care variază de la 6,3 la 11,3 luni [9]. Un alt studiu recent alcătuit din pacienți cu cancer pancreatic metastatic care a examinat eficacitatea unui protocol pe bază de gemcitabină și / sau FOLFIRINOX administrat într-un protocol susținut metabolic a raportat o supraviețuire mediană încurajatoare de 15,8 luni comparativ cu prognosticul mai slab tipic pentru acest cancer [10] . În mod similar, un studiu care a evaluat rezultatele unui protocol de chimioterapie combinată pe bază de taxan, platină și fluoropirimidină aplicat într-o manieră susținută metabolic la pacienții cu cancer gastric avansat a raportat rezultate promițătoare cu un timp mediu de supraviețuire de 39,5 luni comparativ cu timpii de supraviețuire variind de la 9,2 la 14,6 luni în tratamentul convențional standard [11]. La un pacient în vârstă de 81 de ani cu cancer rectal avansat local, regimul FOLFOX-6 a fost administrat folosind abordarea MSCT și s-a dovedit a fi tolerabil și eficient, deoarece a oferit răspunsuri clinice și patologice complete [7] . Într-un alt caz, o femeie de 29 de ani cu cancer de sân triplu negativ în stadiul IV (T4N3M1) a obținut un răspuns clinic, radiologic și patologic complet utilizând un regim MSCT care combina docetaxel, doxorubicină și ciclofosfamidă [8] .

În această abordare susținută metabolic, mai multe mecanisme pot acționa pentru a îmbunătăți eficacitatea chimioterapiei. Postul de 14 ore înainte de chimioterapie, hipoglicemia ușoară indusă de insulină și insulina în sine ar fi putut fi esențiale pentru rezultatele observate. Postul scade nivelul glucozei din sânge și sensibilizează celulele canceroase la tratament prin creșterea stresului metabolic în celulele canceroase, protejând în același timp celulele normale de chimiotoxicitate, îmbunătățind astfel toleranța la tratament [19-20]. În plus, hipoglicemia ușoară indusă de insulină vizează dependența de glucoză și metabolismul energetic neregulat în celulele canceroase, reducând astfel și mai mult disponibilitatea glucozei. Această strategie terapeutică poate provoca stres metabolic acut în celulele canceroase, făcându-le astfel mai vulnerabile la citotoxicitatea agenților chimioterapeutici [3-4]. Insulina poate facilita, de asemenea, acțiunea agenților chimioterapeutici la nivel celular prin creșterea fluidității și permeabilității membranei. Formarea ulterioară a complexelor medicamento-insulină internalizate de endocitoza mediată de receptor poate facilita o creștere a penetrării medicamentului, sporind astfel efectele citotoxice ale agenților chimioterapeutici. Un număr de insulină și receptorii factorului de creștere asemănător insulinei (IGF) sunt reglementați în sus pe membranele celulelor tumorale în comparație cu celulele sănătoase de origine tisulară similară. Celulele canceroase ale sânului, de exemplu, au aproximativ șapte ori mai mulți receptori pentru insulină și de 10 ori mai mulți receptori IGF decât țesutul mamar normal. Răspunsul acestor receptori la insulină poate extinde faza S a ciclului celular,făcând astfel celulele canceroase mai susceptibile la efectele citotoxice ale agenților chimioterapeutici pentru perioade mai lungi de timp. În plus, concentrația mai mică de insulină și receptorii IGF pe celulele normale le poate scuti în mod eficient de efectele citotoxice ale agenților chimioterapeutici, ceea ce poate duce la o siguranță și tolerabilitate sporite.

O altă componentă a protocolului nostru de tratament combinatoriu a fost KD, care exploatează, de asemenea, dereglarea metabolică a celulelor tumorale, exercitându-și acțiunea prin scăderea nivelului de glucoză circulant în timp ce crește nivelul corpului cetonic. Deși KD a fost folosit de zeci de ani ca tratament pentru epilepsia pediatrică intratabilă, potențialul său ca modalitate terapeutică care vizează metabolismul energetic al celulelor canceroase a fost explorat abia recent. Până în prezent, mai multe studii preclinice și rapoarte de caz au oferit sprijin pentru utilizarea sa potențială adjuvantă în tratamentul cancerului [8-12, 15]. În special, pacientul descris în acest studiu nu a primit radioterapie pentru metastaze cerebrale. Aplicarea standard a medicamentelor chimioterapeutice utilizate în acest protocol nu era de așteptat să producă un răspuns din cauza penetrării limitate a medicamentelor peste bariera hematoencefalică. În schimb, rezolvarea leziunii cerebrale ar putea fi atribuită terapiei metabolice ketogenice, despre care s-a raportat că regresează leziunile cerebrale în multe modele de gliom preclinic și la pacienții cu glioblastom multiform.

HT și HBOT vizează, de asemenea, metabolismul energetic nereglat în celulele canceroase. HT exploatează sensibilitatea la căldură a celulelor canceroase și este citotoxică la temperaturi> 43 ° C. Pe lângă faptul că are un efect citotoxic direct, HT contribuie la eficacitatea terapeutică prin facilitarea absorbției chimioterapeutice a medicamentelor, inhibarea reparării acidului dezoxiribonucleic (ADN) în celulele canceroase și creșterea producției de radicali de oxigen [16] . La acest pacient, hipoxia tumorală, despre care se știe că contribuie la agresivitatea tumorii și la rezistența la chimioterapie și radioterapie, a fost vizată cu HBOT. Atât HT cât și HBOT vizează, de asemenea, dependența celulelor tumorale de glicoliză, care este asociată cu reglarea în sus a activității antioxidante responsabile de rezistența crescută a tumorii la chimioterapia prooxidantă și radioterapia [13]. În consecință, HT și HBOT cresc selectiv stresul oxidativ în celulele tumorale, lucrând astfel sinergic cu chimioterapia și radioterapia prooxidantă. Corpurile cetonice protejează celulele normale de stresul oxidativ și oferă un substrat pentru producerea de energie în majoritatea celulelor normale. Utilizarea sinergică concomitentă a acestor terapii (post, KD, HT, HBOT) și potențialul acestora de a crește eficacitatea terapiilor convenționale au fost deja raportate în mai multe studii anterioare asupra diferitelor afecțiuni maligne [4, 8-12, 16, 18] . Într-un studiu recent realizat de Ohguri și colab., Pacienții cu NSCLC cu metastaze pulmonare multiple au primit un regim de chimioterapie carboplatină / paclitaxel, alături de HT și HBOT; rezultatele raportate au sugerat că această combinație a oferit un protocol fezabil și potențial eficient[16] . În plus, rezultate promițătoare, inclusiv rate de supraviețuire remarcabil îmbunătățite, au fost raportate în patru serii de cazuri recente care au evaluat eficacitatea administrării concomitente a acestor trei modalități împreună cu MSCT la pacienții cu stadiu IV pulmonar, stadiu IV pancreatic, stadiu III-IV gastric, și cancerul rectal în stadiul II-IV [9-12] .

Pacientul din acest raport de caz a prezentat stadiul IV (T4N3M1) grad 3, ER +, PR +, HER2- cancer de sân care a avut metastaze la creier, plămâni, mediastin, ficat, abdomen și oase. Strategia terapeutică de combinare a MSCT, KD, HT și HBOT administrată pe o perioadă de șase luni a dat un răspuns complet care a fost susținut de doi ani cu un tratament de întreținere constând din KD, suplimente alimentare și medicamente reutilizate.

Concluzii

În mod clar, există multe obstacole și eșecuri în abordarea clinică convențională actuală pentru tratarea bolii în stadiu final extrem de metastatic. Constatarile acestui studiu, impreuna cu tot mai multe dovezi preclinice si clinice, demonstreaza ca este fezabila implementarea unor protocoale de tratament individualizate mai eficiente si mai putin toxice. În acest scop, sunt necesare mai multe studii pentru a explora modalitățile non-medicamentoase și terapiile combinate care vizează multiple vulnerabilități metabolice și celulare din celulele canceroase. Acest raport de caz reprezintă schimbări remarcabile în modul în care privim vulnerabilitățile cancerului și un salt semnificativ înainte de modelul convențional actual.


Referințe

  1. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018: estimări GLOBOCAN ale incidenței și mortalității la nivel mondial pentru 36 de cancere din 185 de țări . CA Cancer J Clin. 2018, 68: 394-42. 10.3322 / caac.21492
  2. Caswell-Jin JL, Plevritis SK, Tian L și colab.: Schimbarea supraviețuirii în cancerul de sân metastatic cu progresele tratamentului: meta-analiză și revizuire sistematică . JNCI Cancer Spectr. 2018, 2: pky062. 10.1093 / jncics / pky062
  3. Warburg O: Despre originea celulelor canceroase . Ştiinţă. 1956, 123: 309-14. 10.1126 / science.123.3191.309
  4. Seyfried TN, Shelton LM: Cancerul ca boală metabolică . Nutr Metab (Lond). 2010, 7: 7. 10.1186 / 1743-7075-7-7
  5. Seyfried TN, Mukherjee P, Iyikesici MS, Slocum A, Kalamian M, Spinosa JP, Chinopoulos C: Considerarea terapiei metabolice ketogenice ca o abordare complementară sau alternativă pentru gestionarea cancerului de sân . Front Nutr. 2020, 7:21. 10.3389 / fnut.2020.00021
  6. Iyikesici MS, Slocum A, Turkmen E și colab.: Rezultatele pe termen lung ale tratamentului adenocarcinomului pancreatic ductal nerezecabil (stadiul III-IV) utilizând chimioterapie susținută metabolic (MSCT): un studiu retrospectiv . J Pancreas. 2016, 17: 36-41.
  7. Iyikesici M, Slocum A, Turkmen E, Akdemir O, Slocum A, Berkarda F: Răspuns complet al cancerului rectal avansat local (stadiul III) la chimioterapia cu hipertermie susținută metabolic . Int J Cancer Res Mol Mech. 2016, 2: 1-4. 10.16966 / 2381-3318.120
  8. İyikesici MS, Slocum AK, Slocum A, Berkarda FB, Kalamian M, Seyfried TN: Eficacitatea chimioterapiei susținute metabolic combinată cu dieta ketogenică, hipertermie și oxigenoterapie hiperbară pentru cancerul de sân triplu negativ în stadiul IV . Cureus. 2017, 9: e1445. 10.7759 / cureus.1445
  9. Iyikesici MS: Studiu de fezabilitate a chimioterapiei susținute metabolic cu carboplatină / paclitaxel săptămânal combinată cu dietă ketogenică, hipertermie și oxigenoterapie hiperbară în cancerul pulmonar cu celule mici . Int J hipertermie. 2019, 36: 446-55. 10.1080 / 02656736.2019.1589584
  10. Iyikesici MS: Rezultate de supraviețuire pe termen lung ale chimioterapiei susținute metabolic cu regim pe bază de gemcitabină sau regim FOLFIRINOX combinat cu dietă ketogenică, hipertermie și terapie cu oxigen hiperbar în cancerul pancreatic metastatic . Complement Med Res. 2020, 27: 31-39. 10.1159 / 000502135
  11. Iyikesici MS: Rezultatele de supraviețuire ale chimioterapiei susținute metabolic, combinate cu dieta ketogenică, hipertermie și oxigenoterapie hiperbară în cancerul gastric avansat . Niger J Clin Pract. 2020, 23: 734-40.
  12. İyikesici MS: Rezultate preliminare ale chimioterapiei susținute metabolic combinate cu dieta ketogenică, hipertermie și oxigenoterapie hiperbară în cancerul rectal în stadiul II-IV . Arch Clin Exp Med. 2020, 5: 16-20. 10.25000 / acem.650341
  13. Seyfried TN, Yu G, Maroon JC, D’Agostino DP: Press-pulse: o strategie terapeutică nouă pentru gestionarea metabolică a cancerului . Nutr Metab (Lond). 2017, 14:19. 10.1186 / s12986-017-0178-2
  14. Seyfried TN, Arismendi-Morillo G, Mukherjee P, Chinopoulos C: Despre originea sintezei ATP în cancer . iScience. 2020, 23: 101761. 10.1016 / j.isci.2020.101761
  15. Seyfried TN, Flores R, Poff AM, D’Agostino DP, Mukherjee P: Terapia metabolică: o nouă paradigmă pentru gestionarea cancerului malign al creierului . Cancer Lett. 2015, 356: 289-300. 10.1016 / j.canlet.2014.07.015
  16. Ohguri T, Imada H, Narisada H, și colab .: chimioterapie sistemica folosind paclitaxel si carboplatina plus hipertermia regională și tratamentul hiperbarica de oxigen pentru cancerul pulmonar cu celule non-mici , cu multiple metastaze pulmonare: rezultate preliminare . Int J hipertermie. 2009, 25: 160-67. 10.1080 / 02656730802610357
  17. Vaupel P, Mayer A, Höckel M: Hipoxie tumorală și progresie malignă . Metode Enzymol. 2004, 381: 335-54. 10.1016 / S0076-6879 (04) 81023-1
  18. Bennett M, Feldmeier J, Smee R, Milross C: oxigenare hiperbară pentru sensibilizarea tumorii la radioterapie: o revizuire sistematică a studiilor controlate randomizate . Cancer Treat Rev. 2008, 34: 577-91. 10.1016 / j.ctrv.2008.01.001
  19. Nencioni A, Caffa I, Cortellino S, Longo VD: Post și cancer: mecanisme moleculare și aplicații clinice . Nat Rev Cancer. 2018, 18: 707-19. 10.1038 / s41568-018-0061-0
  20. de Groot S, Lugtenberg RT, Cohen D, și colab.: dieta mimică a postului ca adjuvant la chimioterapia neoadjuvantă pentru cancerul de sân în studiul DIRECT de fază 2 randomizat multicentric . Nat Commun. 2020, 11: 3083. 10.1038 / s41467-020-16138-3

https://www.cureus.com/articles/55013-metabolically-supported-chemotherapy-for-managing-end-stage-breast-cancer-a-complete-and-durable-response

Terapie metabolică ketogenică, fără chimio sau radiații, pentru gestionarea pe termen lung a glioblastomului mutant IDH1 : un raport de caz de urmărire de 80 de luni

Thomas N. Seyfried * , Aditya G. Shivane 2 , Miriam Kalamian 3 , Joseph C. Maroon 4 , Purna Mukherjee 1 și Giulio Zuccoli *

  • 1 Departamentul de biologie, Boston College, Chestnut Hill, MA, Statele Unite
  • 2 Departamentul de patologie celulară și anatomică, Spitalul Universitar Plymouth National Health Service (NHS) Trust, Plymouth, Regatul Unit
  • 3 Dietary Therapies LLC, Hamilton, MT, Statele Unite
  • 4 Departamentul de Neurochirurgie, Centrul Medical, Universitatea din Pittsburgh, Pittsburgh, PA, Statele Unite
  • 5 Departamentul de Radiologie, Spitalul pentru Copii St. Christopher, Școala de Medicină a Universității Drexel, Philadelphia, PA, Statele Unite

Context: Tratamentul cu succes al glioblastomului (GBM) rămâne inutil, în ciuda deceniilor de cercetări intense. GBM este similar cu majoritatea celorlalte tipuri de cancer maligne, care necesită glucoză și glutamină pentru creștere, indiferent de eterogenitatea histologică sau genetică. Terapia metabolică ketogenică (KMT) este o intervenție nutrițională netoxică pentru gestionarea cancerului. Raportăm cazul unui bărbat în vârstă de 32 de ani care a prezentat în 2014 crize convulsive și o tumoră de lob frontal drept la RMN. Celulele tumorale au fost imunoreactive cu anticorpi împotriva mutației IDH1 (R132H), P53 (neuniform), indicele MIB-1 (4-6%) și expresia proteinei ATRX absentă. Analiza ADN nu a arătat nicio dovadă a metilării promotorului genei MGMT. Prezența proliferării microvasculare proeminente și a zonelor de necroză au fost în concordanță cu un IDH-glioblastom mutant (clasa 4 a OMS).

Metode: Pacientul a refuzat standardele de îngrijire (SOC) și medicamentele cu steroizi după diagnosticul inițial, dar a fost suficient de informat și suficient de auto-motivat pentru a consuma o dietă ketogenică cu conținut scăzut de carbohidrați constând în principal din grăsimi saturate, legume minime și o varietate de carne. Pacientul a folosit calculatorul indicelui de gluconă cetonă pentru a-și menține indicele de gluconă cetonă (GKI) aproape de 2,0 fără pierderea în greutate corporală.

Rezultate: Tumora a continuat să crească lent, fără edem vasogenic așteptat, până în 2017, când pacientul a optat pentru debulking chirurgical. Zona de amplificare, centrată în girusul frontal inferior, a fost excizată chirurgical. Specimenul de patologie a confirmat IDH1- mutant GBM. În urma intervenției chirurgicale, pacientul a continuat cu o dietă ketogenică autoadministrată pentru a menține valori scăzute ale GKI, indicative ale cetozei terapeutice. La momentul prezentării acestui raport (mai 2021), pacientul rămâne în viață cu o bună calitate a vieții, cu excepția convulsiilor ocazionale. RMN continuă să arate progresia lentă a intervalului tumorii.

Concluzie: Acesta este primul raport despre IDH1 confirmat -mutant GBM tratat cu KMT și debulking chirurgical fără chimioterapie sau radioterapie. Supraviețuirea pe termen lung a acestui pacient, acum la 80 de luni, s-ar putea datora parțial unei sinergii metabolice terapeutice între KMT și mutația IDH1 care vizează simultan căile de glicoliză și glutaminoliză care sunt esențiale pentru creșterea GBM. Sunt necesare studii suplimentare pentru a determina dacă această strategie terapeutică non-toxică ar putea fi eficientă în furnizarea unui management pe termen lung pentru alți pacienți cu GBM cu sau fără mutații IDH .

Introducere

Glioblastomul (GBM) are printre cele mai ridicate rate de mortalitate pentru tumorile cerebrale primare și rămâne slab gestionabil. În ciuda hype-ului din jurul terapiilor recente ( 1 – 5 ), speranța de viață mediană după diagnostic rămâne slabă pentru majoritatea pacienților cu GBM ( 6 – 9 ). Supraviețuirea este puțin mai bună, cu toate acestea, pentru pacientii GBM mai tineri , comparativ cu pacientii GBM mai in varsta si pentru pacientii cu tumori GBM care exprimă IDH1 mutații ( 10 – 14 ). Majoritatea pacienților cu GBM beneficiază de standardul actual de îngrijire (SOC) care implică dezvelirea chirurgicală, radioterapie și chimioterapie cu temozolomidă (TMZ) ( 15 , 16). Mulți pacienți cu GBM pot primi, de asemenea, medicamente cu corticosteroizi (dexametazonă) și bevacizumab pentru gestionarea edemului și, respectiv, a angiogenezei. Utilizarea steroizilor este acum în curs de reevaluare serioasă, deoarece steroizii pot crește glicemia, care este asociată cu o creștere tumorală mai rapidă și supraviețuirea generală scurtată ( 17 , 18 ). Actualul SOC pentru GBM a îmbunătățit doar marginal supraviețuirea generală în comparație cu „cea mai bună îngrijire de susținere”, care este ambiguă în cel mai bun caz ( 19 , 20 ). La fel de dureros și de eșecul managementului este dovada că incidența GBM este în creștere în Regatul Unit ( 21 ).

Recent am revizuit studii care descriu efectele adverse care pot fi asociate cu SOC-ul actual pentru managementul GBM ( 17 ). GBM, la fel ca majoritatea cancerelor maligne, este determinat de fermentația glucozei și glutaminei prin căile glicolizei și respectiv glutaminolizei ( 22 – 27 ). Dependența de fermentarea glucozei și glutaminei provine din fosforilarea oxidativă ineficientă (OxPhos) care este legată de anomalii ale numărului, structurii și funcției mitocondriilor din țesutul GBM ( 17 , 26 – 33 ). Dezvăluirea chirurgicală urmată de radioterapie crește în mod accidental disponibilitatea glucozei și glutaminei în microambientul tumorii ( 17 ,34 , 35 ). Chimioterapia TMZ poate deteriora și mai mult mitocondriile, în același timp, crescând inflamația sistemică și mutațiile factorilor tumorali ( 36 , 37 ). Bevacizumab este chiar mai probabil ca TMZ să provoace disfuncții mitocondriale în tumorile cerebrale umane și este remarcabil prin capacitatea sa de a facilita invazia celulelor tumorale distale prin parenchimul neural și rețeaua perivasculară ( 38 – 40 ). Utilizarea dexametazonei poate accelera și mai mult creșterea GBM prin creșterea nivelului de glucoză din sânge și a metabolismului glutaminei ( 25 , 41 – 44). În lumina acestor informații, supraviețuirea slabă progresivă și generală slabă experimentată de majoritatea pacienților cu GBM care primesc SOC nu ar trebui să fie surprinzătoare.

Winter și colegii săi au inventat termenul „Terapie metabolică ketogenică (KMT)” pentru a descrie o strategie nutrițională anti-neoplazică, utilizând diete ketogenice sau glicemice scăzute, pentru gestionarea glioamelor maligne ( 45 ). KMT câștigă recunoaștere ca strategie terapeutică complementară pentru gestionarea unei game largi de cancere, pe lângă glioamele maligne ( 17 , 19 , 45 – 60 ). Dietele ketogenice cu conținut scăzut de carbohidrați, cu conținut ridicat de grăsimi (KD) reduc glucoza necesară pentru a conduce fermentația aerobă (efect Warburg), ridicând în același timp corpurile cetonice, care nu pot fi metabolizate eficient pentru energie în celulele tumorale din cauza defectelor în OxPhos mitocondrial ( 17 , 26 , 4556 , 61 – 67 ). Mai mult, metabolismul cetonic al organismului îmbunătățește hidroliza ΔG’ATP în celulele normale de la -56kJ / mol la -59kJ / mol, oferind astfel celulelor normale un avantaj energetic față de celulele tumorale ( 27 , 68 , 69 ). Restricția calorică și KD restricționată sunt, de asemenea, anti-angiogenice, antiinflamatorii, antiinvazive și pot ucide celulele tumorale direct prin mecanisme pro-apoptotice ( 17 , 62 , 70 – 73 ). Dovezile arată, de asemenea, că cetoza terapeutică poate acționa sinergic cu mai multe medicamente și proceduri pentru a îmbunătăți gestionarea cancerului, îmbunătățind astfel atât progresia liberă, cât și supraviețuirea generală (26 , 74 – 76 ). Prin urmare, KMT vizează factorii multipli ai creșterii rapide a GBM, îmbunătățind în același timp eficiența metabolică a celulelor normale ale creierului ( 56 ).

Raport de caz

Un bărbat în vârstă de 26 de ani din South Devon a prezentat pe 16 august 2014 la University Hospitals Plymouth NHS Trust, PL6 8DH, Marea Britanie, cu două episoade de amorțeală facială pe partea stângă și convulsii bilaterale tonico-clonice provenite din lobul temporal drept. Nu au existat antecedente de malignitate sau tulburări cronice. Tensiunea arterială a pacientului se încadra în limite normale (110/70). Investigațiile de laborator au evidențiat o chimie sanguină extrem de remarcabilă, cu funcții hepatice și renale în limite normale. Glucoza din sânge și proteina C-reactivă au fost în limite normale. Înainte de intervenția terapeutică, greutatea, înălțimea și indicele de masă corporală (IMC) ale pacientului erau de 63 kg, 180 centimetri și 19,4 kg / m 2, respectiv. RMN cerebral îmbunătățit prin contrast (22 august 2014) a arătat o leziune intraaxială, centrată în lobul frontal inferior drept. Leziunea, care a fost în principal non-intensificatoare și solidă, a dezvăluit prezența unui nodul excentric care îmbunătățește contrastul ( Figura 1 , Panoul 1 , D).FIGURA 1

Figura 1 . Imagini RMN ale tumorii cerebrale a pacientului. Panoul 1 . Imaginile FLAIR (Fluid Attenuated Inversion Recovery) arată IDH1-MBG mutant la diagnostic în august 2014 (A-D) și ~ 8 luni mai târziu, la ultima examinare RMN de urmărire (decembrie 2016) înainte de excizia chirurgicală a nodulului de intensificare (E-H). Leziunea descoperită în august 2018 este centrată în lobul frontal inferior drept (A, B, vârfuri de săgeți) și se lipeste de cortexul premotor (C, vârf de săgeată). Există un nodul îmbunătățitor în leziune, așa cum se vede în imaginea mărită post-contrast (D) (săgeată). Această leziune amplificatoare a măsurat 1,25 ml, care este calculată utilizând formula V = ABC / 2. Urmărirea RMN (E-H) demonstrează progresia la intervale a tumorii neamplificatoare (vârfuri de săgeți). S-a observat, de asemenea, creșterea intervalului de dimensiune a leziunii care mărește, măsurând 5,97 ml (H, săgeată). Panoul 2arată evoluția leziunii între excizia chirurgicală mai 2017 (A-C) și în cea mai recentă evaluare RMN, din martie 2020 (D-F). Imaginile ponderate T2 indică GBM rezidual (vârfuri de săgeată). (B) arată T2-hiperintens GBM care umple cavitatea chirurgicală. Leziunea din cortexul premotor este văzută clar în (C). Vă rugăm să rețineți că dezvăluirea chirurgicală a implicat doar tumora care îmbunătățește, în timp ce cea mai mare parte care nu îmbunătățește GBM nu a fost excizată de neurochirurg. Cel mai recent RMN cerebral (D-F) arată creșterea intervalului în dimensiunea GBM (vârfuri de săgeți), care rămâne circumscrisă regiunii frontale drepte fără a se infiltra în tracturile de substanță albă.

RMN îmbunătățit al creierului (22 august 2014) a arătat o anomalie a semnalului lobar T2 fără difuzie restricționată și cu îmbunătățirea inelului central centrat pe porțiunea de opercula a girusului frontal inferior. Schimbarea semnalului s-a extins și în circumvoluția precentrală ( Figura 1 , Panoul 1 , C). Impresia preliminară a fost un gliom de grad scăzut în transformare. Analiza histopatologică (16 septembrie 2014) a șapte miezuri crem și albe ale țesutului biopsiei cerebrale a relevat o infiltrație corticală difuză de o neoplasmă glială paucicelulară compusă din astrocite gemistocitare predominant fibrilare și ocazionale. Celulele tumorale au fost moderat pleomorfe, cu mitoză rară / rară. A existat micro-calcificare focală și proliferare microvasculară focală ( Figura 2A), dar nu a existat nicio necroză. Indicele de proliferare MIB-1 (Ki67) a fost de 4-6% ( Figura 2B ). Celulele tumorale au fost imune-reactive cu anticorpi împotriva mutantului IDH1 ( R132H ) și la expresia neuniformă a P53. Analiza ADN nu a arătat nicio dovadă a metilării promotorului genei MGMT. Prezența mitozelor rare, a proliferării microvasculare focale și a indicelui de proliferare MIB-1 a fost compatibilă cu un glioblastom mutant IDH (clasa 4 a OMS).FIGURA 2

Figura 2 . Analiza histopatologică a țesutului tumorii cerebrale excizate. (A) Tumoare astrocitică difuză (stea) cu proliferare microvasculară focală (săgeți) . Țesut preluat din biopsia din 2014, pata H&E 200x. (B) Imunohistochimie utilizând anticorp MIB-1 care prezintă un indice de proliferare de ~ 4-6%. Țesut preluat din biopsia din 2014, Immunostain 200x. (C) Secțiunea care prezintă necroza și palisarea celulelor tumorale astrocitice în jurul zonei necrotice (săgeți) . Țesut preluat din biopsia din 2017, pata H&E 200x. (D) Secțiunea care prezintă proliferarea vasculară glomeruloidă (săgeți) . Țesut prelevat din biopsia din 2017, colorare H&E 400x.

Datorită convingerilor culturale ale pacientului cu privire la terapiile toxice, el a refuzat SOC recomandat. În schimb, el a optat pentru terapia metabolică ketogenică (KMT) auto-administrată, care a fost inițiată la 2 săptămâni după diagnosticul histopatologic al GBM. Pacientul a fost motivat să se educe cu privire la implementarea corectă a dietei, înlocuind SOC recomandat cu KMT, în ciuda presiunii din partea furnizorilor săi de asistență medicală de a utiliza SOC. Compoziția energetică a dietei sale zilnice a constat în grăsimi (1.696 kcal), proteine ​​(264 kcal) și carbohidrați (48 kcal), cu adaos de ulei MCT (trigliceride cu lanț mediu). I s-a prescris levetiracetam (750 mg, 2x / zi) pentru tratamentul convulsiilor și ulei MCT (3 lingurițe zilnic cu alimente). El a respectat cu strictețe ghidurile de dietă ketogenică găsite pe site-ul Patricia Daly (https://patriciadaly.com/the-ketogenic-diet-for-cancer ) și a folosit contorul de precizie Xtra glucoză / cetonă (Abbott Labs) și calculatorul indicelui de glucoză / cetonă pentru a-i monitoriza glicemia (mmol) și β din sânge -valori de hidroxibutirat (β-OHB) (mmol) ( 77 ). Pacientului i-au trebuit 2 săptămâni pentru a intra în zona prevăzută de cetoză terapeutică, adică valori ale indicelui glucozei / cetonei (GKI) apropiate de 2,0 sau mai mici, după cum s-a descris anterior ( 77 ). Un al doilea RMN al tumorii sale efectuat pe 24 ianuarie 2015 nu a evidențiat o progresie vizibilă.

RMN-uri seriale preformate la 14 aprilie 2015; 17 iulie 2015; 16 noiembrie 2015; 20 februarie 2016; 9 iulie 2016; și 29 octombrie 2016 au dezvăluit dovezi ale progresiei tumorale a intervalului lent cu creștere a contrastului față de cea observată în RMN original din 2014. Dovezile RM ale progresiei bolii care îmbunătățesc contrastul au fost mai îngrijorătoare cu privire la urmărirea RMN din 15 decembrie 2016 ( Figura 1 , panoul 1 , H). Ca răspuns la aceste modificări observate, pacientul a optat pentru o craniotomie treaz în aprilie 2017. Excizia a fost lipsită de evenimente, rezultând o îndepărtare completă completă a componentei mixte de îmbunătățire a contrastului solid-necrotic al GBM. Cu toate acestea, cea mai mare parte hiperintensă T2 a GBM a rămas neatinsă ( Figura 1 , Panoul 2, A – C). Analiza histologică a țesutului tumoral a arătat o tumoare astrocitică invazivă difuză cu mitoză rară / rară, proliferare microvasculară proeminentă ( Figura 2C ) și zone de necroză ( Figura 2D ). Celulele tumorale au exprimat IDH1 mutant (R132H), P53 (neuniform) și au prezentat pierderea expresiei nucleare ATRX. Caracteristicile histologice generale au fost în concordanță cu diagnosticul de glioblastom mutant IDH1 (clasa 4 a OMS).

Pacientul a continuat cu o schemă strictă de dietă ketogenică după dezvelirea tumorii și și-a menținut valorile GKI la sau aproape de 2,0 și mai mici. Următoarele medicamente au fost luate timp de 1 săptămână numai după craniotomie și au inclus Epilim (200 mg), dexametazonă (2 mg), omeprazol (20 mg) și paracetamol (1 g) pentru tratamentul durerii post-chirurgicale. Activitatea convulsivă tonico-clonică, care a crescut după craniotomie, a scăzut treptat în timp. Diverse suplimente au fost adăugate în dietă, care includea vitamine, minerale, curcuma, resveratrol, omega-3 și boswellia serrata. Nu s-a mai văzut nicio creștere a tumorii pe RMN preformată la 17 august 2017. Deoarece pacientul credea că GBM-ul său era sub control, el și-a relaxat aderența la alimentele cu conținut scăzut de carbohidrați.Acest lucru a dus la o creștere modestă a greutății corporale (89 kg) și a ridicat valorile sale GKI la intervalul 5-10 indicativ pentru creșterea glicemiei și a nivelurilor reduse de cetonă.

Un RMN preformat pe 9 octombrie 2018 a arătat progresia intervalului leziunii. Pacientul și-a dat seama repede că regenerarea tumorii sale ar fi putut fi legată parțial de relaxarea rigorii sale alimentare. Împreună cu optimizarea și intensificarea regimului alimentar, pacientul a adoptat intervenții asupra stilului de viață, inclusiv antrenament fizic moderat, exerciții de respirație și gestionarea stresului fiziologic. Începând cu noiembrie 2018, pacientul a aderat la un program de două mese / zi, cu un regim alimentar riguros cu timp limitat (20 de ore pe zi de post). Dieta consta din ouă, slănină prăjită în ghee / unt (11:00 h) și friptură, cotlet de miel, pateuri de vită și ficat, toate prăjite în ghee / unt / untură (16:00 h). Pacientul nu a continuat cu ulei de MCT după ce a început dieta carnivore. Pacientul nu a ținut un jurnal alimentar specific.Când urma o dietă ketogenică cu calorii restrânse, începea prin a-și cântări mâncarea și a păstra sub 2.000 de calorii pe zi, dar a ajuns să învețe să judece consumul de alimente după cât de foame i-a mâncat până a fost săturat. Glucidele au fost strict eliminate din dieta pacientului. Pacientul a recunoscut că o dietă paleo-carnivoră bine formulată pe bază de animale ar oferi majoritatea micronutrienților biodisponibili (78 ). Acest program nutritiv de post carnivor a redat valorile GKI ale pacientului la 2,0 sau mai puțin. IMC-ul pacientului s-a normalizat la 22,2 (72 kg) în momentul prezentării acestui raport. În plus, pacientul a participat la un program de respirație care implică reținerea respirației, care a crescut media săptămânală de la 15 la 60 de secunde. și a scăzut ritmul cardiac mediu de odihnă dimineața de la 80 la 60 bpm. Pacientul a fost înțărcat de pe toate medicamentele, cu excepția Zebanex (acetat de eslicarbazepină, 1.200 mg) necesar pentru controlul convulsiilor, care se administrează o dată la 16:00. în fiecare zi. Valorile glicemiei și β-OHB ale pacientului sunt prezentate în Figura 3A pe o perioadă de aproape 5 ani, iar valorile sale GKI calculate în această perioadă sunt prezentate în Figura 3B . Numerele brute pentru aceste valori sunt prezentate înTabelele suplimentare .FIGURA 3

Figura 3 . Valorile glicemiei, cetonelor și GKI ale pacientului din 2014 până în 2019. (A) Valorile glicemiei și cetonei (β-OHB) au fost determinate folosind glucometrul Precision Xtra și cetona, așa cum este descris în text. (B) Valorile GKI au fost determinate din valorile individuale de glucoză și cetonă din A folosind calculatorul indicelui de gluconă cetonă, așa cum s-a descris anterior ( 77 ). Valorile individuale au fost combinate pe intervale de timp de 3 luni și sunt exprimate ca medii ± 95% intervale de încredere (IC). Numărul de citiri pentru fiecare punct de date din A și B a variat de la un maxim de n = 151 (iulie-septembrie, 2017), la un minim de n = 7 (aprilie-iunie 2018), și sunt date în tabelele suplimentare 1A –F aranjate pe an din 2014 până în 2019.

Alte șapte evaluări RMN, care se întind de la 28 decembrie 2017 până la 10 martie 2020, au arătat progresia lentă continuă a bolii, fără formarea de edem vasogenic vizibil. În momentul prezentării acestui raport (aprilie 2021), pacientul era activ cu o bună calitate a vieții, cu excepția crizelor tonico-clonice ocazionale și a niciunui semn de creștere a presiunii intracraniene. Pacientul a fost vorbitor la Conferința privind cancerul din copilărie și TYA din septembrie 2018 ( http://www.childhoodcancer2018.org.uk/programme.asp ; Copii cu cancer; Londra, Marea Britanie). El menține o pagină de Facebook care oferă actualizări privind starea sa de sănătate ( http://www.childhoodcancer2018.org.uk/speakers/pablo-kelly.asp ). Figura 4 prezintă o diagramă schematică care prezintă cursul clinic de timp al analizei RMN și al tratamentului dietetic.FIGURA 4

Figura 4 . Cronologia cursului clinic cu datele tratamentelor dietetice și RMN.

Discuţie

Deși supraviețuirea pe termen lung este rară la pacienții cu GBM, aproximativ 5-13% dintre pacienții cu GBM pot supraviețui> 5 ani cu SOC din motive care nu sunt clare ( 79 ). Acest studiu de caz descrie supraviețuirea pe termen lung și managementul terapeutic cu KMT la un bărbat de 32 de ani diagnosticat cu un IDH1 histopatologic și verificat radiografic-mutant GBM. Mai mulți factori ar putea contribui la supraviețuirea pe termen lung și continuă a acestui pacient (acum la 80 de luni). În primul rând, pacientul a refuzat SOC și medicamentele cu steroizi. Datorită preferinței sale pentru terapiile non-toxice și a potențialului recunoscut al KMT pentru gestionarea GBM, pacientul a optat pentru o boală auto-administrată auto cu diferite suplimente. Această strategie, în asociere cu dezvăluirea chirurgicală, ar fi putut contribui în parte la creșterea lentă și rezecția mai eficientă a GBM-ului său. Este bine documentat faptul că supraviețuirea este mai mare la pacientii GBM mai tineri (<50 ani) decât la pacienții cu GBM mai mari (> 50 ani), și că pacienții care au primit o rezecție mai completă a tumorii , în general , supraviețuiesc mai mult decât pacienții care au primit o rezecție subtotală ( 10 , 80 – 82). Rezecția neurochirurgicală totală sau subtotală, totuși, este obținută în general devreme după diagnostic pentru a obține o supraviețuire mai lungă. În schimb, acest pacient a optat pentru o strategie de ceas și așteptare din cauza refuzului său de SOC. În consecință, dezvelirea tumorii a fost efectuată la aproape 3 ani de la diagnostic. Se știe, de asemenea, că supraviețuirea mediană este mai lungă la pacienții cu GBM care exprimă mutația IDH1 ( R132H ) (31 de luni) decât la pacienții care exprimă alela de tip sălbatic (15 luni) ( 13 , 83). În timp ce recunoaștem că răspunsul terapeutic observat la acest pacient ar putea să nu fie văzut la alți pacienți cu GBM tratați în mod similar, există decenii de știință convingătoare care susțin mecanismele prin care această terapie metabolică ar putea reduce progresia GBM ( 17 ).

Creșterea remarcabil de lentă a tumorii pacientului este în contrast cu studiile anterioare privind dinamica de creștere RMN a glioblastoamelor netratate ( 82 ). Analiza a 106 GBM netratate a arătat un volum mediu de 17,7 ml la scanarea RMN de diagnostic și 27,5 ml la scanarea preoperatorie cu un timp estimat de dublare a volumului de 49,6 zile. Mai mult, timpul de dublare a volumului a fost semnificativ mai rapid pentru tumorile mai mici la diagnostic (<3,88 ml) decât pentru tumorile mai mari (> 39,88 ml). Studiile anterioare au arătat, de asemenea, că rezecția chirurgicală nu a crescut în mod semnificativ supraviețuirea la pacienții cu tumori mici, indiferent de ce procent din tumoră ar putea fi dezamăgit ( 84). Timpul de supraviețuire a GBM a fost estimat la 292 de zile după rezecția chirurgicală imediată și la 492 de zile dacă prima rezecție chirurgicală a degradat 80% din tumoră ( 84 ). Am folosit formula ABC / 2 pentru a măsura modificarea volumului tumorii pacientului în timp ( 85 ). Tumora pacientului a măsurat 1,25 ml la diagnostic (august 2014) și a crescut la 5,97 ml la momentul scanării preoperatorii (aprilie 2017), un interval de timp de 32 de luni ( Figura 5 ). Timpul estimat de dublare a volumului pentru tumoarea pacientului a fost de 432 de zile, iar timpul de supraviețuire, după rezecție, este acum de peste 1.400 de zile. În mod clar, creșterea ratei de creștere a tumorii și supraviețuirea generală a acestui pacient este semnificativ mai bună decât cele din majoritatea cazurilor raportate anterior. Tumora pacientului este în concordanță cu IDH1GBM mutant cu o morfologie asemănătoare masei> 33% din tumora care nu mărește contrastul (nCET), așa cum s-a descris anterior ( 86 ). Nu este probabil ca pierderea proteinei ATRX sau metilarea MGMT absentă să fi contribuit la supraviețuirea pacientului în lumina informațiilor anterioare care leagă acești markeri de supraviețuirea slabă ( 87 ). Ar putea KMT-ul ales al pacientului și achiziția întâmplătoare a mutației IDH1 să fi contribuit la supraviețuirea sa pe termen lung cu GBM?FIGURA 5

Figura 5 . Volumul tumorilor prezis și observat pentru GBM mutant IDH1 netratat . Creșterea măsurată a tumorii pacientului în comparație cu creșterea estimată a acesteia, pe baza modelului stochastic al glioblastoamelor umane netratate ( 84 ). Mărimea tumorii, măsurată la diagnostic în august 2014, se calculează numai prin măsurarea imaginilor post-contrast, deoarece literatura actuală nu oferă modele de creștere bazate pe volumul total al tumorii reprezentat de tumora care mărește și care nu mărește. Pe baza acestui model stochastic, rata de creștere prezisă (linie întreruptă albastră), arată că tumoarea amplificatoare ar fi atins un volum incompatibil cu viața în jurul lunii aprilie 2015. În contrast izbitor cu ceea ce era de așteptat, IDH1 al pacientuluiGBM mutant, tratat numai cu KMT, a demonstrat o rată de creștere mult mai mică (linie întreruptă verde). Trebuie remarcat faptul că peste 70% din GBM al pacientului nu s-a îmbunătățit așa cum s-ar fi așteptat pentru mutația IDH. Măsurările volumului tumorii ale pacientului au fost determinate din RMN, așa cum este descris în text.

Este bine cunoscut faptul că supraviețuirea GBM și creșterea tumorii sunt legate direct de nivelurile de glucoză din sânge, adică, glicemia crescută este asociată cu o progresie mai rapidă a bolii și cu timpi de supraviețuire mai scurți ( 18 , 41 , 88 – 97 ). Glucoza este combustibilul pentru fermentația aerobă (efect Warburg), care este factorul majorității cancerelor maligne, inclusiv GBM ( 26 , 98 ). Deși pacientul nu a ținut un jurnal alimentar, el a reușit să mențină valori scăzute ale GKI cu postul intermitent și alegerile sale alimentare cu conținut scăzut de carbohidrați. Capacitatea pacientului de a-și menține valorile GKI în mod constant aproape de 2,0 și mai jos ar viza efectul Warburg, inhibând astfel creșterea tumorii și îmbunătățind supraviețuirea sa generală (99 ). Nivelurile reduse de glucoză din sânge nu numai că vor înfometa tumora metaboliților de creștere prin glicoliză și metabolismul cu un singur carbon, dar vor regla și cascadele de semnalizare PI3K / Akt / Hif1-1α / mTOR care ar inhiba în continuare creșterea celulelor tumorale neregulate ( 17 , 58 , 100 – 103 ). Valorile scăzute ale GKI au fost, de asemenea, în direcția succesului terapeutic prevăzut pentru reducerea producției de acid lactic ( 17 , 56 , 58 , 77 ). Reducerea acidului lactic condus de glucoză ar reduce inflamația și edemul indus de NF-kappa-β în micromediul tumorii, reducând astfel angiogeneza și invazia celulelor tumorale ( 17 ,58 , 70 – 72 , 77 , 102 , 104 ). Reducerea inflamației în micromediul tumorii ar putea explica parțial absența edemului vasogenic robust și creșterea mai lentă a GBM observată la pacientul nostru, așa cum am observat anterior în GBM preclinice neradiate tratate cu KMT ( 75 ). De asemenea, este important să menționăm că supraviețuirea pacientului nostru a fost mult mai lungă decât cea a majorității celorlalți pacienți GBM care au primit KMT după SOC ( 45 , 54 , 59 , 105 – 108). Cu toate acestea, puțini dintre pacienții adulți tratați cu KMT în aceste studii au reușit să atingă sau să mențină valorile GKI prezise pentru a avea cel mai mare beneficiu terapeutic pentru gestionarea GBM ( 77 ). Evitarea radioterapiei ar preveni, de asemenea, necroza lichefactivă, hialinizarea vasculară și progresia rapidă a tumorii, așa cum sa întâmplat la pacientul anterior GBM tratat cu KMT, care avea o vârstă similară la diagnostic ( 17 , 56 ). Decizia pacientului de a utiliza KMT ca alternativă la SOC și capacitatea sa de a menține valori scăzute ale GKI ar fi putut contribui în parte la supraviețuirea sa pe termen lung și la însoțirea unei bune calități a vieții.

Mecanismul potențial prin care mutația IDH1 ar putea reduce creșterea GBM și crește supraviețuirea este discutat mai jos și în Figura 6 . Recent am descris cum energia chimică de la sine este problema centrală pentru viabilitatea celulelor neoplazice. Tumorile nu pot crește fără ATP, indiferent de eterogenitatea lor celulară sau genetică ( 26 ). În plus față de glucoză, glutamina este celălalt combustibil major fermentabil care poate conduce la sinteza ATP în majoritatea cancerelor, inclusiv GBM ( 24 , 26 , 114 ). Glutamina este singurul aminoacid care poate genera sinteza ATP prin mSLP pe calea glutaminolizei ( 25). În timp ce KMT ar putea să nu fie la fel de eficient în țintirea glutaminolizei ca și în glicoliză, creșterea corpului cetonelor din sânge ale pacientului (β-hidroxibutirat și acetoacetat), evidentă din valorile sale scăzute ale GKI, ar putea viza indirect calea glutaminolizei condusă de glutamină; cunoscut și sub numele de efectul Q ( 25 , 26 ). Sinteza ATP prin fosforilarea la nivel de substrat mitocondrial (mSLP) la reacția succinat CoA ligază (SUCL) în calea glutaminolizei poate compensa sinteza ATP diminuată atât prin glicoliză, cât și prin OxPhos ( Figura 6 ). Sinteza acetoacetil-CoA din acetoacetat și β-hidroxibutirat ar sifona unele dintre CoA necesare pentru sinteza succinil-CoA reducând astfel substratul pentru sinteza ATP prin mSLP (26 ). În plus, o reducere a nivelurilor de α-cetoglutarat prin acțiunea creșterii induse de IDH1 în 2-hidroxiglutarat ar putea reduce și mai mult substratul pentru sinteza ATP prin mSLP ( 25 , 26 , 112 , 115 ). Studii recente arată, de asemenea, că 2-hidroxiglutaratul derivat din IDH1 poate facilita degradarea Hif1-α și, astfel, reduce efectul Warburg prin reglarea descendentă a mai multor gene din calea glicolitică ( 113 ). Mai multe dovezi ale unui efect inhibitor al mutației IDH1 asupra consumului de glucoză și glicoliză au fost obținute recent din analiza PET ( 116)). Supraviețuirea pe termen lung a pacientului ar putea rezulta, în parte, dintr-o interacțiune sinergică între KMT autodirecționat și efectele anticanceroase ale mutației IDH1-R132H .FIGURA 6

Figura 6 . Interacțiunea sinergică KMT / IDH1 pentru direcționarea metabolismului energetic GBM. KMT poate reduce disponibilitatea glucozei pentru glicoliză, interferând în același timp cu calea glutaminolizei. Fosforilarea la nivel de substrat mitocondrial condusă de glutamină (mSLP), în calea glutaminolizei, este o sursă majoră de sinteză ATP pentru celulele GBM ( 25 , 26 ). Calea glutaminolizei (roșie) devine dominantă în celulele tumorale cu OxPhos ineficient și care exprimă izoforma dimerică PKM2. PKM2 este exprimat în GBM și produce mai puțin ATP prin glicoliză decât izoforma PKM1 ( 109 – 111). Creșterea corpurilor cetonice (β-hidroxibutirat și acetoacetat) prin KMT ar putea reduce indirect sinteza ATP prin reacția succinat CoA ligază (SUCL) prin devierea CoA de la succinat la acetoacetat. IDH1 mutatie ar putea reduce și mai mult sinteza ATP prin mSLP prin creșterea sintezei de 2-hydroxyglutarate din α-cetoglutarat și reducând astfel substratul CoA succinil pentru reacția SUCL ( 26 , 112 ). Pe lângă efectul său potențial în reducerea glutaminolizei, 2-hidroxiglutaratul poate viza, de asemenea, mai multe gene și enzime care răspund la HIF1α în calea glicolizei, limitând astfel sinteza metaboliților și metabolismul cu un singur carbon necesar pentru creșterea rapidă a tumorii ( 25 , 26 , 103113 ). Reglarea descendentă a lactatului dehidrogenazei A (LDHA) reglementată de Hif1-α, prin acțiunea atât a KMT, cât și a mutației IDH1 , ar reduce nivelurile de lactat extracelular, reducând astfel inflamația micromediului și invazia celulelor tumorale. Prin urmare, inhibarea simultană a glicolizei și glutaminolizei prin efectele sinergice ale KMT și IDH1mutația va accentua majoritatea căilor de semnalizare necesare pentru creșterea rapidă a GBM. BDH, β-hidroxibutirat dehidrogenază; FAD, flavină adenină dinucleotidă; GLSc, glutaminază, citosolică; GLSm, glutaminază; mitocondrial; GLUD, glutamat dehidrogenază; GOT2, aspartat aminotransferază; KGDHC, complex α-cetoglutarat dehidrogenază; LDHA, lactat dehidrogenaza A; NME, nucleozid difosfat kinază; OXCT1, succinil-CoA: 3-cetoacid coenzima A transferaza 1; PC, piruvat carboxilază; PDH, piruvat dehidrogenază; PEP, fosfoenolpiruvat; PKM2, piruvat kinaza M2; SDH, succinat dehidrogenază; SUCL, succinat-CoA ligază. Retipărit cu modificări din Seyfried și colab. ( 26 ).

Dacă o capacitate este cu adevărat importantă pentru biologia tumorilor, atunci inhibarea acesteia ar trebui considerată o strategie terapeutică pentru un management eficient ( 99 , 117 ). În acest caz, capacitatea este metabolizarea fermentației necesară pentru sinteza metaboliților de creștere și a ATP prin căile glicolitice și glutaminoliză ( 26 ). Deoarece „celulele stem” GBM sunt mai dependente de glucoză decât de glutamină pentru creștere, în timp ce „celulele mezenchimale” GBM sunt mai dependente de glutamină decât de glucoză, devine esențial să se inhibe simultan atât căile glicolizei, cât și glutaminoliza, pentru a se obține un management maxim al GBM. ( 24 , 75). Celulele mezenchimale GBM dependente de glutamină apar din microglia / macrofage neoplazice ( 118 , 119 ). Un studiu recent a arătat că expresia markerului macrofag / microglial, CD163, a fost mai mică într-un GBM-mutant IDH1 decât în GBM de tip sălbatic IDH1 ( 120 ). CD163 este un biomarker pentru macrofagele neoplazice dependente de glutamină din țesutul tumoral ( 119 , 121 ). Prin urmare, o interacțiune sinergică între efectele mutației IDH1 și KMT ar putea regla simultan efectul Warburg și efectul Q în populațiile de celule neoplazice GBM, oferind astfel un mecanism nou care să contribuie la supraviețuirea pe termen lung a pacientului nostru .

Deși studiile cu un singur subiect N-of-one au fost considerate strategia finală pentru individualizarea medicinei ( 122 ), nu putem prezice dacă răspunsul terapeutic la KMT observat la pacientul nostru cu GBM va fi văzut și la alți pacienți cu GBM tratați în mod similar, în special la cei cu tumori care sunt de tip sălbatic la locusul IDH1 . Pentru acei pacienți GBM care nu au avut norocul să fi dobândit IDH1 spontanmutația tumorii lor, glutamina care vizează medicamentele utilizate cu KMT va fi necesară pentru a reduce creșterea tumorii. Studiile noastre tradiționale recente de la bancă la pat arată că direcționarea simultană a disponibilității glucozei și a glutaminei, utilizând KMT și inhibitorul pan-glutaminazei, 6-diazo-5-oxo-L-norleucina (DON), poate prelungi semnificativ supraviețuirea în singeza preclinică glioblastoamele ( 75 ). De asemenea, este important să rețineți că dietele ketogenice pot facilita administrarea de medicamente terapeutice cu molecule mici prin bariera hematoencefalică fără toxicitate ( 75 , 123 , 124). Deoarece GBM, la fel ca majoritatea cancerelor maligne, depinde de fermentație pentru sinteza și supraviețuirea ATP, restricția simultană a combustibililor fermentabili, adică glucoza și glutamina, în timp ce ridică corpurile cetonice nefermentabile, oferă o strategie terapeutică non-toxică pentru gestionarea GBM. Vor fi necesare studii suplimentare pentru a testa această ipoteză la alți pacienți diagnosticați cu GBM.

Declarație privind disponibilitatea datelor

Datele brute care susțin concluziile acestui articol vor fi puse la dispoziție de către autori, fără rezerve nejustificate.

Declarație de etică

Consimțământul informat scris a fost obținut de la persoana (persoanele) pentru publicarea oricăror imagini sau date potențial identificabile incluse în acest articol.

Contribuțiile autorului

TS: a scris manuscrisul și a asistat la prezentarea și analiza datelor. AS: a realizat raportul histologic. MK: a furnizat informații despre starea nutrițională și a ajutat la redactarea lucrării. JM: reevaluați datele pacientului și editați lucrarea. PM: date evaluate și asistate în pregătirea manuscriselor. GZ: analiza imaginilor RMN și a ajutat la scrierea lucrării. Toți autorii au contribuit la articol și au aprobat versiunea trimisă.

Conflict de interese

MK a fost angajat de Dietary Therapies LLC.

Autorii declară că acest studiu a primit finanțare de la Fundația pentru Terapii împotriva Cancerului Metabolic, CrossFit Inc., Fundația Familia Nelson și Claudia Peltz, Lewis Topper, Fundația John și Kathy Garcia, Edward Miller, pacientul însuși, Fundația George Yu Fundația Kenneth Rainin, Copiii cu cancer din Marea Britanie și Fondul de cheltuieli de cercetare din Boston College. Finanțatorii nu au fost implicați în proiectarea studiului, colectarea, analiza, interpretarea datelor și în redactarea acestui articol sau în decizia de a le trimite spre publicare.

Mulțumiri

Mulțumim Fundației pentru terapii împotriva cancerului metabolic, CrossFit Inc., Fundația Familiei Nelson și Claudia Peltz, Lewis Topper, Fundația John și Kathy Garcia, Edward Miller, pacientul însuși, Fundația George Yu, Fundația Kenneth Rainin, Copiii cu cancer Marea Britanie și Fondul de cheltuieli de cercetare din Boston College pentru sprijinul lor. Mulțumim, de asemenea, Misha Sakharoff pentru asistarea pacientului cu recomandări dietetice, exerciții de respirație și tehnici de atenție pentru a reduce stresul. De asemenea, mulțumim lui Kevin Cardenas pentru asistență tehnică. În cele din urmă, mulțumim celor doi recenzori pentru recomandările valoroase pentru îmbunătățirea manuscrisului.

Material suplimentar

Materialul suplimentar pentru acest articol poate fi găsit online la: https://www.frontiersin.org/articles/10.3389/fnut.2021.682243/full#supplementary-material

Referințe

1. Polivka J, Polivka J, Holubec L, Kubikova T, Priban V, Hes O, și colab. Progrese în terapia experimentală vizată și imunoterapie pentru pacienții cu glioblastom multiform. Anticancer Res. (2017) 37: 21–33. doi: 10.21873 / anticanres.11285

PubMed Abstract | Text integral CrossRef | Google Scholar

2. Fabbro-Peray P, Zouaoui S, Darlix A, Fabbro M, Pallud J, Rigau V și colab. Asocierea tiparelor de îngrijire, a factorilor de prognostic și a utilizării terapiei cu radioterapie-temozolomidă cu supraviețuire la pacienții cu glioblastom nou diagnosticat: un studiu național francez bazat pe populație. J Neurooncol . (2018) 142: 91–101. doi: 10.1007 / s11060-018-03065-z

PubMed Abstract | Text integral CrossRef | Google Scholar

3. Geraldo LHM, Garcia C, da Fonseca ACC, Dubois LGF, de Sampaio ESTCL, Spohr TCL, și colab. Terapia cu glioblastom în epoca medicinei moleculare. Tendințe de cancer. (2019) 5: 46–65. doi: 10.1016 / j.trecan.2018.11.002

PubMed Abstract | Text integral CrossRef | Google Scholar

4. Wegman-Ostrosky T, Reynoso-Noveron N, Mejia-Perez SI, Sanchez-Correa TE, Alvarez-Gomez RM, Vidal-Millan S, și colab. Factori de prognostic clinic la adulții cu astrocitom: cohorta istorică. Clin Neurol Neurosurg. (2016) 146: 116-22. doi: 10.1016 / j.clineuro.2016.05.002

PubMed Abstract | Text integral CrossRef | Google Scholar

5. Stupp R, Taillibert S, Kanner A, Read W, Steinberg D, Lhermitte B și colab. Efectul câmpurilor de tratare a tumorii plus temozolomidă de întreținere versus temozolomidă de întreținere singură asupra supraviețuirii la pacienții cu glioblastom: un studiu clinic randomizat. JAMA. (2017) 318: 2306-16. doi: 10.1001 / jama.2017.18718

PubMed Abstract | Text integral CrossRef | Google Scholar

6. Gutiontov SI. Mediana nu este mesajul: revizuit. J Clin Oncol. (2020) 38: 1112–4. doi: 10.1200 / JCO.19.03078

PubMed Abstract | Text integral CrossRef | Google Scholar

7. Fatehi M, Hunt C, Ma R, Toyota BD. Diferențe persistente în supraviețuire la pacienții cu glioblastom. World Neurosurg. (2018) 120: e511-6. doi: 10.1016 / j.wneu.2018.08.114

PubMed Abstract | Text integral CrossRef | Google Scholar

8. Johnson DR, Ma DJ, Buckner JC, Hammack JE. Probabilitatea condiționată de supraviețuire pe termen lung în glioblastom: o analiză bazată pe populație. Cancer. (2012) 118: 5608-13. doi: 10.1002 / cncr.27590

PubMed Abstract | Text integral CrossRef | Google Scholar

9. Alvarez-Torres MDM, Fuster-Garcia E, Reynes G, Juan-Albarracin J, Chelebian E, Oleaga L, și colab. Efect diferențial al vascularizației între supraviețuitorii pe termen lung și scurt cu glioblastom de tip sălbatic IDH1 / 2. RMN Biomed. (2021) 34: e4462. doi: 10.1002 / nbm.4462

PubMed Abstract | Text integral CrossRef | Google Scholar

10. Krex D, Klink B, Hartmann C, von Deimling A, Pietsch T, Simon M și colab. Supraviețuirea pe termen lung cu glioblastom multiform. Creier. (2007) 130: 2596–606. doi: 10.1093 / brain / awm204

Text integral CrossRef | Google Scholar

11. Shinojima N, Kochi M, Hamada JI, Hideo N, Yano S, Makino K, și colab. Influența sexului și prezența celulelor gigantice asupra supraviețuirii postoperatorii pe termen lung la pacienții adulți cu glioblastom multiform supratentorial. J Neurochirurgie. (2004) 95: 249-57. doi: 10.3171 / jns.2004.101.2.0219

PubMed Abstract | Text integral CrossRef | Google Scholar

12. Perry JR, Laperriere N, O’Callaghan CJ, Brandes AA, Menten J, Phillips C, și colab. Radiații de scurtă durată plus temozolomidă la pacienții vârstnici cu glioblastom. N Engl J Med. (2017) 376: 1027–37. doi: 10.1056 / NEJMoa1611977

PubMed Abstract | Text integral CrossRef | Google Scholar

13. Yan H, Parsons DW, Jin G, McLendon R, Rasheed BA, Yuan W și colab. IDH1 DD. și mutații IDH2 în glioame. N Engl J Med. (2009) 360: 765-73. doi: 10.1056 / NEJMoa0808710

Text integral CrossRef | Google Scholar

14. Salford LG, Brun A, Nirfalk S. Supraviețuire de zece ani în rândul pacienților cu astrocitoame supratentoriale de gradul III și IV. J Neurosurg. (1988) 69: 506-9. doi: 10.3171 / jns.1988.69.4.0506

PubMed Abstract | Text integral CrossRef | Google Scholar

15. Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC și colab. Efectele radioterapiei cu temozolomidă concomitentă și adjuvantă versus radioterapia singură asupra supraviețuirii în glioblastom într-un studiu randomizat de fază III: analiza pe 5 ani a studiului EORTC-NCIC. Lancet Oncol. (2009) 10: 459-66. doi: 10.1016 / S1470-2045 (09) 70025-7

PubMed Abstract | Text integral CrossRef | Google Scholar

16. Brandes AA, Franceschi E, Ermani M, Tosoni A, Albani F, Depenni R, și colab. Modelul de îngrijire și eficacitatea tratamentului pentru pacienții cu glioblastom în lumea reală: rezultate dintr-un registru potențial bazat pe populație. Ar putea diferi supraviețuirea într-un centru cu volum mare? Neurooncol Pract. (2014) 1: 166–71. doi: 10.1093 / nop / npu021

PubMed Abstract | Text integral CrossRef | Google Scholar

17. Seyfried TN, Shelton L, Arismendi-Morillo G, Kalamian M, Elsakka A, Maroon J, și colab. Întrebare provocatoare: terapia metabolică ketogenică ar trebui să devină standardul de îngrijire pentru glioblastom? Neurochem Res . (2019) 44: 2392–404. doi: 10.1007 / s11064-019-02795-4

PubMed Abstract | Text integral CrossRef | Google Scholar

18. Pitter KL, Tamagno I, Alikhanyan K, Hosni-Ahmed A, Pattwell SS, Donnola S și colab. Corticosteroizii compromit supraviețuirea în glioblastom. Creier. (2016) 139: 1458–71. doi: 10.1093 / brain / aww046

Text integral CrossRef | Google Scholar

19. Seyfried TN, Flores R, Poff AM, D’Agostino DP, Mukherjee P. Terapia metabolică: o nouă paradigmă pentru gestionarea cancerului malign al creierului. Cancer Lett. (2015) 356: 289-300. doi: 10.1016 / j.canlet.2014.07.015

PubMed Abstract | Text integral CrossRef | Google Scholar

20. Zafar SY, Currow D, Abernethy AP. Definirea celor mai bune îngrijiri de susținere. J Clin Oncol. (2008) 26: 5139–40. doi: 10.1200 / JCO.2008.19.7491

Text integral CrossRef | Google Scholar

21. Philips A, Henshaw DL, Lamburn G, O’Carroll MJ. Tumori cerebrale: creșterea incidenței glioblastomului multiform în Anglia 1995-2015 sugerează un factor advers de mediu sau stil de viață. J Environ Health Public. (2018) 2018: 7910754. doi: 10.1155 / 2018/2170208

PubMed Abstract | Text integral CrossRef | Google Scholar

22. Altman BJ, Stine ZE, Dang CV. De la Krebs la clinică: metabolismul glutaminei la terapia cancerului. Nat Rev Cancer. (2016) 16: 749. doi: 10.1038 / nrc.2016.114

PubMed Abstract | Text integral CrossRef | Google Scholar

23. Wise DR, DeBerardinis RJ, Mancuso A, Sayed N, Zhang XY, Pfeiffer HK și colab. Myc reglează un program transcripțional care stimulează glutaminoliza mitocondrială și duce la dependența de glutamină. Proc Natl Acad Sci SUA. (2008) 105: 18782–7. doi: 10.1073 / pnas.0810199105

PubMed Abstract | Text integral CrossRef | Google Scholar

24. Oizel K, Chauvin C, Oliver L, Gratas C, Geraldo F, Jarry U și colab. Direcționarea eficientă a glutaminei mitocondriale prevalează asupra plasticității metabolice a glioblastomului. Clin Cancer Res. (2017) 23: 6292-304. doi: 10.1158 / 1078-0432.CCR-16-3102

PubMed Abstract | Text integral CrossRef | Google Scholar

25. Chinopoulos C, Seyfried TN. Fosforilarea la nivel de substrat mitocondrial ca sursă de energie pentru glioblastom: revizuire și ipoteză. ASN Neuro. (2018) 10: 1759091418818261. doi: 10.1177 / 1759091418818261

PubMed Abstract | Text integral CrossRef | Google Scholar

26. Seyfried TN, Arismendi-Morillo G, Mukherjee P, Chinopoulos C. Despre originea sintezei ATP în cancer. iScience. (2020) 23: 101761. doi: 10.1016 / j.isci.2020.101761

Text integral CrossRef | Google Scholar

27. Seyfried TN, Mukherjee P. Direcționarea metabolismului energetic în cancerul cerebral: revizuire și ipoteză. Nutr Metab. (2005) 2:30. doi: 10.1186 / 1743-7075-2-30

PubMed Abstract | Text integral CrossRef | Google Scholar

28. Deighton RF, Le Bihan T, Martin SF, Barrios-Llerena ME, Gerth AM, Kerr LE și colab. Răspunsul proteomic în glioblastom la pacienții tineri. J Neuro-Oncol . (2014) 119: 79–89. doi: 10.1007 / s11060-014-1474-6

PubMed Abstract | Text integral CrossRef | Google Scholar

29. Deighton RF, Le Bihan T, Martin SF, Gerth AM, McCulloch M, Edgar JM și colab. Interacțiunile dintre proteinele mitocondriale modificate în glioblastom. J Neuro-Oncol. (2014) 118: 247-56. doi: 10.1007 / s11060-014-1430-5

PubMed Abstract | Text integral CrossRef | Google Scholar

30. Oudard S, Boitier E, Miccoli L, Rousset S, Dutrillaux B, Poupon MF. Gliomii sunt conduși de glicoliză: roluri putative ale hexokinazei, fosforilarea oxidativă și ultrastructura mitocondrială. Anticancer Res. (1997) 17: 1903-11.

PubMed Abstract | Google Scholar

31. Feichtinger RG, Weis S, Mayr JA, Zimmermann F, Geilberger R, Sperl W, și colab. Alterări ale complexelor de fosforilare oxidativă în astrocitoame. Glia. (2014) 62: 514-25. doi: 10.1002 / glia.22621

PubMed Abstract | Text integral CrossRef | Google Scholar

32. Ordys BB, Launay S, Deighton RF, McCulloch J, Whittle IR. Rolul mitocondriilor în fiziopatologia gliomului. Mol Neurobiol. (2010) 42: 64-75. doi: 10.1007 / s12035-010-8133-5

Text integral CrossRef | Google Scholar

33. Arismendi-Morillo GJ, Castellano-Ramirez AV. Patologia mitocondrială ultrastructurală în tumorile astrocitice umane: implicații potențiale strategii terapeutice. J Electron Microsc. (2008) 57: 33-9. doi: 10.1093 / jmicro / dfm038

PubMed Abstract | Text integral CrossRef | Google Scholar

34. Bergsneider M, Hovda DA, Shalmon E, Kelly DF, Vespa PM, Martin NA și colab. Hiperglicoliza cerebrală după leziuni cerebrale traumatice severe la om: un studiu de tomografie cu emisie de pozitroni. J Neurosurg. (1997) 86: 241-51. doi: 10.3171 / jns.1997.86.2.0241

PubMed Abstract | Text integral CrossRef | Google Scholar

35. Rohlenova K, Veys K, Miranda-Santos I, De Bock K, Carmeliet P. Metabolismul celulelor endoteliale în sănătate și boală. Trends Cell Biol. (2018) 28: 224–36. doi: 10.1016 / j.tcb.2017.10.010

PubMed Abstract | Text integral CrossRef | Google Scholar

36. Oliva CR, Nozell SE, Diers A, McClugage SG 3rd, Sarkaria JN, Markert JM, și colab. Achiziționarea chimiorezistenței temozolomidei în glioame duce la remodelarea lanțului de transport al electronilor mitocondriale. J Biol Chem. (2010) 285: 39759-67. doi: 10.1074 / jbc.M110.147504

PubMed Abstract | Text integral CrossRef | Google Scholar

37. Johnson BE, Mazor T, Hong C, Barnes M, Aihara K, McLean CY și colab. Analiza mutațională relevă originea și evoluția terapiei determinate de gliomul recurent. Ştiinţă. (2014) 343: 189–93. doi: 10.1126 / science.1239947

PubMed Abstract | Text integral CrossRef | Google Scholar

38. Paez-Ribes M, Allen E, Hudock J, Takeda T, Okuyama H, Vinals F și colab. Terapia antiangiogenă provoacă progresia malignă a tumorilor către creșterea invaziei locale și metastazarea la distanță. Celula cancerului. (2009) 15: 220-31. doi: 10.1016 / j.ccr.2009.01.027

PubMed Abstract | Text integral CrossRef | Google Scholar

39. Nanegrungsunk D, Apaijai N, Yarana C, Sripetchwandee J, Limpastan K, Watcharasaksilp W, și colab. Bevacizumab este superior Temozolomidei, cauzând disfuncții mitocondriale în tumorile cerebrale umane. Neurol Res. (2016) 38: 285-93. doi: 10.1080 / 01616412.2015.1114233

PubMed Abstract | Text integral CrossRef | Google Scholar

40. de Groot JF, Fuller G, Kumar AJ, Piao Y, Eterovic K, Ji Y și colab. Invazia tumorală după tratamentul glioblastomului cu bevacizumab: corelație radiografică și patologică la om și șoareci. Neuro Oncol. (2010) 12: 233–42. doi: 10.1093 / neuonc / nop027

PubMed Abstract | Text integral CrossRef | Google Scholar

41. Klement RJ, Champ CE. Corticosteroizii compromit supraviețuirea în glioblastom parțial prin creșterea nivelului de glucoză din sânge. Creier. (2017) 140: e16. doi: 10.1093 / brain / aww324

PubMed Abstract | Text integral CrossRef | Google Scholar

42. Arcuri C, Tardy M, Rolland B, Armellini R, Menghini AR, Bocchini V. Expresia genei glutaminei sintetaza într-o linie celulară de glioblastom de origine clonală: reglare prin AMP ciclic de dixametazona și dibutiril. Neurochem Res. (1995) 20: 1133-9. doi: 10.1007 / BF00995375

PubMed Abstract | Text integral CrossRef | Google Scholar

43. Wong ET, Lok E, Gautam S, Swanson KD. Dexametazona exercită o interferență imunologică profundă asupra eficacității tratamentului pentru glioblastom recurent. Br J Rac. (2015) 113: 232–41. doi: 10.1038 / bjc.2015.238

PubMed Abstract | Text integral CrossRef | Google Scholar

44. Seyfried TN, Shelton LM, Mukherjee P. Crește standardul de îngrijire existent crește metabolismul energetic al glioblastomului? Lancet Oncol. (2010) 11: 811–3. doi: 10.1016 / S1470-2045 (10) 70166-2

PubMed Abstract | Text integral CrossRef | Google Scholar

45. Winter SF, Loebel F, Dietrich J. Rolul terapiei metabolice ketogenice în gliomul malign: o revizuire sistematică. Crit Rev Oncol Hematol. (2017) 112: 41–58. doi: 10.1016 / j.critrevonc.2017.02.016

PubMed Abstract | Text integral CrossRef | Google Scholar

46. ​​Iyikesici MS. Studiu de fezabilitate a chimioterapiei susținute metabolic cu carboplatină / paclitaxel săptămânal combinată cu dietă ketogenică, hipertermie și oxigenoterapie hiperbară în cancerul pulmonar metastatic cu celule mici. Int J hipertermie. (2019) 36: 446–55. doi: 10.1080 / 02656736.2019.1589584

PubMed Abstract | Text integral CrossRef | Google Scholar

47. Iyikesici MS, Slocum AK, Slocum A, Berkarda FB, Kalamian M, Seyfried TN. Eficacitatea chimioterapiei susținute metabolic, combinată cu dieta ketogenică, hipertermia și oxigenoterapia hiperbară pentru cancerul de sân triplu negativ în stadiul IV. Cureus. (2017) 9: e1445. doi: 10.7759 / cureus.1445

PubMed Abstract | Text integral CrossRef | Google Scholar

48. Seyfried TN, Mukherjee P, Iyikesici MS, Slocum A, Kalamian M, Spinosa JP, și colab. Considerarea terapiei metabolice ketogenice ca o abordare complementară sau alternativă pentru gestionarea cancerului de sân. Front Nutr. (2020) 7:21. doi: 10.3389 / fnut.2020.00021

PubMed Abstract | Text integral CrossRef | Google Scholar

49. Khodabakhshi A, Akbari ME, Mirzaei HR, Seyfried TN, Kalamian M, Davoodi SH. Efectele terapiei metabolice ketogene asupra pacienților cu cancer de sân: un studiu clinic controlat randomizat. Clin Nutr . (2020) 40: 751-8. doi: 10.1016 / j.clnu.2020.06.028

PubMed Abstract | Text integral CrossRef | Google Scholar

50. Kalamian M. KETO pentru CANCER: Terapia metabolică ketogenică ca strategie nutrițională țintită . White River Junction, VT: Chelsea Green (2017).

Google Scholar

51. Weber DD, Aminzadeh-Gohari S, Tulipan J, Catalano L, Feichtinger RG, Kofler B. Dieta ketogenică în tratamentul cancerului – Unde ne aflăm? Mol Metab . (2019) 33: 102–21. doi: 10.1016 / j.molmet.2019.06.026

PubMed Abstract | Text integral CrossRef | Google Scholar

52. Klein P, Tyrlikova I, Zuccoli G, Tyrlik A, Maroon JC. Tratamentul glioblastomului multiform cu înlocuirea totală a mesei cu dieta ketogenică „clasică” 4: 1. Cancer Metab . (2020) 8:24. doi: 10.1186 / s40170-020-00230-9

PubMed Abstract | Text integral CrossRef | Google Scholar

53. Maroon J, Bost J, Amos A, Zuccoli G. Dieta ketogenică cu calorii restricționate pentru tratamentul glioblastomului multiform. J Copil Neurol. (2013) 28: 1002-8. doi: 10.1177 / 0883073813488670

PubMed Abstract | Text integral CrossRef | Google Scholar

54. Zuccoli G, Marcello N, Pisanello A, Servadei F, Vaccaro S, Mukherjee P, și colab. Gestionarea metabolică a glioblastomului multiform utilizând terapia standard împreună cu o dietă ketogenică restricționată: raport de caz. Nutr Metab. (2010) 7:33. doi: 10.1186 / 1743-7075-7-33

PubMed Abstract | Text integral CrossRef | Google Scholar

55. Panhans CM, Gresham G, Amaral JL, Hu J. Explorând fezabilitatea și efectele unei diete ketogenice la pacienții cu afecțiuni maligne ale SNC: o serie de cazuri retrospective. Neuroști din față. (2020) 14: 390. doi: 10.3389 / fnins.2020.00661

PubMed Abstract | Text integral CrossRef | Google Scholar

56. Elsakka AMA, Bary MA, Abdelzaher E, Elnaggar M, Kalamian M, Mukherjee P, și colab. Managementul glioblastomului multiform la un pacient tratat cu terapie metabolică ketogenică și standard de îngrijire modificat: o urmărire de 24 de luni. Front Nutr. (2018) 5:20. doi: 10.3389 / fnut.2018.00020

PubMed Abstract | Text integral CrossRef | Google Scholar

57. Schwartz KA, Noel M, Nikolai M, Chang HT. Investigarea dietei ketogene ca tratament pentru cancerul cerebral agresiv primar: provocări și lecții învățate. Front Nutr. (2018) 5:11. doi: 10.3389 / fnut.2018.00011

PubMed Abstract | Text integral CrossRef | Google Scholar

58. Martuscello RT, Vedam-Mai V, McCarthy DJ, Schmoll ME, Jundi MA, Louviere CD și colab. O dietă suplimentată cu conținut ridicat de grăsimi cu conținut scăzut de carbohidrați pentru tratamentul glioblastomului. Clin Cancer Res. (2016) 22: 2482-95. doi: 10.1158 / 1078-0432.CCR-15-0916

PubMed Abstract | Text integral CrossRef | Google Scholar

59. Rieger J, Bahr O, Maurer GD, Hattingen E, Franz K, Brucker D și colab. ERGO: un studiu pilot al dietei ketogenice în glioblastom recurent. Int J Oncol. (2014) 44: 1843–52. doi: 10.3892 / ijo.2014.2382

PubMed Abstract | Text integral CrossRef | Google Scholar

60. Rieger J, Steinbach JP. Sa tineti dieta sau sa nu tineti dieta – aceasta este inca problema. Neuro Oncol. (2016) 18: 1035–6. doi: 10.1093 / neuonc / now131

PubMed Abstract | Text integral CrossRef | Google Scholar

61. Maroon JC, Seyfried TN, Donohue JP, Bost J. Rolul terapiei metabolice în tratarea glioblastomului multiform. Surg Neurol Int. (2015) 6:61. doi: 10.4103 / 2152-7806.155259

PubMed Abstract | Text integral CrossRef | Google Scholar

62. Zhou W, Mukherjee P, Kiebish MA, Markis WT, Mantis JG, Seyfried TN. Dieta ketogenică restricționată caloric, o terapie alternativă eficientă pentru cancerul malign al creierului. Nutr Metab. (2007) 4: 5. doi: 10.1186 / 1743-7075-4-5

PubMed Abstract | Text integral CrossRef | Google Scholar

63. Kiebish MA, Han X, Cheng H, Chuang JH, Seyfried TN. Anomaliile lanțului de transport al cardiolipinei și electronilor în mitocondriile tumorilor cerebrale ale șoarecilor: dovezi lipidomice care susțin teoria cancerului Warburg. J Lipid Res. (2008) 49: 2545-56. doi: 10.1194 / jlr.M800319-JLR200

PubMed Abstract | Text integral CrossRef | Google Scholar

64. Chang HT, Olson LK, Schwartz KA. Profiluri de exprimare enzimatică ketolitică și glicolitică în gliomii maligne: implicație pentru terapia dietetică ketogenică. Nutr Metab. (2013) 10:47. doi: 10.1186 / 1743-7075-10-47

PubMed Abstract | Text integral CrossRef | Google Scholar

65. Fredericks M, Ramsey RB. 3-Oxo acid coenzima O activitate transferază în creier și tumori ale sistemului nervos. J Neurochem. (1978) 31: 1529–31. doi: 10.1111 / j.1471-4159.1978.tb06581.x

PubMed Abstract | Text integral CrossRef | Google Scholar

66. Maurer GD, Brucker DP, Baehr O, Harter PN, Hattingen E, Walenta S și colab. Utilizarea diferențiată a corpurilor cetonice de către neuroni și liniile celulare ale gliomului: o rațiune pentru dieta ketogenică ca terapie cu gliom experimental. Cancer BMC. (2011) 11: 315. doi: 10.1186 / 1471-2407-11-315

PubMed Abstract | Text integral CrossRef | Google Scholar

67. Gabriel AM, Alan CR, Thomas NS. Caracterizarea ultrastructurală a anomaliilor membranelor asociate mitocondriilor în astrocitoamele umane: implicații funcționale și terapeutice. Ultrastruct Pathol . (2017) 41: 234-44. doi: 10.1080 / 01913123.2017.1300618

PubMed Abstract | Text integral CrossRef | Google Scholar

68. Veech RL. Implicațiile terapeutice ale corpurilor cetonice: efectele corpurilor cetonice în condiții patologice: cetoză, dietă ketogenică, stări redox, rezistență la insulină, metabolism mitocondrial. Prostaglandine Leukot Essent Fatty Acids. (2004) 70: 309-19. doi: 10.1016 / j.plefa.2003.09.007

PubMed Abstract | Text integral CrossRef | Google Scholar

69. Veech RL, Todd King M, Pawlosky R, Kashiwaya Y, Bradshaw PC, Curtis W. „Marea” coenzimă nucleotidică de control. IUBMB Life . (2019) 71: 565-79. doi: 10.1002 / iub.1997

Text integral CrossRef | Google Scholar

70. Mukherjee P, El-Abbadi MM, Kasperzyk JL, Ranes MK, Seyfried TN. Restricția dietetică reduce angiogeneza și creșterea într-un model de tumori cerebrale ortotopice de șoarece. Br J Rac. (2002) 86: 1615–21. doi: 10.1038 / sj.bjc.6600298

PubMed Abstract | Text integral CrossRef | Google Scholar

71. Mukherjee P, Mulrooney TJ, Marsh J, Blair D, Chiles TC, Seyfried TN. Efectele diferențiale ale stresului energetic asupra fosforilării și apoptozei AMPK în tumorile cerebrale experimentale și în creierul normal. Cancerul Mol. (2008) 7:37. doi: 10.1186 / 1476-4598-7-37

PubMed Abstract | Text integral CrossRef | Google Scholar

72. Mulrooney TJ, Marsh J, Urits I, Seyfried TN, Mukherjee P. Influența restricției calorice asupra expresiei constitutive a NF-kappaB într-un astrocitom experimental de șoarece. Plus unu. (2011) 6: e18085. doi: 10.1371 / journal.pone.0018085

PubMed Abstract | Text integral CrossRef | Google Scholar

73. Shelton LM, Huysentruyt LC, Mukherjee P, Seyfried TN. Restricția caloriilor ca terapie anti-invazivă pentru cancerul malign al creierului la șoarece VM. ASN Neuro. (2010) 2: e00038. doi: 10.1042 / AN20100002

PubMed Abstract | Text integral CrossRef | Google Scholar

74. Poff AM, Ari C, Seyfried TN, D’Agostino DP. Dieta ketogenică și oxigenoterapia hiperbară prelungesc supraviețuirea la șoarecii cu cancer metastatic sistemic. Plus unu. (2013) 8: e65522. doi: 10.1371 / journal.pone.0065522

PubMed Abstract | Text integral CrossRef | Google Scholar

75. Mukherjee P, Augur ZM, Li M, Hill C, Greenwood B, Domin MA și colab. Beneficiul terapeutic al combinării dietei ketogenice cu restricție calorică și al glutaminei în glioblastom experimental în stadiu târziu. Comun Biol. (2019) 2: 200. doi: 10.1038 / s42003-019-0455-x

PubMed Abstract | Text integral CrossRef | Google Scholar

76. Klement RJ. Efectele benefice ale dietelor ketogenice pentru pacienții cu cancer: o revizuire realistă, cu accent pe dovezi și confirmare. Med Oncol. (2017) 34: 132. doi: 10.1007 / s12032-017-0991-5

PubMed Abstract | Text integral CrossRef | Google Scholar

77. Meidenbauer JJ, Mukherjee P, Seyfried TN. Calculatorul indicelui de gluconă cetonă: un instrument simplu pentru a monitoriza eficacitatea terapeutică pentru gestionarea metabolică a cancerului cerebral. Nutr Metab. (2015) 12:12. doi: 10.1186 / s12986-015-0009-2

PubMed Abstract | Text integral CrossRef | Google Scholar

78. Toth C, Clemens Z. Progresia oprită a cancerului de palat moale la un pacient tratat doar cu dieta ketogenică paleolitică: o urmărire de 20 de luni. Am J Med Case Rep. (2016) 4: 288-92. doi: 10.12691 / ajmcr-4-8-8

Text integral CrossRef | Google Scholar

79. Park CK, Bae JM, Park SH. Supraviețuitorii pe termen lung ai glioblastomului sunt un grup unic de pacienți lipsiți de trăsături caracteristice universale. Neurooncol Adv. (2020) 2: vdz056. doi: 10.1093 / noajnl / vdz056

PubMed Abstract | Text integral CrossRef | Google Scholar

80. Ahmadloo N, Kani AA, Mohammadianpanah M, Nasrolahi H, Omidvari S, Mosalaei A și colab. Rezultatul tratamentului și factorii prognostici ai glioblastomului multiform la adulți. J Egipt Natl Canc Inst. (2013) 25: 21-30. doi: 10.1016 / j.jnci.2012.11.001

PubMed Abstract | Text integral CrossRef | Google Scholar

81. Barakat MK, Belal AM, Fadel SH, Gamal H. Rezultatul glioamelor de grad înalt în țara cu resurse limitate (10 ani de experiență în Centrul de Oncologie al Universității Alexandria 2003-2012). J Tumori cerebrale Neurooncol . (2016) 1: 1-9. doi: 10.4172 / 2475-3203.1000111

Text integral CrossRef | Google Scholar

82. Stensjoen AL, Solheim O, Kvistad KA, Haberg AK, Salvesen O, Berntsen EM. Dinamica creșterii glioblastoamelor netratate in vivo . Neuro Oncol . (2015) 17: 1402-11. doi: 10.1093 / neuonc / nov029

PubMed Abstract | Text integral CrossRef | Google Scholar

83. Lv S, Teugels E, Sadones J, Quartier E, Huylebrouck M, S DUF și colab. Corelația dintre starea mutației genei IDH1 și supraviețuirea pacienților tratați pentru gliom recurent. Anticancer Res. (2011) 31: 4457–63.

PubMed Abstract | Google Scholar

84. Ma Z, Niu B, Phan TA, Stensjoen AL, Ene C, Woodiwiss T și colab. Modelul de creștere stocastică a glioblastoamelor umane netratate prezice timpul de supraviețuire pentru pacienți. Sci Rep. (2020) 10: 6642. doi: 10.1038 / s41598-020-63394-w

PubMed Abstract | Text integral CrossRef | Google Scholar

85. Sreenivasan SA, Madhugiri VS, Sasidharan GM, Kumar RV. Măsurarea volumelor de gliom: o comparație a formulelor bazate pe măsurare liniară cu tehnica de segmentare manuală a imaginii. J Cancer Res Ther. (2016) 12: 161-8. doi: 10.4103 / 0973-1482.153999

PubMed Abstract | Text integral CrossRef | Google Scholar

86. Lasocki A, Gaillard F, Tacey M, Drummond K, Stuckey S. Modelele morfologice ale tumorii care nu îmbunătățesc contrastul în glioblastom se corelează cu starea mutației IDH1 și supraviețuirea pacientului. J Clin Neurosci. (2018) 47: 168–73. doi: 10.1016 / j.jocn.2017.09.007

PubMed Abstract | Text integral CrossRef | Google Scholar

87. Rahman M, Kresak J, Yang C, Huang J, Hiser W, Kubilis P, și colab. Analiza markerilor imunobiologici în glioblastomul primar și recurent. J Neurooncol . (2018) 137: 249-57. doi: 10.1007 / s11060-017-2732-1

PubMed Abstract | Text integral CrossRef | Google Scholar

88. Champ CE, Klement RJ. Comentariu la „Impactul pronostic advers puternic al episoadelor hiperglicemice în timpul chimioterapiei adjuvante a glioblastomului multiform”. Strahlenther Onkol . (2015) 191: 281-2. doi: 10.1007 / s00066-014-0788-9

PubMed Abstract | Text integral CrossRef | Google Scholar

89. Decker M, Sacks P, Abbatematteo J, De Leo E, Brennan M, Rahman M. Efectele hiperglicemiei asupra rezultatelor la pacienții cu gliom chirurgical de înaltă calitate. Clin Neurol Neurosurg. (2019) 179: 9-13. doi: 10.1016 / j.clineuro.2019.02.011

PubMed Abstract | Text integral CrossRef | Google Scholar

90. Strowd RE, Cervenka MC, Henry BJ, Kossoff EH, Hartman AL, Blakeley JO. Modulație glicemică în neuro-oncologie: experiență și direcții viitoare folosind o dietă Atkins modificată pentru tumorile cerebrale de înaltă calitate. Neurooncol Pract. (2015) 2: 127-36. doi: 10.1093 / nop / npv010

PubMed Abstract | Text integral CrossRef | Google Scholar

91. Link TW, Woodworth GF, Chaichana KL, Grossman SA, Mayer RS, Brem H, și colab. Hiperglicemia este asociată independent cu pierderea funcției postoperatorii la pacienții cu glioblastom primar elocvent. J Clin Neurosci. (2012) 19: 996–1000. doi: 10.1016 / j.jocn.2011.09.031

PubMed Abstract | Text integral CrossRef | Google Scholar

92. McGirt MJ, Chaichana KL, Gathinji M, Attenello F, Than K, Ruiz AJ, și colab. Hiperglicemia persistentă ambulatorie este asociată independent cu scăderea supraviețuirii după rezecția primară a astrocitoamelor maligne ale creierului. Neurochirurgie. (2008) 63: 286-91. doi: 10.1227 / 01.NEU.0000315282.61035.48

PubMed Abstract | Text integral CrossRef | Google Scholar

93. Seyfried TN, Sanderson TM, El-Abbadi MM, McGowan R, Mukherjee P. Rolul corpurilor de glucoză și cetonă în controlul metabolic al cancerului cerebral experimental. Br J Rac. (2003) 89: 1375-82. doi: 10.1038 / sj.bjc.6601269

PubMed Abstract | Text integral CrossRef | Google Scholar

94. Derr RL, Ye X, Islas MU, Desideri S, Saudek CD, Grossman SA. Asocierea dintre hiperglicemie și supraviețuire la pacienții cu glioblastom nou diagnosticat. J Clin Oncol. (2009) 27: 1082–6. doi: 10.1200 / JCO.2008.19.1098

PubMed Abstract | Text integral CrossRef | Google Scholar

95. Mayer A, Vaupel P, Struss HG, Giese A, Stockinger M, Schmidberger H. Impact puternic pronostic advers al episoadelor hiperglicemice în timpul chimioradioterapiei adjuvante a glioblastomului multiform. Strahlenther Onkol. (2014) 190: 933-8. doi: 10.1007 / s00066-014-0696-z

PubMed Abstract | Text integral CrossRef | Google Scholar

96. Tieu MT, Lovblom LE, McNamara MG, Mason W, Laperriere N, Millar BA, și colab. Impactul glicemiei asupra supraviețuirii pacienților cu glioblastom tratați cu radiații și temozolomidă. J Neurooncol. (2015) 124: 119–26. doi: 10.1007 / s11060-015-1815-0

PubMed Abstract | Text integral CrossRef | Google Scholar

97. Zhao S, Cai J, Li J, Bao G, Li D, Li Y și colab. Profilarea bioinformatică identifică o semnătură de risc legată de glucoză pentru malignitatea gliomului și supraviețuirea pacienților. Mol Neurobiol . (2016) 54: 8203-10. doi: 10.1007 / s12035-016-0314-4

PubMed Abstract | Text integral CrossRef | Google Scholar

98. Yu M, Chen S, Hong W, Gu Y, Huang B, Lin Y și colab. Rolul prognostic al glicolizei pentru rezultatul cancerului: dovezi din 86 de studii. J Cancer Res Clin Oncol. (2019) 145: 967–99. doi: 10.1007 / s00432-019-02847-w

PubMed Abstract | Text integral CrossRef | Google Scholar

99. Seyfried TN, Yu G, Maroon JC, D’Agostino DP. Press-pulse: o strategie terapeutică nouă pentru gestionarea metabolică a cancerului. Nutr Metab. (2017) 14:19. doi: 10.1186 / s12986-017-0178-2

PubMed Abstract | Text integral CrossRef | Google Scholar

100. Li X, Wu C, Chen N, Gu H, Yen A, Cao L și colab. Calea de semnalizare PI3K / Akt / mTOR și terapia țintită pentru glioblastom. Oncotarget. (2016) 7: 33440-50. doi: 10.18632 / oncotarget.7961

PubMed Abstract | Text integral CrossRef | Google Scholar

101. Israelsen WJ, Dayton TL, Davidson SM, Fiske BP, Hosios AM, Bellinger G și colab. Ștergerea specifică izoformei MG PKM2 relevă o cerință diferențială pentru piruvat kinaza în celulele tumorale. Celulă. (2013) 155: 397-409. doi: 10.1016 / j.cell.2013.09.025

Text integral CrossRef | Google Scholar

102. Marsh J, Mukherjee P, Seyfried TN. Efectele proapoptotice dependente de Akt ale restricției dietetice asupra gestionării în stadiu târziu a unui omolog fosfatază și tensină / complex de scleroză tuberoasă astrocitom de șoarece cu 2 deficiențe. Clin Cancer Res. (2008) 14: 7751-62. doi: 10.1158 / 1078-0432.CCR-08-0213

PubMed Abstract | Text integral CrossRef | Google Scholar

103. Zhang K, Xu P, Sowers JL, Machuca DF, Mirfattah B, Herring J și colab. Analiza proteomică a celulelor glioblastom hipoxice relevă adaptarea metabolică secvențială a căilor metabolice cu un singur carbon. Mol Cell Proteomics. (2017) 16: 1906–21. doi: 10.1074 / mcp.RA117.000154

PubMed Abstract | Text integral CrossRef | Google Scholar

104. Jiang YS, Wang FR. Restricția calorică reduce edemul și prelungește supraviețuirea la un model de gliom de șoarece. J Neuro-Oncol. (2013) 114: 25-32. doi: 10.1007 / s11060-013-1154-y

PubMed Abstract | Text integral CrossRef | Google Scholar

105. Woolf EC, Syed N, Scheck AC. Metabolismul tumorii, dieta ketogenică și beta-hidroxibutiratul: abordări noi ale terapiei adjuvante a tumorilor cerebrale. Front Mol Neurosci. (2016) 9: 122. doi: 10.3389 / fnmol.2016.00122

PubMed Abstract | Text integral CrossRef | Google Scholar

106. Artzi M, Liberman G, Vaisman N, Bokstein F, Vitinshtein F, Aizenstein O și colab. D. Modificări ale metabolismului cerebral în timpul dietei ketogene la pacienții cu tumori cerebrale primare: studiu 1H-MRS. J Neurooncol. (2017) 132: 267-75. doi: 10.1007 / s11060-016-2364-x

Text integral CrossRef | Google Scholar

107. Champ CE, Palmer JD, Volek JS, Werner-Wasik M, Andrews DW, Evans JJ și colab. Direcționarea metabolismului cu o dietă ketogenică în timpul tratamentului glioblastomului multiform. J Neuro-Oncol. (2014) 117: 125-31. doi: 10.1007 / s11060-014-1362-0

PubMed Abstract | Text integral CrossRef | Google Scholar

108. Schwartz K, Chang HT, Nikolai M, Pernicone J, Rhee S, Olson K, și colab. Tratamentul pacienților cu gliom cu diete ketogenice: raportul a două cazuri tratate cu un protocol de dietă ketogenică cu restricție energetică aprobată de IRB și revizuirea literaturii. Cancer Metab. (2015) 3: 3. doi: 10.1186 / s40170-015-0129-1

PubMed Abstract | Text integral CrossRef | Google Scholar

109. David CJ, Chen M, Assanah M, Canoll P, Manley JL. Proteinele HnRNP controlate de c-Myc dereglează piruvat kinaza mplicarea ARNm în cancer. Natură. (2010) 463: 364-8. doi: 10.1038 / nature08697

PubMed Abstract | Text integral CrossRef | Google Scholar

110. Mukherjee J, Phillips JJ, Zheng S, Wiencke J, Ronen SM, Pieper RO. Expresia piruvat kinazei M2, dar nu activitatea piruvat kinazei, este reglată în mod specific, în grade, în gliomul uman. Plus unu. (2013) 8: e57610. doi: 10.1371 / journal.pone.0057610

PubMed Abstract | Text integral CrossRef | Google Scholar

111. Jiang Y, Li X, Yang W, Hawke DH, Zheng Y, Xia Y și colab. PKM2 reglează segregarea cromozomială și progresia mitozei celulelor tumorale. Mol Cell. (2014) 53: 75-87. doi: 10.1016 / j.molcel.2013.11.001

PubMed Abstract | Text integral CrossRef | Google Scholar

112. Xu W, Yang H, Liu Y, Yang Y, Wang P, Kim SH și colab. 2-hidroxiglutaratul de oncometabolit este un inhibitor competitiv al dioxigenazelor dependente de alfa-cetoglutarat. Celula cancerului. (2011) 19: 17-30. doi: 10.1016 / j.ccr.2010.12.014

PubMed Abstract | Text integral CrossRef | Google Scholar

113. Chesnelong C, Chaumeil MM, Blough MD, Al-Najjar M, Stechishin OD, Chan JA și colab. Lactatul dehidrogenază A care se reduce la glioamele mutante IDH. Neuro Oncol. (2014) 16: 686-95. doi: 10.1093 / neuonc / not243

PubMed Abstract | Text integral CrossRef | Google Scholar

114. Venneti S, Dunphy MP, Zhang H, Pitter KL, Zanzonico P, Campos C, și colab. Imagistica PET bazată pe glutamină facilitează evaluarea metabolică îmbunătățită a gliomilor in vivo . Sci Transl Med . (2015) 7: 274ra217. doi: 10.1126 / scitranslmed.aaa1009

PubMed Abstract | Text integral CrossRef | Google Scholar

115. Dang L, White DW, Gross S, Bennett BD, Bittinger MA, Driggers EM și colab. Mutațiile IDH1 asociate cancerului produc 2-hidroxiglutarat. Natura . (2009) 462: 739-44. doi: 10.1038 / nature08617

PubMed Abstract | Text integral CrossRef | Google Scholar

116. Liu FM, Gao YF, Kong Y, Guan Y, Zhang J, Li SH și colab. Valoarea diagnosticului consumului mai scăzut de glucoză pentru glioamele mutate IDH1 pe FDG-PET. Cancer BMC. (2021) 21:83. doi: 10.1186 / s12885-021-07797-6

PubMed Abstract | Text integral CrossRef | Google Scholar

117. Hanahan D, Weinberg RA. Semne distinctive ale cancerului: generația următoare. Celulă. (2011) 144: 646-74. doi: 10.1016 / j.cell.2011.02.013

Text integral CrossRef | Google Scholar

118. Seyfried TN, Huysentruyt LC. Despre originea metastazelor cancerului. Rev. Oncogeneza critică. (2013) 18: 43–73. doi: 10.1615 / CritRevOncog.v18.i1-2.40

Text integral CrossRef | Google Scholar

119. Huysentruyt LC, Akgoc Z, Seyfried TN. Ipoteză: macrofagele / microglia neoplazice sunt prezente în glioblastomul multiform? ASN Neuro. (2011) 3: e00064. doi: 10.1042 / AN20110011

PubMed Abstract | Text integral CrossRef | Google Scholar

120. Rahimi Koshkaki H, Minasi S, Ugolini A, Trevisi G, Napoletano C, Zizzari IG, și colab. Caracterizarea imunohistochimică a infiltratului imunitar în microambientul tumoral al glioblastomului. J Pers Med. (2020) 10: 112. doi: 10.3390 / jpm10030112

PubMed Abstract | Text integral CrossRef | Google Scholar

121. Garvin S, Oda H, Arnesson LG, Lindstrom A, Shabo I. Expresia celulară tumorală a CD163 este asociată cu radioterapia postoperatorie și prognosticul slab la pacienții cu cancer de sân tratați cu o intervenție chirurgicală conservatoare de sân. J Cancer Res Clin Oncol. (2018) 144: 1253–63. doi: 10.1007 / s00432-018-2646-0

PubMed Abstract | Text integral CrossRef | Google Scholar

122. Lillie EO, Patay B, Diamant J, Issell B, Topol EJ, Schork NJ. Studiul clinic n-of-1: strategia finală pentru individualizarea medicinei? Per Med. (2011) 8: 161–73. doi: 10.2217 / pme.11.7

PubMed Abstract | Text integral CrossRef | Google Scholar

123. Denny CA, Heinecke KA, Kim YP, Baek RC, Loh KS, Butters TD și colab. Dieta ketogenică restricționată îmbunătățește acțiunea terapeutică a N-butildeoxinojirimicinei către acumularea creierului GM2 la șoarecii adulți cu boala Sandhoff. J Neurochem. (2010) 113: 1525–35. doi: 10.1111 / j.1471-4159.2010.06733.x

PubMed Abstract | Text integral CrossRef | Google Scholar

124. Altinoz MA, Ozpinar A, Seyfried TN. Acidul caprilic (octanoic) ca potențial chimioterapeutic al acidului gras pentru glioblastom. Acizi grași esențiali Prostagl Leukot . (2020) 159: 102142. doi: 10.1016 / j.plefa.2020.102142

PubMed Abstract | Text integral CrossRef | Google Scholar

Cuvinte cheie: standard de îngrijire, glicoliză, glutaminoliză, post, fosforilare la nivel de substrat mitocondrial (mSLP), 2-hidroxiglutarat, dietă carnivoră

Citare: Seyfried TN, Shivane AG, Kalamian M, Maroon JC, Mukherjee P și Zuccoli G (2021) Terapie metabolică ketogenică, fără chimio sau radiații, pentru gestionarea pe termen lung a IDH1- Glioblastomul mutant: o urmărire de 80 de luni Raport de caz. Față. Nutr. 8: 682243. doi: 10.3389 / fnut.2021.682243

Primit: 18 martie 2021; Acceptat: 07 mai 2021;
Publicat: 31 mai 2021.

Editat de:Kathryn Knecht , Universitatea Loma Linda, Statele Unite

Revizuite de:Rainer Johannes Klement , Spitalul Leopoldina, Germania
Arkadiusz Damian Liśkiewicz , Universitatea de Medicină din Silezia, Polonia

Drepturi de autor © 2021 Seyfried, Shivane, Kalamian, Maroon, Mukherjee și Zuccoli. Acesta este un articol cu ​​acces liber distribuit în conformitate cu condițiile Creative Commons Attribution License (CC BY) . Utilizarea, distribuirea sau reproducerea în alte forumuri este permisă, cu condiția ca autorul (autorii) original (i) și deținătorul (autorii) drepturilor de autor să fie creditați și dacă publicația originală din această revistă este citată, în conformitate cu practica academică acceptată. Nu este permisă nicio utilizare, distribuție sau reproducere care nu respectă acești termeni.

* Corespondență: Thomas N. Seyfried, Thomas.seyfried@bc.edu ; Giulio Zuccoli, giulio.zuccoli@gmail.com

https://www.frontiersin.org/articles/10.3389/fnut.2021.682243/full

Efectele suplimentării genisteinei asupra metilării ADN la nivelul genomului și a expresiei genice la pacienții cu cancer de prostată localizat

Birdal Bilir , 1, 5 Nitya V. Sharma , Jeongseok Lee , Bato Hammarstrom , 2, 7 Aud Svindland , 3, 4 Omer Kucuk , 5, 6 și Carlos S. Moreno 1, 6

Genisteina [4 ‘, 5,7-trihidroxiizoflavonă sau 5,7-dihidroxi-3- (4-hidroxifenil) cromen-4-onă] este o formă de agliconă izoflavonoidă, derivată din plante, genistină (un glicozid) (Nayeem et. al., 2019 [ 16 ]; Sansai și colab., 2020 [ 20 ]). Genisteina se găsește în principal în plantele leguminoase, în special în soia împreună cu alte izoflavone importante, daidzeina și gliciteina (Kalaiselvan și colab., 2010 [ 12 ]). Alte surse de genisteină includ fasole, naut, legume, fructe, nuci, alimente pe bază de soia și suplimente de genisteină. De asemenea, s-a raportat că boabele de soia nefermentate conțin mai multă genisteină decât cele fermentate (Kuligowski și colab., 2017 [ 13 ]; Li și Zhang, 2017 [ 14]]). În plus, genisteina poate fi sintetizată prin introducerea genei IFS (gena izoflavonei sintază) în celulele de drojdie și liniile de orez, ceea ce duce la un conținut crescut de genisteină în orez (până la 30 de ori) (Spagnuolo și colab., 2015 [ 23 ]) .

1 Departamentul de patologie și medicină de laborator, Universitatea Emory, Atlanta, GA, SUA2 Departamentul de Urologie, Institutul de Cercetare a Cancerului, Spitalul Universitar Oslo3 Departamentul de Medicină Clinică, Universitatea din Oslo4 Departamentul de Patologie, Spitalul Universitar Oslo, Oslo, Norvegia5 Departamentul de hematologie și oncologie medicală6 Winship Cancer Institute, Emory University, Atlanta, GA, SUACorespondență cu: Dr. Carlos S. Moreno, Departamentul de patologie și medicină de laborator, Winship Cancer Institute, Emory University, Whitehead Research Building, camera 105J, 615 Michael Street, Atlanta, GA 30322, SUA, E-mail: ude.yrome@oneromcAdresa actuală: Departamentul de Medicină de Mediu și de Muncă, Spitalul Universitar Oslo, Oslo, NorvegiaAcest articol a fost citat de alte articole din PMC.Mergi la:

Abstract

Studiile epidemiologice au arătat că compușii dietetici au efecte semnificative asupra carcinogenezei prostatei. Dintre agenții dietetici, genisteina, izoflavona majoră din soia, prezintă un interes deosebit, deoarece consumul ridicat de produse din soia a fost asociat cu o incidență scăzută a cancerului de prostată, sugerând un rol preventiv al genisteinei în cancerul de prostată. În ciuda numeroaselor studii pentru a înțelege efectele genisteinei asupra cancerului de prostată, mecanismele de acțiune nu au fost pe deplin elucidate. Am investigat diferențele dintre nivelurile de metilare și expresie genică ale specimenelor de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie folosind Illumina HumanMethylation450 și Illumina HumanHT-12 v4 Expression BeadChip Microarrays Prezentul studiu a fost un studiu randomizat, controlat cu placebo,studiu clinic dublu-orb pe pacienți norvegieni care au primit zilnic 30 mg genisteină sau capsule placebo timp de 3-6 săptămâni înainte de prostatectomie. Modificările exprimării genei au fost validate prin PCR cantitativă (qPCR). Metilarea genomului întreg și profilarea expresiei au identificat site-uri metilate diferențial și au exprimat gene între grupurile placebo și genisteină. Genele reglementate diferențial au fost implicate în procesele de dezvoltare, markerii celulelor stem, proliferarea și reglarea transcripțională. Analiza îmbogățirii a sugerat reducerea generală a activității MYC și creșterea activității PTEN la pacienții tratați cu genisteină. Aceste descoperiri evidențiază efectele genisteinei asupra modificărilor globale în expresia genelor în cancerul de prostată și efectele sale asupra căilor moleculare implicate în tumorigeneză de prostată.Cuvinte cheie: genisteină, cancer de prostată, metilare ADN, expresie geneticăMergi la:

Introducere

Cancerul de prostată este cea mai frecvent diagnosticată afecțiune malignă și a doua cauză principală de deces prin cancer în rândul bărbaților din Statele Unite. Se estimează că aproximativ 180.890 de cazuri noi de cancer de prostată și 26.120 de decese cauzate de cancer de prostată au avut loc în SUA în 2016 ( 1 ). Factorii de risc comuni pentru cancerul de prostată sunt vârsta, rasa / etnia, geografia, istoricul familial și stilul de viață ( 2 ). În funcție de gravitatea bolii, opțiunile actuale de tratament pentru cancerul de prostată includ terapii unice sau o combinație de terapii, cum ar fi supravegherea activă, chirurgia, radioterapia, chimioterapia, terapia hormonală sau vaccinurile ( 3). Deși aceste intervenții au îmbunătățit semnificativ calitatea vieții pacienților și ratele globale de supraviețuire, tratamentul eficient al cancerului de prostată este încă limitat datorită provocărilor majore, cum ar fi eterogenitatea genetică, recurența tumorii (~ 30% din cazuri) și rezistența la medicamente chimioterapeutice convenționale ( 4 – 6 ). Prin urmare, este crucial să se dezvolte noi strategii preventive și terapeutice care au potențialul de a îmbunătăți rezultatele pentru pacienții cu cancer de prostată.

Studiile epidemiologice au arătat că există o diferență semnificativă în ratele de incidență și mortalitate ale cancerului de prostată între diferite țări, cu cele mai ridicate rate în SUA și țările europene și cele mai mici rate în țările asiatice, cum ar fi Japonia și China ( 7 , 8 ). Această variabilitate largă a ratelor de cancer de prostată între țări sugerează că mai mulți factori, inclusiv diferențele genetice, epigenetice și de mediu, joacă un rol cheie în etiologia bolii. În special, s-a demonstrat că imigranții asiatici din SUA au o incidență crescută a cancerului de prostată în comparație cu acei indivizi cu același background genetic care trăiesc în Asia, indicând faptul că factorii de mediu, în special dieta, sunt factorii determinanți majori ai incidenței cancerului de prostată (9 ). Una dintre diferențele dietetice remarcabile dintre țările asiatice și cele occidentale este cantitatea de consum de alimente pe bază de soia. Populațiile asiatice consumă cantități mari de alimente din soia, care sunt bogate în izoflavone (~ 2 g de izoflavone pe kg de soia proaspătă) ( 10 ). S-a demonstrat că concentrațiile plasmatice și de lichide prostatice ale izoflavonelor la bărbații asiatici sunt de 10 până la 100 de ori mai mari decât cele la bărbații occidentali, cu niveluri deosebit de ridicate ale genisteinei de izoflavonă ( 11 , 12 ). Un număr tot mai mare de studii bazate pe populație a demonstrat că aportul ridicat de izoflavone din soia este asociat cu un risc redus cu 25-30% de cancer de prostată ( 13 , 14 ).

Fiind principala izoflavonă biologic activă în dieta soia, genisteina a fost investigată pe larg pentru potențialul său chimiopreventiv în diferite tipuri de cancer, inclusiv în cancerul de prostată. Aportul zilnic mediu de genisteină la populațiile asiatice sa dovedit a fi de 20-80 mg, în timp ce este de 1-3 mg în SUA, susținând efectele protectoare ale genisteinei împotriva cancerului de prostată la bărbații asiatici ( 15 ). Genistein atinge concentrațiile plasmatice de 1-5 u , M 6-8 ore după ingestia de dieta bogata soia ( 11 , 16 ). Timpul de înjumătățire plasmatică al genisteinei a fost raportat la 7,9 ore la adulți. În plus, concentrațiile de izoflavone totale din soia din țesutul prostatei s-au arătat de ~ 6 ori mai mari decât nivelurile serice de izoflavone ( 17). Studiile de siguranță și farmacocinetice ale izoflavonelor din soia au demonstrat că s-a observat o toxicitate clinică minimă la subiecții sănătoși administrați cu izoflavone din soia purificate la doze care depășesc aporturile alimentare normale ( 18 ).

Datorită similarității sale structurale cu hormonul steroid 17β-estradiol, se leaga genisteina la receptorii de estrogen, ER-α și ER-β, cu o afinitate mai mare pentru ER-β, și acționează ca un modulator naturale selectiv al receptorului de estrogen ( 16 , 19 , 20 ). Genisteina își exercită efectele inhibitoare asupra celulelor canceroase de prostată prin reglarea în sus a expresiei ER-β, care are roluri anti-proliferative și pro-apoptotice în celulele prostatei ( 21 , 22 ). În plus față de activitățile sale estrogenice, genisteina reglează căile mediate de receptorul androgen (AR) în cancerul de prostată ( 23 , 24 ). De remarcat, s-a arătat că efectul inhibitor al genisteinei asupra expresiei AR este mediat și de ER-β (25 ). Mai multe alte mecanisme moleculare care stau la baza efectelor preventive ale genisteinei asupra cancerului de prostată includ inhibarea proliferării celulare prin inducerea opririi ciclului celular G1 și / sau G2 / M ( 26 – 28 ), angiogeneză ( 29 , 30 ) și metastază ( 31 – 33 ) și inducerea apoptozei ( 34 , 35 ). Genisteina își exercită efectele pleiotrope în contextul cancerului de prostată prin modularea mai multor căi de transducție a semnalului celular, cum ar fi IGF-1 ( 36 ), TGF-β ( 37 ), Wnt / β-catenină ( 36 ), NF-κB ( 38 ) , AKT și MAPK ( 39) semnalizare. Această modulare ar putea fi legată direct de receptorii nucleari sau modificarea stării de fosforilare a proteinelor de transducție a semnalului. În plus, genisteina inhibă activitățile tirozin kinazei ( 40 ) și prezintă proprietăți antioxidante ( 41 , 42 ) în celulele prostatei. Swami și colab. ( 43 ) au demonstrat că genisteina reduce progresia cancerului de prostată prin inhibarea sintezei și activității prostaglandinelor. De asemenea, sa raportat că genisteina are posibile efecte asupra deteriorării și reparării ADN-ului în celulele canceroase de prostată ( 42 ). Mai mult, genisteina inhibă metilarea ADN-ului ( 44 – 48 ) și modificările histonice ( 47 ,48 ) și reglează miARN ( 49 – 52 ) în cancerul de prostată. Este de interes că genisteina sa dovedit a spori eficacitatea radioterapiei și a chimioterapiei ( 53 , 54 ).

Deși au fost efectuate numeroase studii in vitro și in vivo pentru a înțelege efectele protectoare ale genisteinei împotriva cancerului de prostată, demonstrate prin studii epidemiologice, mecanismele moleculare care guvernează modul în care genisteina afectează patogeneza cancerului de prostată rămân în continuare evazive. Este de remarcat faptul că o provocare majoră este variabilitatea largă a efectelor genisteinei în funcție de doză, de forma de administrare sau de momentul și durata expunerii ( 55). În ciuda bogăției de studii efectuate pe linii celulare umane și modele animale, doar câteva studii clinice prospective randomizate au fost efectuate pentru a examina efectele moleculare ale genisteinei asupra cancerului de prostată. În studiul de față, după cunoștințele noastre pentru prima dată, am investigat efectele intervenției genisteinei asupra metilării globale și a modelelor de expresie genică la pacienții cu cancer de prostată localizat și am identificat ținte noi care sunt modulate diferențial prin suplimentarea cu genisteină, oferind alte perspective mecaniciste asupra efectelor genisteinei asupra carcinogenezei prostatei.Mergi la:

Materiale și metode

Subiecte

Probele de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie ( 56 ) au fost analizate pentru modificări globale în metilarea ADN și expresia genelor. Participanții au fost recrutați din ambulatoriul de la Departamentul de Urologie, Spitalul Universitar Oslo, Oslo, Norvegia în perioada aprilie 2007 – august 2008. Studiul a fost aprobat de Agenția Norvegiană pentru Medicamente, Comitetul Regional de Etică, Ombudsmanul pentru confidențialitate și Prostate Biobank la Spitalul Universitar Oslo, Aker.

Profilarea metilării la nivelul genomului

ADN-ul total a fost izolat din țesuturile de prostată înghețate folosind kitul DNeasy Blood and Tissue (Qiagen, Valencia, CA, SUA) conform instrucțiunilor producătorului. ADN-ul a fost supus nucleului de genomică integrată Emory pentru analiza metilării ADN-ului folosind Illumina HumanMethylation450 BeadChip Microarrays. Datele de metilare sunt disponibile pe GEO (numărul de acces GSE84749 ).

Profilarea expresiei la nivel de genom

ARN-ul total a fost extras din țesuturile de prostată înghețate folosind kitul de izolare miVNA mirVana (Life Technologies, Grand Island, NY, SUA), urmat de curățarea ARN folosind kitul RNeasy Mini (Qiagen). ARN-ul total a fost trimis la nucleul de genomică integrat Emory pentru analiza expresiei genice utilizând Illumina HumanHT-12 v4 Expression BeadChip Microarray. Datele despre microarray sunt disponibile pe GEO (numărul de acces GSE84748 ).

Analiza PCR cantitativă (qPCR)

ARN a fost transcris invers în ADNc folosind kitul de sinteză ADNc iScript (Bio-Rad Laboratories, Hercules, CA, SUA). Grundurile au fost proiectate folosind instrumentul Primer3. Secvențele primerilor sunt enumerate înTabelul I. qPCR a fost efectuat folosind iQ SYBR-Green Supermix (Bio-Rad Laboratories) pe un iCycler Bio-Rad conform protocoalelor producătorului. Gena β-actină umană, care s-a dovedit a fi o genă validă de referință pentru normalizarea qPCR în probe de țesut uman de cancer de prostată, a fost utilizată ca control intern în prezentul studiu ( 57 ). Ca calibrator s-a folosit o probă normală de țesut prostatic. Modificările relative ale datelor de exprimare a genei au fost analizate prin metoda 2 −ΔΔCT . S-au efectuat triplicate pentru fiecare probă. Datele sunt prezentate ca medie ± deviație standard.

Tabelul I

Secvențe ale primerilor utilizați în analiza PCR cantitativă.

Numele primarSecvență primară (5 ′ → 3 ′)
CKS2-FPTTAGTCTCCGGCGAGTTGTTG
CKS2-RPCATAACATGCCGGTACTCGT
JAG1-FPAGTCGTGCATGCTCCAATCG
JAG1-RPCCCCACACACACTTGGCTC
NOTCH3-FPGATGTGGACGAGTGTGCTGG
NOTCH3-RPCAGGCATGGGTTGGGGTC
MMP26-FPGGACTTTGTTGAGGGCTATTTCCA
MMP26-RPGGAGGTGTCGGACCCATCAG
HIF1A-FPCACCACAGGACAGTACAGGAT
HIF1A-RPCGTGCTGAATAATACCACTCACA
CDK6-FPGCTGACCAGCAGTACGAATG
CDK6-RPGCACACATCAAACAACCTGACC
CD24-FPCGCGGACTTTTCTTTTGGGG
CD24-RPACTGGAATAAATCTGCGTGGGT
AMACR-FPCCGTTCTGTGCTATGGTCCTG
AMACR-RPAGCCTTGGATTTTCCCGCTG
MYC-FPCCTACCCTCTCAACGACAGC
MYC-RPTTGTTCCTCCTCAGAGTCGC
SPP1-FPCAAACGCCGACCAAGGAAAA
SPP1-RPGGCCACAGCATCTGGGTATT
NEU1-FPCGCAGCTATGATGCCTGTGA
NEU1-RPGGTCAGGTTCACTCGGAACTC
ADCY4-FPCCTGGGACCAGGTGTCCTAT
ADCY4-RPCAAGATACAGCCCGAGGACC
β-actină-FPCACAGAGCCTCGCCTTTGCC
β-actină-RPTGACCCATGCCCACCATCAC

Analiza qPCR.

Analiza datelor

Analiza expresiei genice a fost efectuată utilizând modulul GenePattern ComparativeMarkerSelection ( 58 ) comparând tumorile tratate cu genisteină cu tumorile tratate cu placebo. Datele Illumina Microarray au fost filtrate pentru a include gene care au fost detectate (P <0,05) în cel puțin un grup experimental pentru a rezulta într-un set de date de 15918 gene pentru analiză. Modulul de selecție a markerului comparativ al GenePattern a fost utilizat pentru a calcula testele t-Student ale celor două fețe între grupuri cu 10.000 permutări pentru a calcula ratele de descoperire false. Sămânța aleatorie utilizată a fost 779948241. Clusterul ierarhic a fost realizat utilizând software-ul Cluster ( 59 ) și Java TreeView ( 60 ). Analiza microarray de metilare a fost efectuată în R utilizând modulul CpGassoc în Bioconductor ( 61). Datele de la sondele de 450K au fost filtrate la cele în care valoarea β maximă – minimă a fost> 0,2 pentru a rezulta sonde de 160K pentru analiza diferențială a metilării. CpGassoc a fost utilizat pentru a identifica 162 de sonde semnificative care au fost metilate diferențial. Trei sonde au fost metilate diferențial între probele tumorale tratate cu genisteină și probele tumorale tratate cu placebo, trei sonde au fost semnificative între probele tumorale tratate cu genisteină și probele normale și 156 au fost semnificativ diferite între probele tumorale tratate cu placebo și probele normale.

analize statistice

Testul U Mann-Whitney (cu două cozi) a fost utilizat pentru a determina diferențe semnificative între două grupuri de date. P <0,05 a fost considerat semnificativ statistic.Mergi la:

Rezultate

Caracteristici clinicopatologice

Am analizat probe de țesut prostatic dintr-un studiu anterior, care a fost un studiu clinic randomizat, controlat placebo, dublu-orb, de fază 2, pe pacienți norvegieni cu cancer de prostată localizat care au primit 30 mg genisteină sintetică sau capsule placebo zilnic timp de 3-6 săptămâni înainte de radical prostatectomie ( 56 ). Caracteristicile clinice și patologice ale cazurilor au fost descrise anterior ( 56 ). Disponibilitatea țesutului înghețat a limitat dimensiunea eșantionului în acest studiu și am investigat metilarea ADN și nivelurile de expresie genică a probelor de tumori de prostată de la 10 pacienți care au primit genisteină și 10 pacienți care au primit placebo. Au fost de asemenea analizate patru probe adiacente de țesut normal de prostată. Datele clinice pentru cei 20 de pacienți analizați aici sunt furnizate înTabelul II. Nu au existat diferențe semnificative statistic în ceea ce privește vârsta, nivelurile PSA serice și scorul Gleason între cele două grupuri de tratament.

Tabelul II

Date clinice pentru cei 20 de pacienți analizați în prezentul studiu.

TratamentID-ul pacientuluiGleasonSuma GleasonEtapăVârstăPSA
Genisteină (n = 10)13 + 4726812.0
73 + 4726810.9
83 + 362596.2
103 + 473a615.1
133 + 362587.6
144 + 373a648.5
174 + 482616.1
183 + 362576.0
193 + 362637.8
203 + 472687.9
Media (SD)6,7 (0,7)62,7 (4,2)7,8 (2,2)
Placebo (n = 10)243 + 362616.4
253 + 362574.2
263 + 473a689.9
274 + 482699.2
304 + 372555.1
333 + 362566.4
343 + 362637.6
353 + 473a605.7
383 + 472629.9
393 + 362667.0
Media (SD)6,6 (0,7)61,7 (4,9)7.1 (2.0)

Metilare diferențială în țesutul tratat cu genisteină în comparație cu țesutul tratat cu placebo

Profilurile de metilare a ADN-ului la nivelul genomului unui total de 24 de probe de prostată din țesuturi tumorale sau normale au fost generate folosind trusa Illumina HumanMethylation450 BeadChip. Starea de metilare a fiecărei probe a fost analizată pentru 485.577 de situri, acoperind 21.231 de gene. Am comparat profilurile de metilare ale probelor de tumori tratate cu genisteină cu cazurile tratate cu placebo. În general, modificările de metilare au fost modeste și nu a existat o genă metilată semnificativ diferențiat după corecție pentru testarea ipotezelor multiple. Cu toate acestea, valorile P necorectate au indicat faptul că RBM28 și CYTSBgenele au fost demetilate în probe tumorale tratate cu genisteină comparativ cu probele tratate cu placebo. Lipsa semnificației statistice s-a datorat probabil numărului mic de probe analizate în acest studiu. Am observat 156 de sonde cu metilare crescută semnificativ în țesuturile tumorale tratate cu placebo față de țesuturile normale care nu au fost semnificative între țesuturile tumorale tratate cu genisteină și țesuturile normale, sugerând că genisteina ar putea avea unele efecte de demetilare (disponibile la cerere). Aceste 156 de sonde corespundeau a cel puțin 92 de gene separate, inclusiv ADCY4 , ALOX12 , HAAO , LRRC4 , NEU1 , RAPGEFL1 și WNT7B (Tabelul III).

Tabelul III

Lista a 156 de sonde metilate diferențial (92 de gene).

ID țintăNumele geneiValoarea P (GT vs. PT)Valoarea P (GT vs. N)Valoarea P (PT vs. N)
cg00353923LRRC4; SND1nsns0,000214451
cg00420348EFCAB4Ansns0,000247793
cg00459232CD9nsns0,000270319
cg00494665nsns0,000274219
cg00506168PDXKnsns0,000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0,000393857
cg01228355CORINnsns0,000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0,000942104
cg01561916HAAOnsns0,00015216
cg01684881FZD2nsns0,000472597
cg01856645DMGDH; BHMT2nsns0,000876054
cg02072400nsns3.73E-05
cg02131967ASnsns0,000468338
cg02215070AKR1B1nsns0,000607743
cg02493798ALOX12nsns0,000106934
cg02534363NBEAL2nsns0,000263128
cg02659920EPS8L2nsns0,000563556
cg02665650ANKS1Ansns0,000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0,000993538
cg03119308RBM280,000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0,000320776
cg03452174RAB34nsns0,000820466
cg03456213C9orf3nsns0,000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0,000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

Deschideți într-o fereastră separată

GT, tumoare tratată cu genisteină; PT, tumoare tratată cu placebo; N, normal; NS, nu semnificativ.

Profilul expresiei genei se modifică după tratamentul cu genisteină

Pentru a identifica efectele moleculare ale genisteinei asupra nivelurilor de ARNm în cancerul de prostată, am comparat profilurile de expresie genică ale tumorilor tratate cu genisteină cu probele tratate cu placebo. Din nou, nu au existat probe exprimate diferențial care să rămână semnificative statistic după corecție pentru testarea ipotezelor multiple. Cu toate acestea, au existat 628 de sonde care au atins valori P semnificative nominal (disponibile la cerere). Gruparea ierarhică a acestui set de date a arătat o segregare puternică a pacienților cu și fără tratament cu genisteină (Fig. 1). Genele cu valori P semnificative nominal au inclus gene NOTCH3 , JAG1 , CKS2 , HIF1A , CDK6 , MYC , CD24 , AMACR , MMP26 și SPP1 (Tabelul IV). NEU1 și ADCY4 nu au atins semnificație nominală , dar a avut o tendință spre semnificație, și integrarea datelor de metilare cu nivelurile de expresie expresia genelor pereche de profile de date indicate au scăzut stare de metilare și crescute de ADCY4 si NEU1 gene in cazurile tratate genisteina.figura 1

Profilarea expresiei întregului genom al probelor de tumori tratate cu placebo sau genisteină. Gruparea ierarhică a modificărilor în expresia genelor pentru acele gene cu un P <0,05 nominal între probele genistein-tumorale și probele placebo-tumorale.

Tabelul IV

Gene cu expresie diferențială a genelor analizate prin qPCR.

Simbol genicExpresia genelor se schimbă
MicroarrayqPCR
CKS2−2,02−2,50
NOTCH31,722.08
HIF1A−1,63−1,80
CDK6−2,87−1,57
JAG11,916.00
NEU1 a1,771,50
ADCY4 a1,671,60
C-UL MEU−1,57−2.30
CD24−2,02−2,64
AMACR−1,95−2.14
MMPP26−2,78−2,84
SPP1−2,36−3.09

Modificările de pliuri sunt genisteină-tumoră / placebo-tumorăo stare de metilare a ADN-ului este corelată cu expresia genelor în NEU1 și ADCY4. qPCR, PCR cantitativă.

Validarea datelor microarray

Am investigat nivelurile de expresie a 12 gene selectate (Tabelul IV) în toate cele 24 de eșantioane analizate prin microarrays folosind qPCR și au observat că datele microarray au fost corelate cu rezultatele qPCR (Fig. 2). Creșterea nivelurilor de expresie qPCR ale genelor NOTCH3 și JAG1 în tumorile tratate cu genisteină comparativ cu tumorile tratate cu placebo au fost semnificative statistic prin testul U Mann-Whitney.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este IJO-51-01-0223-g01.jpg

Deschideți într-o fereastră separatăFigura 2

Analiza qPCR a nivelurilor de expresie a 12 gene din grupurile placebo și genisteină. Modificările de expresie ale genelor selectate din datele microarray au fost validate folosind qPCR. Datele sunt prezentate ca modificări ale pliurilor în raport cu probele de control. qPCR, PCR cantitativă.

Analiza îmbogățirii

Am efectuat analize de îmbogățire a genei pe cele 628 de sonde semnificative nominal care au fost exprimate diferențial între probele de genisteină și placebo (Tabelul V) folosind Analiza căii de ingeniozitate ( 62 ) și baza de cunoștințe DAVID ( 63). Valoarea P indică distribuția hipergeometrică Valorile P ale suprapunerii pentru seturile de gene și categoriile funcționale. FDR indică o rată de descoperire falsă, corectate valorile P ale suprapunerii. Scorul z de activare este o indicație a consistenței membrilor în sus și în jos reglementați ai unui set de gene, cum ar fi o funcție biologică (tabelul de sus) sau țintele unui regulator în amonte (tabelul de mijloc). Scorurile de activare z> 2 sau <−2 sunt semnificative statistic pentru consistența activării sau inhibării. Moleculele indică numărul de molecule din setul de 628 de sonde analizate care se suprapun cu o anumită categorie. Rețeaua mecanistică indică numărul total de gene țintă ale unui regulator în amonte, iar numărul de gene suprapuse este indicat între paranteze. Am observat îmbogățirea termenilor asociați cu angiogeneza, apoptoza, tranziția epitelială la mezenchimală,progresia tumorii și legarea PDGF. Analiza potențialelor regulatoare din amonte prin analiza IPA a sugerat că PTEN și PDGF au fost activate, în timp ce MYC, β-estradiol, receptorul glucocorticoid NR3C1 și interferon-γ au fost reprimate ca răspuns la tratamentul cu genisteină.

Tabelul V

Analiza îmbogățirii a 628 de sonde semnificative nominal exprimate diferențial între grupurile de genisteină și placebo.

AnalizăValoarea PActivare scor zNumărul de moleculeFuncţie
IPA5.92E-080,77318Progresia tumorii
IPA4.88E-071,01355Neoplasm abdominal
IPA1.09E-061.92728Diferențierea liniilor celulare tumorale
IPA1.34E-06−1.01719Tranziția epitelial-mezenchimală
IPA7.46E-062.41222Tumora neuroendocrină
IPA7.98E-052.05428Necroza tumorii
AnalizăValoarea P a suprapuneriiActivare scor zRețea mecanicistăRegulator în amonte
IPA3.85E-08−0,692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0,832144 (13)IFNG
IPA2.17E-061,608141 (16)PTEN
IPA4.59E-06−2.995133 (13)C-UL MEU
AnalizăFDRActivare scor zNumărul de moleculeTermen
DAVID7.90E-04N / A17GO: 0005840 ribozom
DAVID1.19E-02N / A34mitocondrie
DAVID2.00E-02N / A16GO: 0001568 dezvoltarea vaselor de sânge
DAVID1.77E-02N / A10GO: 0019838 legarea factorului de creștere
DAVID3.52E-02N / A7GO: 0008629 inducerea apoptozei prin semnale intracelulare
DAVID3.16E-02N / A4GO: 0048407 legarea factorului de creștere derivat din trombocite

Deschideți într-o fereastră separatăMergi la:

Discuţie

Din câte știm, prezentul studiu este primul care evidențiază efectele genisteinei asupra modificărilor globale ale metilării ADN și ale expresiei genice la pacienți dintr-un studiu clinic de genisteină în cancerul de prostată. Analiza integrativă a metilării genomului întreg și profilarea expresiei au identificat un număr de situri candidate metilate diferențial și au exprimat site-uri între grupurile placebo și genisteină. Cu toate acestea, diferențele dintre grupurile placebo și grupurile cu genisteină nu au fost semnificative statistic după corecție pentru testarea multiplelor ipoteze, posibil datorită numărului mic de cazuri din acest studiu. Deși modificările induse de genisteină nu sunt semnificative, aceste rezultate pot ajuta la elucidarea mecanismelor moleculare care stau la baza activităților genisteinei în cancerul de prostată.Matricile de metilare a ADN-ului la nivel de genom au arătat că un număr de gene, inclusivRBM28 și CYTSB , păreau a fi demetilate în probele tumorale tratate cu genisteină, comparativ cu probele din grupul placebo. Cu toate acestea, nu am observat modificări ale nivelurilor de expresie ale acestor gene. Printre genele exprimate diferențial identificate prin analiza microarray s-au numărat CKS2 , NOTCH3 , HIF1A , CDK6 , JAG1 , NEU1 , ADCY4 , MYC , CD24 , AMACR , MMP26 și SPP1. Datele microarray au fost confirmate prin analiza qPCR a acestor gene. Alte gene cu semnificație nominală prin microarray, dar care nu au fost testate de qPCR au inclus ZNF639 , CRIM1 , PGC și USP54 (disponibil la cerere).

Este interesant de remarcat faptul că statutul de metilare ADN – ul a fost corelat invers cu expresia genelor pentru NEU1 si ADCY4 gene, care a scazut de metilare și expresia crescută a ARNm în grupul genisteina comparativ cu grupul placebo. Descoperirea noastră care arată potențialul genisteinei pentru demetilarea ADN-ului este în concordanță cu datele raportate anterior care sugerează că genisteina acționează ca un inhibitor al DNMT, provocând astfel demetilarea insulelor CpG în promotorii genelor. De exemplu, s-a demonstrat că genisteina reactivează genele supresoare tumorale cu tăcere hipermetilată, inclusiv p16INK4a , receptorul de acid retinoic β ( RARβ ) și O 6-metilguanină metiltransferază ( MGMT), în celulele canceroase de prostată și esofag ( 46 ). Mai mult, genisteina a fost implicată în demetilarea promotorului WNT5a în celulele cancerului de colon ( 64 ). Una dintre genele care s-au dovedit a fi demetilate de genisteină în studiul de față este ADCY4, care este un membru al familiei adenilat ciclaselor, enzimele legate de membrană care catalizează formarea adenozinei monofosfat ciclic mesager secundar (AMPc) ( 65 ). În concordanță cu constatările noastre, s-a demonstrat recent că ADCY4 este un marker de metilare a ADN-ului care reprezintă evenimente epigenetice timpurii în tumorigeneză de prostată, susținând ipoteza noastră că genisteina poate inversa modelul metilării ADN-ului în ADCY4 în cancerul de prostată ( 66).). Cealaltă genă care a fost modulată prin intervenția genisteinei în prezentul studiu a fost NEU1, care este o sialidază lizozomală implicată în catabolismul glicoconjugatului și semnalizarea celulară, inclusiv răspunsurile imune și transducția semnalului mediată de receptorul elastinei ( 67 ). De fapt, NEU1 este esențial pentru desialilarea integrinei β4 și inhibarea FAK, ducând la suprimarea metastazelor hepatice în cancerul de colon ( 68 ). Kato și colab. ( 69 ) au raportat că supraexprimarea NEU1 a dus la suprimarea metastazelor pulmonare în melanom. În plus, suprimarea NEU1 de către miR-125b sa dovedit a promova migrația, invazia și metastaza în cancerele gastrice ( 70). Cu toate acestea, NEU1 poate avea, de asemenea, efecte pro-metastatice în cazurile de cancer pancreatic și ovarian ( 71 ) și, prin urmare, nu este pe deplin clar care ar putea fi impactul general al nivelurilor crescute de NEU1 în cancerul de prostată. Prin urmare, este important să se examineze modificările expresiei NEU1 la nivelul proteinelor și sunt necesare studii moleculare și celulare pentru a evalua consecințele funcționale ale modificărilor induse de reglarea ascendentă a NEU1 în celulele cancerului de prostată.

Dintre genele exprimate diferențial care au fost validate de qPCR, doar expresia mARN-urilor NOTCH3 și JAG1 au fost semnificativ mai mari în grupul cu genisteină comparativ cu grupul placebo de qPCR. Pe baza constatărilor noastre la nivel de ARNm, fără nici o confirmare la nivel proteic sau funcțional, ar fi speculativ să sugerăm că semnalizarea Notch poate juca un rol în mecanismul de acțiune al genisteinei asupra cancerului de prostată. NOTCH3 este important pentru EMT indus de TGFβ în cancerul de prostată ( 72 ) și este indus de hipoxie și contribuie la progresia cancerului de prostată ( 73 ). Ligandul Notch JAG1 este, de asemenea, asociat cu cancer de prostată mai agresiv ( 74 , 75 ), EMT și angiogeneză (76 ). Cu toate acestea, un rol de supresie tumorală a semnalizării Notch a fost raportat și în diferențierea neuroendocrină indusă de hipoxie a celulelor canceroase de prostată, precum și în alte tipuri de cancer, inclusiv cancerul vezicii urinare, tumorile maligne hematologice, gliomul, carcinomul tiroidian și cancerul pulmonar ( 77 – 82 ), indicând posibilitatea ca expresia crescută a NOTCH3 / JAG1 prin tratamentul cu genisteină să îmbunătățească rezultatele prin funcția sa de supresoare tumorală. Datele noastre sugerează că studii suplimentare pentru a delimita efectul genisteinei asupra căii de semnalizare Notch în cancerul de prostată pot fi justificate.

Analizele de îmbogățire a modificărilor ARNm induse de genisteină au indicat faptul că modificările subtile ale expresiei genice observate între probele de genisteină și placebo sunt în concordanță cu multe efecte raportate anterior ale genisteinei pe căile tumorale critice, inclusiv PTEN, PDGF, MYC, β-estradiol, receptor glucocorticoid și interferon- y ( 41 , 83 – 89 ). Genisteina pare să promoveze activitatea PTEN și inhibă activitatea MYC, în concordanță cu utilitatea sa potențială în îmbunătățirea rezultatelor în cancerul de prostată.

Pe scurt, rezultatele noastre indică faptul că intervenția genisteinei induce modularea mai multor gene, inclusiv NOTCH3 , JAG1 , ADCY4 și NEU1, sugerând că aceste gene pot avea potențialul de a fi ținte moleculare noi ale genisteinei în cancerul de prostată. Aceste gene sunt implicate în multe procese biologice critice, inclusiv ciclul celular, angiogeneza, răspunsul imun celular și transducția semnalului intracelular, oferind o perspectivă suplimentară asupra multiplelor căi moleculare implicate în tumorigeneză de prostată. Cu toate acestea, sunt necesare studii mecaniciste suplimentare pentru a investiga efectele genisteinei asupra reglării expresiei acestor gene la nivelul proteinelor și funcțiilor celulare. Aceste descoperiri pot contribui apoi la proiectarea de noi strategii pentru prevenirea și tratamentul cancerului de prostată. O avertisment al studiilor de profilare a expresiei genice este incapacitatea identificării mecanismelor de acțiune care sunt modulate la nivel post-transcripțional,sugerând posibilitatea ca genisteina să modifice procese celulare suplimentare. Un alt punct care trebuie făcut este momentul și durata expunerii la genisteină. Studiile de control al cazurilor au demonstrat că consumul ridicat de soia la începutul vieții (în timpul copilăriei și / sau adolescenței) este asociat cu o reducere de 25-60% a riscului de cancer mamar (90 , 91 ). În mod similar, aportul ridicat de soia la pubertate, perioada în care prostata suferă o creștere indusă de androgen, ar putea fi mai eficientă în prevenirea cancerului de prostată. O limitare a prezentului studiu este numărul mic de probe de pacienți. Alte studii clinice controlate randomizate de mari dimensiuni ar oferi rezultate mai definitive ale efectelor genisteinei asupra țesuturilor prostatei pacientului.Mergi la:

Mulțumiri

Prezentul studiu a fost susținut parțial de nucleul de genomică integrat Emory (EIGC), care este subvenționat de Grantul de asistență al Centrului de Cancer NCI P30CA138292 și de Școala de Medicină a Universității Emory și este una dintre facilitățile de bază integrate Emory. Acesta a fost susținut în continuare de un Premiu de Cercetare a Soia din cadrul Programului de Cercetare în Sănătate al Soia al United Soybean Board.Mergi la:

Referințe

1. Siegel RL, Miller KD, Jemal A. Statistici despre cancer, 2016. CA Cancer J Clin. 2016; 66 : 7–30. doi: 10.3322 / caac.21332. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Fapte și cifre despre cancerul de prostată 2016. American Cancer Society Inc; Atlanta, GA: 2016. [ Google Scholar ]3. Dunn MW, Kazer MW. Prezentare generală a cancerului de prostată. Semin Oncol Nurs. 2011; 27 : 241-250. doi: 10.1016 / j.soncn.2011.07.002. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Sartor AO. Progresia cancerului de prostată metastatic rezistent la castrate: impactul intervenției terapeutice în spațiul post-docetaxel. J Hematol Oncol. 2011; 4 : 18. doi: 10.1186 / 1756-8722-4-18. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W, III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, și colab. American Cancer Society ghiduri de îngrijire pentru supraviețuirea cancerului de prostată. CA Cancer J Clin. 2014; 64 : 225–249. doi: 10.3322 / caac.21234. [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, și colab. Sarcina de modificare a numărului de copii prezice recăderea cancerului de prostată. Proc Natl Acad Sci SUA. 2014; 111 : 11139–11144. doi: 10.1073 / pnas.1411446111. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Ferlay J, Bray F, Pisani P, Parkin DM. Globocan 2000: Incidența, mortalitatea și prevalența cancerului la nivel mondial. Presa IARC; Lyon: 2001. [ Google Scholar ]8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Statistici globale privind cancerul. CA Cancer J Clin. 2011; 61 : 69–90. doi: 10.3322 / caac.20107. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Kimura T. East întâlnește vestul: Diferențe etnice în epidemiologia cancerului de prostată între asiatici de est și caucazieni. Cancerul Chin J. 2012; 31 : 421-429. doi: 10.5732 / cjc.011.10324. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Reinli K, Block G. Conținutul de fitoestrogen din alimente – un compendiu al valorilor literaturii. Cancerul Nutr. 1996; 26 : 123–148. doi: 10.1080 / 01635589609514470. [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Adlercreutz H, Markkanen H, Watanabe S. Concentrații plasmatice de fitoestrogeni la bărbații japonezi. Lancet. 1993; 342 : 1209–1210. doi: 10.1016 / 0140-6736 (93) 92188-Y. [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S, Griffiths K. Lignans și izoflavonoizi în plasmă și lichid prostatic la bărbați: eșantioane din Portugalia, Hong Kong , și Regatul Unit. Prostata. 1997; 32 : 122–128. doi: 10.1002 / (SICI) 1097-0045 (19970701) 32: 2 <122 :: AID-PROS7> 3.0.CO; 2-O. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hwang YW, Kim SY, Jee SH, Kim YN, Nam CM. Consumul de alimente din soia și riscul de cancer de prostată: o meta-analiză a studiilor observaționale. Cancerul Nutr. 2009; 61 : 598-606. doi: 10.1080 / 01635580902825639. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Van Poppel H, Tombal B. Chimioprevenția cancerului de prostată cu substanțe nutritive și suplimente. Cancer Manag Res. 2011; 3 : 91–100. doi: 10.2147 / CMAR.S18503. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Barnes S, Peterson TG, Coward L. Justificare pentru utilizarea matricelor de soia care conțin genisteină în studiile de chemoprevenție pentru cancerul de sân și de prostată. J Cell Biochem (Suppl) 1995; S22 : 181–187. doi: 10.1002 / jcb.240590823. [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, și colab. Analiza farmacocinetică și farmacodinamică de fază I a izoflavonelor de soia neconjugate administrate persoanelor cu cancer. Biomarkeri de epidemiol pentru cancer Prev. 2003; 12 : 1213–1221. [ PubMed ] [ Google Scholar ]17. CD Gardner, Oelrich B, Liu JP, Feldman D, Franke AA, Brooks JD. Concentrațiile de izoflavonă din soia prostatică depășesc nivelurile serice după suplimentarea dietei. Prostata. 2009; 69 : 719–726. doi: 10.1002 / pros.20922. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA și colab. Siguranța și farmacocinetica izoflavonelor purificate din soia: Administrare cu doză unică la femeile aflate în postmenopauză. Sunt J Clin Nutr. 2002; 76 : 1126–1137. [ PubMed ] [ Google Scholar ]19. Yildiz F. Fitoestrogeni în alimente funcționale. CRC Press; Boca Raton, FL: 2005. https://doi.org/10.1201/9781420027594 . [ CrossRef ] [ Google Scholar ]20. Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M, Masamune Y. Interacțiunea fitoestrogenilor cu receptorii de estrogen alfa și beta. Biol Pharm Bull. 2001; 24 : 351–356. doi: 10.1248 / bpb.24.351. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Chang WY, Prins GS. Receptorul de estrogen-beta: Implicații pentru glanda prostatică. Prostata. 1999; 40 : 115–124. doi: 10.1002 / (SICI) 1097-0045 (19990701) 40: 2 <115 :: AID-PROS7> 3.0.CO; 2-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP, Gupta G. Mecanisme sinergice chimioprotectoare ale fitoestrogenilor dietetici într-o combinație selectă împotriva cancerului de prostată. J Nutr Biochem. 2011; 22 : 723–731. doi: 10.1016 / j.jnutbio.2010.06.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Wang J, Eltoum IE, Lamartiniere CA. Chimioprevenția genisteinei a cancerului de prostată la șoarecii TRAMP. J Cancer. 2007; 6 : 3. doi: 10.1186 / 1477-3163-6-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Davis JN, Kucuk O, Sarkar FH. Expresia antigenului specific prostatei este reglată transcripțional de genisteină în celulele cancerului de prostată. Mol Carcinog. 2002; 34 : 91–101. doi: 10.1002 / mc.10053. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Reglarea receptorilor de androgen prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgen este mediată de receptorul de estrogen beta. Eur Urol. 2004; 45 : 245–251. doi: 10.1016 / j.eururo.2003.09.001. discuție 251. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S, Hursting SD. Doza mică de genisteină induce inhibitori de kinază dependenți de ciclină și oprirea ciclului celular G (1) în celulele cancerului de prostată uman. Mol Carcinog. 2000; 29 : 92–102. doi: 10.1002 / 1098-2744 (200010) 29: 2 <92 :: AID-MC6> 3.0.CO; 2-Q. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Reglarea în sus a p21WAF1 indusă de genisteină, reglarea în jos a ciclinei B și inducerea apoptozei în celulele canceroase de prostată. Cancerul Nutr. 1998; 32 : 123–131. doi: 10.1080 / 01635589809514730. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH, Hillman GG. Genisteina inhibă activarea NF-kappaB indusă de radiații în celulele canceroase de prostată, promovând apoptoza și oprirea ciclului celular G2 / M. Cancer BMC. 2006; 6 : 107. doi: 10.1186 / 1471-2407-6-107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Li Y, Sarkar FH. Reglarea descendentă a invaziei și a genelor legate de angiogeneză identificate prin analiza microarray cDNA a celulelor canceroase de prostată PC3 tratate cu genisteină. Cancer Lett. 2002; 186 : 157–164. doi: 10.1016 / S0304-3835 (02) 00349-X. [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Guo Y, Wang S, Hoot DR, Clinton SK. Suprimarea interacțiunilor autocrine și paracrine mediate de VEGF între celulele cancerului de prostată și celulele endoteliale vasculare de către izoflavonele din soia. J Nutr Biochem. 2007; 18 : 408–417. doi: 10.1016 / j.jnutbio.2006.08.006. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Reglarea expresiei genelor și inhibarea metastazei osoase experimentale a cancerului de prostată de către genisteina dietetică. Neoplazie. 2004; 6 : 354–363. doi: 10.1593 / neo.03478. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY, He DL. Un nou efect anticanceros al genisteinei: inversarea tranziției mezenchimale epiteliale în celulele canceroase de prostată. Acta Pharmacol Sin. 2008; 29 : 1060–1068. doi: 10.1111 / j.1745-7254.2008.00831.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Kumi-Diaka JK, Hassanhi M, Merchant K, Horman V. Influența genisteinei izoflavonei pe expresia matricei metaloproteinazei-2 în celulele cancerului de prostată. J Med Food. 2006; 9 : 491–497. doi: 10.1089 / jmf.2006.9.491. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kazi A, Daniel KG, Smith DM, Kumar NB, Dou QP. Inhibarea activității proteazomului, un mecanism nou asociat cu capacitatea genisteinei de inducere a apoptozei celulare tumorale. Biochem Pharmacol. 2003; 66 : 965–976. doi: 10.1016 / S0006-2952 (03) 00414-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Kumi-Diaka J, Sanderson NA, Sala A. Rolul mediator al proteazei caspase-3 în mecanismul intracelular al apoptozei induse de genisteină în liniile celulare de carcinom prostatic uman, DU145 și LNCaP. Biol Cell. 2000; 92 : 595-604. doi: 10.1016 / S0248-4900 (00) 01109-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Lee J, Ju J, Park S, Hong SJ, Yoon S. Inhibarea semnalizării IGF-1 de către genisteină: Modularea expresiei E-cadherinei și reglarea descendentă a semnalizării β-cateninei în celulele cu cancer de prostată PC-3 hormon refractare. Cancerul Nutr. 2012; 64 : 153–162. doi: 10.1080 / 01635581.2012.630161. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Xu L, Bergan RC. Genisteina inhibă activarea matricei metaloproteinazei tip 2 și invazia celulelor cancerului de prostată prin blocarea factorului de creștere transformant activarea mediată de beta a căii proteinei kinazei 2-27-kDa proteinei șocului termic activat prin mitogen-activat kinază 2-27-kDa. Mol Pharmacol. 2006; 70 : 869–877. doi: 10.1124 / mol.106.023861. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Davis JN, Kucuk O, Sarkar FH. Genisteina inhibă activarea NF-kappaB în celulele canceroase de prostată. Cancerul Nutr. 1999; 35 : 167–174. doi: 10.1207 / S15327914NC352_11. [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Li Y, Sarkar FH. Inhibarea activării factorului nuclear kappaB în celulele PC3 de către genisteină este mediată prin calea de semnalizare Akt. Clin Cancer Res. 2002; 8 : 2369–2377. [ PubMed ] [ Google Scholar ]40. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y. Genistein, un inhibitor specific al protein kinazelor specifice tirozinei. J Biol Chem. 1987; 262 : 5592–5595. [ PubMed ] [ Google Scholar ]41. Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS, Ha J. Efectele antioxidante ale genisteinei sunt asociate cu activarea proteinei kinazei activate de AMP și inducerea PTEN în celulele canceroase de prostată . J Med Food. 2010; 13 : 815–820. doi: 10.1089 / jmf.2009.1359. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Raschke M, Rowland IR, Magee PJ, Pool-Zobel BL. Genisteina protejează celulele prostatei împotriva deteriorării ADN-ului induse de peroxidul de hidrogen și induce expresia genelor implicate în apărarea împotriva stresului oxidativ. Carcinogeneză. 2006; 27 : 2322–2330. doi: 10.1093 / carcin / bgl082. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM, Feldman D. Inhibarea sintezei și acțiunilor prostaglandinelor de către genisteină în celulele canceroase de prostată umane și de izoflavone din soia la pacienții cu cancer de prostată. Int J Rac. 2009; 124 : 2050–2059. doi: 10.1002 / ijc.24161. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L, Bernard-Gallon D. Metilarea ADN și fitoestrogeni din soia: Studiu cantitativ în liniile celulare umane de cancer de prostată DU-145 și PC-3. Epigenomica. 2011; 3 : 795–803. doi: 10.2217 / epi.11.103. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L și colab. Fitoestrogenii din soia modifică metilarea ADN a promotorului GSTP1, RASSF1A, EPH2 și BRCA1 în celulele cancerului de prostată. În Vivo. 2010; 24 : 393–400. [ PubMed ] [ Google Scholar ]46. Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang C. Inversarea hipermetilării și reactivării a 16 gene INK4a , RARbeta și MGMT de către genisteină și alte izoflavone din soia. Clin Cancer Res. 2005; 11 : 7033–7041. doi: 10.1158 / 1078-0432.CCR-05-0406. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV, Dahiya R. cancer de prostată. Cancer. 2010; 116 : 66–76. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M, Dahiya R. Acetilarea histonei mediată de genisteină și demetilarea activează genele supresoare tumorale din celulele cancerului de prostată. Int J Rac. 2008; 123 : 552-560. doi: 10.1002 / ijc.23590. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Li Y, Kong D, Ahmad A, Bao B, Dyson G, Sarkar FH. Dereglarea epigenetică a miR-29a și miR-1256 de către izoflavonă contribuie la inhibarea creșterii și invaziei celulelor canceroase de prostată. Epigenetica. 2012; 7 : 940–949. doi: 10.4161 / epi.21236. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ, Bernard-Gallon DJ. miARN exprimate diferențial în liniile celulare de cancer de prostată după tratamentul cu soia. În Vivo. 2011; 25 : 917–921. [ PubMed ] [ Google Scholar ]51. Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y, Dahiya R. MicroRNAs 221/222 și reglarea mediată de genisteină a genei supresoare tumorale ARHI în cancerul de prostată. Cancer Prev Res (Phila) 2011; 4 : 76–86. doi: 10.1158 / 1940-6207.CAPR-10-0167. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, ​​Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I și colab. Genisteina reglează în sus microRNA-574-3p supresor tumoral în cancerul de prostată. Plus unu. 2013; 8 : e58929. doi: 10.1371 / journal.pone.0058929. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J, Sarkar FH. Genisteina potențează efectul radiației asupra celulelor carcinomului de prostată. Clin Cancer Res. 2001; 7 : 382–390. [ PubMed ] [ Google Scholar ]54. Li Y, Kucuk O, Hussain M, Abrams J, Cher ML, Sarkar FH. Activitățile antitumorale și antimetastatice ale docetaxelului sunt îmbunătățite de genisteină prin reglarea osteoprotegerinei / receptorului activator al factorului nuclear-kappaB (RANK) / ligand RANK / semnalizarea MMP-9 în cancerul de prostată. Cancer Res. 2006; 66 : 4816–4825. doi: 10.1158 / 0008-5472.CAN-05-3752. [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, și colab. Genisteina și cancerul: starea actuală, provocările și direcțiile viitoare. Adv Nutr. 2015; 6 : 408–419. doi: 10.3945 / an.114.008052. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Katoh M. Rețea de WNT și alte cascade de semnalizare de reglementare în celule stem pluripotente și celule stem canceroase. Curr Pharm Biotechnol. 2011; 12 : 160–170. doi: 10.2174 / 138920111794295710. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV. Atât beta-actina, cât și GAPDH sunt gene de referință utile pentru normalizarea RT-PCR cantitativă în probe de țesut uman FFPE de cancer de prostată. Prostata. 2008; 68 : 1555–1560. doi: 10.1002 / pros.20815. [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006; 38 : 500-501. doi: 10.1038 / ng0506-500. [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci SUA. 1998; 95 : 14863–14868. doi: 10.1073 / pnas.95.25.14863. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Saldanha AJ. Java Treeview – vizualizare extensibilă a datelor micro-matrice. Bioinformatică. 2004; 20 : 3246–3248. doi: 10.1093 / bioinformatics / bth349. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Barfield RT, Kilaru V, Smith AK, Conneely KN. CpGassoc: O funcție R pentru analiza datelor despre microarray de metilare a ADN-ului. Bioinformatică. 2012; 28 : 1280–1281. doi: 10.1093 / bioinformatics / bts124. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Qiagen’s Ingenuity Pathway Analysishttp://www.qiagen.com/ingenuity .63. Dennis G, Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Baza de date pentru adnotare, vizualizare și descoperire integrată. Genomul Biol. 2003; 4 : 3. doi: 10.1186 / gb-2003-4-5-p3. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Wang Z, Chen H. Genisteinul crește expresia genelor prin demetilarea promotorului WNT5a în linia celulară de cancer de colon SW1116. Anticancer Res. 2010; 30 : 4537–4545. [ PubMed ] [ Google Scholar ]65. Gao BN, Gilman AG. Clonarea și exprimarea unei adenilil ciclaze distribuite pe scară largă (tip IV). Proc Natl Acad Sci SUA. 1991; 88 : 10178-10182. doi: 10.1073 / pnas.88.22.10178. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG, Freije D. Un panou de markeri de metilare a ADN-ului dezvăluie metilare extinsă în nucleele biopsiei prostatei histologice benigne de la pacienții cu cancer. Biomark Res. 2014; 2 : 25. doi: 10.1186 / s40364-014-0025-9. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Monti E, Bonten E, D’Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R, Tettamanti G. Sialidases in vertebrates: O familie de enzime adaptate pentru mai multe funcții celulare. Adv Carbohydr Chem Biochem. 2010; 64 : 403–479. doi: 10.1016 / S0065-2318 (10) 64007-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H, Miyagi T. Contribuția sialidazei NEU1 la suprimarea metastazelor celulelor canceroase ale colonului uman prin desialilarea integrinei beta4. Oncogene. 2009; 28 : 1218–1229. doi: 10.1038 / onc.2008.471. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S, Miyagi T. Supraexprimarea sialidazei de tip lizozomal conduce la suprimarea metastazelor asociate cu reversia fenotipului malign în celulele melanomului B16 murin. Int J Rac. 2001; 92 : 797–804. doi: 10.1002 / ijc.1268. [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W, Che X. MicroRNA-125b promovează invazia și metastaza cancerului gastric prin vizarea STARD13 și NEU1. Tumora Biol. 2016; 37 : 12141–12151. doi: 10.1007 / s13277-016-5094-y. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Haxho F, Neufeld RJ, Szewczuk MR. Neuraminidază-1: O țintă terapeutică nouă în tumorigeneză în mai multe etape. Oncotarget. 2016; 7 : 40860–40881. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H, Zhou Y. Notch3 este important pentru tranziția epitelial-mezenchimală indusă de TGF-β în osul cancerului pulmonar cu celule mici. metastază prin reglarea ZEB-1. Cancer Gene Ther. 2014; 21 : 364–372. doi: 10.1038 / cgt.2014.39. [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, și colab. Notch3 este activat de hipoxia cronică și contribuie la progresia cancerului de prostată uman. Int J Rac. 2013; 133 : 2577–2586. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, și colab. Corelarea Sprouty1 și Jagged1 cu celule agresive de cancer de prostată cu diferite sensibilități la privarea de androgen. J Cell Biochem. 2014; 115 : 1505-1515. doi: 10.1002 / jcb.24805. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A, Trindade A. Dinamica semnalizării crestăturii în prostata adultă sănătoasă și în dezvoltarea tumorilor de prostată. Prostata. 2016; 76 : 80–96. doi: 10.1002 / pros.23102. [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH, Duarte A. Endotelial Jagged1 promovează creșterea tumorilor solide atât prin funcții pro-angiogenice, cât și prin funcții angiocrine. Oncotarget. 2015; 6 : 24404–24423. doi: 10.18632 / oncotarget.4380. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, și colab. Semnalizarea prin crestături modulează diferențierea neuroendocrină indusă de hipoxie a celulelor cancerului de prostată uman. Mol Cancer Res. 2012; 10 : 230–238. doi: 10.1158 / 1541-7786.MCR-11-0296. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A, Klinakis A. Un nou rol de supresor tumoral pentru calea Notch în cancerul de vezică urinară. Nat Med. 2014; 20 : 1199–1205. doi: 10.1038 / nm.3678. [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Hernandez Tejada FN, Galvez Silva JR, Zweidler-McKay PA. Provocarea vizării crestăturii în tumorile maligne hematologice. Front Pediatr. 2014; 2 : 54. doi: 10.3389 / fped.2014.00054. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, și colab. O funcție de supresie tumorală pentru semnalizarea Notch în subtipurile tumorale din creier anterior. Celula cancerului. 2015; 28 : 730–742. doi: 10.1016 / j.ccell.2015.10.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB și colab. Rolul supresorului tumorii al Notch3 în carcinomul tiroidian medular, dezvăluit prin inducție genetică și farmacologică. Mol Cancer Ther. 2015; 14 : 499–512. doi: 10.1158 / 1535-7163.MCT-14-0073. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Semnalizarea prin crestături induce oprirea ciclului celular în celulele cu cancer pulmonar cu celule mici. Cancer Res. 2001; 61 : 3200–3205. [ PubMed ] [ Google Scholar ]83. Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX, Yang YM. Genisteina induce arestarea G2 / M în celulele canceroase gastrice prin creșterea expresiei PTEN supresoare tumorale. Cancerul Nutr. 2013; 65 : 1034–1041. doi: 10.1080 / 01635581.2013.810290. [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY, Chow NH. Romanul vizează anti-angiogeneza genisteinei pe celulele canceroase umane. Biochem Pharmacol. 2005; 69 : 307-318. doi: 10.1016 / j.bcp.2004.09.025. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Jagadeesh S, Kyo S, Banerjee PP. Genisteina reprimă activitatea telomerazei prin intermediul mecanismelor transcripționale și posttranslaționale în celulele canceroase de prostată umane. Cancer Res. 2006; 66 : 2107-2115. doi: 10.1158 / 0008-5472.CAN-05-2494. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genisteina crește expresia beta a receptorilor de estrogen în cancerul de prostată prin reducerea metilării sale promotor. J Steroid Biochem Mol Biol. 2015; 152 : 62-75. doi: 10.1016 / j.jsbmb.2015.04.018. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Whirledge S, Senbanjo LT, Cidlowski JA. Genisteina perturbă semnalizarea receptorilor glucocorticoizi în celulele Ishikawa endometriale uterine umane. Perspectiva sănătății Environ. 2015; 123 : 80-87. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]88. Bhamre S, Sahoo D, Tibshirani R, Dill DL, Brooks JD. Modificări ale expresiei genetice induse de genisteină în linia celulară de cancer de prostată LNCaP. Open Prostate Cancer J. 2010; 3 : 86–98. doi: 10.2174 / 1876822901003010086. [ CrossRef ] [ Google Scholar ]89. Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A, Vakili MA. Genisteina induce un efect imunomodulator de protecție la un model de șoarece de cancer de col uterin. Iran J Immunol. 2012; 9 : 119–127. [ PubMed ] [ Google Scholar ]90. Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN, Ziegler RG. Consumul de soia în copilărie și riscul de cancer mamar la femeile asiatice americane Biomarkeri de epidemiol pentru cancer Prev. 2009; 18 : 1050–1059. doi: 10.1158 / 1055-9965.EPI-08-0405. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W. Consumul de alimente din soia pentru adolescenți și adulți și riscul de cancer mamar: Rezultate din Studiul de sănătate al femeilor din Shanghai . Sunt J Clin Nutr. 2009; 89 : 1920–1926. doi: 10.3945 / ajcn.2008.27361. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Oncologie sunt furnizate aici prin amabilitatea Spandidos Publications

Baza farmacologică și noi perspective ale acțiunii quercetinului în ceea ce privește efectele sale anti-cancer

Si-Min Tang 1Xue-Ting Deng 1Jian Zhou cQuan-Peng Li cXian-Xiu Ge cLin Miao claAl doilea spital al oamenilor din Huai’an, Huai’an, ChinabCentrul medical pentru boli digestive, al doilea spital afiliat, Universitatea de medicină Nanjing, Nanjing, ChinacDepartamentul de endoscopie gastrointestinală, Universitatea de Medicină din Nanjing, Nanjing, China

Primit la 29 iulie 2019, revizuit la 14 octombrie 2019, acceptat la 26 octombrie 2019, disponibil online la 13 noiembrie 2019 .

https://doi.org/10.1016/j.biopha.2019.109604Obțineți drepturi și conținut

Sub Creative Commons licență acces deschis

Abstract

Quercetina este un fel de compuși flavonoizi care provine din natură și există pe scară largă în dieta zilnică. Studiile anterioare au descoperit că quercetina are multe efecte, cum ar fi antiinflamatorii, anti-oxidarea și anti-cancerul. Atât experimentele in vivo, cât și cele in vitro au demonstrat că quercetina poate exercita efecte antitumorale modificând progresia ciclului celular, inhibând proliferarea celulară, promovând apoptoza, inhibând angiogeneza și progresia metastazelor și afectând autofagia. Această revizuire rezumă dovezile pentru potențialul farmacologic și inhibarea quercetinei asupra cancerelor, susținând punctul de vedere că quercetina ar trebui considerată în mod adecvat ca un agent terapeutic împotriva diferitelor tipuri de cancer

1. Introducere

Cancerul reprezintă o amenințare gravă pentru sănătatea fizică și mentală a oamenilor, iar incidența și mortalitatea cancerului sunt mari la nivel global [ 1 , 2 ]. Potrivit GLOBOCAN, în 2012, aproximativ 14,1 milioane de pacienți din întreaga lume au fost diagnosticați nou cu cancer și 8,2 milioane de pacienți cu cancer au murit [ 3 ]. Pe lângă faptul că provoacă vătămări grave corpului pacientului, cancerul impune și o povară economică imensă asupra pacienților, iar sarcina asupra țărilor în curs de dezvoltare este în creștere [ 4 ]. Cancerul nu este o afecțiune limitată, determinată de o singură cauză, ci un tip de boală cu caracteristici similare [ 5]. Studiile anterioare au sugerat că markerii cancerului includ menținerea proliferării, evaziunea factorilor inhibitori ai creșterii, inhibarea morții celulare, nemurirea replicativă, angiogeneza și creșterea invaziei și metastazelor. Menținerea acestor șase funcții biologice se datorează diversității genetice cauzate de instabilitatea genomică [ 6 ].

În mod tradițional, tratamentul pentru cancer utilizează cele patru metode de intervenție chirurgicală, radioterapie, chimioterapie și imunoterapie singur sau în combinație [ 7 ]. Însoțită de utilizarea medicamentelor pentru chimioterapie, rezistența la medicamente cauzată de adaptarea celulelor canceroase la agenții chimioterapeutici este principalul motiv pentru obstrucționarea eficacității medicamentelor pentru chimioterapie [ 8 ]. Prin urmare, este necesară dezvoltarea medicamentelor adjuvante sau alternative. De secole, medicina chineză s-a dovedit că joacă un rol terapeutic în toate etapele cancerului, acordând prioritate distrugerii celulelor canceroase și prezentând efecte anticancerigene semnificative și poate îmbunătăți calitatea vieții pacienților cu cancer [ [9] ,  [ 10] ,  [11]]. Multe ingrediente din medicina tradițională chineză sunt extrase din plante naturale.

Quercetina (3,3 ′, 4 ′, 5,7-pentahidroxiflavona) este un compus care aparține familiei flavonoide. Este un produs natural în dieta umană și abundent sub formă de glicozid într-o varietate de plante, fructe și legume, cum ar fi ceapa, hrișca și broccoli. A fost adăugat la alimentele funcționale ca supliment alimentar comercial și poate juca un rol în prevenirea sau tratarea diferitelor boli, cum ar fi cancerul [ 12 ]. În ultimii ani, o mulțime de cercetări au confirmat că doza rezonabilă de quercetină are o varietate de funcții biologice, cum ar fi efectele antiinflamatoare, anti-oxidante și anti-canceroase [ 13 ].

Acest articol va rezuma activitatea anticancer a quercetinei pe mai multe tumori sistemice in vivo și in vitro și va evalua dovezile disponibile pentru a prezice posibilul efect inhibitor al quercetinei asupra cancerului uman pe baza mecanismului său anticancer.

2. Funcțiile farmacologice și biologice ale quercetinei

Quercetina este un fel de compus flavonoid pe care omul îl poate obține din alimente și plante. În comparație cu quercetina, forma conjugată a glicozidei quercetinei este mai bine absorbită. Quercetina este absorbită în principal în celulele intestinale sub formă de glicozide, hidrolizată în agliconă și intră în lumenul intestinal, iar mecanismul său poate fi legat de transportul glucozei. Procesul de transformare are loc în principal în intestine, iar unele se pot face în ficat și sânge. Quercetina și metaboliții săi sunt excretați în cea mai mare parte în intestin, iar o mică parte poate fi excretată în urină prin rinichi [ [14] ,  [15] ,  [16]]. Cele mai recente cercetări au arătat că microbiota intestinală joacă un rol important în generarea glicozidazelor și enzimelor, care pot transfera quercetina în molecule mai mici, mai ușor absorbite [ 17 , 18 ]. Quercetina poate fi metabolizată în derivați glucuronidați, metilați și sulfați [ 19 ].

Este bine cunoscut faptul că participarea deplină a quercetinei la reglarea metabolismului fierului are o semnificație biologică vitală. Quercetina poate reduce fierul cu valență ridicată pentru a inhiba oxidarea lipidelor și pentru a stinge producția de ROS catalizată prin fier [ 20 ]. Ca un antioxidant excelent in vitro, activitatea sa antioxidantă se manifestă în principal prin afectarea glutationului, a activității enzimei, a speciilor reactive de oxigen (ROS) și a reglării căilor de transducție a semnalului, precum NRFB, MAPK și AMPK [ 21 ]. Ca un agent eficient de eliminare a ROS, quercetina exercită efectele antioxidante prin activitatea de scavare a radicalilor liberi, reducând nivelul ROS și inhibând peroxidarea lipidelor [ 22 , 23]. Nu există nicio îndoială că quercetina poate avea, de asemenea, efecte antiinflamatorii puternice și poate reduce procesul inflamator [ 24 ]. Funcția antiinflamatoare funcționează în principal prin inhibarea eliberării citokinelor, scăderea producției de COX și LOX și menținerea stabilității mastocitelor [ [25] ,  [26] ,  [27] ]. Cercetătorii au descoperit că quercetina poate inhiba apariția fibrozei hepatice la șobolanii cu leziuni hepatice prin colestază prin reducerea expresiei TGF-β1 și a-SMA prin construirea modelului BDL și prevenirea stresului oxidativ [ 28 ]. În plus, derivații de quercetină joacă, de asemenea, funcții biologice importante, cu capacitate antioxidantă mai mare, efecte neuroprotectoare și activitate anticanceroasă puternică [[29] ,  [30] ,  [31] ,  [32] ].

Mai mult, au fost efectuate studii clinice ale quercetinei și nu s-au observat toxicitate sau efecte secundare ale quercetinei asupra populației [ 33 ]. Studiile clinice au demonstrat efectul inhibitor al quercetinei asupra inflamației și capacitatea sa de a inhiba riscul de cancer de prostată [ 34 , 35 ]. Studiile clinice de fază I au confirmat siguranța administrării intravenoase a quercetinei și au găsit dovezi ale activității sale antitumorale. Studiile clinice bazate pe quercetină au confirmat efectele scăderii tensiunii arteriale și ameliorării anemiei [ [36] ,  [37] ,  [38] ].

3. Activitatea terapeutică a quercetinei în cancer

Quercetina a demonstrat efecte benefice semnificative asupra multor boli. Datorită dozelor rezonabile de quercetină nu au efecte secundare toxice evidente asupra celulelor normale, tot mai mulți cercetători sunt atenți la efectul terapeutic al quercetinei asupra tumorilor. Numeroase studii au arătat că quercetina poate exercita funcții antitumorale într-o varietate de mecanisme și a fost confirmată în modele in vitro și in vivo ale diferitelor tumori, cu rezultate încurajatoare Quercetina previne semnificativ ciclul celular, promovează apoptoza și inhibă angiogeneza și metastazele în vitro ( Fig. 1 ). În studiile in vivo, concluziile indică faptul că doza selectată de quercetină este eficientă în inhibarea creșterii modelelor tumorale de xenogrefă.

Fig. 1

3.1. Studii in vitro

3.1.1. Efectul quercetinei asupra ciclului celular al celulelor canceroase

Ciclul celular este procesul de bază al diviziunii celulare și este în principal împărțit în patru faze: faza G1 (sinteza pre-ADN), faza S (faza de sinteză a ADN), faza G2 (faza de sinteză tardivă a ADN) și faza M (faza mitotică) ), care este reglementată în principal de ciclina, kinazele dependente de ciclină (CDK) și inhibitorul kinazei dependente de ciclină (CKI). Ciclul celular este reglementat în principal de calea de reglementare a rețelei pRb. Ciclina formează un complex cu CDK-ul său corespunzător, care fosforilează Rb și apoi eliberează E2F și cAb1. Ulterior, E2F intră în nucleu pentru a promova faza G1 în faza S pentru divizarea autonomiei celulare. În progresia ciclului celular, un tip de CKI, INK4 (inclusiv p15, p16, p18, p19) concurează cu ciclina D1 pentru legarea la CDK4 / CDK6, inhibând fosforilarea Rb și inhibând progresia ciclului celular.O altă cale importantă este reglementată în principal de p53, care induce expresia p21, GADD45 și Bax pentru a regla diviziunea ciclului celular [[39] ,  [40] ,  [41] ]. Cu toate acestea, în studiile de patogenie tumorală, s-au găsit o activitate anormală a ciclului celular și replicarea necontrolată a celulelor tumorale datorită expresiei anormale a ciclinelor.

În celula U937 de leucemie umană, s-a demonstrat că quercetina induce oprirea ciclului celular la G2 / M. Acumularea de G2 / M a fost odată cu scăderea ciclinei D, ciclinei E și E2F, iar nivelul ciclinei B a crescut în mod vizibil [ 42 ]. Rezultate similare s-au găsit și în carcinomul ovarian (SKOV3), odată cu scăderea ciclinei D1, celula a fost de asemenea arestată în fazele S și G2 / M [ 43 ]. În plus, quercetina poate induce, de asemenea, modificări în faza G0 / G1 a celulelor leucemiei limfocitare cronice 232B4 și a celulelor osteosarcomului HOS [ 44]. Există, de asemenea, numeroase studii privind reglarea căilor legate de p53 de către quercetină asupra progresiei ciclului celular tumoral. Studiul a constatat că quercetina poate induce presiunea ER și apoi poate promova eliberarea de p53, inhibând astfel activitatea CDK2, ciclinei A, ciclinei B, arestând astfel celulele cancerului de sân MCF-7 în faza S [ 45 ]. Într-un studiu realizat de o altă echipă de studiu asupra liniei celulare MDA-MB-453 a cancerului de sân, quercetina a indus oprirea fazei G2 / M în celulele MDA-MB-453. În acest studiu, au constatat, de asemenea, o creștere semnificativă a expresiei p53 [ 46 ].

În plus față de quercetin, derivații asociați cu quercetin pot afecta, de asemenea, progresia ciclului celular într-o varietate de moduri. În timp ce se află în liniile celulare de cancer de prostată PC-3 și DU-145, o anumită doză de tratament cu quercetin-6-C-beta-d-glucopiranozidă duce la stoparea ciclului celular în faza G0 / G1. Acest fenomen poate fi asociat cu reglarea descendentă a ciclinei E și D, PNCA și expresia proteinei Cdk-2 și expresia crescută a p21 și p27 [ 47 ]. Cercetătorii au găsit, de asemenea, un nou derivat O-alchilat al quercetinului, 7-O-Geranylquercetin, care ar putea aresta liniile celulare de cancer gastric SGC-7901 și MGC-803 la ciclul celular G2 / M [ 48 ] ( Tabelul 1 ).

Tabelul 1. Efectul quercetinului asupra opririi ciclului celular și a mecanismelor sale în diferite celule canceroase.

Tipul de cancerLinii telefoniceCiclul celuleiMecanismReferințe
LimfomU937G2 / M↑ ciclină B42 ]
↓ ciclină D și E, E2F1 și E2F2
Carcinom ovarianSKOV3S și ​​G2 / M↓ ciclină D143 ]
OsteosarcomU20SG0 / G1
Cancer mamarMDA-MB-453G2 / M↑ p5346 ]
Conserva gastricăSGC-7901, MGC-803G2 / M48 ]
Leucemie limfocitară cronică232B4G0 / G149 ]
Cancer de prostatăPC-3, DU-145G0 / G1↓ ciclină E și D, PNCA, Cdk-247 ]
↑ p21, p27
OsteosarcomHOSG1 / S↓ ciclină D144 ]
Cancer mamarMCF-7S↓ CDK2, ciclina A și B45 ]
↑ p53, p58

3.1.2. Efectul quercetinei asupra apoptozei celulelor canceroase

Apoptoza este programul sinuciderii celulare și este procesul prin care organismele elimină celulele inutile sau nesănătoase din corp. Acesta include în principal căile apoptotice intrinseci (numite și mitocondriale) și extrinseci (numite și receptorii morții) [ 50 ]. Calea intrinsecă este activată prin eliberarea mitocondrială a citocromului c (cit c), iar calea extrinsecă este declanșată de receptorii de moarte TRAILR și FAS, care împreună activează o serie de proteaze, inclusiv caspaza-3, -6, -7, -8 , -9 și -10 și, în cele din urmă, duce la moartea celulelor. Este deosebit de notoriu faptul că celulele tumorale evită apoptoza și apoi fac dezvoltarea tumorii. Prin urmare, declanșarea apoptozei celulelor tumorale a devenit o realizare majoră în terapia anticancer [ 51 ].

S-a demonstrat că quercetina poate afecta calea apoptotică și poate induce moartea celulelor tumorale. S-a demonstrat că o doză rezonabilă de quercetin crește expresia proteinelor pro-apoptotice și scade nivelul de expresie al proteinelor anti-apoptotice. Tratamentul cu quercetină poate induce celule de leucemie mieloidă acută HL-60, celule de melanom A375SM și apoptoză de celule de cancer ovarian A2780S [ [52] ,  [53] ,  [54] ]. Celulele stem canceroase joacă un rol cheie în progresia cancerului. Recent, s-a confirmat că quercetina poate induce și apoptoza celulelor stem de cancer gastric [ 55]. În timpul căii apoptotice intrinseci, quercetina activează caspaza-3, -8, -9, stimulează expresia Bax, Bad și reglează în jos proteinele anti-apoptotice, cum ar fi Bcl-XL, Bcl-2 și Mcl-1. În același timp, quercetina a crescut eliberarea citocromului c din mitocondrii în citoplasmă. Aceste rapoarte clarifică în continuare că apoptoza indusă de quercetin poate fi, de asemenea, direct legată de Bcl-2 [ 56 , 57 ]. În timpul procesului de apoptoză, TRAIL joacă un rol pozitiv. Moartea celulelor tumorale indusă de TRAIL este în mare parte apoptotică. Apoptoza căii extrinseci devine o țintă importantă în cercetarea anti-cancer, deoarece ucide predominant celulele tumorale și economisește celulele normale [ 51 ]. Quercetina influențează expresia TRAILR, FAS, TNFR1 etc. [ 58]. Poate coopera cu TRAIL pentru a induce apoptoza în cancerul pulmonar cu celule mici, cancerul de colon, gliomul și multe alte celule canceroase prin două căi, crescând expresia DR5 și inhibând expresia supraviețuitoare [ [59] ,  [60] ,  [61] ].

Glicozidele cu quercetină exercită, de asemenea, o funcție pro-apoptotică similară cu quercetina. Glicozidele cu quercetină au declanșat generarea ROS, au accelerat crearea citc și au reglementat expresia proteinelor asociate apoptozei, care eventual duc la apoptoza celulelor canceroase [ 48 ]. Glicozidele cu quercetină pot activa, de asemenea, apoptoza indusă de caspaza-3 în celulele HepG2 [ 62 ]. ( Tabelul 2 )

Tabelul 2. Efectul quercetinei asupra apoptozei celulare și mecanismele acesteia în diferite celule canceroase.

Tipul de cancerLinii telefoniceMecanismCalea semnuluiReferințe
MelanomA375SMCalea intrinsecă↓ bcl-2JNK / P38 MAPK52 ]
↑ bax
LeucemieHL-60↓ bcl-xlERK53 ]
↑ bax, bak
Cancer ovarianA2780S↓ bax, bcl-2, mcl-1, procaspase-3, 954 ]
↑ caspase-3, 9
Cancer gastricGCSC↓ bcl-2PI3K / AKT55 ]
↑ bax, caspase-3, 9
GliomaU87-MG, U251, A172, LN229Ambii↓ survivin, XIAPPI3K / AKT61 ]
↑ PARP, caspase-7, 8, 9
Cancer de plamaniH460Calea extrinsecă↑ caspase-3 și 8, FAS, TRAILR58 ]
Cancer de colonHT-2959 ]
Cancer de plamaniH460, A549↓ survivinAKT-SURVIVIN60 ]
↑ DR5

3.1.3. Efectul quercetinei asupra angiogenezei și metastazelor celulelor canceroase

Angiogeneza se referă la creșterea de noi capilare, al căror proces este mediat de factori de creștere, molecule de aderență, endostatină, etc. Angiogeneza disregulată este strâns legată de bolile neoplazice și afectează creșterea și metastaza tumorilor [ 63]. Angiogeneza tumorală este un proces complex în care celulele tumorale interacționează cu celulele endoteliale. Factorul de creștere endotelial vascular (VEGF) joacă un rol important de amorsare. VEGF este o moleculă cheie pentru creșterea și supraviețuirea celulelor endoteliale, poate promova proliferarea celulelor endoteliale, crește permeabilitatea vasculară, extravazarea fibrinei plasmatice, depunerea celulozei și poate provoca angiogeneza tumorii prin inducerea căii de semnalizare dependente de receptorul VEGF 2 (VEGFR2) [ 64 , 65 ].

Multe produse naturale pot inhiba angiogeneza tumorii prin diferite mecanisme [ [66] ,  [67] ,  [68] ]. Quercetina poate juca, de asemenea, un rol antitumoral prin inhibarea creșterii vaselor de sânge. În cazurile de cancer de prostată și de sân, quercetina vizează calea angiogenezei mediate de VEGFR-2, reprimă expresia factorului de reglare din aval AKT și limitează creșterea tumorii [ 69 , 70 ]. Quercetina poate limita, de asemenea, angiogeneza celulelor rezistente la medicamente și poate crește efectul medicamentelor anti-cancer [ [71] ,  [72] ,  [73] ].

Pentru majoritatea tumorilor maligne, angiogeneza este procesul inițial al metastazei tumorale. Densitatea micro-vaselor tumorale este legată de potențialul metastatic mai mare și de supraviețuirea slabă a tumorilor maligne. Neovascularizarea oferă nutriție și mediu de evacuare pentru creșterea celulelor tumorale. Celulele tumorale suferă o serie de căi circulante pentru a coloniza și a forma tumori secundare [ 74 , 75]. Pe lângă efectul său inhibitor asupra angiogenezei, quercetina poate inhiba și metastaza tumorii printr-o varietate de mecanisme moleculare. Tranziția epitelială-mezenchimală (EMT) este un proces important în metastaza cancerului. Procesul EMT implică reglarea descendentă a proteinelor de tip epitelial (de exemplu, E-cadherină, MUC1 etc.), precum și achiziționarea de markeri mezenchimali, inclusiv N-cadherină, Vimentină, Snail și așa mai departe [ 76]. Quercetina poate inhiba apariția EMT prin creșterea expresiei E-cadherinei și scăderea familiei de proteine ​​N-cadherină, Vimentină, Snail în multe tipuri de cancer. În plus, metaloproteinazele matriciale (MMP) sunt membri ai familiei de endopeptidază care remodelează matricea extracelulară zincată (ECM) care joacă un rol în mai multe etape ale cancerului. Studiile au arătat că MMP sunt implicate în principal în procesul de invazie și metastază a cancerului [ 77 , 78 ]. În cancerul colorectal, precum și în carcinomul cu celule scuamoase de cap și gât, quercetina poate inhiba, de asemenea, invazia și migrația celulelor tumorale prin reglarea expresiei MMPs [ 79 , 80 ].

Studiile au arătat că quercetina poate inhiba invazia și metastaza celulelor canceroase pulmonare prin inhibarea căii de activare Akt dependent de melc. După tratamentul cu quercetină, expresia proteinelor asociate N-cadherinei, vimentinei, ADAM9 și MMPs a fost semnificativ reglată în jos, iar expresia E-cadherinei a crescut semnificativ [ 81 ]. În liniile celulare de cancer colorectal, cercetătorii au folosit TGF-β1 pentru a induce EMT în celulele canceroase. Administrarea de quercetin poate inhiba Twist1 și regla expresia E-cadherinei pentru a inhiba EMT [ 82]. Quercetina poate inhiba nivelul MMP2 și MMP7 în celulele cancerului pancreatic PANC-1 și PATU-8988, care sunt strâns legate de procesul EMT. Cercetătorii au subliniat, de asemenea, că quercetina poate inhiba invazia și metastaza celulelor cancerului pancreatic prin inhibarea căii de semnalizare STAT3 și inversarea progresiei maligne induse de IL-6 [ 83 ]. Quercetina poate inhiba migrația celulelor melanomului indusă de HGF prin inhibarea activării c-Met și a acestuia în aval Gabl, FAK și PAK [ 84 ]. Mai mult, glicozidele cu quercetină pot inhiba, de asemenea, metastaza cancerului. Poate inhiba căile FAK și ERK1 / 2 și poate suprima vitalitatea migratorie în celulele cancerului pancreatic [ 85 ].

3.1.4. Efectul quercetinei asupra autofagiei celulelor canceroase

Autofagia este un proces în care celulele sintetizează noi macromolecule și ATP printr-o serie de reacții în condiții de înfometare și deficit de energie, menținând secvențial metabolismul normal și supraviețuirea celulelor. Formarea autofagozomilor este un pas cheie în autofagie și se bazează pe regulatorul pozitiv al complexului ATG1 / ULK, care constă din ATG1, ATG13 și ATG17. Și apoi se activează clasa Ⅲ PI3K complex, ATG5-12 conjugat cu 16 promovează alungirea membranelor autofagice, după ce s-a format markerul autofagozom LC3Ⅱ [ 86 ].

Studiile au constatat că dezvoltarea unor boli tumorale este strâns legată de autofagie și există modificări ale activității autofagiei în multe celule tumorale. În domeniul oncologiei, se crede că autofagia este inițial un inhibitor al dezvoltării tumorii, în timp ce mai multe cercetări sugerează că autofagia poate promova progresia tumorii [ 87 , 88 ]. S-au format tratamentul liniilor celulare de cancer gastric cu quercetină, vacuole autofagice și organite veziculare acide (AVO), LC3Ⅰ a fost transformat în LC3Ⅱ, care a fost recrutat în autofagozomi pentru activarea genelor autofagice și inițierea progresiei autofagiei protectoare în celulele cancerului gastric. Efectul autofagic protector al quercetinei asupra celulelor canceroase gastrice este prin inhibarea semnalizării Akt-mTOR și prin acumularea expresiei HIF-α [ 89]. Acumularea de LC3Ⅱ și formarea de AVO s-au găsit și în glioblastomul tratat cu quercetin și în liniile celulare de cancer de colon, toate acestea confirmând inducerea autofagiei de protecție a celulelor tumorale de către quercetin [ [90] ,  [91] ,  [92] ]. Cu toate acestea, pretratarea cu clorochină, un inhibitor al autofagiei, poate crește promovarea apoptozei și inhibarea proliferării de către quercetin [ 89 , 90 ].

3.2. Studii in vivo

S-a demonstrat că quercetina inhibă creșterea diferitelor tipuri de cancer în diferite modele de xenogrefe. Rata de supraviețuire a modelelor animale purtătoare de tumori a fost semnificativ crescută, iar volumul tumorii a fost redus dramatic după tratamentul cu quercetină. Efectul inhibitor al quercetinei asupra modelelor animale de xenogrefă se poate reflecta în promovarea apoptozei, inhibarea proliferării, angiogeneza și metastazele. ( Tabelul 3 )

Tabelul 3. Efectul quercetinei asupra metastazelor celulare în diferite celule canceroase.

Tipul de cancerLinii telefoniceMecanismCalea semnuluiReferințe
Conserva pulmonarăA549, HCC827↑ E-cadherinăAKT81 ]
↓ N-caderină,
vimentină, ADAM9, catepsină C, V și MMP1, 2, 7, 12
Cancer colorectalSW480↑ E-cadherină82 ]
↓ Twist1, vimentin
Cancer pancreaticPANC-1, PATU-8988↓ MMP2, MMP7STAT383 ]
MelanomA2058, A375HGF / c-Met84 ]

În modelele de xenogrefe de celule de cancer mamar și leucemie, diferite doze de quercetină pot promova apoptoza și ciclul celular prin inhibarea căii Akt / mTOR [ 98 , 100 ]. In vivo, efectul quercetinei asupra creșterii tumorii se poate manifesta și prin angiogeneza grefei și metastaze. Trombospondina-1 (TSP-1) este un factor anti-angiogenic descoperit anterior, care poate inhiba creșterea tumorii. Studii recente au descoperit că quercetina poate inhiba creșterea tumorii la șoarecii model de cancer de prostată prin reglarea în sus a expresiei TSP-1 [ 95 ]. În modelul șoarecilor BALB / c de cancer mamar, Zhao și colab. a constatat că tratat cu 34 mg / kg de quercetin poate inhiba, de asemenea, angiogeneza prin inhibarea căii calcineurină / NFAT [ 101]. Experimentele in vivo au confirmat, de asemenea, efectul inhibitor al quercetinei asupra metastazelor tumorale. Metastaza pulmonară colorectală a fost semnificativ redusă după tratamentul cu 50 mg / kg de quercetin [ 79 ]. Administrarea de quercetină inhibă, de asemenea, EMT prin afectarea căii de semnalizare EGFR și inhibarea expresiei VEGF [ 96 , 99 ]. Efectul inhibitor al quercetinei asupra creșterii tumorilor alogene a fost găsit și la modelele de celule tumorale precum cancerul pulmonar, cancerul pancreatic etc. În plus, quercetina poate coordona și activitatea antitumorală cu alți compuși [ 93 , 107 ]. De exemplu, vincristina și quercetina agenții lipozomali co-încapsulați pot crește eficacitatea terapeutică a tratamentului pentru cancerul de sân [ 107] ( Tabelul 4 ).

Tabelul 4. Doza și mecanismul de quercetin pentru a inhiba creșterea tumorii la modelele de xenogrefă.

DozaAdministrareOrganeAnimaleMecanismReferințe
Dieta de 0,4%poProstataȘoareci SCID(+) apoptoză, (-) proliferare93 ]
(-) Semnalizare AR și PI3K / Akt
150 mg / kgipProstataȘoareci(-) HSP7294 ]
25,50,75 mg / kgProstataȘoareci BALB / c(-) angiogeneză95 ]
(-) TSP-1
200 mg / kgpoProstataŞobolan(-) Calea EGFR96 ]
120 mg / kgipLeucemieȘoareci NOD / SCID(+) apoptoză, autofagie97 ]
120 mg / kgipLeucemieȘoareci NOD / SCID(+) apoptoză, autofagie98 ]
(+) Calea JNK / ERK MAPK
(-) Calea Akt / mTOR
50 mg / kgipSânȘoareci(-) metastaze, glicoliză99 ]
(-) VEGF, PKM2, pAKT / AKT
15,45 mg / kgipSânȘoareci SCIDInduceți oprirea ciclului celular100 ]
(-) Akt / mTOR
34 mg / kgipSânBALB / c(-) angiogeneză101 ]
(-) calea calcineurină / NFAT
50, 100, 200 mg / kgipSân, colonBALB / c(+) apoptoză102 ]
50 mg / kgipColonBALB / c(-) metastază79 ]
150 mg / kgIGFicatBALB / c103 ]
ipFicatBALB / c(+) apoptoză, (-) proliferare104 ]
30 mg / kgpoGastricȘoareci NOD / SCID105 ]
50 mg / kgipPlămânȘoareci Athymic(-) aurora B106 ]

4. Concluzie și opinia experților

Cancerul este o boală e