Rezultatele căutări pentru: limfom

Remisiunea limfomului folicular după tratamentul infecției cu virusul hepatitei C

Aici descriem un pacient cu limfom folicular avansat și infecție concomitentă cu virusul hepatitei C (VHC).

Pacientul a remis complet ambele afecțiuni după tratamentul cu terapie antivirală cu acțiune directă (sofosbuvir) și ribavirină

Figura 1. 

Constatări imagistice la pacientul cu limfom folicular înainte și după tratamentul pentru infecția cu virusul hepatitei C.

În februarie 2014, un bărbat de 44 de ani a prezentat umflături submandibulare. O biopsie a arătat limfom folicular de gradul 2, care a fost pozitiv pentru CD20, CD10, proteina limfom 6 a celulelor B (BCL6) și proteina limfom 2 a celulelor B (BCL2) cu un indice de proliferare Ki67 de 15%. Boala în stadiul 4 a fost diagnosticată pe baza limfadenopatiei răspândite, a unei mase mezenterice mari ( Figura 1A ) care măsura 7,5 cm cu 3,0 cm cu 9,7 cm și implicarea măduvei osoase la nivel scăzut constând dintr-un grup paratrabecular de centrocite monomorfe care au fost pozitive pentru CD20 și CD79a. Scorul indicelui internațional de prognostic al limfomului folicular a fost 1 (pe o scară de la 0 la 5, scorurile mai mari indicând un risc mai mare de rezultat slab).

Pacientul HCV-anticorpi-pozitivi au avut o incarcatura virala ARN VHC de 1 x 10 6  UI per mililitru cu virus genotip 3a. Testele serologice pentru virusul imunodeficienței umane și virusul hepatitei B au fost negative. Nivelul său de alanină aminotransferază a fost ridicat la dublu față de limita superioară a intervalului normal. O măsurare a rigidității ficatului de 7,3 kPa (interval interquartil, 0 până la 8,0) pe elastografie tranzitorie (FibroScan, pe o scară de la 2,5 kPa la 75,0 kPa, cu scoruri mai mari care indică fibroză mai severă) a arătat fibroză hepatică ușoară.

Pacientul a primit un curs de 24 de săptămâni de sofosbuvir (în doză de 400 mg o dată pe zi) și ribavirină (1200 mg o dată pe zi) din martie până în septembrie 2014. În decurs de 4 săptămâni, nivelul ARN VHC a fost nedetectabil. La 12 săptămâni după terminarea tratamentului, nivelul ARN VHC a rămas nedetectabil, cu un nivel normal de alanină aminotransferază și rezultate FibroScan consistente cu o rată ridicată de răspuns virologic susținut.

În decembrie 2014, constatările privind tomografia computerizată (CT) a pieptului, abdomenului și pelvisului au fost în concordanță cu un răspuns parțial foarte bun al limfomului folicular. Tomografia cu emisie de pozitroni și CT în iunie 2015 au arătat noduri mezenterici de dimensiuni normale fără  boală avidă de 18 F-fluorodeoxiglucoză ( Figura 1B și 1D ). Testele imunohistochimice și citometrice în flux au arătat că măduva osoasă nu conține limfom. În septembrie 2016, pacientul a rămas bine, fără dovezi clinice de reapariție a bolii.

VHC este asociat cu limfoamele cu celule B și, în special, cu limfomul din zona marginală. 1  Terapia antivirală cu interferon poate induce remisia la pacienții cu ambele afecțiuni. 2  Unii pacienți cu limfom cu celule B (în principal limfom cu zonă marginală) au avut un răspuns la sofosbuvir, adesea cu chimioterapie concomitentă. 3,4

Am constatat că un pacient cu limfom folicular a avut remisie completă după tratamentul cu sofosbuvir-ribavirină și eliminarea VHC. Constatarea că tratamentul VHC este utilă în tratamentul limfomului cu celule B asociate cu VHC justifică un studiu suplimentar.

Nicola Maciocia, B.Sc.
University College London Hospitals NHS Foundation Trust, Londra, Regatul Unit

Dr. Alastair O’Brien
University College London, Londra, Regatul Unit

Kirit Ardeshna, FRCP, FRCPath.
University College London Hospitals NHS Foundation Trust, Londra, Regatul Unit
kirit.ardeshna@uclh.nhs.uk

Sprijinit prin finanțare (către dr. Ardeshna) de la University College London – University College London Hospital Biomedical Research Center.

Formularele de divulgare  furnizate de autori sunt disponibile împreună cu textul complet al acestei scrisori la NEJM.org. 4 Referințe

  1. 1. de Sanjose S, Benavente Y, Vajdic CM și colab. Hepatita C și limfomul non-Hodgkin din 4784 de cazuri și 6269 controale de la Consorțiul internațional de epidemiologie a limfomului. Clin Gastroenterol Hepatol 2008; 6: 451-458
  2. 2. Arcaini L, Vallisa D, Rattotti S și colab. Tratamentul antiviral la pacienții cu limfoame indolente cu celule B asociate cu infecția cu VHC: un studiu al Fondazione Italiana Linfomi. Ann Oncol 2014; 25: 1404-1410
  3. 3. Sultanik P, Klotz C, Brault P, Pol S, Mallet V. Regresia unui limfom de zonă marginală diseminată asociată cu VHC sub tratament antiviral fără IFN. Blood 2015; 125: 2446-2447
  4. 4. Carrier P, Jaccard A, Jacques J și colab. Limfoame non-Hodgkin cu celule B asociate cu VHC și noi agenți antivirali direcți. Liver Int 2015; 35: 2222-2227

Material suplimentar

Formulare de divulgarePDF104 KB

Citarea articolelor  (18)

  1. Tomonari Shimagaki, Takashi Maeda, Nao Kinjo, Daisuke Imai, Huanlin Wang, Nao Ohama, Keitaro Edahiro, Makoto Edagawa, Tomoyoshi Takenaka, Takahiro Ohmine, Shohei Yamaguchi, Kozo Konishi, Shinichi Tsutsui, Hiroyuki Matsuda. (2020) Limfom folicular hepatic primar la 5 ani după un răspuns virologic susținut de infecția virală cu hepatita C. Journal of Clinical Pathology  12 , jclinpath-2020-206469.
  2. James R. Cerhan. (2020) Epidemiologia limfomului folicular. Clinici de hematologie / oncologie din America de Nord  34 : 4, 631-646.
  3. Jeff Hosry, Roberto N. Miranda, Felipe Samaniego, Georgios Angelidakis, Harrys A. Torres. (2020) Caracteristicile clinicopatologice ale limfomului folicular la pacienții infectați cu virusul hepatitei C. Oncologie hematologică  38 : 3, 301-308.
  4. Chikako Ono, Takasuke Fukuhara, Songling Li, Jian Wang, Asuka Sato, Takuma Izumi, Yuzy Fauzyah, Takuya Yamamoto, Yuhei Morioka, Nikolay V. Dokholyan, Daron M. Standley, Yoshiharu Matsuura, Glenn Randall. (2020) Diverse miARN compensează rolul miR-122 asupra replicării VHC. PLOS Pathogens  16 : 6, e1008308.
  5. Joe Taylor, Alison M Yeomans, Graham Packham. (2020) Inhibarea țintită a factorilor de inițiere a traducerii ARNm ca strategie terapeutică nouă pentru neoplasmele cu celule B mature. Explorarea terapiei antitumorale vizate  1 : 1, 3-25.
  6. Jessica P. Hwang, Noelle K. LoConte, John P. Rice, Lewis E. Foxhall, Erich M. Sturgis, Janette K. Merrill, Harrys A. Torres, Howard H. Bailey. (2019) Implicații oncologice ale infecției cronice cu virusul hepatitei C. Journal of Oncology Practice  15 : 12, 629-637.
  7. Tung-Hung Su, Chun-Jen Liu, Tai-Chung Tseng, Shih-Wan Chou, Chen-Hua Liu, Hung-Chih Yang, Shang-Ju Wu, Pei-Jer Chen, Ding-Shinn Chen, Chi-Ling Chen, Jia-Horng Kao. (2019) Terapia antivirală timpurie reduce riscul de limfom la pacienții cu infecție cronică cu hepatită C. Farmacologie și terapie alimentară  49 : 3, 331-339.
  8. Alfredo Marzano, Emanuele Angelucci, Marco Astegiano, Chiara Baratelli, Luigi Biancone, Paolo Bironzo, Giuseppina Brancaccio, Maurizia Rossana Brunetto, Raffaele Bruno, Patrizia Burra, Maria Giuseppina Cabras, Paolo Caraceni, Claudia Chialà, Maria Grazia Clemente, Agostino Colli, Bruno Daniele , Elisabetta De Gasperi, Vito Di Marco, Maria Chiara Ditto, Stefano Fagiuoli, Clodoveo Ferri, Giovanni Battista Gaeta, Paolo Antonio Grossi, Barbara Imperatrice, Pietro Lampertico, Fabio Salvatore Macaluso, Salvatore Madonia, Massimo Marignani, Chiara Mazzarelli, Alberto Mella, Gabriele Missale, Simone Parisi, Luisa Pasulo, Massimo Puoti, Maria Rendina, Davide Ribaldone, Giuseppe Rossi, Pierluigi Toniutto, Alessandra Tucci, Pietro Vajro, Mauro Viganò, Riccardo Volpes, Anna Linda Zignego. (2019) Document de poziție AISF privind VHC la pacienții imunocompromiși. Boli digestive și hepatice  51 : 1, 10-23.
  9. Çetin Karaca. 2019. Manifestări extrahepatice ale infecției cu virusul hepatitei C. Hepatita virală: Hepatita cronică C, 183-195.
  10. Weicheng Ren, Xiaofei Ye, Hong Su, Wei Li, Dongbing Liu, Mohammad Pirmoradian, Xianhuo Wang, Bo Zhang, Qiang Zhang, Longyun Chen, Man Nie, Yao Liu, Bin Meng, Huiqiang Huang, Wenqi Jiang, Yixin Zeng, Wenyu Li , Kui Wu, Yong Hou, Klas G. Wiman, Zhiming Li, Huilai Zhang, Roujun Peng, Shida Zhu, Qiang Pan-Hammarström. (2018) Peisaj genetic al limfomului difuz cu celule B mari, asociat cu virusul hepatitei B. Blood  131 : 24, 2670-2681.
  11. Mohd Suhail, Sayed Sartaj Sohrab, Abid Qureshi, Mohd Tarique, Hany Abdel-Hafiz, Khalid Al-Ghamdi, Ishtiaq Qadri. (2018) Asocierea proteinelor mutate VHC și SNP-uri gazdă în dezvoltarea carcinomului hepatocelular. Infecție, genetică și evoluție  60 , 160-172.
  12. Sarah C. Rutherford, Eric N. Stewart, Zhengming Chen, Amy Chadburn, Natasha E. Wehrli, Koen van Besien, Peter Martin, Richard R. Furman, John P. Leonard, Leandro Cerchietti. (2018) Ribavirina, inhibitorul eIF4E, ca potențial terapeutic al antilimfomului: date clinice timpurii. Leucemie și limfom  59 : 1, 256-258.
  13. Xavier A. Andrade, Luis H. Paz, Mo ”ath Nassar, Diana M. Oramas, Harry E. Fuentes, Paula Kovarik, Satya Mishra, Anshu Singh. (2018) Limfom primar cu celule B difuze hepatice după un răspuns complet pentru infecția cu hepatită C după terapia antivirală directă. Acta Haematologica  139 : 2, 77-80.
  14. Wouter T. Zandee, Wouter W. de Herder. (2018) Evoluția tratamentului tumorii neuroendocrine reflectată de ghidurile ENETS. Neuroendocrinologie  106 : 4, 357-365.
  15. L. Couronné, E. Bachy, S. Roulland, B. Nadel, F. Davi, M. Armand, D. Canioni, JM Michot, C. Visco, L. Arcaini, C. Besson, O. Hermine. (2018) De la infecția cu virusul hepatitei C la limfomul cu celule B. Analele de oncologie  29 : 1, 92-100.
  16. Thomas F. Baumert, Frank Jühling, Atsushi Ono, Yujin Hoshida. (2017) Carcinomul hepatocelular legat de hepatita C în era antivirale de nouă generație. BMC Medicine  15 : 1.
  17. Harrys A. Torres, Terri Lynn Shigle, Nassim Hammoudi, James T. Link, Felipe Samaniego, Ahmed Kaseb, Vincent Mallet. (2017) Sarcina oncologică a infecției cu virusul hepatitei C: o perspectivă clinică. CA: A Cancer Journal for Clinicians  67 : 5, 411-431.
  18. Chikako Ono, Takasuke Fukuhara, Daisuke Motooka, Shota Nakamura, Daisuke Okuzaki, Satomi Yamamoto, Tomokazu Tamura, Hiroyuki Mori, Asuka Sato, Kentaro Uemura, Yuzy Fauzyah, Takeshi Kurihara, Takahiro Suda, Akira Nishio, Tor Su Ham Tatsumi, Tetsuo Takehara, Kazuaki Chayama, Takaji Wakita, Kazuhiko Koike, Yoshiharu Matsuura, Aleem Siddiqui. (2017) Caracterizarea propagării independente de miR-122 a VHC. PLOS Pathogens  13 : 5, e1006374.

https://www.nejm.org/doi/full/10.1056/NEJMc1513288

Limfomul anaplastic cu celule mari ALK-1- cu limfoproliferație cutanată CD30 + tratată cu vâsc: remisie spontană sau răspuns la tratament?

 2011 noiembrie; 223 (6): 364-7. doi: 10.1055 / s-0031-1285914. Epub 2011 3 noiembrie.

1
Departamentul de Medicină Integrală Pediatrică și Adolescentă, Gemeinschaftskrankenhaus, Herdecke, Germania. gkameda@hotmail.com

Abstract

O fată în vârstă de 12 ani a prezentat slăbiciune generală și pierdere în greutate, o mărire a ganglionilor limfatici cervicali localizați și leziuni cutanate compatibile cu papuloza limfomatoidă (LyP). Biopsiile de la nivelul ganglionului limfatic și piele au relevat un diagnostic histologic al limfomului anaplastic (ALCL) cu celule mari nodulare (ALCL) cu o limfoproliferație cutanată sincronă CD30 +, în concordanță cu papuloza limfomatoidă (LyP). Fata a fost tratată cu vâsc (MT) ca monoterapie. În decurs de o săptămână după inițierea tratamentului MT, leziunile pielii și mărirea ganglionilor limfatici s-au îmbunătățit. În continuarea terapiei MT cu 30 de luni de la diagnostic, pacientul este încă în remisie completă. Nu este posibil să știm dacă acesta a fost un caz rar de remisie spontană a manifestărilor nodale și cutanate ale acestei limfoproliferații cu celule T CD30 + sau dacă efectul observat a fost un răspuns terapeutic specific la tratamentul MT.

PMID: 
22052633 
DOI: 
10.1055 / s-0031-1285914

Evenimentele adverse grave și fatale prezintă risc asociat cu adăugarea de rituximab la chimioterapia limfomului non-Hodgkin cu celule B (B-NHL) : o meta-analiză.

Abstract

SCOP:

Rituximab este un anticorp monoclonal care vizează antigenul CD20 cu capacitatea de a crește remisia globală (OR) în limfomul non-Hodgkin (B-NHL) al celulelor B. S-a efectuat o revizuire sistematică și o meta-analiză pentru a determina riscul evenimentelor adverse severe (AE) severe și fatale relevante din punct de vedere clinic asociate cu utilizarea rituximabului în tratamentul B-NHL.

PACIENȚII ȘI METODELE:

Am inclus studii clinice de fază III care au utilizat chimioterapie în asociere cu rituximab sau chimioterapie, ca și pentru B-NHL. Analizele statistice au fost efectuate pentru a calcula raportul de risc sumar (RR) al AE severe și fatale relevante legate de rituximab.

REZULTATE:

Opt studii clinice controlate randomizate au fost incluse în această meta-analiză. Rezumatul RR obținut nu a evidențiat un risc crescut asociat rituximab asociat statistic în 13 evenimente adverse severe (infecții, febră, anemie, trombocitopenie, granulocitopenie, toxicitate hepatică, toxicitate cardiacă, toxicitate neurologică, toxicitate pulmonară, mucozită, greață / vărsături, diaree , alopecie), cu excepția leucocitopeniei (36,4% față de 31%, RR = 1,13, CI 95%, 1,01-1,27, P = 0,03). Incidența AE fatale a arătat o diferență remarcabilă între grupul tratat cu rituximab și grupul martor (RR = 1,45; CI 95%; 1,04-2,02; P = 0,03).

CONCLUZIE:

Această meta-analiză indică faptul că nu a existat nici o dovadă a incidenței statistic mai mari a majorității SAE în grupul care conține rituximab comparativ cu chimioterapia în monoterapie. Cu toate acestea, infecțiile fatale au fost mai frecvent observate la pacienții cărora li s-a administrat rituximab. Având în vedere moartea indusă de infecție cu scăderea incidenței în timpul perioadei de tratament, efectele rituximabului asupra infecțiilor necesită investigații suplimentare

 2015; 27 (6): 365-70. doi: 10.1179 / 1973947815Y.0000000025. Epub 2015 15 aprilie.
Evenimentele adverse grave și fatale prezintă risc asociat cu adăugarea de rituximab la chimioterapia limfomului non-Hodgkin (B-NHL) cu celule B: o meta-analiză.
Hua Q 1 , Zhu Y , Liu H.

1
Departamentul de Oncologie, Primul Spital Afiliat al Universității Medicale Anhui, Hefei, China.
PMID: 
25872413 
DOI: 
10.1179 / 1973947815Y.0000000025
[Indexat pentru MEDLINE]

Remisiunea completa si supravietuirea pe termen lung a unui pacient cu un limfom difuz cu celule mari B Sub Viscum album Extrase Dupa rezistenta la R-CHOP: Un raport de caz.

Abstract

FUNDAL:

Un limfom Hodgkin predominant al limfocitelor nodulare (NLPHL) este un neoplasm limfoproliferativ cu prognoză corectă, dar posibilitatea unei transformări maligne într-un limfom difuz de celule B mari (DLBCL) este mare. DLBCL progresează agresiv. Introducerea rituximabului în terapie a condus la rezultate mai bune. Utilizarea extractelor de albine Viscum (VAE) în cancer este stabilită, dar aplicarea lor în limfom este rară.

PREZENTARE CAZ:

Un pacient în vârstă de 65 de ani a fost diagnosticat cu stadiul IIB DLBCL cu splenomegalie, transformat dintr-un NLPHL, după o istorie de 30 de ani a ganglionilor limfatici inghinali în mod repetat mărită. Pacientul a respins inițial chimioterapia. După ce durerea tumorală a crescut, el a acceptat terapiile consecutive bendamustină plus vincristină plus prednisolon, trofosfamidă și rituximab plus ciclofosfamid plus hidroxdaunorubicină plus vincristină plus prednison (R-CHOP), inducând doar o ușoară regresie a leziunilor splenice. VAE a fost aplicat suplimentar la R-CHOP. La cinci luni de la terminarea chimioterapiei – în timpul terapiei VAE continuate în doze crescânde – s-a regăsit regresia leziunilor paraaortale. Pacientul a recuperat pe deplin în conformitate cu aplicarea VAE continuă și este în remisiune completă în curs de desfășurare și într-o stare bună de sănătate la 17 ani după diagnosticul inițial.

CONCLUZIE:

Deoarece remisia completă a tulburărilor limfoproliferative după tratamentul cu VAE a fost raportată anterior, investigațiile suplimentare ale VAE în limfom par foarte valoroase.

 2018 Sep; 38 (9): 5363-5369. doi: 10.21873 / anticanres.12865.
Remisiunea completa si supravietuirea pe termen lung a unui pacient cu un limfom difuz cu celule mari B Sub Viscum album Extrase Dupa rezistenta la R-CHOP: Un raport de caz.
Gutsch J 1 , Werthmann PG 2 , Rosenwald A 3 , Kienle GS 4, 5 .

1
Gemeinschaftskrankenhaus Herdecke, Spitalul Universitar de la Universitatea din Witten / Herdecke, Herdecke, Germania.
2
Institutul de Epistemologie Aplicată și Metodologie Medicală, Universitatea din Witten / Herdecke, Freiburg, Germania paul.werthmann@ifaemm.de.
3
Institutul de Patologie și Comprehensive Cancer Center Mainfranken, Universitatea din Würzburg, Würzburg, Germania.
4
Institutul de Epistemologie Aplicată și Metodologie Medicală, Universitatea din Witten / Herdecke, Freiburg, Germania.
5
Centrul de Medicină Complementară, Institutul de Prevenire a Infectării și Epidemiologia Spitalului, Centrul Medical, Facultatea de Medicină, Universitatea din Freiburg, Freiburg, Germania.
PMID: 
30194190 
DOI: 
10.21873 / anticanres.12865

Regresia durabilă a limfomului cutanat primar pe celule B în urma tratamentului cu vâsc ce induce febră: două rapoarte de caz

Context: Vâscul este un tratament natural complementar pentru cancer care este utilizat pe scară largă, de obicei în plus față de terapia cancerului alopata recomandată. Cu toate acestea, se cunosc puține despre utilizarea, eficacitatea și siguranța utilizării în tratamentul limfomului cutanat.

Raportul cazului: Doi pacienți cu limfom de celule B cutanate primare (centrul de foliculi pT 2b cN x M 0și zona marginală pT 2a cN x M 0 ) fie au refuzat sau au amânat tratamentul cancer alopat/ convențional și au primit tratamente de înaltă doză de inducere a febrei; a fost administrată o combinație de aplicare intratumorală, subcutanată și intravenoasă; și un pacient a suferit, de asemenea, hipertermie în întregul corp. Limfomul a regresat dupa o perioadă de 12 și, respectiv, 8 luni și după administrarea unei doze cumulative de 12,98 g și respectiv 4,63 g de extract de vasc. Pacienții sunt în remisiune până la data de 3,5 ani de la începerea tratamentului. Niciunul dintre pacienți nu a primit tratament cancer alopat pentru cancer în timpul întregii perioade de observație.

 

Remisiile pe termen lung de limfom după tratamentul cu febră-indusa cu toxine bacteriene au fost documentate de la William Coley. 1 limfoame cutanate primare reprezintă aproximativ 5% din totalul limfomului non-Hodgkin (incidență anuală 1: 100 000); 20% până la 25% dintre acestea sunt limfoame de celule B cutanate primare (PCBCL). 2  4 Cele mai frecvente subtipuri sunt limfomul central de folicul cutanat primar (PCFCL), limfomul zonei marginale cutanate primare (PCMZL) și limfomul difuz cu celule mari. Centrele de folicul și limfomul de limfocite din zona marginală B au tendința de a fi indolente și au o supraviețuire de 5 ani de peste 95% 5 ; deși recăderile sunt frecvente, progresia sistemică este rară.Leziunile unice sunt tratate cu radioterapie, steroizi intralezionali, excizie chirurgicală sau o strategie „așteaptă și vezi”. Boala sistemică multifocală sau recidivantă este de obicei tratată cu rituximab (R, anticorp monoclonal anti-CD20), chimioterapie cu un singur agent sau cu un agent multiplu (de exemplu, clorambucil sau ciclofosfamidă, vincristină, prednisolon, ciclofosfamidă, vincristină și predisolonă [CVP] imunoterapie cu interferon-α. 6 , 7 PCBCL este asociat cu dereglarea imunității și, în unele cazuri, imunodeficiența cu inflamație cronică (în special PCMZL), de exemplu, în artrita reumatoidă sau sindromul Sjügren și cu infecția cu Borrelia burgdorferi . 8  12 Aceștia răspund la tratamente imunologice, cum ar fi injecțiile intralezionale cu interferon-α13 sau cu interferon-γ care codifică adenovirusul, ceea ce poate duce chiar la remisie în leziunile îndepărtate neinjectate. 14 Supraviețuirea în limfomul sistemic se corelează cu celulele imune tumorale infiltrate, 15 și pentru regresiile spontane observate ocazional ale limfomului non-Hodgkin, au fost propuse mecanisme imunologice. 16 , 17

Extractul de visc(mistletoe) (ME) este un remediu cancer din plante întregi derivat din  Viscum album L, un arbust hemi-parazit; este utilizat pe scară largă pentru tratamentul cancerului natural /complementar, în special în Europa, în combinație cu terapia cancer alopata/convențională. O varietate de compuși biologic activi au fost izolați din extractul de viscum album ME, incluzând lec-tinuri de vâsc (MLs), viscotoxine, oligo- și polizaharide și altele. 19 , 20 extractul de viscum album ME are activitate imunostimulatoare (activarea in vivo și in vitro a monocitelor / macrofagelor, granulocitelor, celulelor naturale ucigase, celulelor T, celulelor dendritice, inducerea unei varietăți de citokine 19 , 20 ) și mai mulți compuși ) sunt citotoxice cu efecte determinante de inducere a apoptozei. 19  21

extractul de viscum album ME este, de obicei, aplicat subcutanat la o doză inițială scăzută, care se titrează încet în sus și se ajustează individual. Această abordare este asociată cu îmbunătățirea calității vieții și, probabil, și cu supraviețuirea.22  24 Ritmul de scădere a tumorii a fost rar observat la doze mici, dar în principal după o doză mare de extractul de viscum album ME care provoacă febra, adesea injectată intratumoral sau ca perfuzie intravenoasă (IV). 22  24 Cu toate acestea, aceste observații au fost raportate numai în seriile de caz și în rapoartele de caz. 23  27 Nici un studiu randomizat nu a investigat încă rolul extractului de viscum album ME în tratamentul limfomului. În afară de simptomele asemănătoare gripei dependente de doză, de febră și de reacțiile inflamatorii la locurile injectate, tratamentul cu extract de viscum album ME este sigur. Ocazional, reacțiile de hipersensibilitate sunt raportate. 28

Doi pacienți cu limfom cutanat primar au fost tratați la Clinica Park Attwood (PAC, care a fost închisă în 2010), un centru britanic specializat în îngrijirea cancerului complementar și, în special, în tratamentul cu extractul de viscum album ME de inducere a dozei mari și a febrei. Consimțământul informat pentru tratamentul cu extractul de viscum album ME a fost obținut de la ambii pacienți, înțelegându-se că acest lucru nu ar înlocui terapiile cancer alopate recomandate și că există dovezi temeinice că extractul de viscum album ME ar putea îmbunătăți toleranța tratamentului principal atunci când este aplicat concomitent.

CAZUL 1:

LIMFOM FOLICIL CU CELULE B PRIMAR CUTANAT

O femeie de 51 de ani a prezentat 2 leziuni la nivelul piciorului inferior din stânga, în mai 2008, la departamentul de oncologie al unui mare spital terțiar (Aberdeen Royal Infirmary [ARI]). Ea a observat pentru prima dată în vara anului 2007 o leziune în regiunea Achilles superioară din stânga, care a crescut în dimensiune și a devenit roșie. În toamna anului 2007, o leziune similară a apărut peste talpa medie a aceluiași picior, iar în săptămânile care au precedat prezentarea, au apărut câteva leziuni prin satelit mult mai mici în jurul leziunii anterioare.

Histopatologia a confirmat limfomul celulelor B foliculare de grad 1 ( figurile 1 și 2). 2 ). Stadializarea scanării tomografiei computerizate (CT) (piept, abdomen, pelvis) nu a raportat nici o limfadenopatie intraabdominală sau pelvină, dar a arătat un 2,7 x 1,7 limfaj ganglionar inghinal, care nu a fost biopsizat.Etapa a fost pT 2b cN x M 0. 26 Biopsia hematologiei, biochimiei și a măduvei osoase a fost în mod normal normală. Analiza de rearanjare a genei IgH a constatat o clonalitate confirmând limfomul cu celule B;Receptorul de celule T (TCR) -β-ve; TCR-γ foarte slab policlonal. Cytogenetica: translocațiile t (11; 14) și t (14; 18) nu au fost testate.

figura 1

Tumoră limfoidă celulară. Modelul este în mare măsură difuz cu zone focale nodulare (H & E × 10). Imaginea este oferită de Dr. Ghada Bashat, Patologie, Infirmeria Regală Aberdeen.
Figura 2

Tumoră limfoidă celulară. Modelul este în mare măsură difuz cu zone focale nodulare (H & E × 20). Imaginea este oferită de Dr. Ghada Bashat, Patologie, Infirmeria Regală Aberdeen .

Pacientul a fost în general bun; ea nu a avut antecedente de leziuni sau infecții și nici un simptom B, cum ar fi oboseală, transpirații nocturne, scădere în greutate sau prurit. Ea a avut lipomi de piele de lungă durată în diferite zone ale corpului, dar a fost în general sănătoasă, a crescut o fiică , a lucrat ca terapeut de mișcare, a fost non-fumător,nu băut  alcool, nu a luat medicamente regulate și nu a raportat alergii.

Având în vedere leziunile multicentrice, cu sateliți și posibila implicare a nodului regional care indică progresul, s-a recomandat ca ea să fie supusă imunochimoterapiei sistemice cu 6 cicluri de ciclofosfamidă, vincristină și prednison plus rituximab (R-CVP) finalizarea ciclurilor. Deși pacientul nu se opunea acestui tratament în principiu, ea a decis să o păstreze în rezervă și să-și îmbunătățească mai întâi imunitatea cu tratamentul visc ME.

La prezentarea pentru tratamentul visc ME în iunie 2008, pacientul a suferit o leziune posterioară în regiunea Achilles proximă stânga, cu dimensiunile de 5 cm × 4 cm ( Figura 3 ) și o tumoare anterioară a tibiei de 4 cm × 2 cm ( figura 4 ) numărul de sateliți din jur, fiecare <1,5 cm. Cele două leziuni mari au fost ridicate, roșii și calde la atingere. Pielea care se suprapune a fost subțire, dar intactă. Nu au existat semne de infiltrare a țesuturilor profunde; ea nu a raportat nici o durere, și nu s-au constatat deficite neurologice.Piciorul stâng a fost bine perfuzat, dar în jurul leziunilor și gleznei a apărut edeme pătrunzătoare.

Figura 3

Limfomul cutanat primar pe celule B în iulie 2008. Leziunea posterioară a lăsat piciorul inferior.
Figura 4

Limfomul cutanat primar pe celule B în iulie 2008. Leziunea anterioară a părăsit piciorul inferior; sateliții înconjurători nu arată clar.

Tratament natural cancer visc

Tratamentul cu visc ME (utilizând Abnobaviscum fraxini ) a inclus o combinație de aplicații intravenoase IV, intratumorale (IT) și subcutanate (SC) pe o perioadă de 12,3 luni și aplicații IV și SC pe o perioadă de încă 8 luni. Detalii sunt prezentate în Tabelul 1 . Tratamentul natural limfom a fost subdivizat într-o fază de inducție, în care se generează reacții febrile la extractul viscME și o fază post-inductivă. Tratamentul natural limfom cu extract visc ME a fost combinat cu tehnica de hipertermie a întregului corp (WBHT) – o tehnică de creștere a temperaturii miezului la 39 ° până la 39,5 ° C timp de 2 până la 5 ore cu radiație infraroșu, filtrată în apă, în condiții controlate. Leziunile cutanate nu au fost direcționate direct. Nu avea alte tratamente pentru cancer și nu lua medicamente.

tabelul 1

Programul de tratament (06/02 / 08-06 / 08/09) al pacientului cu PCBCL a

În timpul inducției, pacientul a avut 4 răspunsuri febrile de ≥38,5 ° C cu durată <24 ore, cu valori maxime de 38,5 ° C (după ziua 3); 38,7 ° C (după ziua 4); 39,1 ° C (după ziua 8); și 38,6 ° C (după ziua 11). Pentru abordarea IT, leziunile au fost injectate din marginea sănătoasă a pielii, pentru a evita ruperea tenului subțire de hârtie care acoperă tumorile bulversate. Volumul de lichid ME a depășit adesea 20 ml (20 mg / ml / fiolă) și a fost injectat în mod egal intra și perilezional în timp ce se repoziționează acul în timpul injectării.

După tratamentul IntraTumoral cu extract de viscum fraxiniparazit pe frasin), leziunile au răspuns imediat cu inflamație și inflamație imediată postinjecție, urmate de o rezoluție clinică a inflamației, iar pe parcursul tratamentului natural limfom, leziunile au apărut succesiv mai puțin inflamate. Rata de regresie părea ușor accelerată după începerea tratamentului cu hipertermie intreg corpul WBHT (ziua 37), iar după 4 luni, sa înregistrat o îmbunătățire generală clară. Leziunile au continuat să prezinte fluctuații asociate injectării, iar leziunea posterioară a fost rezolvată mai întâi.

Leziunile au scăzut constant în volum, consistență și roșeață. Remisiunea a fost evaluată prin examinare vizuală și palpare și confirmată de 3 clinicieni independenți din 3 setări clinice diferite, incluzând ARI.

Capacitatea generală și rezistența pacientului s-au îmbunătățit. 

Re-scanarea în mai 2009 a reflectat „Nu există semne supraclaviculare, axilare sau mediastinale … limfadenopatie retroperitoneală sau pelviană; ca și înainte, există noduri inghinale, dintre care cea mai mare este la stânga și are o dimensiune de 1,3 × 1,8 cm. Acest nod a fost documentat ca fiind de 2,7 × 1,7 cm în timpul stadializarii. „

Numărul total de sânge și biochimia de rutină au fost normale.

Având în vedere semnele clinice favorabile de control, injecțiile cu TI au fost întrerupte la 12,3 luni. Tratamentul combinat IV și SC ME cu WBHT a continuat timp de încă 8 luni, iar leziunile au continuat să se regreseze. În cele din urmă, zonele au fost înfundate, lăsând zone deprimate (posterior, Figura 5 ) și nivel (leziuni anterioare, Figura 6 ) zone hiperpigmentate. Terapia alopata a fost amânată pe o perioadă nedeterminată. 

La ultima revizuire din decembrie 2011, pacientul sa descurcat bine si a ramas in remisie; aparițiile au fost similare cu cele din iunie 2011Figurile 7 și 8 8 ).

Figura 5

Limfomul cutanat primar pe celule B în mai 2010. Piciorul inferior stâng posterior; după pigmentarea posttratament și depresie.
Figura 6

Limfomul cutanat primar pe celule B în mai 2010. Piciorul inferior din stânga anterioară prezintă modificări ale pigmentării.
Figura 7

Limfomul cutanat primar pe celule B în iunie 2011. Piciorul inferior posterior stâng.
Figura 8

Limfomul cutanat cu celule B primare în iunie 2011. Piciorul inferior din stânga anterioară.

tolerabilitatea tratamentului vasc

Febră a fost asociată cu boală (gradul 1) și gradul 2 la oboseală. Administrarea ulterioară combinată IV / IT a provocat oboseală (gradul 1-2) timp de 1 până la 3 zile. Nu s-a observat hipersensibilitate. Injecțiile SC au provocat răspunsuri de 4 cm până la 5 cm de eritem pentru <2 zile. Injecțiile intralezionale cu extract vasc ME concentrat au fost inconfortabile, cu presiune fluidă și durere pentru câteva minute, dar nu au necesitat analgezie. Răspunsurile inflamatorii (eritem, umflare, sensibilitate) și creșterea tranzitorie a edemului piciorului inferior au durat timp de <2 zile și au fost tratate cu aplicații de răcire. Pacientul nu a prezentat nici o flebită la locurile de canulare.

Descrierea pacientului a tratamentului

În acest caz, pacientul a descris experiența de tratament după cum urmează:

Cu febra initiala si nivelurile de energie fluctuante, tratamentul meu a fost intens, epuizant si a fost singurul lucru pe care l-am putut face in acea perioada: dar nu a fost o povara si o experienta semnificativa. În timpul unuia dintre episoadele febra mare, o experiență traumatizantă veche a devenit dezangajată și de atunci m-am simțit eliberată; Acum mă simt mai bine decât înainte de cancer, fizic și emoțional. De asemenea, m-am simțit împuternicita să colaborez cu medicii mei pentru a-mi dezvolta cel mai bun tratament. Sunt foarte recunoscătoare pentru noua mea sănătate!

CAZUL 2: LIMFOM CELULE B A ZONEI MARGINALE PRIMARE CUTANOASE

Un asistent de zbor în vârstă de 52 de ani a fost diagnosticat la același departament de oncologie (ARI) cu limfomul de celule B limită cutanată primară cutanată pT 2a cN x M 0 (PCMZL). În decembrie 2007, la 2-3 zile după venapuncție, a dezvoltat o leziune în fosa antecubitală stângă, care a fost excizată în mai 2008. Histopatologia a prezentat limfom de zonă marginală nodală ( figura 9 ). O scanare CT staționară a gâtului, pieptului, abdomenului și bazinului nu a arătat semne de boală sistemică; biopsia măduvei osoase, biochimia și hematologia au fost normale. La scurt timp după excizie, pacientul a dezvoltat o a doua leziune pe peretele drept al pieptului anterior, medial la piciorul drept anterior axilar. Leziunea a fost doar palpabilă (fără fotografii). Pacientul a fost asimptomatic, nu a avut nici o pierdere în greutate recentă sau oboseală. S-au recomandat mai multe opțiuni de tratament: R-CVP, 10 fracții de radioterapie în câmpul implicat al celor două situsuri sau clorambucil pulsat timp de 6 luni; el a refuzat aceste opțiuni.

Figura 9

Limfomul zonei marginale limfatice. Arhitectura nodului este eliminată difuz prin o populație de celule limfoide, plasmacytice și histiocitare (H & E × 10). Imaginea este oferită de Dr. Ghada Bashat, Patologie, Infirmeria Regală Aberdeen.

Pacientul a avut o istorie de rozacee cu keratită; certozelor actinice ale spatelui superior (tratate cu crioterapie ocazională); 2 carcinoame cu celule bazale – unul din partea superioară a spatelui (excizat în 1999) și unul din piciorul stâng (excizat la începutul anului 2007) și un diagnostic incert al sclerodermiei cutanate facial fără implicare viscerală, dar a ridicat titruri de factor antinuclear care nu răspundea azatioprină și prednisolon oral (2004). Folosea moderat nicotina și alcoolul. În afară de emolienți, el nu a folosit alte medicamente anticanceroase alopate sau alte medicamente convenționale, nu a raportat alergii formale și nu a primit vâsla. Nu a avut infecții recente și nici o traumă a țesuturilor moi.

La prezentarea la PAC în august 2008, pacientul cu limfom era în stare generală de sănătate generală, cu un nivel de performanță Karnofsky de peste 90%. În axila stângă exista un limfade moi și mobile. Leziunea toracică superioară dreaptă a fost de 2 × 3 cm palpabilă și mobilă. Nu au existat alte descoperiri anormale.

Tratament natural limfom

Tratamentul IntraVenos, IntraTumoral și SubCutanat combinat cu extract visc ME ( Abnobaviscum fraxini ) a fost furnizat pe o perioadă de 8,5 luni. Detalii sunt prezentate în Tabelul 2 . În timpul consimțământului informat, pacientului cu limfom i sa explicat că teoria sa autoimună care sta la baza ar putea fi agravată. Nu a primit alte tratamente anticanceroase.

Tabelul 2

Programul de tratament (08/09 / 08-04 / 20/09) și dimensiunea tumorii a pacientului cu PCMZL a

El a avut 6 răspunsuri febrile (38 ° până la 39,2 ° C) între zilele 5 și 87. Nu au existat semne de infecție concomitentă. După injectările IntraTumorale cu extract de visc ME, leziunea limfomului a arătat de fiecare dată un model de răspuns similar al inflamației și eritemului timp de până la 2 zile, apoi rezoluție. Leziunea a crescut în dimensiune în prima lună la 4 × 5 cm, apoi a rămas neschimbată timp de 3 luni, iar după ce doza de IT a crescut la 100 mg ME, leziunea a scăzut constant pentru a deveni impalpabilă la 8,5 luni ( Tabelul 2 ). Acest răspuns complet (CR) a fost verificat clinic de 3 clinicieni în 2 instituții separate, inclusiv ARI. IT-urile au încetat în aprilie 2009, iar tratamentul cu SC și IV a fost continuat până în noiembrie 2010. La o scanare CT în martie 2010 nu a fost remarcabilă. Pacientul a fost revizuit ultima dată în decembrie 2011 și sa descurcat bine și în remisie; nu s-au dezvoltat noi leziuni.

tolerabilitatea tratamentului limfom cu vasc

În primele 3 luni, tratamentul a fost o provocare. Episoadele de febră, în special, au fost însoțite de boală și oboseală de gradul 1 până la 2. Odată ce, flebita de gradul 2 a apărut la locul de cannulare IV și a fost rezolvată spontan; în mod interesant, nu a rezultat nici o recidivă locală. Dozele SC și IT au fost urmate de reacții tipice ale inflamatorie, care s-au rezolvat fără cicatrizare sau fibroză subcutanată. Nu s-au observat hipersensibilitate și nu s-au observat semne sau simptome de reactivare autoimună. După 6 luni, pacientul a raportat în mod constant o îmbunătățire a vitalității și bunăstării.

Descrierea pacientului a tratamentului

În acest caz, pacientul a descris experiența de tratament visc după cum urmează:

Când mi sa oferit chemo- / radioterapie, mi sa părut agresivă ca un ciocan de sanie pentru a sparge o nuca. Înțelegerea mea cu privire la terapia vascului a simțito mai blândă și pur și simplu ca un lucru bun de făcut. Tratamentul în sine, în timp ce era provocator, mi-a confirmat sentimentul că a fost temelia principală de a fi vindecat.

DISCUŢIE

Limfomul primar cu celule B cutanate de 2 pacienți a regresat după administrarea unei combinații de SC, IV și aplicații IT de tratament cu extract visc ME de mare doză și inducția febrei. Motivul combinației a fost de a optimiza răspunsurile imune, așa cum se înțelege în prezent, pentru a determina febra și pentru a aplica principiul vaccinării „in situ” cu aplicația IntraTumorala. La un pacient, s-a adăugat hipertermie corp intreg WBHT pentru a beneficia de avantajele unei competențe imune imbunatatite care este asociată cu hipertermia de febră. 29 La trei ani și jumătate de la începerea tratamentului, pacienții rămân în remisie clinică.

Cu doze mari, în special în cazul aplicațiilor extract visc ME locale, remisiile tumorale au fost raportate în mod repetat într-o serie de tipuri de tumori, incluzând cancerul de sân, cancerul de celule Merkel, cancerul hepatic primar, cancerul pancreatic și cancerul celular scuamos cutanat. 25-27 Totuși, administrarea de doze mari și combinate IT, IV și SC care urmărește să provoace inducția febrilă este mai puțin frecventa și subestimata.

Literatura privind tratamentul cu extract de vasc ME al limfomului este limitată în comparație cu cea a altor tipuri de tumori. Un studiu clinic uman retrospectiv descrie rezultatele favorabile, incluzând câteva remisiuni într-un grup de 61 de pacienți cu limfom folicular non-Hodgkin tratați cu un extract vasc ME scăzut (Iscador Pini), fie singur, fie combinat cu sau după terminarea chimioterapiei. Un alt studiu retrospectiv a investigat în primul rând aspectele de siguranță ale tratamentului cu extact de vasc ME în limfomul Hodgkin și non-Hodgkin și nu a identificat niciun risc. 31Unele rapoarte de caz descriu remisia limfomului non-Hodgkin sub extract vasc ME în monoterapie, 32-35 inclusiv 2 în limfomul cutanat cu celule T la copii. 36 , 37 În aceste cazuri, doza a fost mai mică decât în ​​cazurile raportate aici și a fost aplicată în principal subcutanat și numai parțial intravenos și intratumoral. A fost raportată cel puțin o reacție la febră.

Studiile preclinice cu celule limfomice și modele de limfom murin tratate cu vasc extract ME,vasc  lectic ML izolate, vasc lectic  ML recombinant și alte peptide vasc extract ME au arătat în mod constant efecte antitumorale cu inhibarea tumorilor, inhibarea metastazelor și beneficii de supraviețuire. 19 , 38  42 vasc extract ME conține mai multe ingrediente citotoxice, printre care lectine și viscotoxine, care sunt deosebit de abundente în Abnobaviscum fraxini .Atunci când medicamentele lectice sunt aplicate sistemic, citotoxicitatea lor este moderată de proteinele serice 43 și ulterior de apariția anticorpilor anti-ML; De aceea, este de așteptat citotoxicitatea acestora, în principal prin administrarea IntraTumorala. Cu toate acestea, un răspuns al bolii ar putea fi, de asemenea, efectuat printr-un mecanism imunologic, așa cum s-a demonstrat în mod repetat pentru extract vasc ME. 19 , 20 În plus, febra pare să aibă un rol în apărarea tumorală. Impactul tratamentului cu vasc extract ME nu poate fi stabilit cu ușurință atunci când este utilizat concomitent cu tratamentul cancerului principal. Cu toate acestea, ocazional, pacienții amână sau refuză tratamentul convențional convențional în favoarea extract vasc ME, iar astfel de cazuri permit evaluarea tratamentului extract vasc ME individual . Doi dintre acești pacienți sunt descriși mai sus; acestea sunt singurele cazuri de limfom cutanat tratate la PAC numai cu vasc extract ME și, prin urmare, sunt neselectate. Cazurile altor 2 pacienți din PAC care au avut cancer la alte locuri și au fost tratați cu monoterapie cu extract ME au fost publicate anterior. 27

În limfom, se estimează că remiterea spontană survine în 5% până la 20% din cazuri. Este uneori de lungă durată 16 , 17 , 46 , 47 și adesea este asociat cu reducerea unui tratament sau a unei stări imunosupresoare;după febră, infecții virale sau bacteriene sau vaccinare; sau după biopsie și după eradicarea helicobacterului în limfomul gastric. 17 Într-un mic studiu de urmărire care a urmărit pacienții de-a lungul multor ani, au fost raportate remisii spontane la 4 din 16 pacienți cu PCFCL (unul complet) și la 4 din 8 pacienți cu PCMZL (nici unul dintre aceștia nu a fost complet) o recidivă. Deși remisia spontană ar fi putut juca un rol în cazurile prezentate aici, în primul dintre cazurile prezentate, leziunile au crescut progresiv până la începerea tratamentului cu extract vasc ME și apoi au scăzut în mod constant, cu fluctuante răspunsuri inflamatorii legate de tratament. În cel de-al doilea caz, leziunea a fost rezolvată după creșterea inițială legată de tratament și cu o anumită întârziere, ceea ce reprezintă un model de răspuns cunoscut în remisiile tumorale asociate extracte vasc ME. De aceea, o simplă coincidență este puțin probabilă, mai ales că cele două cazuri sunt neselectate (ceea ce înseamnă că ele nu au fost selectate dintr-un grup mai mare de pacienți cu limfoame cutanate tratați cu extract vasc ME, dar au fost singurii pacienți cu limfoane cutanate tratate în acest mod) și reprezintă numai pacienții cu PCBCL din PAC care au fost tratați cu monoterapie cu extract vasc ME. De asemenea, trebuie să considerăm că tratamentul cu extract vasc ME de inducție a febrei este susceptibil de a modifica doar acele mecanisme implicate în remisia spontană frecventă descrisă pentru limfom.

Două alte publicații de caz privind tratamentul natural cancer cu extrat vasc ME al unei entități asociate, limfo-proliferarea celulelor T-CD30 +, au raportat regresia completă a bolilor cutanate și nodale multiple și active. 37 , 38 Într-un caz, tratamentul a constat în administrarea de doze mici  IV (3 infuzii de 0,02 mg, 0,2 mg și 2 mg) și SC (până la 2 mg de două ori pe săptămână) fără febră sau răspunsuri la locul locului, în termen de o săptămână și un răspuns complet (CR) durabil (30 de luni) în decurs de 4 săptămâni. Cel de-al doilea caz a fost tratat cu intenție de febră primară (38 ° C), IT și SC și a avut un răspuns parțial dependent de doză și CR care a recidivat cu o doză mai mică extrat vasc ME, dar a regresat din nou cu creșterea dozei.

O apreciere diferențiată a componentelor singulare ale tratamentului extract vasc ME combinat – rolul specific al febrei și a fiecărei contribuții specifice a SC, IT și IV – și a sinergiilor nu este posibil având în vedere cunoștințele actuale și necesită cercetări ulterioare.

Deși tratamentul a fost bine tolerat și siguranța observată este în concordanță cu alte investigații privind siguranța tratamentului natural cancer cu extract vasc ME în doze mai mari, 28 acest tratament ar trebui rezervat pentru medici care au experiență în aplicarea extract vasc ME în doze mai mari și IT / IV până la anchetele au explorat rolul unei doze mari de extract vasc ME care provoacă febra în cancer și siguranța sa în detaliu.

CONCLUZIE

Doza mare de tratament cu vâsc, care determină febra, pare să aibă efecte benefice în două cazuri de limfom de celule B cutanate primare. Sunt necesare cercetări suplimentare pentru a investiga efectele antitumorale, mecanismele potențiale de acțiune, cel mai bun mod de aplicare și siguranța și eficacitatea asociate.

Consimţământ

Consimțământul informat în scris a fost obținut de la ambii pacienți pentru publicarea raportului și a figurilor însoțitoare. Ambii au citit versiunea finală a lucrării și au confirmat conținutul acesteia.

Informații despre colaboratori

Maurice Orange, este medic generalist, fost medic în cadrul Clinicii Park Attwood, Marea Britanie, și în prezent oncolog  medicul spitalicesc la Ita Wegman Klinik, Arlesheim.

Maria P. Fonseca, Maria P. Fonseca a fost fostă asistentă generală la Clinica Park Attwood și este în prezent în practică privată la Emerson College, Regatul Unit.

Broder H. von Laue, Broder H. von Laue, dr. Med, este medic senior, practică oncologică, Niefern-Oeschelbronn, Germania.

Stefan Geider, Ștefan Geider, dr med, este medic generalist la Camphill Medical Practice NHS, St John’s, Aberdeen, Regatul Unit.

Gunver S. Kienle, dr. Gunver S. Kienle, este cercetător principal la Institutul de Epistemologie Aplicată și Metodologie Medicală de la Universitatea Witten / Herdecke din Freiburg, Germania.

REFERINȚE

1. Wiemann B, toxina lui Colenes, Starnes CO , factor de necroză tumorală și cercetare în domeniul cancerului: o perspectivă istorică . Pharmac Ther . 1994; 64 ( 3 ): 529-64 PubMed ]
2. Willemze R, Jaffe ES, Burg G și colab. Clasificarea WHO-EORTC pentru limfoame cutanate . Sânge .2005May15; 105 ( 10 ): 3768-85 PubMed ]
3. Bradford PT, Devesa SS, Anderson WF, Toro JR. Modele cutanate de incidenta a limfomului in Statele Unite: un studiu bazat pe populatie de 3884 de cazuri . Sânge . 2009May21; 113 ( 21 ): 5064-73 Articol fără PMC ] PubMed ]
4. Slater DN. Noua Organizație Mondială a Sănătății – Organizația Europeană pentru Cercetarea și Tratamentul Clasificării Cancerului pentru limfoame cutanate: o căsătorie practică a doi giganți . Br J Dermatol . 2005November; 153 ( 5 ): 874-80 PubMed ]
5. Willemze R. Limfom cutanat primar pe celule B: clasificare și tratament . Curr Opin Oncol .2006September; 18 ( 5 ): 425-31 PubMed ]
6. Recomandările naționale privind cancerul la nivel național NCCNTM versiunea 4.2011: limfomul cutanat primar cu celule B. Fort Washington: Rețeaua națională de cancer cuprinzătoare; 2011
7. Senff NJ, Noordijk EM, Kim YH și colab. Organizația Europeană pentru Cercetare și Tratamentul Cancerului și Societatea Internațională pentru Limfomul Cutanat recomandări consens pentru administrarea limfoamelor cutanate cu celule B. Sânge . 2008September1; 112 ( 5 ): 1600-9 PubMed ]
8. Zhao XF, Reitz M, Chen QC, Stass S. Patogeneza leucemiei și limfomului precoce . Cancer Biomark .2011; 9 ( 1-6 ): 341-74 PubMed ]
9. Magro CM, Porcu P, Ahmad N, Klinger D, Crowson AN, Nuovo G. Imunocitom cutanat: un studiu clinic, histologic și fenotipic de 11 cazuri . Aplicația Immunohistochem Mol Morphol . 2004September; 123 ): 216-24 PubMed ]
10. Cho-Vega JH, Vega F, Rassidakis G, Medeiros LJ. Limfomul celulei B limfată cutanată primară . Am J Clin Pathol . 2006June; 125 Suppl: S38-49 PubMed ]
11. Takino H, Li C, Hu S și colab. Limfomul celulelor limfatice B limfatice primare: un studiu molecular și clinicopatologic al cazurilor din Asia, Germania și Statele Unite . Mod Pathol . 2008December; 21 ( 12 ): 1517-26 PubMed ]
12. Hoover RN. Riscul limfoamelor la populațiile cu imunitate modificată – o căutare a mecanismului .Cancer Res . 1992October1; 52 ( 19 Suppl): 5477s-8s PubMed ]
13. Cozzio A, Kempf W, Schmid-Meyer R și colab. Intra-leziune de terapie cu interferon alfa2a cu doză mică pentru limfomul cu celule B marginale cutanate primare . Leucem limfom . 2006May; 47 ( 5 ): 865-69 PubMed ]
14. Dummer R, Eichmüller S, Gellrich S, și colab. Studiu clinic de fază II privind aplicarea intratumorală a TG1042 (adenovirus-interferon-gamma) la pacienți cu limfoame cu celule T cutanate avansate și limfoame cu celule B multisectoriale cutanate . Mol Ther . 2010June; 18 ( 6 ): 1244-7 articol gratuit PMC ]PubMed ]
15. Dave SS, Wright G., Tan B, și colab. Predicția supraviețuirii în limfomul folicular pe baza caracteristicilor moleculare ale celulelor imune care infiltrează tumori . N Engl J Med . 2004November18;351 ( 21 ): 2159-69 PubMed ]
16. Horning SJ, Rosenberg SA. Istoricul natural al limfoamelor non-Hodgkin de grad scăzut inițial netratate . N Engl J Med . 1984December6; 311 ( 23 ): 1471-5 PubMed ]
17. Wiernik PH. Spontanremissionen bei lymphomen . În: Heim ME, Schwarz R, editori. , editori.Spontanremissionen in der onkologie . Stuttgart / New York: Schattauer Verlag; 1998. p. 193-199
18. Molassiotis A, Fernandez-Ortega P, Pud D, și colab. Utilizarea medicamentelor complementare și alternative la pacienții cu cancer: un studiu european . Ann Oncol . 2005April; 16 ( 4 ): 655-63 PubMed ]
19. Kienle GS, Kiene H. Mistel în der Oncologie: Fakten und konzeptionelle Grundlagen . Stuttgart, New York: Schattauer Verlag; 2003
20. Büssing A, redactor. , editor. Vâscul: genul Viscum . Amsterdam: Edituri Academice din lemn de esență tare; 2000
21. Büssing A, Schietzel M. Proprietățile de inducere a apoptozei din extractele Viscum album L., provenite de la arbori gazdă diferiți, se corelează cu conținutul lor de lectine toxice de vâsc . Anticancer Res . 1999Jan-Feb; 19 ( 1A ): 23-8 PubMed ]
22. Kienle GS, Kiene H. Articolul revizuit: Influența extractelor Viscum album L (european vâsc) asupra calității vieții la pacienții cu cancer: o revizuire sistematică a studiilor clinice controlate . Integr Cancer Ther . 2010June; 9 ( 2 ): 142-57 PubMed ]
23. Kienle GS, Glockmann A, Schink M, Kiene H. Viscum album L. extracte în cancerele mamare și ginecologice: o revizuire sistematică a cercetărilor clinice și preclinice . J Exp Clin Cancer Res .2009June11; 28 : 79. Articol gratuit PMC ] PubMed ]
24. Kienle GS, Kiene H. Terapia complementară a cancerului: o revizuire sistematică a studiilor clinice prospective privind extractele de vas de antroposofie . Eur J Med Res . 2007March26; 12 ( 3 ): 103-19 PubMed ]
25. Matthes H, Schad F, Buchwald D, Schenk G. Injecția fină cu ultrasunete ghidată cu ultrasunete a Viscum albumului L. (vaselină, Helixor M) în tratamentul cancerului pancreatic primar inoperabil: un studiu pilot . Gastroenterologie . 2005; 128 ( 4 Suppl 2): ​​433, T 988
Mabed M, El-Helw L, Shamaa S. Studiu de fază II privind visc-fraxini-2 la pacienții cu carcinom hepatocelular avansat . Br J Cancer . 2004January12; 90 ( 1 ): 65-9 articol gratuit PMC ] PubMed ]
27. Orange M, Fonseca M, Lace A, von Laue HB, Geider S. Răspunsuri tumorale durabile după inducerea dozei mari primare cu extracte de vâsc: Două rapoarte de caz . Eur J Integr Med . 2010June; 2 ( 2 ): 63-9
28. Kienle GS, Grugel R, Kiene H. Siguranța dozelor mai mari de Viscum album L. la animale și la om – revizuirea sistematică a modificărilor imune și a parametrilor de siguranță . BMC Complement Altern Med. 2011August28; 11 : 72. Articol gratuit PMC ] PubMed ]
29. Skitzki JJ, Repasky EA, Evans SS. Hipertermia ca strategie de imunoterapie pentru cancer . Curr Opin Investig Drugs . 2009June; 10 ( 6 ): 550-8 articol gratuit PMC ] PubMed ]
30. Kuehn JJ. Raspunsurile la tratament privind albumul pini (Iscador P) in limfomul non-Hodgkinś explorand un nou traseu terapeutic . Medicina (B Aires) . 2007; 67 ( Suppl II ): 107-14
31. Stumpf C, Rosenberger A, Rieger S, Tröger W, Schietzel M. [Extracte de vâsc în terapia bolilor maligne, hematologice și limfatice – o analiză monocentrică, retrospectivă de peste 16 ani] . Forsch Komplementarmed Klass Naturheilkd . 2000June; 7 ( 3 ): 139-46 germană. PubMed ]
32. Wagner R. Eine Praxisbeobachtung 1993 – 1996 . Iscador-Informationen, Verein für Krebsforschung e V. Ostfildern . 1996; ( 4 ): 1-42
33. Wolf P. Die mistel-infusionstherapie zur behandlung von tumorleiden . Naturamed . 1989; 4 : 720-724
34. Goyert A. Niedrig dosirete Misteltherapie bei niedrig malign non-Hodgkin-limfom. Erfahrungsbericht .In: Scheer R, Becker H, Berg PA, editori. , editori. Grundlagen der Misteltherapie: Aktueller Stand for Forschung und Klinische Anwendung . Stuttgart: Hippokrates Verlag GmbH; 1996. p. 362-5
35. Kuehn JJ. [Rezultat favorabil pe termen lung cu terapia vâscului la un pacient cu limfom non-Hodgkin centroblastic-centrocytic] . Dtsch Med Wochenschr . 1999November26; 124 ( 47 ): 1414-8 germană.PubMed ]
36. Kameda G, Kempf W, Oschlies I, Michael K, Seifert G, Längler A. [ Limfomul anaplastic cu celule mari ALK-1- cu limfoproliferare cutanată cutanată tratată cu vasc: remisie spontană sau răspuns la tratament?] Klin Padiatr . 2011November; 223 ( 6 ): 364-7 germană. PubMed ]
37. Seifert G, Tautz C, Seeger K, Henze G, Laengler A. Utilizarea terapeutică a vasului pentru tulburarea limfoproliferativă cutanată CD30 + / papuloza limfomatoidă . J Eur Acad Dermatol Venereol . 2007April;21 ( 4 ): 558-60 PubMed ]
38. Kovacs E, Link S, Toffol-Schmidt U. Compararea extractului VisCum album QuFrF cu vincristina într-un model in vitro al limfoamului WSU-1 al celulelor B. Arzneimittelforschung . 2008; 58 ( 11 ): 592-7PubMed ]
39. Kuttan G, Vasudevan DM, Kuttan R. Efectul unui preparat din Viscum album in dezvoltarea tumorii in vitro și la șoareci . J Ethnopharmacol . 1990April; 29 ( 1 ): 35-41 PubMed ]
40. Braun JM, Ko HL, Schierholz JM, Weir D, Blackwell CC, Beuth J. Aplicarea extractelor standardizate vâsc amplifica răspunsul imun si regleaza in jos colonizarea cu metastaze de organe în modele murine . Cancer Lett . 2001September10; 170 ( 1 ): 25-31 PubMed ]
41. Kuttan G, Vasudevan DM, Kuttan R. reducerea activității unui ingredient activ izolat din extract de vâsc și posibila mecanism de acțiune a tumorii . J Exp Clin Cancer Res . 1992; 11 ( 1 ): 7-12
42. Pryme IF, Bardocz S, Pusztai A, Ewen SW. Dietetice suplimentarea vâsc lectină și a redus de creștere a unui limfom non-Hodgkin murin . Histol Histopathol . 2002January; 17 ( 1 ): 261-71 PubMed ]
43. Frantz M, Jung ML, Ribéreau-Gayón G, Anton R. Modularea vâsc ( Viscum album L.) lectine citotoxicitate prin carbohidrați și glicoproteinelor serice . Arzneimittelforschung . 2000May; 50 ( 5 ): 471-8 PubMed ]
44. Stettin A, Schultze JL, Stechemesser E, Berg PA. Anti-vâsc lektin Anticorpii sunt produși la pacienți în timpul tratamentului cu un extract apos vâsc derivat din Viscum album L. și neutralizează citotoxicitatea indusă de lectina in vitro . Klin Wochenschr . 1990September14; 68 ( 18 ): 896-900 PubMed ]
45. KIENLE GS. Febra in tratamentul cancerului: terapia Coley și observații epidemiologice . Global Adv Sanatate Med . 2012; 1 ( 1 ): 92-100 PMC articol liber ] PubMed ]
46. Gattiker HH, Wiltshaw E, Galton DA. Regresie spontană în limfomul non-Hodgkin . Cancer . 1980May15; 45 ( 10 ): 2627-32 PubMed ]
47. Papac RJ. Regresie spontană a cancerului . Cancer Treat Rev . 1996November; 22 ( 6 ): 395-423 PubMed ]
48. Bekkenk MW, Vermeer MH, Geerts ML, și colab. Tratamentul multifocale limfom cutanat cu celule B primare: un studiu clinic de urmarire a 29 pacienți . J Clin Oncol . 1999August; 17 ( 8 ): 2471-8 PubMed ]

Articole din Avansuri globale în domeniul sănătății și medicina sunt furnizate aici prin amabilitatea SAGE Publications
Logo-ul gahmj

Global Advances in Health and Medicine
Glob Adv Sănătate Med . 2012 Mar; 1 (1): 18-25.
Publicat online 2012 Mar 1. doi: 10.7453 / gahmj.2012.1.1.006
PMCID: PMC3833476

Limba: engleză | Chineză | Spaniolă

Regresia durabilă a limfomului cutanat primar pe celule B în urma tratamentului cu vâsc – febră: două rapoarte de caz
Maurice Orange , MSc, corespunzator autorul Aija Lace , Maria P. Fonseca , Broder H. von Laue , Dr med, Ștefan Geider , Dr med și Gunver S. Kienle , Dr med

Maurice Orange, Maurice Orange, MSc, is a general practitioner, formerly medical director at Park Attwood Clinic, United Kingdom, and currently senior hospital doctor integrative oncology at the Ita Wegman Klinik, Arlesheim.
corresponding authorCorresponding author.

Regresia completă a limfomului cu celule B mari de grad înalt cu Ganoderma lucium(ciuperca imunomodulatoare)

Regresia completă a limfomului de grad înalt este extrem de rară.

Reportam un astfel de caz care ar fi putut fi mediat de Ganoderma lucidum (Lingzhi), un medicament pe bază de plante imunomodulator.

Un bărbat în vârstă de 47 de ani a prezentat durere epigastrică. Endoscopia a arătat un ulcer gastric mare, care, pe biopsie, a fost diagnosticat cu limfom de celule B mari.

La gastrectomie, după 11 zile, nu s-a găsit nici o dovadă a limfomului de celule B mari, în ciuda eșantionării aprofundate. 

În schimb, a existat un infiltrație densă și permeabilă a limfocitelor T citotoxice mici CD3 (+) CD8 (+) care acoperă întreaga grosime a peretelui gastric.

In situ reverse transcription polymerase chain reaction for T-cell receptor beta-chain family did not detect a monoclonal T-cell population. We postulate that the cytotoxic T cells may represent an active host-immune response against the large B-cell lymphoma that resulted in a complete regression.

Reacția în lanț in situ a polimerazei transcripție inversă pentru familia lanțului beta al receptorilor de celule T nu a detectat o populație de celule T monoclonale.

Se postulează faptul că celulele T citotoxice pot reprezenta un răspuns imun gazdă activ împotriva limfomului de celule B mari care a dus la o regresie completă. 

La interogatoriu, pacientul a luat megadoze de Ganoderma lucidum, care ar fi declanșat reacția imună de succes.

PMID: 17478779 
DOI: 10.1177 / 1066896906295890

 

https://www.ncbi.nlm.nih.gov/pubmed/17478779

Cheuk W 1 , Chan JK , Nuovo G , Chan MK , Fok M.

Informații despre autor

1
Departamentul de Patologie, Spitalul Reginei Elisabeta, Wylie Road, Kowloon, Hong Kong.

Limfom și limfom non-Hodgkin (NHL)-tratamente naturale si alternative

Tratamente naturale si alternative Limfom și limfom non-Hodgkin (NHL) 

PENTRU CEI BOLNAVI (si nu numai): SFINTELE TAINE : SPOVEDANIE, IMPARTASANIE SI MASLU MINIM!!!DES!

toate articolele ref limfom de pe acest blog:

https://tratamenteanticancer.wordpress.com/?s=limfom

Modificat dupa un articol original scris de Webster Kehr, Independent Cancer Research Foundation, Inc

Notă:

1. a.În timp ce acest site rareori spune ceva favorabil despre chimioterapie și tratamente convetionale cancer , este un site impartial si obiectiv si pentru a fi corecti față de medicina alopata, limfom non-Hodgkins este una dintre cele extrem putine si rare tipuri de cancer care po0te răspunde destul de bine la tratamente alopate cancer (in mod specific, la chimioterapie, in sensul de micsorare a tumorilor) .

1.b ATENTIE : eliminarea tumorilor NU inseamna si vindecarea de cancer.Astfel, nici o tehnica care se concentreaza doar pe eliminarea/extirparea tumorilor (inclusiv operatie, chimioterapie si radioterapie sau alta tehnica alternativa)  NU va rezolva problema cancerului – acesta poate reapare oricand si oriunde speculeaza slabiciune in organism.

DE CE? cititi cauzele cancerului.Cancerul se instaleaza si se extinde /creste necontrolat intr-un organism NUMAI cand 2 conditii sunt indeplinite simultan :

IMUNITATEA SCAZUTA si ACIDITATE CELULARA / LIPSA DE OXIGEN IN CELULE.

Pina nu corectati aceste 2 lucruri(care poate fi destul de complex si necesita o suita intreaga de tratamente cancer sinergice care sa combata cancerul din cat mai multe directii si sa rezolve si alte nevoie ale unui bolnav de cancer si sa ENERGIZEZE, INTAREASCA si REechilibreze intreg organismul) , NU veti scapa de cancer(de ex. :  mi-a scris o doamna care s-a operat de 7 ori la intervale de 4 ani pentru a scapa de o tumoare si mereu tumoarea a reaparut; valabil si pentru chimioterapie, radioterapie si orice alta tehnica ce se concentreaza EXCLUSIV pe eliminarea  tumorilor )

Revin la tratamente Limfom și limfom non-Hodgkin (NHL)

O opțiune este de a utiliza tratamente cancer conventionale (chimioterapie -administrarea de medicamente chimice ce isi au originile in razboiul mondial , avand un efect destructiv asupra intregului organism si imunitatii,de asemenea cancerigena-chimioterapia induce cancere secundare si metastaze) și protocolul clorură de cesiu (care este menționat mai jos), deoarece acestea sunt tratamente sinergice, in sensul, altaturi de protocolul axat pe dieta Budwig, protocolul anticancer axat pe clorura de cesiu (insemnand combinatia de tratamente anti cancer sinergice ce include si clorura de cesiu) , sustin un pacient care urmeaza chimio (desi protocoalele cancer alternative sunt mult mai eficiente daca organismul nu are daune de chimio/radio ).

Tratamentul cancer alternativ Limfom și limfom non-Hodgkin (NHL)

care a dat rezultatele cele mai promitatoare este  protocolul axat pe clorură de cesiu  cu Dispozitiv PEMF : QRS

Clorură de cesiu este una dintre cele mai vechi și cele mai dovedite atat teoretic cat si practic  tratamente alternative pentru cancer. In acest caz, pacientul poate adăuga PEMF (Pulsed Electro Magnetic Freq.) – dispozitivul QRS, care este un protocol electromedical bland pentru durere.

Combinația de clorură de cesiu și dispozitivul QRS este un tratament anticanceros superb!

Tipuri grave de limfom, cum ar fi celule de manta, și în special acele persoane care au simptome legate de ganglionilor limfatici ce preseaza pe trahee, esofag sau alte locatii critice, trebuie să adauge chimioterapie pentru protocolul lor de cesiu . Acest lucru se datorează faptului că cesiu individual, nu produce suficientă scădere în dimensiune a unui nodul limfatic în unele limfoame pt. a  rezolva simptome critice .

Ideea este : cazurile in care viata este pusa in pericol datorita nodulilor limfatici care apasa pe locatii critice in organism au nevoie de ceva care sa le reduca dimensiunea nodulilor . Teoria este că, în aceste cazuri, chimioterapia rezolvă dimensiunea ganglionilor limfatici mai mult decât umflarea inflamatorie provocata de cesiu (tumorile se vor umfla in mod cert  in prima faza cu cesiu datorita atacului sistemului imunitar;acest lucru se va intampla in prima faza- 2 -3 saptamani,dupa care vor incepe sa isi reduca din dimensiuni- cititi cu atentie din carte si adaugati enzime PROTEOLITICE (PROTEASE) : tripsina chimotriopsina, bromelaina(ananas), papaian(papaya), serapaptaza, etc destul de multe -cei de la b17.ro au terapie metabolica similara cu Dr Kelley si e posibil sa aiba si enzime bune(nu lucrez cu nimeni, nu ma intereseaza de unde luati)  impreuna cu suc de iarba de grau si alte ANTI-INFLAMATORIIi(cirese , MSM cu turmeric, etc)

COMENTARIU: personal nu mi-s face in veci chimio ‘terapie’.insa in aceste tipuri de cancer ar avea aplicatii chimioterapia prin reducerea dimensiunii nodulilor ce pun in pericol IMEDIAT viata.
problema e ca partea naturista a tratamentului cancer(inclusiv clorura de cesiu) intareste imunitatea si duce la inflamatie si aici e nasol cu inflamatia.

Desi exista antiinflamatorii naturale :

acestea de multe ori nu sunt suficient de rapide si trebuie intervenit uneori si cu putina chimio sa reduca dimensiunea ganglionilor si sa salveze viata pe moment daca apare un astfel de pericol in care inflamatia ganfluonilor pune in pericol imediat viata.
Mai degraba as cauta un loc unde se face IPT:
Si in germania de exemplu exista clinici cu tratamente naturale is alternative cancer ce includ IPT :http://germancancerclinics.com/
IPT se aplica cu succes in limfom:http://www.iptq.com/lymphoma.htm
Alt exemplu pt limfom Non Hodkins :http://www.euro-med.us/patient-stories/gary.cfm;

cei de la http://germancancerclinics.com/st-george-hospital au si IPT si lucreaza cu formularul E112(decontat de asigurarile de sanatate):

spitalul St. Georg lucreaza cu formularul 112.

„Am fost acum in aprilie, au fost incluse ca si cheltuieli: locuitul meu in spital, masa, medicamentele, perfuziile, transfuzia de sange, toate tratamentele de detoxifiere.
Noi am platit jumatate din hipertermiile locale si jumatate din hipertermiile totale.
Noi suntem foarte multumite de felul cum am fost tratate acolo de tot personalul.

O zi buna!

Cu stima,

 
Iovita Roxana, ASOCIATIA DORINTA PENTRU VINDECARE

………………….

Buna ziua,
 
Imi cer scuze ca va raspund mai greu, o sa incerc sa va raspund la intrebarile dvs.
Cei din Germania nu stiau ca Romania este in Uniunia Europeana, si ca noi de fapt avem aceleasi drepturi ca si cei din Germania si Austria.
Dupa ce am lamurit aceste aspecte a fost totul usor.
Pentru obtinerea formularului am avut nevoie de o scrisoare de accept din partea clinici apoi de raport medical de la doctorul specialist, cu aceste documente am mers la casa de sanatate unde am obtinul formularul.
Efecte pozitive: inainte sa ajungem in Germania sora mea nu mai putea sa se alimenteze, nu suporta lumina, mirosurile si nu se mai putea tine pe picioare, avea dureri groaznice si foarte multa ascita in abdomen. Trebuia sa scoata apa la 3-4 zile aproximativ 7-8 litri.
Dupa primul ciclu de tratament,  nu mai avea dureri,  ascita nu sa mai format deloc cu toate ca in Romania doctori au spus ca va avea apa mereu, si dupa 4 saptamani de tratament am plecat acasa pe picioarele ei.
De atunci a mai fost de 3 ori in Germania la tratament si de fiecare data se intorcea mai bine.
De curand a facut un RMN unde arata ca tumorile s-au oprit din evolutie ceea ce este fantastic pentru ca era un cancer galopant , si ne-au spus cei din Germania ca putem sa ne asteptam si la o operatie cam peste 2-3 luni.
Tin sa precizez ca medici din Romania, Ungaria si Italia la momentul diacnosticului dat in octombrie 2014, iau dat aproximativ 1-2 luni de viata.
Suntem foarte multumiti de tratamentul din Germania si recomand la toata lumea.
Daca mai ai intrebari te rog sa imi trimiti pe mail.
Roxana”
E-mail: dorintapentruvindecare@gmail.com;cei ce nu primesc raspuns la mail ii rog sa ma contacteze

 

Protocolul de clorură de cesiu este un tratament alcalin  flexibil.

Cesiu, solutie externa ce se aplica ca si crema  prin piele in zonele cu tumori gasiti si in Ungaria(tot la b17) daca in SUA( Larry de la essenceoflife, cel mai bun expert in cesiu spune Webster Kehr)  nu e o solutie optima(desi nu stiu daca cei din Ungaria asigura si suport pentru ca sunt MULTE AVERTISMENTE la CESIU si lucruri de monitorizat, inclusiv echlibrul cu potasiu, etc.;CESIU este un tratament excelent si nu va cauza probleme daca se respecta niste reguli-CITITI CU ATENTIE DIN CARTE pentru ca vendorul, din graba de a va vinde un produs, nu stiu cate va va spune si despre eventuale complicatii).

NOTA: IN LINKUL TRADUS DE GOOGLE DE LA B17 APARE SUMA de 95.000  EUR.ESTE O GRESEALA TRADUCERE.ESTE VORBA DE MONEDA UNGURILOR .CESIU cu MSM/DMSO  NU COSTA MAI MULT DE 200 USD in state si nici aici.

Protocolul de cesiu atins o rata de vindecare de 50 % la pacientii cu cancer foarte avansat , unii deja în comă . 47 din cele 50 de pacienti au fost ” fără speranță “, iar unii au avut doar câteva zile de trăit . Medicii au dat doze foarte mari de cesiu .

Respectati insa TOATE AVERTISMENTELE  descrise in carte

NOTA: Protocolul axat pe pe dieta dr Budwig(cel care e descris si in carte) NU va cauza nici un fel de inflamatie si umflare si este e asemenea o optiune  tratament cancer de luat in calcul.

Nu degeaba protocolul Dr Budwig (asa cum este descris si in carte) cu doze RIDICATE grasimi hidrosolubile omega3 are 2 premii Nobel ca fundament si a obtinut o rata de curabilitate 90% pe o perioada de 50 ani!!

Rebounder (pt a pune in miscare si detoxifia  limfa)

Deoarece sistemul limfatic nu are nici un fel de „pompă” a fluidelor limfatice (asa cum sistemul circulator are inimă), este important să  „pompati” artificial  sistemul limfatic.

„rebounders” sunt trambuline mici, concepute pentru utilizare terapeutică.

Vezi acest blog:  Blog pe Rebounder

Aici este un alt site rebounder:http://www.healthbounce.com/

ATENȚIE:

1 .  Melatonina (din supliment) NU trebuie utilizata de către persoanele cu leucemie, boala Hodgkin, limfom sau mielom multiplu. Melatonina cu efect benefic asupra imunității ar putea agrava cancerul sistemului imunitar.

Probabil acelasi avertisment trebuie dat si pentru alte suplimente ce stimuleaza puternic imuntiatea precum ciuperci imuno(ABM, Reishi/Ganoderma,Transfer Factor, AHCC, etc), vitamina C IV, Terapii Ozon , electromedicale Bob Beck , Rife etc insa cel mai bine este sa intrebati VANZATORUL/PRODUCATORUL daca suplimentul poate/nu poate fi luat in limfom(cazul dvs specific)

2. Suplimente de calciu ar trebui să fie, de asemenea, luate cu grijă pentru a evita hipercalcemie.

Nu uitati totusi ca e vorba de un STIL DE VIATA , NU DOAR DE DIETA cancer sau SPIRITUAL(credinta, nadejde , pace interioara,dragoste) sau SUPORTUL EMOTIONAL a celor din jur  sau diverse SUPLIMENTE sau apa (ionizata) alcalina sau expunerea MINIM 30 minute la SOARE si MISCARE ZIUA sau ODIHNA si somnul adecvat pe timp de noapte inainte de 22 (inclusiv 20 mg MELATONINA) sau PROBIOTICE LACTICE sau ALTELE .

TOATE AU ROLUL SI IMPORTANTA LOR si TREBUIE INCLUSE IN ORICE PLAN TRATAMENT CANCER care se doreste de SUCCES.

DREAPTA/ORTODOXA CREDINTA IN DUMNEZEU ADEVARAT(SFANTA TREIME,DUMNEZEUL IUBIRII care NU vrea moartea pacatosului ci sa fie viu si sa cunoasca ADEVARUL), credinta din care deriva NADEJDEA,PACEA INTERIOARA, DRAGOSTEA –

IMPACT MAJOR ,( a se vedea si  

ce spun sfintii parinti despre bolile trupesti si cum trebuie abordate

ce spun sfintii parinti despre bolile sulfetesti si cum trebuie abordate

(nu uitati cat de mult ne iubeste DUMNEZEU care Si-a pus sufletul si S-a suit pe cruce pentru noi; a jertfit pe unicul Sau FIU din dragoste pentru noi)

RUGATI-VA PENTRU CEL BOLNAV, CHEMATI PREOTII SA II FACA MASLU SI UNGERE CU MIR SI SA SE ROAGE IMPREUNA CU DVS , SPOVEDITI-L SI IMPARTASITI-L:

https://tratamenteanticancer. wordpress.com/2016/02/19/ viata-si-minunile-sfantului- nectarie/

stiu personal de cazuri ridicate e pe pat moarte sau din scaun rotile dupa 7 Sfinte Maslu( o fata/colega  calcata de masina care a facut anevrism cerebral careia nu i s-au dat mari sanse , un barbat calcat ‘in fata si in spate de masina’ si altele, inclusiv bolnavi cancer – nu uitati ca Dumnezeu implineste cererile in masura CREDINTEI).
Evitati inselarile pagane cu yoga, meditatii, kundalini, silva ,reicki Mind Control ,etc -nu e vorba de acelasi Dumnezeu si toti zeii pagani sunt demoni, care pot face si ei minuni 

–PACEA INTERIOARA dar si  emotiile si sustinerea celor din jur IMPACT MAJOR  ,

– lumina solara MINIM 30 minute (inclusiv vitamina D3 5000-20000 UI iarna si energia solara) IMPACT MAJOR ,

– miscarea aerobica moderata intr-un mediu oxigenat si cat de cat curat si lipsit de chimicale IMPACT MAJOR (in cazul de fata inclusiv prin REBOUNDER, plimbare in parc, lucru in gradina),

– odihna adecvata in special noaptea inante de 22( FARA suplimentarea melatonina in cazul de fata ) IMPACT MAJOR ,

-ajutati ficatul cu ARMURARIU si ,DACA NU FACETI CHIMIO CLISME CAFEA

alimentatia alcalininzanta bogata in fructe legume ierburiIpelin dulce 25 grame frunze uscate pe zi)  si verdeturi si condimente(curcumina 8 grame pe zi) neprocesate si macar bine spalate dar si  optima dpdv nutritional si bogata ENERGETIC   are IMPACT MAJOR ( inclusiv apa alcalina(de preferat  apa ionizata alcalina sau macar apa curata , purificata minim cu carbune activat), inclusiv doze mari de nucifere samburi si seminte germinate si grasimi permise in cancer(OMEGA 3) ;NU ZAHAR SI AMIDONOASE , NICI GLUTAMINA si  IN NICI UN CAZ cine stie ce post restrictiv gen cura Breuss sau Valeriu Popa alte “minuni” promovate la noi care nu au nici un fundament si nu face decat sa  va duca mai repede mai aproape de viata de apoi, asa cum i-au dus si pe multi altii ,ale caror rude au lasat plansete pe acest blog);sa inclusa si PROBIOTICE si alimente FERMENTATE -muraturi de FERMENTATIE NATURALA, iaurt kefir sana DE LA TARANI , BORS CRUD, etc

O dieta de casexie (si cancer) este o dieta KETOGENICA(bogata in GRASIMI SANATOASE, permise in cancer, precum NUCIFERE SAMBURI SI SEMINTE GERMINATE (nuci, nuci macademia is braziliene , nucade cocos,samburi caise,   migdale, alune de padure, saminte de in , de dovleac , de pepeni , de mere, de pere . etc-FARA CAJU, FISTIC, ARAHIDE SI  FARA AMIDONOASE precum CEREALE CARTOFI  )si ULEIURI PRESATE LA RECE DIN ACESTEA, LEGUMINOASE(fasole, linte , mazare, etc -ATENTIE la GMO la mazare si in special la SOIA  ), LEGUME DIVERSE (in special cele ce cresc la SUPRAFATA SOLULUI si NU in pamant si NU cele bogate in AMIDON) ),IERBURI – PELIN DULCE 25 grame frunze uscate pe zi, VERDETURI si CONDIMENTE-CURCUMINA 8 grame pe zi , ghimbir, scortisoara, tamaie, etc), care LIMITEAZA APORTUL  de GLUCIDE si ofera organismului pe langa diversi nutrienti si ENERGIE din GRASIMI BENEFICE INGERATE IN DOZE MARI- O DIETA ASA CUM ESTE SI DIETA DR BUDWIG(care mai are si rol antitumoral si face ca aceste grasimi sa fie absorbite mai usor)

la aceasta, se pot adauga diverse suplimente din cele de mai jos:

se pot face cele mai bune suplimente in casa din SUCURI DE LEGUME IERBURI SI VERDETURI SI CONDIMENTE (facute din legume de la suprafaca solului, legume mai curate la interior decat radacinoasele iar la exterior bine SPALATE si CLATITE in VAS cu apa CURATA) in care se pot integra mixul Budwig, o pasta facuta la blender din NUCIFERE SAMBURI SI SEMINTE GERMINATE, uleiuri si grasimi din acestea permise in cancer, LEGUMINOASE GERMINATE PASTA (gen fasole batuta) oua de tara, avocado copt (crema), alge marine(SPIRULINA CHLORELLA, KOMBU, KELP, AFA),vitamina C, MSM si altele

 NU, IN NICI UN CAZ cine stie ce post restrictiv gen cura Breuss sau Valeriu Popa alte “minuni” promovate la noi care nu au nici un fundament si nu face decat sa  va duca mai repede mai aproape de viata de apoi, asa cum i-au dus si pe multi altii ,ale caror rude au lasat plansete pe acest blog).

Nu degeaba protocolul Dr Budwig (asa cum este descris si in carte) cu doze RIDICATE grasimi hidrosolubile omega3 are 2 premii Nobel ca fundament si a obtinut o rata de curabilitate 90% pe o perioada de 50 ani!!
  • apa ionizata alcalina/apa hidrogenta iarasi optionala datorita costului-macar filtrata cu 250 ml suc lamaie sau 500 ml suc grepfruit si 2 lingurite bicarbonat sodiu pe zi
  • electromedicale precum Bob Beck(click aici), Hulda Clark pentru curatarea sangelui/limfei de microbi, pentru a intari sistemul imunitar( care sunt mai accesibile ca pret).
  • dispozitive electromedicinale speciale pentru a energiza celulele si a omora microbii de cancer Photon Genius și Genie,Quantum Pulse, Dispozitive GB-4000 ( optionale datorita costuluil doar pentru cine isi permite)

Daca aveti dureri vedeti aceste articole Stop dureri cancer I(click aici) si  Stop dureri cancer II (click aici)

Toate acestea de mai sus va sunt la indemana si au costuri modice, ca si cele din carte. De exemplu, vitamina D – expunerea la soare care previne MINIM 77% din cancere, este GRATUITA.

Nu uitati DETOXIFIEREA FICATULUI(ARMURARIU si , DACA NU FACETI CHIMIO, CLISME CAFEA) cat si DEPARAZITARE(ajuta imunitatea-cea cu cuisoare nuc negru si pelin dulce precum Hulda Clark e ok)

ATENTIE:

Daca faceti CHIMOTERAPIE – FARA SUCURI DE LEGUME, FRUCTE IN EXCES si FARA CLISME CAFEA datorita efectului puternic detoxifiant asupra FICATULUI. Datorita TOXICITATII CHIMIOTERAPIEI acesta poate ceda, deci MOARTE!

 

 

– si altele complementare descrise la sfarsitul acestui articol despre cancer, metastaze si celule stem cancer- clicklucruri care trebuie sa se regaseasca in ORICE abordare care se doreste de succes impotriva acesteti conditii de “deficienta sistemica – la nivel de organism” numita cancer,   au impact major

MONITORIZATI PERIODIC sa vedeti daca ceea ce faceti e suficient de potent sau sunt necesare ajustari (doze, tipuri suplimente, etc) sau chiar shimbari radicale in planul tratament natural anticancer .

DOAMNE AJUTA TUTUROR!

NOTA FINALA:

Am incercat sa schitez aici cateva probleme si caracteristici specifice limfoamelor precum si sa schitez cateva solutii.

Insa fiecare caz e unic si fiecare bolnav de cancer are situatia si nevoile proprii. 

imi doresc sa va ajut si sa gasim solutii impreuna, insa, nu pot face 2 lucruri:

  1. nu pot lua decizii pentru viata dumneavoastra in locul dumneavoastra.
  2. nu va pot ajuta mai mult decat o pot face Dumnezeu,Maica Domnului si toti sfintii si decat vreti dumneavoastra.

Daca doriti sa va vindecati de cancer primul lucru pe care trebuie sa-l faceti este sa CAUTATI AJUTOR LA BUNUL DUMNEZEU

 

In orice caz, nu uitati  sa va si relaxati si sa va bucurati de cei dragi!

Multa sanatate,

Cristian

Acum aș vrea să aud de la dumneavoastra:

Ați încercat oricare dintre sfaturile din acest articol? Ce efecte ați observat asupra sănătății dumneavoastră?

Lăsați-vă gândurile prin adăugarea unui comentariu mai jos.

ROG SA SEMNALATI GRESELI DE ORTOGRAFIE PRIN COMENTARII MAI JOS

CONSIDERATI UTILE CELE DE AICI?

SPUNETI SI ALTORA! Sunt butoane sub aceasta pagina cat si in DREAPTA SUS!

Act de declinare/DISCLAIMER:

Acest site este numai în scop educational.Acest site ofera date medicale și informează cu privire la opțiunile alternative medicale.Acesta nu este conceput ca un substitut pentru diagnosticul, tratamentul sau sfatul unui profesionist autorizat calificat.Nimeni nu ar trebui să ia în considerare că acest site reprezintă “practica medicala.”Acest site nu își asumă responsabilitatea pentru modul în care sunt folosite materiale de aici.Declarațiile cu privire la tratamente alternative pentru cancer nu au fost aprobate medicinal – am scris deja acestea mai sus, cand am mentionat de Dr. Burzinki si restul celor discreditati,  totusi trebuie sa fiu in regula si cu legea.

De asemenea, este dreptul dumneavoastra legal sa faceti singuri alegerea de tratare. 

Vă rog să rețineți că acest site actualizeza în mod constant conținutul său .

 

ionizator apa alkaviva jupiter emco tech biontechionizator apa cel mai bun calitate performanteionizator apa AlkaViva Melody H2 hidrogen molecular diatomicionizator-apa-alkaviva-athena-h2ionizator-apa-alkaviva-vesta-h2apa ionizata alcalina sanatate beneficii regulibeneficii si proprietati apa ionizata alcalinacel mai bun ionizator apa calitate performante durabilitateionizator apa pret amortizarecompara ionizatoare apa purificatoare si generatoare apa hidrogen diatomic molecularcertificari ionizatoare apa Alkavivaalkaviva water ionizers filters and diatomic molecular hydrogen generatorsreasons why Alkaviva are best water ionizersionized alkaline water with diatomic molecular hydrogen advantagescompare water ionizers purifiers diatomic molecular hydrogen generatorsadvantages of alkaline ionized water benefits propertiesbest water-ionizer AlkaViva Vesta H2 diatomic molecular hydrogen waterwater ionizer price amortizationionized alkaline water and health advantagesAlkaviva Vesta H2 water ionizer purifier and diatomic molecular hydrogen water generatoralkaviva Athena H2 water ionizer purifier and diatomic molecular hydrogen water generatorAlkaviva Melody II H2 water ionizeralkaviva water ionizers certificationsDie Besten Wasser Ionisierer & Luftreiniger filter in Der Welt – AlkaViva(IonWays): EmcoTech(Jupiter) & BionTech)die besten wasser ionisierer luftreiniger filter AlkaViva Vesta H2alkalin ionisierte wasser antioxidant molekulare wasserstoffalkalin ionisertes wasser lebendiges wasser und gesundheitAlkaviva Vesta H2 wasserstoffinfusion wasser ionisator reiniger wasserfilterAlkaviva Athena H2 wasserstoffinfusion wasser ionisator reiniger wasserfilterAlkaviva Melody II H2 wasserstoffinfusion wasser ionisator reiniger wasserfilterWASSER-IONISIERER IM VERGLEICHEigenschaften und Vorteile des alkalin ionisierten Wassers das ionisierte Wasserpurificadores – ionizadores de agua – comparaciónMEJOR PURIFICADORES – FILTROS & IONIZADORES DE AGUA EN EL MUNDO Alkaviva Emcotech Jupiter Biontechcertificaciones ionizadores y filtros de agua Alkaviva Ionways Emcotech Jupiter BiontechAgua ionizada alcalina , hidrógeno molecular diatómicoAgua Ionizada alcalina y ácido Y SaludPURIFICADOR (2 FILTROS X 13 ETAPAS DE FILTRACIÓN DE AGUA) – IONIZADOR DE AGUA (9 ELECTRODOS) ALKAVIVA VESTA H2 – HIDRÓGENO INFUSIÓNPURIFICADOR (2 FILTROS DE AGUA ) IONIZADOR DE AGUA (7 ELECTRODOS) – ALKAVIVA ATHENA H2purificador 2 filtros ionizador de agua Melody II H2 AlkavivaCertifications d’ioniseurs et de les filters d’eau AlkaViva (Ionways)PROPRIÉTÉS ET BIENFAITS DE L’EAU IONISÉE ALCALINEL’eau ionisée alcaline antioxydant – hydrogène moléculaire diatomiqueComparaison d’ioniseurs d’eauPURIFICATEUR (2 FILTRES X 13 ÉTAPES DE FILTRATION D’EAU) – IONISEUR D’EAU (9 ÉLECTRODES) VESTA H2PURIFICATEUR (2 FILTRES D’EAU) IONISEUR D’ EAU(7 ÉLECTRODES) ALKAVIVA ATHENA H2PURIFICATEUR (2 FILTRES ) – IONISEUR D’EAU (5 ÉLECTRODES) MELODY II H2AlkaViva(IonWays)EmcoTech(JupiterScience) – número 1 en todo el mundo del agua filtrada-ionizadaMIGLIOR PURIFICATORI FILTRI – IONIZZATORI D’ACQUA NEL MONDOPURIFICATORE (2 FILTRI X 13 TAPPE DI FILTRAZIONE D’ACQUA) – IONIZZATORE D’ACQUA (9 ELETTRODI) ALKAVIVA VESTA H2PURIFICATORE (2 FILTRI D’ACQUA) IONIZZATORE D’ ACQUA (7 ELETTRODI)- ALKAVIVA ATHENA H2PURIFICATORE ( FILTRI)-IONIZZATORE D’ACQUA MELODY II H2filtrare apa AlkaViva UltraWaterstudii dieta si apa alcalina apa cu hidrogen molecularavantaje ionizatoare apa hidrogen AlkaViva H2performanta ionizator apaelectrozi ionizator apacuratare ionizator apaMIGLIOR PURIFICATORI FILTRI – IONIZZATORI D’ACQUA NEL MONDOMIGLIOR PURIFICATORI FILTRI – IONIZZATORI D’ACQUA NEL MONDOACQUA IONIZZATA ALCALINA, ACQUA VIVA E SALUTE!Acqua ionizzata alcalina con idrogeno diatomic molecolarerispetto purificatori – ionizzatori d’acquaCERTIFICAZIONI D’IONIZZATORI E FILTRI D’ACQUA ALKAVIVA (IonWays)PURIFICATORI / FILTRI -IONIZZATORI D’ACQUA ALKAVIVA / EmcoTech (JUPITER)- il numero 1 in tutto il mondo!Лучшие очистители воды — фильтры-ионизаторы в мире

 

Daca vreti sa sustineti acest site puteti printr-un simplu SHARE pe butoanele de mai jos sau din dreapta sus.

Link-uri – Căutare pentru toate aparițiile cuvântului: limfatic 

 

Restricție calorică și nutrițională pentru a spori eficacitatea chimioterapiei pentru leucemia limfoblastică acută: studiul IDEAL

Puncte cheie

  • Integrarea restricției calorice în inducția B-ALL este fezabilă, reduce creșterea grăsimii în excesul de greutate și îmbunătățește răspunsul bolii la tratament.
  • Insulina și adiponectina sunt identificate ca potențiali biomarkeri ai chimiosensibilității B-ALL care justifică investigații suplimentare.

Mergi la:

Abstract

A fi supraponderal sau obez (OW / OB) în timpul inducerii leucemiei limfoblastice acute cu celule B (ALL-B) este asociat cu chimiorezistență, cuantificat prin boala reziduală minimă (MRD). Am emis ipoteza că restricțiile calorice și nutritive din dietă / exerciții fizice ar putea reduce câștigurile din masa grasă (FM) și pot reduce MRD postinducție. Studiul Îmbunătățirea dietei și exercițiului în ALL (IDEAL) a înscris pacienți cu vârsta cuprinsă între 10 și 21 de ani, nou diagnosticați cu B-ALL (n = 40), în comparație cu un control istoric recent (n = 80). Concepute pentru a atinge deficite calorice ≥20% în timpul inducției, pentru a reduce aportul de grăsimi / sarcina glicemică și pentru a crește activitatea, punctele finale ale IDEAL au fost câștigul FM (primar), MRD ≥0,01% și aderența / fezabilitatea. Biologia integrată a explorat biomarkerii fiziologiei OW / OB. Intervenția IDEALĂ nu a redus semnificativ modificarea mediană a FM față de valoarea inițială (+5.1% [intervalul interquartilei [IQR], 15,8] vs + 10,7% [IQR, 16,0];P = .13), dar analiza stratificată a arătat beneficii la cei OW / OB (+ 1.5% [IQR, 6.6] vs + 9.7% [IQR, 11.1]; P = .02). După luarea în considerare a factorilor de prognostic, intervenția IDEAL a redus semnificativ riscul MRD (odds ratio, 0,30; 95% interval de încredere, 0,09-0,92; P= .02). Studiul a depășit pragurile de aderare (≥75% din dieta generală) și de fezabilitate (≥80% vizite finalizate). Biologia integrată a constatat că intervenția IDEAL a crescut adiponectina circulantă și a redus rezistența la insulină. Intervenția IDEALĂ a fost fezabilă, a scăzut creșterea grăsimii la cei OW / OB și a redus boala reziduala minima MRD. Acesta este primul studiu efectuat în orice tumoră malignă hematologică pentru a demonstra potențialul beneficiu al restricției calorice prin dietă / exerciții pentru a spori eficacitatea chimioterapiei și a îmbunătăți răspunsul la boală. Un studiu prospectiv, randomizat, este justificat pentru validare. Aceste studii au fost înregistrate la www.clinicaltrials.gov ca # NCT02708108 (studiu IDEAL) și # NCT01317940 (control istoric).\

Rezumat vizual

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansuri ADV2020004018absf1.jpg

Blood Adv. 2021 13 aprilie; 5 (7): 1853–1861.Publicat online 2021 apr 1. 

doi:  10.1182 / bloodadvances.2020004018 PMCID: PMC8045487 PMID: 33792627

Etan Orgel , Celia Framson , Rubi Buxton , Jiyoon Kim , Gang Li , Jonathan Tucci , David R. Freyer , Weili Sun , Matthew J. Oberley , Christina Dieli-Conwright , 8 și Steven D. Mittelman 5

Informații despre autor

 Note despre articol 

Informații privind drepturile de autor și licență 

Disclaimer

Date asociate

Materiale suplimentare\

Introducere

Excesul de greutate și obezitatea sunt din ce în ce mai recunoscute ca contribuind semnificativ la incidența cancerului, recidiva și supraviețuirea pacientului. 1– 3 Impactul advers al obezității asupra rezultatului cancerului a fost bine descris pentru leucemia limfoblastică acută cu celule B (ALL; B-ALL), 4– 8 cele mai frecvente malignități pediatrice. Mai mult decât atât, obezitatea preexistentă este asociată cu un risc crescut de a dezvolta B-ALL în timpul copilăriei 9, în care până la 40% dintre copii și adolescenți încep tratamentul ALL cu supraponderalitate sau obezitate (OW / OB). 9 , 10 Chimioterapia prelungită cu glucocorticoizi și comportamentul sedentar în prima lună de terapie (inducție) agravează în continuare această problemă, provocând creșteri rapide ale grăsimilor. 10 , 11 Fiind obez în timpul tratamentului pentru Institutul Național al Cancerului (NCI) / Roma cu risc ridicat de B-ALL (HR-ALL) conferă un risc cu 50% mai mare de recidivă și supraviețuire mai slabă la copii și adulți. 5 , 7Studiile preclinice care demonstrează chimiorezistența mediată de adipocite în B-ALL au adăugat dovezi biologice pentru a susține aceste asociații. 12– 16 Influența adversă a obezității începe din momentul diagnosticului; pacienții OW / OB la diagnostic prezintă un risc mai mult de două ori mai mare pentru boala reziduală minimă persistentă (MRD) la sfârșitul inducției (EOI). 17 Deoarece eradicarea timpurie a celulelor B-ALL cuantificate prin MRD este un semn distinctiv al chemosensibilității în B-ALL și cel mai puternic predictor al recăderii și supraviețuirii, 18 , 19 această constatare este deosebit de îngrijorătoare.

Cu toate acestea, datele recente sugerează că impactul negativ al OW / OB asupra tuturor rezultatelor poate fi reversibil. O analiză secundară a datelor studiilor clinice din cadrul grupului oncologic pentru copii (COG) a arătat că pacienții obezi care au devenit nonobezi în timpul tratamentului au avut un risc redus de recidivă. 20 Grupul nostru a testat acest efect într-un model preclinic și a constatat că trecerea șoarecilor obezi la o dietă cu conținut scăzut de calorii și grăsimi concomitent cu chimioterapia a îmbunătățit în mod similar supraviețuirea. 21 Aceste observații implică faptul că o intervenție care vizează obezitatea ar putea inversa efectele sale negative. Restricția calorică și privarea de combustibili cheie (de exemplu, glucoză, acizi grași) au fost identificate ca căi prin care chimiorezistența indusă de obezitate și / sau progresia tumorii pot fi inversate. 22Cu toate acestea, eficacitatea acestei abordări pentru îmbunătățirea răspunsului la boală nu a fost încă demonstrată în niciun cancer pediatric sau hematologic. 23 Îmbunătățirea chimiosensibilității celulelor maligne fără intensificarea dozelor este crucială pentru a spori eficacitatea chimioterapiei fără a crește povara vindecării din cauza toxicității legate de tratament.

Din aceste date, am emis ipoteza că inducerea unui deficit caloric concomitent cu restricția macronutrienților plus exercițiul fizic ar scădea creșterea grăsimii în timpul inducției, inversa fiziologia supraponderală și, prin urmare, ar îmbunătăți chemosensibilitatea B-ALL, evidențiată de reducerea MRD. Așa cum am constatat anterior că pacienții care încep terapia cu lean adipozității semnificativ , de asemenea , a câștigat și fiziologie excesului de greutate, 11 am emis ipoteza în continuare că ambele OW / OB si slaba pacientii ar putea beneficia de o astfel de intervenție. Pentru a testa acest lucru, am efectuat un studiu controlat de dovadă de principiu, non-randomizat, care vizează fiziologia supraponderală și aportul nutrițional la copiii mai mari și adolescenții nou diagnosticați cu HR-ALL (îmbunătățirea dietei și exercițiul în studiul ALL [IDEAL]).Mergi la:

Metode

Populația de pacienți

Pacienții cu vârsta cuprinsă între 10 și 21 de ani, nou diagnosticați cu NCI / Roma HR-ALL de novo și au început tratamentul cu un regim de inducere a 4 medicamente în stil COG la 2 centre academice regionale au fost eligibili pentru înscrierea în studiul IDEAL. Pacienții cu HR-ALL <10 ani (de exemplu, care prezintă un număr de celule albe din sânge [WBC] de 50 × 10 3 / μL) au fost excluși pentru a maximiza rolul autoeficacității și implicarea pacienților în dietă și intervenția de efort . 24 , 25 Detaliile stratificării riscului de COG și chimioterapia de inducție pentru HR-ALL au fost descrise anterior. 26 , 27 Pacienți cu sindrom Down, indicele de masă corporală (IMC) <percentila 10 (sau IMC <18,5 la pacienții ≥20 ani), 28disfuncția intestinală preexistentă sau cei incapabili să efectueze intervenția (de exemplu, bolnavi critici la prezentare) au fost excluși. Procesul IDEAL a fost deschis acumularii din mai 2016 până în martie 2019. Controlul istoric a fost stabilit de la pacienții B-ALL consecutivi neselectați tratați între ianuarie 2008 și martie 2014 cu același regim de inducție în stil COG și care îndeplinesc criteriile de eligibilitate aplicabile. Cel mai recent subset al controlului istoric (2011-2014) a fost înscris într-un studiu prospectiv al compoziției corpului în timpul terapiei ALL. Acest studiu predecesor a inclus terapia postinductivă cu vitamina D 29 ; cu toate acestea, datele privind compoziția corporală a masei grase (FM) și a masei slabe (LM) incluse în controlul istoric au fost obținute exclusiv din faza de inducție a pre-vitaminei D, numai de observare a studiului.11 Consimțământul informat a fost obținut și documentat de la toți subiecții înainte de înscriere. Atât procesul actual, cât și cel precedent au fost aprobate de către comitetele de revizuire instituționale ale spitalelor.

Proiectarea studiului și punctele finale

Studiul IDEAL a fost un studiu prospectiv, non-randomizat, controlat, cu punctul final principal al modificării procentuale în FM în timpul inducției. Punctele finale secundare au fost EOI MRD și fezabilitatea și respectarea intervenției. Intervenția a fost efectuată numai în timpul fazei de inducție de 4 săptămâni (Figura 1 suplimentară). După cum am arătat anterior că modificarea procentului IMC în timpul inducției nu se corelează cu modificarea FM și LM, compoziția corpului 11 a fost măsurată la diagnostic și la EOI în studiul IDEAL și controlul istoric utilizând standardul de aur al întregului corp, cu energie duală absorptiometria cu raze X (DXA) așa cum s-a descris anterior (densitometrul fasciculului ventilatorului în modul matrice [Delphi W; Hologic Inc, Waltham, MA]). 11MRD în măduvă a fost măsurată prin citometrie în flux într-un laborator certificat COG utilizând un panou standardizat de anticorpi și strategii ierarhice de gating pentru a stabili o populație imunofenotipică „diferită de cea normală”. 18 MRD + a fost definită folosind un prag de ≥0.010% per contemporan B-ALL stratificare a riscului 18și MRD detectabil ca ≥0.000%. Fezabilitatea a fost definită ca completarea a ≥80% din vizitele săptămânale de studiu pentru pacienții care primesc chimioterapie de inducție. Aderența a fost definită ca ≥75% la intervenția prescrisă, evaluată de dietetician și auto-raportată pentru exerciții. Biologia integrată a evaluat biomarkerii a 4 mecanisme teoretizate pentru chimiorezistența B-ALL indusă de obezitate: factori de creștere, adipokine (citokine asociate adipocitelor), inflamație și sensibilitate la insulină. Atât pentru studiul IDEAL, cât și pentru controlul istoric, biomarkerii de imagistică și de laborator trebuiau obținuți înainte de începerea chimioterapiei, acolo unde este posibil. Toți biomarkerii au trebuit colectați înainte de începerea intervenției și ambii biomarkeri și imagistica au fost obligați să apară în 96 de ore de la începerea chimioterapiei (protocol suplimentar de încercare).

Intervenție IDEALĂ

Intervenția IDEALĂ a fost concepută pentru a induce un deficit caloric de ≥20%, împărțit în mod egal între aportul redus de calorii și creșterea cheltuielilor energetice.(activitate fizica) Necesarul estimat de energie al pacientului a fost calculat utilizând ecuația Schofield pentru rata metabolică bazală ajustată pentru un factor de activitate de 1,3. 30 , 31Intervenția a început cât mai devreme posibil după inițierea chimioterapiei și înainte de ziua de inducție 4. Vizitele de studiu au fost integrate în vizitele săptămânale de rutină pentru chimioterapie în clinica ambulatorie sau în cadrul internării (Figura suplimentară 1). Aspectele generale ale intervenției au inclus (1) evaluarea preferințelor pacientului pentru a individualiza dieta și alegerile de exercițiu, (2) includerea familiei în educație și (3) întărirea săptămânală folosind tehnici de intervievare motivațională.

Prescripțiile de educație, dietă și exerciții sunt rezumate în tabelul 1și furnizate în detaliu în protocolul suplimentar Trial. Dieteticianul din studiu a efectuat planificarea meniului individualizat cu schimburi de alimente, așa cum este descris de Schenk și colab. 32 Dieta a fost întărită la vizitele săptămânale și cu apeluri telefonice la intervale opționale. Aportul alimentar a fost înregistrat folosind înregistrări alimentare de 3 zile și rechemări de 24 de ore. Nutrienții au fost calculați utilizând baza de date pentru alimente și nutrienți a Departamentului Agriculturii din SUA (USDA) pentru studii dietetice. 33Nivelurile de glucoză au fost monitorizate de către furnizori în timpul inducției ca standard de îngrijire, cu insulină prescrisă în mod obișnuit pentru hiperglicemie indusă de steroizi (glucoză în repaus alimentar, ≥126; postprandial, ≥200); datele privind utilizarea insulinei au fost extrase din înregistrările de tratament ca o măsură relevantă clinic a rezistenței la insulină și a eșecului celulelor β. Un fiziolog și fizioterapeut (PT) a proiectat intervenția de exerciții aerobice și de rezistență utilizând echivalentul metabolic al sarcinilor (MET) pentru a cuantifica exercițiile moderate până la viguroase pentru un „meniu” personalizat de activități. PT a evaluat funcția și puterea motorului la momentul inițial și săptămânal folosind testul Bruininks-Oseretsky de competență motorie, ediția a doua (BOT-2). 34Pe baza evaluărilor săptămânale ale performanței, prescripția pentru exerciții fizice a fost ajustată folosind MET pentru fiecare activitate pentru a menține efortul obiectivului. Un pedometru Fitbit Flex 2 a fost furnizat pentru a măsura activitatea acasă. Datele Fitbit au fost extrase central folosind Fitabase (SmallSteps Labs, LLC).

Tabelul 1.

Rezumatul intervenției IDEALE

Intervenție IDEALĂ
Tema educațieiAbordare
 Beneficii de dietă și exerciții fizice în timpul inducției Integrat în conferința medicului și evaluarea dietei (prin RD) și a activității (prin PT)
 Selecția alimentelor și controlul porțiilor My Plate (USDA), semafor, meniuri individualizate cu recomandări de porțiuni
 Exercițiu sigur în timpul chimioterapiei Instrucțiuni, demonstrații și tehnici de către PT în timpul vizitelor
Intervenția dieteiObiectivul zilnic de aport
 Deficitul caloric * ≥10%
 Proteină ≥20% din totalul caloriilor
 Gras <25% din totalul caloriilor
 Carbohidrați <55% din totalul caloriilor
 Sarcină glicemică scăzută  <100/2000 kcal
 Progresie Obiectiv caloric ± 5% săptămânal
Intervenție de exercițiuObiective
 Cheltuieli calorice * ≥10%
 Frecvență Zilnic
 Intensitate  Efort moderat
 Timp Sesiuni de 15-30 de minute (200 min / săptămână)
 Tip Exercițiu aerob + antrenament de rezistență
 Locație Acasă §
 Progresie Așa cum este tolerat

RD, dietetician înregistrat.* Estimat din necesarul de energie estimat calculat; vezi „Metode”. Calculat folosind indicele glicemic pentru alimentele consumate, prag ajustat pentru aportul real de calorii. Calculat pentru fiecare dintr-un meniu de activități comune folosind MET.§ Continuarea internării pentru cei spitalizați în timpul inducției.

Biomarkeri integrati ai fiziologiei OW / OB

Plasma a fost colectată de la fiecare pacient la diagnostic și la EOI pentru a măsura factorii de creștere, citokine și adipokine. Testele Luminex au fost utilizate pentru a măsura interleukina 1β (IL-1β), IL-6, IL-10 și factorul de necroză tumorală α (EMD Millipore) și a leptinei, insulinei, a factorului de creștere asemănător insulinei [IGF] care leagă proteina 3 ( IFGBP-3), factorul de activare a celulelor B (BAFF) și proteina de legare a acizilor grași 4 (sisteme de cercetare și dezvoltare). Adiponectina totală / Acrp30, IGF-1 totală și IGF-1 liberă au fost măsurate utilizând teste individuale imunosorbente legate de enzime (sisteme R&D). Nivelurile rezultate în afara limitei de detectare a testului în ambele direcții au fost incluse în mod conservator în analiză la limita de detectare. Toate analizele citokinelor au fost efectuate de către Immune Assessment Core de la UCLA, urmând instrucțiunile producătorului.

metode statistice

Normele populației ajustate în funcție de vârstă / sex au fost utilizate pentru a defini starea greutății: OW / OB (IMC ≥85%) 28 față de slab (IMC, 10% până la 84,9%). Pentru pacienții cu vârsta ≥20 de ani, categoriile au fost definite utilizând criterii pentru adulți (IMC ≥25 și IMC 18,5-24,9, respectiv). Mărimea eșantionului a fost determinată în funcție de punctul final principal al modificării în FM față de valoarea inițială, comparativ între cohorta IDEAL și controlul istoric, pe baza unui eșantion t , cu două fețe, ttest cu 5% eroare de tip I și cel puțin 90% putere pentru a detecta o diferență de 2,5 puncte procentuale în schimbarea FM între cele 2 cohorte. Modificarea procentuală în FM a fost calculată pentru fiecare pacient, ajustată pentru FM de bază. În plus față de analiza primară pentru diferențele generale, datorită diferențelor probabile de comportament și răspuns la intervenția IDEAL, analizele sub-grup exploratorii post-hoc au examinat modificarea FM stratificată de pacienții care erau OW / OB față de cei slabi. Pentru a analiza punctul final secundar al MRD, au fost construite modele liniare generalizate care utilizează regresia logistică binară, inclusiv indicatori prognostici demografici și tradiționali (vârstă, număr inițial WBC, categorie de risc citogenetic, sex, etnie). Pentru a evalua o influență potențială a perioadei de tratament asupra punctului final al MRD între controlul istoric și cohorta IDEAL,MRD a fost analizată cu interacțiunea cohortei și anul diagnosticului. Toate testele statistice au fost efectuate ca teste pe 2 fețe, cu excepția testelor unilaterale determinate a priori pentru punctul final MRD, cu semnificația stabilită laP <.05. Fezabilitatea și aderența au fost calculate ca medie pentru cohortă în general și pe componente de intervenție. Analizele citokinelor au fost analizate cu abordări parametrice sau neparametrice, după cum s-a considerat adecvat. Toate analizele au fost efectuate folosind R ( www.r-project.org ).Mergi la:

Rezultate

Populația de studiu

Studiul IDEAL a înrolat 40 de pacienți cu HR-ALL nou diagnosticat. Dintre acestea, 36 din 40 au fost evaluate de DXA pentru punctul final principal, 38 din 40 pentru MRD și 39 din 40 pentru aderență și fezabilitate (vezi CONSORT; Figura 2 suplimentară). Controlul istoric a inclus 80 de pacienți tratați consecutiv pentru comparație, dintre care 36 au fost înrolați în studiul de compoziție corporală cu rezultate DXA pereche pre / postinducție. Așa cum se arată în tabel 2, nu a existat nicio diferență în ceea ce privește vârsta, sexul sau prezentarea WBC în comparație cu martorii; studiul IDEAL a inclus mai puțini pacienți hispanici, deși 15% dintre pacienții IDEAL nu au raportat etnia. Comparația compoziției corpului între cohorte a demonstrat că cohorta IDEAL a avut un procent mai mare de IMC și FM la momentul inițial, deși diferențele în FM au fost limitate în principal la cele OW / OB la diagnostic (Tabelul 1 suplimentar). Cohorta IDEAL a fost, de asemenea, înclinată spre caracteristici biologice nefavorabile (tabel 2). Mai exact, mai puțini pacienți în IDEAL au demonstrat dublă trisomie (4 și 10) și au fost identificați mai mulți pacienți cu caracteristici prognostice citogenetice adverse cunoscute (48% vs 10%). Creșterea biologiei adverse s-a datorat în primul rând implementării screeningului pentru cromozomii Philadelphia (cum ar fi Ph) ca LLA ca boală cu risc mai mare în 2016 (tabelul suplimentar 2). 35 , 36 În ciuda screening-ului pentru genetică asemănătoare Ph-ului, chimioterapia de inducție a rămas constantă între cohorte, incluzând nicio terapie specifică adăugată în timpul intervenției de studiu pentru cei cu LLA Ph-like. Examinarea efectului de timp nu a arătat nicio influență a anului de diagnostic asupra ratelor de MRD pozitive sau detectabile ( P = .60 și P= .47, respectiv). Comparația caracteristicilor de prezentare din subsetul DXA și subseturile de biomarkeri a arătat modele similare cohortei părinte (tabelele suplimentare 3 și 4).

tabel 2.

Descrierea cohortei

CaracteristicăProces IDEAL, nr. (%) sau medie ± SDControl istoric, nr. (%) sau medie ± SDP
Total40 (100)80 (100)n / A
Vârstă, y
 Media ± SD15,0 ± 3,014,7 ± 2,5.72
 10-14.919 (48)46 (58).34
 ≥1521 (52)34 (42)
Sex
 Femeie16 (40)37 (46).56
 Masculin24 (60)43 (54)
Etnie
 Nu hispanic8 (20)14 (18).002
 Hispanic26 (65)66 (83)
 Nu a fost raportat6 (15)0 (0)
WBC, × 10 3 / μL
 Media ± SD56 ± 11750 ± 93.54
 <5031 (77)57 (71).52
 ≥509 (23)23 (29)
Citogenetica *
 Neutru18 (45)61 (76)<.001
 Favorabil3 (7)10 (13)
 Advers19 (48)8 (10)
 Necunoscut0 (0)1 (1)
Boala SNC 
 CNS126 (65)62 (78).32
 CNS212 (30)16 (20)
 CNS32 (5)2 (2)
Categoria IMC
 A se sprijini14 (35)45 (56).09
 Supraponderal6 (15)9 (11)
 Obezi20 (50)26 (33)
IMC percentilă79,5 ± 27,367,2 ± 32,8.03
Compoziția corpului 
 Masă grasă, kg25,2 ± 14,118,4 ± 11,3.04
 % Gras32,7 ± 9,627,8 ± 9,0.02
 Masă slabă, kg45,3 ± 14,739,5 ± 12,5.11
 % A se sprijini64,4 ± 9,268,9 ± 8,5.02

Deschideți într-o fereastră separată

SNC, sistemul nervos central; CNS1, fără celule blastice în lichidul cefalorahidian (LCR); CNS2, <5 WBC / μL CSF cu celule blastice; CNS3, ≥5 WBC / μL CSF cu celule blastice sau semne de implicare a SNC; n / a, nu se aplică; SD, deviație standard.* Citogenetica clasificată utilizând stratificarea riscului COG; vezi „Metode”. Implicarea SNC conform criteriilor COG. Compoziția corpului evaluată de DXA în subsetul controlului istoric.

Eficacitate pentru a preveni creșterea grăsimii

În ansamblu, nu a existat nicio diferență semnificativă în modificarea FM față de valoarea inițială de preinducție la cei care au primit intervenția IDEAL față de controlul istoric DXA (schimbare mediană, + 5,1% [interval intercuartiliu [IQR], 15,8) vs + 10,7% [IQR, 16,0 ]; P = .13). Pacienții care au aderat la intervenția dietetică, așa cum sunt definiți prin protocol, au câștigat cel mai mic nivel FM (schimbare mediană, + 2,4% [IQR, 13,7]). Cu toate acestea, în analiza de subgrup exploratorie stratificată după IMC la diagnostic (Figura 1A), Pacienții OW / OB IDEAL au câștigat semnificativ mai puțin FM decât controalele OW / OB (schimbare mediană, + 1,5% [IQR, 6,6] față de + 9,7% [IQR, 11,1]; P = 0,02), deși nu a fost prezentă nicio diferență pentru cei slabi la diagnostic față de controalele istorice (schimbare mediană, + 20,5% [IQR, 23,6] vs + 11,0% [IQR, 18,6]; P = 0,19). Dintre cei care au început terapia OW / OB în studiul IDEAL, 36% (8 din 22) au pierdut FM în timpul inducției, comparativ cu 25% (4 din 16) din OW / OB în controalele istorice ( P = .42). Intervenția IDEALĂ nu a împiedicat pierderea LM comparativ cu controlul istoric în niciunul dintre grupurile IMC (modificări mediane, slabă -11,6% [IQR, 9,1] vs -13,8% [IQR, 16,9], P = 0,83; OW / OB – 13,1% [IQR, 11,0] vs -15,9 [IQR, 10,1], P =, 95) (Figura 1B).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansuri ADV2020004018f1.jpg

Figura 1.

Modificarea FM și LM în timpul inducției. În comparație cu controalele istorice, modificarea FM față de valoarea inițială (A) a scăzut la cei OW / OB (IMC ≥85%) la diagnostic în cohorta IDEAL, dar nu la cei slabi (IMC <85%). Modificarea LM față de valoarea inițială (B) nu a fost semnificativ diferită pentru niciunul dintre grupuri. * Semnificativ la 2 fețe P <.05.

Eficacitate pentru reducerea EOI MRD

Prevalența MRD EOI stratificată în funcție de categoria IMC este prezentată în Figura 2. Analiza multivariabilă a demonstrat că intervenția IDEAL a fost asociată cu un risc semnificativ redus de pozitivitate MRD EOI după contabilizarea covariabilelor confundante (raportul cotei [OR], 0,30; interval de încredere 95% [IC 95%], 0,09-0,92; P unilateral = .02) (Tabelul 3). Intervenția IDEAL a redus, de asemenea, riscul de MRD detectabil (> 0,000%) comparativ cu controalele istorice (OR, 0,16; IC 95%, 0,04-0,52; P unilateral = 0,002) (Tabelul suplimentar 5). Pacienții cu OW / OB sau WBC inițial mai mare au rămas cu un risc mai mare de MRD EOI. Nu a existat nicio interacțiune semnificativă între IMC și intervenția în model ( P = .60). Datorită diferențelor de clasificare a riscului de LLA de tip Ph între cohorte (Tabelul 2 suplimentar), analiza de sensibilitate a fost efectuată aplicând clasificarea de risc comună de la controlul istoric (AALL08B1 26 ) la ambele studii (adică fără test de tip Ph). Acest model a demonstrat un beneficiu de protecție similar al intervenției IDEAL asupra pozitivității EOI MRD (SAU, 0,30; IC 95%, 0,09-0,84; P unilateral= .01). Reducerea riscului de MRD prin intervenția IDEAL a fost, de asemenea, semnificativă în toate modelele la pragul mai conservator pe 2 fețe de P <.05.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansurile ADV2020004018f2.jpg

Figura 2.

MRD la EOI. Prevalența MRD ≥0,01% la EOI în cohorta IDEAL comparativ cu controalele istorice și stratificată prin inițierea IMC. În studiul IDEAL, 24 din 38 (63%) evaluabile pentru MRD la EOI au fost OW / OB comparativ cu 35 din 80 (44%) în controlul istoric.

Tabelul 3.

Analiza multivariabilă a intervenției IDEALE și EOI MRD ≥ 0,01%

CovariabilSAUIC 95%P
Vârsta ≥15 ani1.100,44-2,79.42
IMC la diagnostic, OW / OB3.401.23-10.13.01 *
WBC la diagnostic, × 10 3 / μL1,011.00-1.02.01 *
Citogenetica
 Favorabil
 Advers0,940,27-3,17.46
Etnie
 Hispanic0,700,19-2,65.29
 Nu a fost raportat
Genul masculin1,530,57-4,17.20
IDEALintervenţie0,300,09-0,92.02 *

Toate valorile P sunt unilaterale; vezi „Metode”.

MRD, boală reziduală minimă în măduva osoasă.* De asemenea, semnificativ la testul pe 2 fețe P <.05. Variabila informează modelul, dar prezice perfect rezultatul (toți pacienții favorabili au fost MRD <0,01%).

Aderența și fezabilitatea

Intervenția IDEAL a fost integrată cu succes în chimioterapia de inducție, cu 86,5% (339 din 392) din toate vizitele de studiu așteptate finalizate. Dintre cei 39 de pacienți cu evaluări ulterioare, respectarea medie a dietei a fost de 82,1% (IC 95%, 77,7-86,5). În special, 92% dintre pacienți (36 din 39) au obținut un bilanț caloric negativ pe tot parcursul inducției. Aderența la fiecare componentă a dietei a depășit pragurile, cu excepția aportului de grăsimi (Figura 3 suplimentară). În schimb, respectarea medie a exercițiilor prescrise a fost de 31,2% (IC 95%, 19,5-43,0). Datele Fitbit au demonstrat că 59% (23 din 39) au respectat monitorizarea activității Fitbit pentru ≥50% din inducție (zile urmărite definite ca orice activitate). Pașii medieni pe zi în zilele urmărite au fost de 1530 pași pe zi (IQR, 1306 pași pe zi).

Biologie integrată

Concentrațiile de citokine au fost analizate la diagnostic (n = 39) și la EOI (n = 36) la pacienții IDEAL și la eșantioane bancare din controlul istoric (n = 28). La diagnostic, leptina a fost pozitivă (Rho 0,70; P <0,001) și adiponectina invers (Rho = -0,28; P = 0,03) corelată cu FM. Raportul adiponectină-leptină (A / L), un marker al sensibilității la insulină, a fost asociat invers cu FM la diagnostic (Rho = -0,66; P <0,001). După inducție, leptina nu s-a modificat semnificativ, dar adiponectina și raportul A / L corespunzător au fost mai mari în cohorta IDEAL decât martorii (Figura 3), indicând o sensibilitate mai mare la insulină cu o mai mică disfuncție adipocitară în cohorta IDEALĂ. În mod corespunzător, 32% dintre pacienții slabi (7 din 22) din controlul istoric DXA au necesitat insulină pentru gestionarea hiperglicemiei, comparativ cu 0% dintre pacienții slabi (0 din 14) în studiul IDEAL ( P = .02). Nu a existat nicio diferență în cerințele de insulină în grupul OW / OB care a primit IDEAL (43%; 10 din 23) față de controalele OW / OB (29%, 6 din 21; P = .24). La cei care nu au primit insulină exogenă, nivelurile de insulină circulante au fost mai mici la EOI în cohorta IDEAL vs martori (n = 25 vs 17, 413 pg / mL [IQR, 395] vs 678 pg / mL [IQR, 303]; P =. 02). Interesant este că în MRD pacienți, raporturile A / L au fost mai mari la EOI în IDEAL vs martori (2,68 [IQR, 4,49] vs 1,32 [IQR, 2,37]; P = 0,09), dar nu la pacienții cu MRD + (1,52 [IQR, 1,02] vs 1,2 [ IQR, 1,65]; P =, 45). Asocierea pre / postcomparări a citokinelor a găsit o stare antiinflamatorie generală în ambele cohorte, cu dovezi suplimentare pentru o sensibilitate îmbunătățită la insulină în IDEAL versus martori (Figura suplimentară 4).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansurile ADV2020004018f3.jpg

Figura 3.

Raportul A / L la EOI. Raportul A / L este o măsură sensibilă pentru sensibilitatea la insulină și adipocite sănătoase. Raportul A / L la EOI a fost mai mare atât pentru pacienții slabi, cât și pentru pacienții cu OW / OB tratați în studiul IDEAL în comparație cu controlul istoric. ** Semnificativ la P -2-fețe <<01.Mergi la:

Discuţie

Studiul IDEAL este primul studiu prospectiv pentru testarea restricției calorice și nutrienților plus exerciții fizice ca modalitate terapeutică pentru îmbunătățirea eficacității chimioterapiei și a răspunsului la boală în caz de malignitate hematologică. Studiul IDEAL a dovedit că este fezabil să se integreze acest tip de intervenție cu mai multe fațete în chimioterapia de inducție. Deși intervenția nu a demonstrat un câștig de grăsime redus semnificativ în cohorta generală față de controlul istoric, analizele post hoc stratificate prin IMC au demonstrat diferențe în efectul intervenției la pacienții OW / OB vs slabi. Intervenția IDEAL a redus cu succes creșterea grăsimii la pacienții OW / OB, dar nu și la cei slabi la diagnostic. Cel mai important, intervenția IDEAL a redus riscul apariției MRD EOI la toți pacienții, indiferent de inițierea IMC și după luarea în considerare a caracteristicilor prognostice. În special,acest efect a fost prezent în ciuda numărului mai mic de pacienți din cohorta IDEAL având LLA cu caracteristici biologice cu risc mai mic. Reducerea MRD a fost confirmată și într-o analiză de sensibilitate utilizând aceleași criterii de risc biologic pentru ambele cohorte. Deși toți pacienții au beneficiat astfel de intervenție, riscul pentru MRD a rămas ridicat la cei care erau OW / OB în raport cu omologii lor slabi, în concordanță cu experiența noastră din trecut. Deși studiul nu a fost conceput pentru a evalua supraviețuirea pe termen lung, reducerea cu succes a MRD are ramificații clinice semnificative. MRD rămâne cel mai puternic predictor la nivel de pacient al rezultatului slab37 și, prin urmare, este utilizat în mod obișnuit pentru a ghida intensificarea terapiei, imunoterapia și / sau transplantul de celule hematopoietice, toate acestea adăugând cost și comorbiditate. 38– 40 Astfel, reducerea chimiorezistenței și a MRD în populația HR-ALL scade ambele morbiditate și potențial îmbunătățește supraviețuirea.

Este remarcabil faptul că câștigul în FM a scăzut doar la pacienții cu OW / OB. Aderența la dietă a fost excelentă, cu deficite calorice și obiective de macronutrienți atinse la aproape toți pacienții, inclusiv în grupul slab. Este posibil ca adipocitele și FM-ul corespunzător să răspundă diferit la restricția calorică la pacienții OW / OB față de pacienții slabi. 41 , 42 Deoarece comportamentul sedentar a fost, de asemenea, omniprezent, cu pași medii înregistrați pe zi mai puțin de percentila a cincea pentru copii și adolescenți, 43 poate fi necesar un exercițiu îmbunătățit pentru a restabili flexibilitatea metabolică la pacienții cu FM refractară IDEAL. 42Dincolo de efectele sale asupra FM, inactivitatea fizică în prima lună a contribuit probabil și la pierderea semnificativă a masei musculare constatată în ambele cohorte. Pierderea LM în studiul IDEAL a fost similară cu cea constatată în controalele istorice, indicând faptul că restricția calorică din IDEAL nu a agravat pierderea LM și că chiar și nivelurile scăzute de exercițiu au contracarat orice efect catabolic al restricției calorice. Cu toate acestea, pierderea LM este deosebit de problematică în timpul terapiei ALL. LM este asociat cu densitatea minerală osoasă și, prin urmare, diminuarea LM ar putea exacerba pierderea osoasă dramatică observată în timpul inducerii de la chimioterapia ALL. 44 Procesul succesor planificat al IDEAL va explora aceste întrebări într-un mod aleatoriu, abordând direct comportamentul sedentar și rafinând intervenția exercițiului pentru a promova pierderea FM și menținerea LM.

Am emis ipoteza că IDEAL va reduce FM și, prin urmare, va reduce protecția adipocitelor pentru TOATE celulele. 12 Alternativ, reducerea FM ar putea îmbunătăți profilurile farmacocinetice ale chimioterapiei. 12 , 16 , 45 Cu toate acestea, îmbunătățirea observată a MRD nu a fost legată de aceste modificări ale FM, sugerând că fiziopatologia nu este strict mediată de țesutul adipos în sine. Obezitatea moderează, de asemenea, o varietate de căi de semnalizare intracelulară asociate cancerului implicate în chimiorezistență. 46 , 47Dintre căile potențiale testate în studiu, am identificat calea insulină-glucoză și adipokina adiponectină ca potențiali mediatori cheie ai chimiorezistenței și eficacității IDEAL. Insulina stimulează semnalizarea intracelulară fosfatidilinozitol-3-kinază (PI3K) / AKT, o cale cunoscută și vizabilă implicată în TOATE chimiorezistența. 48 , 49În ciuda cohortei IDEAL care a început tratamentul cu FM mai mare decât cohorta de control istorică, intervenția IDEAL a îmbunătățit sensibilitatea la insulină, fapt demonstrat de creșterea raportului plasmatic A / L, eliminarea necesității de insulină exogenă la pacienții slabi, insulina circulantă mai mică și scăderea BAFF în comparație cu comenzi. Într-un studiu care a testat o formă severă de post intermitent la femeile cu cancer de sân, niveluri mai scăzute de insulină au fost observate în mod similar la cei care au respectat postul cu răspuns îmbunătățit al bolii. 50Deși cu o abordare dietetică diferită și o populație de cancer, aceasta adaugă sprijin rolului presupus al insulinei în chimiorezistență și potențialul modificărilor dietetice de a influența răspunsul bolii la nivelul tumorilor. Interesant, în studiul IDEAL, scăderea insulinei a fost însoțită de creșteri marcate ale adiponectinei. Adiponectina poate contribui separat la îmbunătățirea eficacității chimioterapiei, deoarece inhibă direct și indirect fosforilarea PI3K / AKT și ținta mecanicistă din aval a semnalizării rapamicinei prin protein kinaza activată cu 5 ‘adenozin monofosfat. 51 Aceste constatari sprijini continuarea studiilor de insulină în definirea mecanismului de eficacitate de interventie ideală și nou identifică adiponectina ca un potential biomarker al ALL chemosensitivitate.

Există câteva limitări inerente unui proces de fază incipientă. În primul rând, ca studiu cu un singur braț, IDEAL a încorporat un control istoric nerandomizat pentru comparație. Cu toate acestea, regimurile de inducție statică și ratele de MRD în timpul acestei ere de tratament au minimizat posibilele prejudecăți. Identificarea ulterioară a LLA-ului Ph ca grup de prognostic advers a complicat analiza riscului de bază pentru punctul final al MRD. Pentru a aborda acest lucru, diferențele biologice au fost ajustate pentru toate analizele multivariabile pentru MRD, iar rezultatele pozitive au fost reproduse în analiza de sensibilitate utilizând clasificarea de risc mai veche. De asemenea, observăm că aderența slabă la componenta de exercițiu a fost predominantă și a fost agravată și de inactivitatea fizică. Deoarece exercițiul fizic este o provocare pentru pacienți, acest lucru poate sprijini potențialul beneficiu doar de restricția calorică dietetică.Contribuția relativă la eficacitate a fiecărei componente va necesita o explorare suplimentară într-un studiu mai mare, randomizat. În cele din urmă, recunoaștem că cohorta noastră a inclus pacienți cu rate ridicate de obezitate, etnie hispanică și a inclus doar terapie HR-ALL în stil COG. Agenții de chimioterapie pentru inducerea HR-ALL sunt, de asemenea, relativ conservați în rândul consorțiilor internaționale și au fost chiar adoptați de mulți consorții adulți.7 Cu toate acestea, testarea intervenției IDEAL într-un cadru mai larg este acum justificată. Un studiu prospectiv randomizat, stratificat de TOATE biologia și obezitatea, va fi realizat în cadrul Consorțiului Terapeutic Progrese în Considerația Leucemiei și Limfomului Copilului pentru a valida aceste constatări într-un cadru național de consorțiu. Studiul IDEAL oferă dovada principiului fezabilității și plauzibilității biologice a ruperii legăturii dintre fiziologia supraponderală și biologia tumorii pentru a îmbunătăți eficacitatea chimioterapiei, răspunsul la boală și supraviețuirea în LLA: toate fără morbiditate sau mortalitate adăugate.Mergi la:

Material suplimentar

Versiunea full-text a acestui articol conține un supliment de date.Faceți clic aici pentru fișier de date suplimentare. (1,0M, pdf)Mergi la:

Mulțumiri

Autorii recunosc Richard Sposto pentru contribuția biostatistică la planificarea și proiectarea studiilor, Katie Villabroza pentru coordonarea cercetării clinice și operațiunea studiilor, precum și pacienții și familiile care s-au oferit voluntar să participe la studiile de cercetare.

Această lucrare a fost susținută de Fundația Gabrielle’s Angel pentru cercetarea cancerului și parțial de Institutele Naționale de Sănătate, Institutul Național al Cancerului (subvenții R01 CA201444 [SDM], P30 CA-16042 [GL], UL1TR000124-02 [GL] și P50 CA211015 [GL]) și Centrul Național pentru Avansarea Științelor Translaționale (acordă UL1TR001855 și UL1TR000130) prin intermediul Institutului de Științe Clinice și Translaționale din California de Sud (SC CTSI).

Conținutul este exclusiv responsabilitatea autorilor și nu reprezintă neapărat opiniile oficiale ale Institutelor Naționale de Sănătate.Mergi la:

Note de subsol

Protocolul studiului clinic care detaliază intervenția este disponibil integral în Date suplimentare care însoțesc versiunea online a publicației. Datele individuale agregate sau neidentificate ale participanților care susțin punctele finale primare și secundare vor fi puse la dispoziția autorului corespunzător la cererea rezonabilă și după stabilirea unui acord de acces la date aprobat, pentru o perioadă de 3 ani de la data publicării.Mergi la:

Autor

Contribuție: Toți autorii au participat la proiectarea studiului, interpretarea rezultatelor și revizuirea manuscrisului, au dat aprobarea finală a manuscrisului și sunt de acord să răspundă pentru toate aspectele lucrării legate de acuratețea sau integritatea sa; JK și GL au efectuat analizele statistice; iar EO și SDM au conceput conceptul de încercare și au scris prima versiune a manuscrisului.

Dezvăluirea conflictului de interese: EO a servit într-un consiliu consultativ pentru Servier Pharmaceuticals în afara domeniului acestei activități. Ceilalți autori nu declară interese concurente.

Corespondență: Etan Orgel, Spitalul pentru Copii din Los Angeles, Cancer and Blood Disease Institute, 4650 Sunset Blvd, MS # 54, Los Angeles, CA 90027; e-mail: ude.csu.alhc@legroe .Mergi la:

Referințe

1. Larsson SC, Wolk A. Supraponderalitatea și obezitatea și incidența leucemiei: o meta-analiză a studiilor de cohortă . Int J Rac . 2008; 122 ( 6 ): 1418-1421. [ PubMed ] [ Google Scholar ]2. Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ. Supraponderalitatea, obezitatea și mortalitatea cauzată de cancer într-o cohortă de adulți din SUA studiată prospectiv . N Engl J Med . 2003; 348 ( 17 ): 1625-1638. [ PubMed ] [ Google Scholar ]3. Lauby-Secretan B, Scoccianti C, Loomis D, Grosse Y, Bianchini F, Straif K; Grupul de lucru al Agenției Internaționale pentru Cercetarea Cancerului. Grăsime corporală și cancer – punctul de vedere al Grupului de lucru IARC . N Engl J Med . 2016; 375 ( 8 ): 794-798. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]4. Orgel E, Genkinger JM, Aggarwal D, Sung L, Nieder M, Ladas EJ. Asocierea indicelui masei corporale și a supraviețuirii în leucemia pediatrică: o meta-analiză . Sunt J Clin Nutr . 2016; 103 ( 3 ): 808-817. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]5. Butturini AM, Dorey FJ, Lange BJ și colab. . Obezitatea și rezultatul în leucemia limfoblastică acută pediatrică . J Clin Oncol . 2007; 25 ( 15 ): 2063-2069. [ PubMed ] [ Google Scholar ]6. Egnell C, Ranta S, Banerjee J, și colab. . Impactul indicelui de masă corporală asupra recăderii la copiii cu leucemie limfoblastică acută tratați conform protocoalelor de tratament nordic . Eur J Haematol . 2020; 105 ( 6 ): 797-807. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]7. Stock W, Luger SM, Advani AS și colab. . Un regim pediatric pentru adolescenți mai în vârstă și adulți tineri cu leucemie limfoblastică acută: rezultate ale CALGB 10403 . Sânge . 2019; 133 ( 14 ): 1548-1559. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]8. Butturini A, Vignetti M, Gubbiotti S, și colab. . Obezitatea prezice independent supraviețuirea fără evenimente (EFS) la adulții cu leucemie limfoblastică acută BCR-ABL-negativă (LLA): o analiză retrospectivă a două studii GIMEMA [rezumat] . Sânge . 2005; 106 ( 11 ). Rezumat 1828. [ Google Scholar ]9. Ghosh T, Richardson M, Gordon PM, Ryder JR, Spector LG, Turcotte LM. Indicele de masă corporală asociat cu riscul de leucemie limfoblastică acută cu celule B cu risc ridicat al copilăriei și adolescenților: un raport al grupului oncologic pentru copii . Cancer Med . 2020; 9 ( 18 ): 6825-6835. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]10. Withycombe JS, Smith LM, Meza JL și colab. . Schimbarea greutății în timpul tratamentului cu inducere a leucemiei limfoblastice acute din copilărie prezice obezitatea: un raport al Grupului de oncologie pentru copii . Cancer de sânge Pediatr . 2015; 62 ( 3 ): 434-439. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]11. Orgel E, Mueske NM, Sposto R, Gilsanz V, Freyer DR, Mittelman SD. Limitări ale indicelui de masă corporală pentru evaluarea compoziției corpului datorită obezității sarcopenice în timpul terapiei cu leucemie . Limfom Leuk . 2018; 59 ( 1 ): 138-145. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]12. Orgel E, Sea JL, Mittelman SD. Mecanisme prin care obezitatea influențează supraviețuirea în urma leucemiei limfoblastice acute . J Natl Cancer Inst Monogr . 2019; 2019 ( 54 ): 152-156. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]13. Behan JW, Yun JP, Proektor MP și colab. . Adipocitele afectează tratamentul leucemiei la șoareci . Cancer Res . 2009; 69 ( 19 ): 7867-7874. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]14. Ehsanipour EA, Sheng X, Behan JW și colab. . Adipocitele provoacă rezistența celulelor leucemice la L-asparaginază prin eliberarea de glutamină . Cancer Res . 2013; 73 ( 10 ): 2998-3006. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]15. Pramanik R, Sheng X, Ichihara B, Heisterkamp N, Mittelman SD. Țesutul adipos atrage și protejează celulele leucemiei limfoblastice acute de chimioterapie . Leuk Res . 2013; 37 ( 5 ): 503-509. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]16. Sheng X, Parmentier JH, Tucci J și colab. . Adipocitele sechestrează și metabolizează daunorubicina chimioterapeutică . Mol Cancer Res . 2017; 15 ( 12 ): 1704-1713. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]17. Orgel E, Tucci J, Alhushki W, și colab. . Obezitatea este asociată cu leucemie reziduală după terapia de inducție pentru leucemia limfoblastică acută precursor B în copilărie . Sânge . 2014; 124 ( 26 ): 3932-3938. [ PubMed ] [ Google Scholar ]18. Borowitz MJ, Wood BL, Devidas M și colab. . Semnificația prognostică a bolii reziduale minime în B-ALL cu risc ridicat: un raport din studiul grupului oncologic pentru copii AALL0232 . Sânge . 2015; 126 ( 8 ): 964-971. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]19. Borowitz MJ, Devidas M, Hunger SP și colab. ; Grupul de Oncologie pentru copii. Semnificația clinică a bolii reziduale minime în leucemia limfoblastică acută din copilărie și relația acesteia cu alți factori de prognostic: un studiu de grup oncologic pentru copii . Sânge . 2008; 111 ( 12 ): 5477-5485. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]20. Orgel E, Sposto R, Malvar J, și colab. . Impactul asupra supraviețuirii și toxicității în funcție de durata extremelor de greutate în timpul tratamentului pentru leucemie limfoblastică acută pediatrică: un raport al Grupului oncologic pentru copii . J Clin Oncol . 2014; 32 ( 13 ): 1331-1337. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]21. Tucci J, Alhushki W, Chen T, Sheng X, Kim YM, Mittelman SD. Trecerea la o dietă cu conținut scăzut de grăsimi îmbunătățește rezultatul leucemiei limfoblastice acute la șoarecii obezi . Cancer Metab . 2018; 6 ( 1 ): 15. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]22. Lettieri-Barbato D, Aquilano K. Împingerea limitelor terapiei împotriva cancerului: jocul nutrienților . Front Oncol . 2018; 8 : 148. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]23. O’Flanagan CH, Smith LA, McDonell SB, Hursting SD. Când mai puțin poate fi mai mult: restricția calorică și răspunsul la terapia cancerului . BMC Med . 2017; 15 ( 1 ): 106. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]24. Walpole B, Dettmer E, Morrongiello BA, McCrindle BW, Hamilton J. Interviuri motivaționale pentru a spori autoeficacitatea și a promova pierderea în greutate la adolescenții supraponderali și obezi: un studiu controlat randomizat . J Pediatr Psychol . 2013; 38 ( 9 ): 944-953. [ PubMed ] [ Google Scholar ]25. Iannotti RJ, Schneider S, Nansel TR și colab. . Autoeficacitatea, așteptările rezultatelor și autogestionarea diabetului la adolescenții cu diabet de tip 1 . J Dev Behav Pediatr . 2006; 27 ( 2 ): 98-105. [ PubMed ] [ Google Scholar ]26. Hunger SP, Loh ML, Whitlock JA și colab. ; COG Comitetul pentru leucemie limfoblastică acută. Planul 2013 al Grupului de Oncologie pentru copii pentru cercetare: leucemie limfoblastică acută . Cancer de sânge Pediatr . 2013; 60 ( 6 ): 957-963. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]27. Larsen EC, Devidas M, Chen S și colab. . Dexametazona și doza mare de metotrexat îmbunătățesc rezultatul pentru copii și adulți tineri cu leucemie limfoblastică acută B cu risc crescut: un raport din studiul grupului oncologic pentru copii AALL0232 . J Clin Oncol . 2016; 34 ( 20 ): 2380-2388. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]28. Kuczmarski R, Ogden C, Grummer-Strawn L, și colab. . Diagrame de creștere CDC: Statele Unite. Date avansate din statistici vitale și de sănătate . Hyattsville, MD: Centrul Național pentru Statistici de Sănătate; 2000. [ PubMed ] [ Google Scholar ]29. Orgel E, Mueske NM, Sposto R și colab. . Un studiu controlat randomizat care testează un regim de vitamina D optimizat pentru aderență pentru a atenua modificarea oaselor la adolescenții tratați pentru leucemie limfoblastică acută . Limfom Leuk . 2017; 58 ( 10 ): 2370-2378. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]30. Necesități de energie și proteine. Raportul unei consultări comune a experților FAO / OMS / UNU . Reprezentant tehnic al Organelor Mondiale pentru Sănătate . 1985; 724 : 1-206. [ PubMed ] [ Google Scholar ]31. Iezuit C, Dillon C, Compher C, Lenders CM; Consiliul Director al Societății Americane pentru Nutriție Parenterală și Enterală (ASPEN). Liniile directoare clinice ASPEN: sprijin nutrițional al pacienților pediatrici spitalizați cu obezitate . JPEN J Parenter Enteral Nutr . 2010; 34 ( 1 ): 13-20. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]32. Schenk JM, Neuhouser ML, Lin DW, Kristal AR. O intervenție dietetică pentru a obține modificări dietetice rapide și complexe pentru studii care investighează efectele dietei asupra țesuturilor colectate în timpul procedurilor chirurgicale invazive . J Am Diet Conf . Univ . 2009; 109 ( 3 ): 459-463. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]33. Serviciul de cercetare agricolă al Departamentului Agriculturii din SUA (USDA). Grupul de cercetare a sondajelor alimentare: Baza de date despre alimente și nutrienți pentru studii dietetice 2013-2014 . http://www.ars.usda.gov/nea/bhnrc/fsrg . Accesat la 18 septembrie 2019.34. Deitz JC, Kartin D, Kopp K. Review of the Bruininks-Oseretsky Test of Motor Proficiency, Second Edition (BOT-2) . Phys Occup Ther Pediatr . 2007; 27 ( 4 ): 87-102. [ PubMed ] [ Google Scholar ]35. Tasian SK, Loh ML, Hunger SP. Leucemie acută limfoblastică asemănătoare cromozomului Philadelphia . Sânge . 2017; 130 ( 19 ): 2064-2072. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]36. Chen IM, Harvey RC, Mullighan CG și colab. . Modelarea rezultatelor cu CRLF2, IKZF1, JAK și boala reziduală minimă în leucemia limfoblastică acută pediatrică: un studiu al grupului oncologic pentru copii . Sânge . 2012; 119 ( 15 ): 3512-3522. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]37. Berry DA, Zhou S, Higley H și colab. . Asocierea bolii reziduale minime cu rezultatul clinic în leucemia limfoblastică acută la copii și adulți: o meta-analiză . JAMA Oncol . 2017; 3 ( 7 ): e170580. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]38. Rețeaua națională cuprinzătoare de cancer (NCCN). NCCN Guidelines: Clinical Practice Guidelines in Oncology: Acute Lymphoblastic Leucemia (Adult and AYA), version1.2020 . Disponibil la: www.nccn.org . Accesat la 20 mai 2020.39. Athale UH, Gibson PJ, Bradley NM, Malkin DM, Hitzler J; Grupul de lucru POGO MRD. Boală reziduală minimă și leucemie infantilă: recomandări standard de îngrijire din partea Grupului de lucru pentru MRD Pediatric Oncology Group din Ontario . Cancer de sânge Pediatr . 2016; 63 ( 6 ): 973-982. [ PubMed ] [ Google Scholar ]40. Hucks G, Rheingold SR. Călătoria către terapia cu celule T CAR: experiența pediatrică și a adulților tineri cu B-ALL recidivant sau refractar . Blood J Cancer . 2019; 9 ( 2 ): 10. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]41. Aydin C, Jarema KA, Phillips PM, Gordon CJ. Restricție calorică la tulpinile slabe și obeze de șobolan de laborator: efecte asupra compoziției corpului, metabolismului, creșterii și sănătății generale . Exp Physiol . 2015; 100 ( 11 ): 1280-1297. [ PubMed ] [ Google Scholar ]42. Rynders CA, Blanc S, DeJong N, Bessesen DH, Bergouignan A. Comportamentul sedentar este un factor determinant al inflexibilității metabolice . J Fiziol . 2018; 596 ( 8 ): 1319-1330. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]43. Barreira TV, Schuna JM Jr., Mire EF și colab. . Pași normativi / zi și valori de cadență de vârf pentru copii și adolescenți din Statele Unite: sondaj național de examinare a sănătății și nutriției 2005-2006 . J Pediatr . 2015; 166 ( 1 ): 139-143. [ PubMed ] [ Google Scholar ]44. Orgel E, Mueske NM, Wren TA și colab. . Lezarea precoce a osului cortical și spongios din chimioterapia de inducție pentru adolescenți și adulți tineri tratați pentru leucemie limfoblastică acută . Bone . 2016; 85 : 131-137. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]45. Behan JW, Avramis VI, Yun JP, Louie SG, Mittelman SD. Obezitatea indusă de dietă modifică farmacocinetica vincristinei din sânge și țesuturile șoarecilor . Farmacol Res . 2010; 61 ( 5 ): 385-390. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]46. Chen J. Căi de semnal multiple în cancerul asociat obezității . Obes Rev . 2011; 12 ( 12 ): 1063-1070. [ PubMed ] [ Google Scholar ]47. Longo VD, Fontana L. Restricția caloriilor și prevenirea cancerului: mecanisme metabolice și moleculare . Trends Pharmacol Sci . 2010; 31 ( 2 ): 89-98. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Barrett D, Brown VI, Grupp SA, Teachey DT. Direcționarea axei de semnalizare PI3K / AKT / mTOR la ​​copiii cu afecțiuni maligne hematologice . Medicamentele pediatre . 2012; 14 ( 5 ): 299-316. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Bertacchini J, Heidari N, Mediani L, și colab. . Direcționarea rețelei PI3K / AKT / mTOR pentru tratamentul leucemiei . Cell Mol Life Sci . 2015; 72 ( 12 ): 2337-2347. [ PubMed ] [ Google Scholar ]50. de Groot S, Lugtenberg RT, Cohen D și colab. ; Grupul olandez de cercetare a cancerului de sân (BOOG). Dieta care mimează postul, ca adjuvant la chimioterapia neoadjuvantă pentru cancerul de sân, în studiul multicentric randomizat de fază 2 DIRECT . Nat Commun . 2020; 11 ( 1 ): 3083. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]51. Vansaun MN. Căi moleculare: semnalizarea adiponectinei și a leptinei în cancer . Clin Cancer Res . 2013; 19 ( 8 ): 1926-1932. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]


Articolele de la Blood Advances sunt furnizate aici prin amabilitatea Societății Americane de Hematologie

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8045487/

Test deschis, explorator, de fază II, de Itraconazol oral pentru tratamentul carcinomului bazocelular

Daniel J. Kim , James Kim , Katrina Spaunhurst , Javier Montoya , Rita Khodosh , Kalyani Chandra …Afișați mai multe

Itraconazolul, un medicament antifungic aprobat de US Food and Drug Administration, inhibă calea de semnalizare Hedgehog (HH), un factor crucial al tumorigenezei carcinomului bazocelular (BCC) și reduce creșterea BCC la șoareci. Am evaluat efectul itraconazolului asupra căii HH și asupra dimensiunii tumorii în tumorile BCC umane.Pacienți și metode

Pacienții cu ≥ o tumoră BCC> 4 mm în diametru au fost înscriși pe două cohorte pentru a primi itraconazol oral 200 mg de două ori pe zi timp de 1 lună (cohorta A) sau 100 mg de două ori pe zi pentru o medie de 2,3 luni (cohorta B). Punctul final principal a fost modificarea biomarkerilor: proliferarea tumorii Ki67 și activitatea HH ( ARNm GLI1 ). Punctele finale secundare au inclus modificarea dimensiunii tumorii la un subgrup de pacienți cu tumori multiple.Rezultate

Au fost înrolați în total 29 de pacienți, dintre care 19 au fost tratați cu itraconazol. Tratamentul cu Itraconazol a fost asociat cu două evenimente adverse (oboseală de gradul 2 și insuficiență cardiacă congestivă de gradul 4). Itraconazolul a redus proliferarea celulară cu 45% ( P = 0,04), activitatea căii HH cu 65% ( P = 0,03) și a redus aria tumorii cu 24% (IC 95%, 18,2% până la 30,0%). Din opt pacienți cu mai multe tumori nonbiopsiate, patru au obținut un răspuns parțial și patru au avut boală stabilă. Tumorile de la pacienții de control netratați și de la cei tratați anterior cu vismodegib nu au prezentat modificări semnificative ale proliferării sau dimensiunii tumorii.

Concluzie

Itraconazolul are activitate anti-BCC la om. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului, în special în raport cu alți inhibitori ai căii

Carcinomul cu celule bazale (BCC) este cel mai frecvent diagnosticat cancer la om, cu aproximativ 2 milioane de cazuri noi în Statele Unite în fiecare an. 1 Pacienții afectați de sindromul nev de celule bazale (Gorlin), ereditar (mostenire online mendeliană la om nr. 109400) pot dezvolta sute până la mii de BCC. 2 Pacienții cu sindromul nevocelular bazal moștenesc o copie defectă a genei supresoare tumorale PTCH1 , care acționează ca un inhibitor primar al căii de semnalizare Hedgehog (HH). 3 – 5 PTCH1 mutațiilor genetice și pierderea de tip sălbatic rămase alelă apar și în sporadice BCC. 3 – 5În esență, toate BCC au activare malignă a căii de semnalizare HH, care este în mod obișnuit măsurată prin expresia unei gene țintă care codifică factorul de transcripție GLI1 . 2 – 4 Recenta aprobare din partea US Food and Drug Administration (FDA) a vismodegib, un antagonist al componentei esențiale a căii HH Smoothened (SMO), validează eficacitatea inhibării căii HH în tratamentul BCC. 6 Vismodegib este aprobat pentru BCC local avansat (inoperabil) sau metastatic, care cuprinde doar 2% din toate BCC. Majoritatea BCC pot fi tratate prin excizie chirurgicală, deși intervenția chirurgicală poate duce la cicatrici și morbiditate semnificative. 5Având în vedere incidența în creștere a BCC și tratamentul său costisitor – unul dintre cei mai mari în rândul beneficiarilor Medicare 7 – există o mare nevoie clinică nesatisfăcută de forme nechirurgicale de tratament. 8 Deși unele creme chimioterapeutice precum imiquimod și fluouracil sunt aprobate de FDA, aceste opțiuni topice sunt eficiente numai împotriva subtipului superficial al BCC, care cuprinde doar 30% din toate BCC. 9 , 10 Efectele adverse frecvente (căderea părului, pierderea în greutate, crampele musculare) ale vismodegibului îl exclud ca opțiune de tratament viabilă pentru majoritatea BCC-urilor non-avansate. 6

Am efectuat un screening al medicamentelor aprobate de FDA și am identificat itraconazolul, un agent antifungic oral utilizat pe scară largă, ca un puternic antagonist al căii HH. 11 Anterior, am demonstrat că itraconazolul suprimă carcinogeneza BCC murină autohtonă, induce necroza tumorală și reduce expresia ARNm GLI1 la șoareci. 11 Pentru a evalua mecanismul de acțiune și eficacitatea clinică a itraconazolului în BCC umană, am efectuat un studiu deschis, de dovadă a conceptului, de fază II, în două cohorte de pacienți cu BCC sporadică. Obiectivele principale ale celor două cohorte au fost de a evalua dacă inhibarea indusă de itraconazol a activității căii HH ( GLI1 ARNm) ar putea reduce proliferarea tumorii (Ki67) și dimensiunea tumorii la BCC umană și pentru a evalua dacă s-ar putea realiza reduceri semnificative ale dimensiunii tumorii cu doze mai mici de itraconazol administrate pe o durată mai lungă.PACIENTI ȘI METODEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODE <<REZULTATEDISCUŢIEREFERINȚEPacienți și tratamente

Am recrutat pacienți cu ≥ o tumoră BCC> 4 mm (cel mai lung diametru), fără comorbidități și teste normale ale funcției hepatice în decurs de 1 an înainte de înscriere. Cei care au luat medicamente care ar putea afecta tumorile BCC sau metabolismul itraconazolului (de exemplu, anticonvulsivante, corticosteroizi) și cei care nu au putut participa atât la biopsie inițială, cât și la excizia chirurgicală la aceeași instituție au fost excluși din studiu. Toți pacienții au fost măsurați AST / ALT după 1 lună de itraconazol.

Am examinat 67 de pacienți pentru eligibilitate și am înscris 29 la două site-uri; 37 de pacienți au fost excluși de la înscriere din cauza incapacității lor de a avea atât biopsie, cât și excizie în același loc. Cohorta A (Universitatea Stanford, Stanford, CA) a înrolat 25 de pacienți din aprilie 2010 până în decembrie 2010, iar cohorta B (Universidad Católica de Chile, Santiago, Chile) a înrolat patru pacienți din iulie 2010 până în septembrie 2011 (diagrama CONSORT; Fig 1). Un singur pacient a întâmpinat diagnosticul clinic pentru sindromul nevocelular bazal.

Fig. 1.Diagrama CONSORT. qPCR, reacție în lanț cantitativă a polimerazei.

În cohorta A, pacienții au primit itraconazol în comprimate de 200 mg pe cale orală de două ori pe zi, între momentul biopsiei și momentul exciziei definitive (în mod obișnuit 4 săptămâni). Scopul principal al cohortei A a fost evaluarea biomarkerilor tumorali (proliferarea Ki67 și activitatea căii HH [ GLI1mARN]) și dimensiunea tumorii se modifică după 1 lună de tratament. În cohorta B, pacienții au primit comprimate de 100 mg pe cale orală de două ori pe zi. Scopul principal al cohortei B a fost de a determina dacă o doză mai mică de itraconazol administrată pe o durată mai lungă (medie, 2,3 luni; interval, 1 până la 4 luni) ar putea realiza în continuare efecte semnificative clinic. Pacienții eligibili altfel, dar care nu doreau să ia itraconazol, au fost înrolați pe brațul de control al studiului și nu au primit tratament. Studiile paralele au fost aprobate de către comitetele de revizuire instituționale respective.

Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresie în timpul terapiei, probabil ca urmare a rezistenței secundare la vismodegib. 12 Deoarece itraconazolul antagonizează și SMO și se știe puțin despre modul în care rezistența la un medicament poate afecta eficacitatea unui alt inhibitor al SMO, cei tratați anterior cu vismodegib au fost analizați separat de pacienții naivi cu vismodegib. Prin urmare, am analizat în cele din urmă trei grupuri discrete: unul, pacienții care nu au primit nici un itraconazol; doi, pacienți cărora li s-a administrat itraconazol fără tratament anterior cu vismodegib; și trei, pacienți cărora li s-a administrat itraconazol cu ​​tratament anterior cu vismodegib.Biopsii tumorale și evaluări ale biomarkerului (cohorta A)

La momentul înscrierii, pacienții din cohorta A aveau leziuni BCC țintă (una sau două dintre cele mai reprezentative tumori) selectate pentru biopsie. Tumorile biopsiate au fost încorporate în parafină și colorate pentru Ki67 pentru a evalua proliferarea celulară. Celulele cu colorare nucleară pozitivă (indicând celule în proliferare activă) au fost numărate de Flagship Biosciences (Flagstaff, AZ) și normalizate la numărul total de nuclee prezente în BCC. Datele de proliferare celulară prezentate aici sunt exprimate ca procent de celule cu un semnal pozitiv. Pentru a evalua activitatea căii HH, probele de biopsie proaspete au fost congelate rapid, plasate în Trizol (Invitrogen, Carlsbad, CA) și omogenizate utilizând MP FastPrep 24 (MP Biomedicals, Solon, OH). ARN-ul total a fost purificat cu tuburi de fază Lock Gels (Eppendorf, Hamburg, Germania) și un kit ARN PureLink Micro (Invitrogen).ADNc a fost sintetizat cu SuperScript III Reverse Transcriptase (Invitrogen). Reacția în lanț a polimerazei în timp real a fost efectuată pe un iCycler Bio-Rad folosind iQ SyberGreen Supermix (Bio-Rad, Hercules, CA). Schimbare de oriExpresia ARNm GLI1 a fost măsurată utilizând analiza ΔΔC t , cu HPRT1 ca genă de control intern și pielea normală colectată de la pacienții cu BCC ca probe de control pentru normalizarea probelor BCC. Secvențele de primer de reacție în lanț ale polimerazei au fost:

  • GLI1 înainte: 5 ′ GAAGTCATACTCACGCCTCGAA 3 ′
  • GLI1 invers: 5 ′ CAGCCAGGGAGCTTACATACAT 3 ′
  • HPRT1 înainte: 5 ′ GGTCAGGCAGTATAATCCAAAG 3 ′
  • Revers HPRT1 : 5 ′ GGACTCCAGATGTTTCCAAAC 3 ′

În cazurile în care biopsia / excizia a avut un volum tumoral limitat, probele au fost prioritare pentru analiza proliferării celulare. Nici o tumoră nu a fost biopsiată pentru analiza biomarkerului în cohorta B, deoarece scopul său principal a fost de a evalua efectul dozei mici de itraconazol asupra dimensiunii tumorii.Măsurători ale dimensiunii tumorii

În cohorta A, 11 din 15 pacienți au avut o singură tumoare BCC. Această leziune țintă a fost biopsiată și excizată pentru analiza biomarkerului. Leziunile țintă nu au fost evaluate pentru modificarea dimensiunii tumorii, deoarece au fost biopsiate la momentul inițial. Doar patru din 15 pacienți au avut ≥ o tumoră BCC și au fost observate leziuni nedestinate (n = 42) pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial. Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. În schimb, toate tumorile de la cei patru pacienți (n = 14 BCC) din cohorta B au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 200 mg pe zi (durata medie, 2,3 luni).Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) a fost calculată de la data înscrierii până la data ultimei evaluări clinice.

Pentru fiecare pacient măsurat pentru zona tumorii, parametrii de răspuns clinici BCC validați au fost utilizați conform Skvara și colab 13 și definiți după cum urmează: răspuns complet, nu mai există dovezi vizibile ale unei leziuni în concordanță cu BCC; răspuns parțial, deși rămâne un BCC, există o scădere vizibilă a dimensiunii; și fără răspuns, BCC nu a scăzut vizibil în dimensiune. Un investigator dermatolog care a fost orbit de grupurile de tratament a efectuat toate evaluările clinice folosind fotografii făcute înainte și după tratament. Nu am utilizat criterii RECIST pentru tumorile solide, deoarece majoritatea leziunilor BCC aveau o dimensiune <10 mm, iar leziunile tumorale au fost evaluate în primul rând pentru modificările biomarkerului.Analize statistice

Ca studiu exploratoriu, am calculat că un număr minim de 27 de pacienți trebuia să fie înrolați pentru a detecta o diferență de două ori între modificarea Ki67 la pacienții netratați față de cei tratați cu itraconazol (β, 0,80; față-verso α, 0,05). Testul sumelor de rang nonparametric Mann-Whitney a fost utilizat pentru comparații nepereche, iar testul de rang semnat Wilcoxon a fost utilizat pentru comparații pereche. Toate valorile P raportate sunt pe două fețe.REZULTATEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATE <<DISCUŢIEREFERINȚEDemografia pacientului

Am înrolat 29 de pacienți cu un total de 101 tumori BCC; 19 pacienți cu un total de 90 BCC au consimțit la tratamentul cu itraconazol (cohorta A, n = 15; cohorta B, n = 4). La momentul inițial, pacienții tratați cu itraconazol și pacienții martor au fost similari ca vârstă, sex, tip BCC și localizarea tumorilor BCC ( Tabelul 1 ). Tumorile au apărut în regiunile corpului expuse în mod clasic la soare, inclusiv fața, gâtul și trunchiul. Pacienții au fost predominant bărbați mai în vârstă (vârsta medie, 60 de ani) cu subtipuri BCC nodulare. Pacienții cărora li sa administrat itraconazol au avut, în medie, aproape 5 ori mai multe tumori la momentul inițial comparativ cu cei care nu au fost tratați cu itraconazol ( P= .13). Durata medie de observare / tratament a fost de aproximativ 1 lună la pacienții martor și la pacienții tratați cu itraconazol din cohorta A (n = 76 de tumori) și 2,3 luni la pacienții tratați cu itraconazol din cohorta B (n = 14 tumori). Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresia bolii și au oprit vismodegibul timp de ≥ 6 luni înainte de a începe itraconazolul.

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

CaracteristicăControl (n = 10)Itraconazol (n = 19)
Nu.%Nu.%
Vârsta la biopsia inițială, ani
    In medie68,562.2
    Gamă53 la 8144 – 85
Sex
    Masculin8801579
    Femeie220421
Numărul total de tumori BCC prezente1190
Numărul mediu de tumori BCC per pacient1.14,77
Tip tumoră BCC *
    Nodular6432150
    Superficial4291433
    Infiltrativ214512
    Micronodular21425
Localizarea tumorii BCC
    Față6553539
    Înapoi2181719
    Umăr001314
    Gât0089
    Cufăr0067
    Picior1967
    Braţ21822
    Scalp0022
    Ureche0013
Istoria tratamentului cu vismodegib003
Durata medie a tratamentului, luni
    Pacienți cu Stanford (200 mg de două ori pe zi)1.11.0
    Pacienți din Chile (100 mg de două ori pe zi)N / A2.3

Abrevieri: BCC, carcinom bazocelular; NA, nu se aplică.

* Include numai tumorile care au fost biopsiate.Evenimente adverse legate de droguri

Doi din 19 pacienți au întrerupt tratamentul cu itraconazol din cauza efectelor adverse descrise anterior asociate cu itraconazolul. O insuficiență cardiacă congestivă de gradul 4 a apărut la un pacient care a avut o boală cardiacă nediagnosticată în urma tratamentului anterior cu adriamicină pentru limfom Hodgkin acum 20 de aniFig 1). Un al doilea pacient a întrerupt din cauza oboselii de gradul 2. Alte efecte adverse au fost ușoare și toate efectele adverse au fost reversibile la întreruperea tratamentului. Nu s-au detectat creșteri ale testării funcției hepatice (AST / ALT) la niciun pacient în timpul tratamentului.Analiza biomarkerului (numai cohorta A)

Un total de 63 de biopsii de la 22 din 25 de pacienți înscriși în cohorta A au fost disponibile pentru analiza biomarkerului ( Fig 1). Am comparat modificarea proliferării Ki67 în biopsiile luate la momentul inițial și la excizie la o lună mai târziu la pacienții tratați cu itraconazol (20 BCC) și la pacienții netratați / de control (12 BCC). Itraconazolul a scăzut proliferarea celulară cu 35% la pacienții naivi cu vismodegib în analize nepereche ( P = .079; Fig. 2De la A la 2C). În cadrul comparațiilor pacienților cu activitatea Ki67 de la momentul inițial până la excizie, itraconazolul a scăzut proliferarea celulară cu 45% la pacienții naivi cu vismodegib (n = 8; P = 0,04 în perechi ; Fig 2D). În schimb, pacienții martori și cei tratați anterior cu vismodegib nu au prezentat modificări semnificative în proliferarea celulară ( Fig 2E).

Fig 2.Cuantificarea Ki67 și analiza tumorilor de carcinom bazocelular (BCC). (A) Analiza nepereche a tumorilor individuale de la pacienții martor și pacienții tratați cu itraconazol. Colorarea Ki67 a tumorilor BCC la momentul inițial și excizia de la pacienții de control (B) și (C) pacienți naivi cu vismodegib tratați cu itraconazol. Colorarea pozitivă (maro) indică proliferarea nucleelor; colorarea negativă (albastră) nu indică activitate proliferativă. Analiza pereche a pacientului Ki67 medii în rândul pacienților (D) naivi cu vismodegib și (E) pacienți de control tratați cu itraconazol.

Pentru analiza căii de semnalizare HH, un total de 24 de biopsii au fost colectate de la pacienții tratați cu itraconazol și analizați pentru nivelurile de ARNm GLI1 . Într-o analiză nepereche, itraconazolul a scăzut ARNm GLI1 cu 65% în tumorile de la pacienții naivi cu vismodegib comparativ cu valoarea inițială ( P = 0,028; Fig 3A). Examinând numai tumori asociate de la patru pacienți (naivi cu vismodegib), itraconazolul a scăzut ARNm GLI1 cu 45% în tumori după o lună, comparativ cu valoarea inițială ( Fig 3B). Tumorile de la pacienții cu tratament anterior cu vismodegib nu au demonstrat o scădere semnificativă a expresiei ARNm GLI1 . Alte studii clinice BCC nu au demonstrat, de asemenea, nicio modificare a expresiei ARNm GLI1 la pacienții tratați cu placebo sau pacienții de control. 14 , 15

Fig 3.Niveluri de expresie a ARNm GLI1 în tumorile de carcinom bazocelular de la pacienții tratați cu itraconazol timp de 1 lună. Unii pacienți au primit anterior tratament cu vismodegib și nu au mai răspuns la vismodegib. (A) Analiza nepereche a nivelurilor de ARNm GLI1 din tumorile inițiale și tumorile excizate după tratamentul cu itraconazol. Ca martor, ARNm GLI1 a fost evaluat pe pielea normală nontumorală. ARNm GLI1 a scăzut cu 65% la pacienții naivi cu vismodegib tratați cu itraconazol de la momentul inițial până la excizie ( P = .028). (B) În analiza asociată a tumorilor de la aceiași pacienți, itraconazolul a scăzut expresia GLI1 cu 45% după o lună numai la pacienții naivi cu vismodegib.Modificări ale dimensiunii tumorii și răspunsul clinic (cohorte A și B)

Itraconazolul a redus dimensiunea tumorii și a favorizat reepitelizarea în tumorile BCC a opt din cei 29 de pacienți naivi cu vismodegib ( Fig 4). În cohorta A, patru pacienți au avut> o tumoră BCC, iar aceste leziuni nedestinate au fost observate pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial (n = 43). Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. La cei patru pacienți din cohorta B, toate cele 14 tumori BCC au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 100 mg de două ori pe zi (durata medie, 2,3 luni). Niciuna dintre tumorile cohortei B nu a fost biopsiată pentru analiza biomarkerului, deoarece scopul cohortei B a fost de a evalua o doză mai mică de itraconazol pentru o durată mai lungă. Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) este prezentată în Figura 5. În medie, tumorile de la pacienții naivi cu vismodegib au scăzut cu 24% (IÎ 95%, 18,2% până la 30,0%) după tratamentul cu itraconazol ( Fig 5). Mai mult, reducerile medii ale tumorilor la pacienții din cohorta B au fost comparabile cu cele ale cohortei A ( P = .435). Această constatare sugerează că administrarea alternativă de itraconazol (doze mai mici pe o durată mai lungă) poate realiza în continuare reduceri semnificative clinic.

Fig 4.Reducerea sau reepitelizarea tumorilor de carcinom bazocelular (BCC) de către itraconazol la pacienții fără vismodegib. (A) Tumoră BCC nodulară pe picior de la înrolare până în ziua 25. (B) Tumoră BCC infiltrativă pe umăr de la înrolare până în ziua 28. (C) Vedere laterală și (D) laterală a tumorii BCC nodulare pe frunte de la înrolare până în ziua 59.

Fig 5.Modificarea procentuală a zonei tumorale pentru 57 de tumori de carcinom bazocelular (BCC) de la opt pacienți tratați cu itraconazol. În timpul tratamentului cu itraconazol, aria tumorii a scăzut în medie cu 24% (IC 95%, 18,2% până la 30,0%). În cohorta A, patru pacienți au avut mai multe tumori BCC, iar leziunile nedestinate au fost disponibile pentru măsurarea dimensiunii tumorii. Aria tumorii a fost aproximată prin înmulțirea celor mai lungi diametre perpendiculare ale tumorilor, măsurate cu etriere. Tumorile nonbiopsiate au fost evaluate pentru modificarea zonei tumorale la momentul inițial și după 4 săptămâni. În cohorta B, tumorile BCC nu au fost evaluate pentru biomarkeri; au fost evaluați numai pentru modificarea dimensiunii clinice la momentul inițial (după biopsia inițială care confirmă diagnosticul BCC) și după tratamentul cu itraconazol 200 mg în medie 2,3 luni.Procentul de modificare a zonei a fost calculat de la data înscrierii până la data ultimei evaluări clinice.

În ciuda reducerii generale a dimensiunii, niciuna dintre tumorile BCC nu a dispărut complet cu tratamentul cu itraconazol după o medie de 1,1 luni (cohorta A, n = 43 tumori) și 2,3 luni (cohorta B, n = 14 tumori). Patru pacienți au prezentat răspuns parțial și patru au prezentat o boală stabilă folosind liniile directoare descrise anterior. 16 În evaluările clinice, nici pacienții de control, nici pacienții cu antecedente de tratament cu vismodegib nu au prezentat modificări ale dimensiunii tumorii

În acest studiu de dovadă a conceptului, am demonstrat prima utilizare off-label, după cunoștințele noastre, a unui medicament aprobat de FDA pentru tratamentul BCC care vizează activitatea căii HH. Itraconazolul poate reduce dimensiunea tumorii BCC prin inhibarea căii de semnalizare HH după 1 lună de tratament. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului.

Ca un studiu exploratoriu de fază II, scopul principal al acestui studiu a fost de a determina dacă itraconazolul la doze prescrise în mod obișnuit de 200 până la 400 mg zilnic ar putea reduce proliferarea tumorii și calea HH în BCC umane după o lună. Doar patru pacienți din cohorta B au fost tratați timp de> 1 lună și, prin urmare, nu avem rezultate privind eficacitatea clinică anti-BCC a itraconazolului pe o perioadă mai lungă de tratament. Mai mult, nu putem compara în mod direct eficacitatea pe termen scurt a itraconazolului cu cea a vismodegibului, primul inhibitor de HH aprobat de FDA care a prezentat o rată de răspuns de 40% la pacienții cu BCC avansat local tratați timp de> 10 luni. 6Itraconazolul pare să aibă o utilitate clinică mai mică în comparație cu vismodegib ca tratament de primă linie, deoarece concentrația inhibitoare jumătate maximă a itraconazolului este de 100 × mai puțin puternică in vitro comparativ cu vismodegib, iar itraconazolul reduce calea HH cu 65% după 1 lună, spre deosebire de Reducere de 90% cu vismodegib. 15 Itraconazolul poate fi eficient ca terapie de linia a doua, deoarece itraconazolul acționează asupra SMO într-un loc distinct de ciclopamină și vismodegib. 11 După cum se demonstrează prin teste de semnalizare in vitro, 17eficacitatea itraconazolului este dependentă de doză, iar studiile viitoare ar trebui să examineze dacă dozele mai mari de itraconazol administrate pe perioade mai lungi de tratament pot aborda eficacitatea observată cu vismodegib și alți antagoniști SMO. Cu toate acestea, administrarea cronică a itraconazolului ar putea avea, de asemenea, efecte adverse și toxicitate suplimentare, care nu au fost observate în acest studiu exploratoriu, deși au fost raportate tratamente pe termen lung cu 600 până la 900 mg pe zi, cuprinse între 3 și 16 luni, cu toxicități controlabile. 18 , 19

Studiul nostru are mai multe limitări. În primul rând, a fost limitată de mărimea eșantionului, deoarece am înrolat doar 29 de pacienți; cu toate acestea, mulți pacienți au avut mai multe tumori, iar acest studiu a evaluat 101 BCC. În al doilea rând, toți, cu excepția unuia dintre pacienții din acest studiu, au avut BCC non-avansat și niciunul nu a avut boală metastatică; astfel, rezultatele noastre nu pot fi comparate cu rata globală de răspuns de 40% observată cu vismodegib la pacienții cu BCC avansat sau metastatic. 6În al treilea rând, am avut doar trei pacienți care au prezentat progresia cu vismodegib și nu au efectuat analize de secvențiere pentru a determina mecanismul de rezistență la medicamente vismodegib. Astfel, nu am putut testa în mod direct dacă itraconazolul ar putea fi o opțiune viabilă ca tratament de linia a doua după eșecul vismodegibului. În al patrulea rând, am evaluat doar eficacitatea pe termen scurt a itraconazolului și este necesară administrarea cronică pentru a compara eficacitatea și toxicitatea itraconazolului în raport cu vismodegib. Viitoare studii clinice randomizate sunt necesare pentru a determina eficacitatea itraconazolului la o gamă mai largă de pacienți cu sarcini variate ale bolii, o eficacitate diferențială potențială în tumorile rezistente la vismodegib versus tumorile naive cu vismdoegib și posibilitatea dacă un dublu atac anti-SMO ar fi da rezultate superioare.Rezultatele noastre preclinice sugerează că o dublă inhibare anti-SMO reduce creșterea tumorii mai eficient decât itraconazolul sau ciclopamina în monoterapie.11

Recent, terapia combinatorie cu trioxid de arsen (ATO), aprobată de FDA pentru leucemia promielocitară acută, s-a dovedit a fi eficientă în BCC murin și medullobloastomul rezistent la vismodegib. 20 ATO acționează ca un antagonist HH prin prevenirea traficului ciliar și destabilizarea GLI2, un factor de transcripție în aval de SMO. 17 Tratamentul combinat cu itraconazol și ATO s-ar putea dovedi deosebit de benefic în tumorile BCC rezistente 21 la antagoniștii SMO, cum ar fi vismodegib, care imită și concurează pentru legarea cu ciclopamina. 20 Presupunând că BCC rezistente la vismodegib se comportă similar cu meduloblastomul, 22 , 23 terapia combinată cu itraconazol-ATO poate depăși rezistența rezultată dinMutații SMO și amplificări GLI2 , deoarece itraconazolul inhibă SMO printr-un mecanism distinct de ciclopamină, 11 și ATO inhibă factorii de transcripție GLI . În acest scop, am inițiat un studiu al combinației de itraconazol și ATO la pacienții cu BCC metastatice pentru care vismodegib a eșuat (clinictrials.gov NCT01791894).© 2014 de Societatea Americană de Oncologie Clinică

Vezi editorialul însoțitor la pagina 720

Susținut de Stanford Clinical and Translational Science Institute (SPARK) și Damon Runyon Clinical Investigator Award (JYT).

Prezentat parțial la reuniunea anuală a Asociației Americane pentru Cercetarea Cancerului, Orlando, FL, 2-6 aprilie 2011.

Dezvăluirile autorilor despre posibilele conflicte de interese și contribuțiile autorilor se găsesc la sfârșitul acestui articol.

Informații despre studiile clinice: NCT01108094.DIVULGAREA AUTORILOR PRIVIND POTENȚIALELE CONFLICTE DE INTERES

Deși toți autorii au completat declarația de divulgare, următorii autor (i) și / sau membrii apropiați ai familiei unui autor au indicat un interes financiar sau de altă natură care este relevant pentru subiectul examinat în acest articol. Anumite relații marcate cu „U” sunt cele pentru care nu s-a primit nicio compensație; acele relații marcate cu „C” au fost compensate. Pentru o descriere detaliată a categoriilor de divulgare sau pentru mai multe informații despre politica ASCO privind conflictele de interese, vă rugăm să consultați Declarația de divulgare a autorului și secțiunea Dezvăluiri de potențiale conflicte de interese din Informații pentru contribuabili.

Ocuparea forței de muncă sau poziția de conducător: Niciun Consultant sau Rol consultativ: Jean Y. Tang, Genentech (C) Proprietate de acțiuni: Niciun Onorariu: Niciun Finanțare pentru cercetare: Niciun Mărturie de expert: Niciun Brevete, Redevențe și Licențe: Niciun Alt Remunerație: Nici unulCONTRIBUȚIILE AUTORULUI

Concepție și design: Philip A. Beachy, Jean Y. Tang

Sprijin financiar: Philip A. Beachy, Jean Y. Tang

Sprijin administrativ: Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Furnizarea de materiale de studiu sau pacienți: Jean Y. Tang

Colectarea și asamblarea datelor: Daniel J. Kim, Katrina Spaunhurst, Javier Montoya, Rita Khodosh, Kalyani Chandra, Teresa Fu, Anita Gilliam, Monserrat Molgo, Philip A. Beachy, Jean Y. Tang

Analiza și interpretarea datelor: Daniel J. Kim, James Kim, Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Scriere manuscrisă: Toți autorii

Aprobarea finală a manuscrisului: Toți autoriiREFERINȚEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATEDISCUŢIEREFERINȚE <<

1.DL Miller , MA Weinstock : Cancer de piele nonmelanom în Statele Unite: Incidență J Am Acad Dermatol 30: 774 – 778 , 1994 Crossref , Medline ,  Google Scholar
2.MR Gailani , SJ Bale , DJ Leffell , etal: Defecte de dezvoltare în sindromul Gorlin legate de o genă suppresivă tumorală putativă pe cromozomul 9 Celula 69: 111 – 117 , 1992 Crossref , Medline ,  Google Scholar
3.H Hahn , C Wicking , PG Zaphiropoulous , etal: Mutații ale omologului uman al Drosophila patch-uri în sindromul nevoid carcinom bazocelular Celula 85: 841 – 851 , 1996 Crossref , Medline ,  Google Scholar
4.RL Johnson , AL Rothman , J Xie , etal: Omolog om al patchei, o genă candidată pentru sindromul nevului cu celule bazale Știință 272: 1668 – 1671 , 1996 Crossref , Medline ,  Google Scholar
5.EH Epstein : Carcinoame bazocelulare: Atacul ariciului Nat Rev Cancer 8: 743 – 754 , 2008 Crossref , Medline ,  Google Scholar
6.A Sekulic , MR Migden , AE Oro , etal: Eficacitatea și siguranța vismodegibului în carcinomul bazocelular avansat N Engl J Med 366: 2171 – 2179 , 2012 Crossref , Medline ,  Google Scholar
7.TS Housman , SR Feldman , PM Williford , etal: Cancerul de piele este printre cele mai costisitoare dintre toate tipurile de cancer de tratat pentru populația Medicare J Am Acad Dermatol 48: 425 – 429 , 2003 Crossref , Medline ,  Google Scholar
8.E de Vries , M Louwman , M Bastiaens , etal: Creșteri rapide și continue ale ratelor de incidență a carcinomului bazocelular în sud-estul Țărilor de Jos din 1973 J Invest Dermatol 123: 634 – 638 , 2004 Crossref , Medline ,  Google Scholar
9.H Gollnick , CG Barona , RG Frank , etal: Rata de recurență a carcinomului bazocelular superficial după tratamentul cu cremă imiquimod 5%: Încheierea unui studiu de urmărire pe termen lung de 5 ani în Europa Eur J Dermatol 18: 677 – 682 , 2008 Medline ,  Google Scholar
10.K Gross , L Kircik , G Kricorian : 5% cremă 5-fluorouracil pentru tratamentul carcinomului bazocelular superficial mic: Eficacitate, tolerabilitate, rezultat cosmetic și satisfacția pacientului Dermatol Surg 33: 433 – 439 , 2007 discuție 440 Medline ,  Google Scholar
11.J Kim , JY Tang , R Gong , etal: Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii Hedgehog și creșterea cancerului Celula cancerului 17: 388 – 399 , 2010 Crossref , Medline ,  Google Scholar
12.RL Yauch , GJ Dijkgraaf , B Alicke , etal: Mutația netezită conferă rezistență la un inhibitor al căii Hedgehog în meduloblastom Știința 326: 572 – 574 , 2009 Crossref , Medline ,  Google Scholar
13.H Skvara , F Kalthoff , JG Meingassner , etal: Tratamentul topic al carcinoamelor bazocelulare în sindromul carcinomului bazocelular nevoidic cu un inhibitor netezit J Invest Dermatol 131: 1735 – 1744 , 2011 Crossref , Medline ,  Google Scholar
14.DD Von Hoff , PM LoRusso , CM Rudin , etal: Inhibarea căii arici în carcinomul bazocelular avansat N Engl J Med 361: 1164 – 1172 , 2009 Crossref , Medline ,  Google Scholar
15.JY Tang , JM Mackay-Wiggan , M Aszterbaum , etal: Inhibarea căii arici la pacienții cu sindromul nevului bazocelular N Engl J Med 366: 2180 – 2188 , 2012 Crossref , Medline ,  Google Scholar
16.GJ Dijkgraaf , B Alicke , L Weinmann , etal: inhibarea moleculei mici a GDC-0449 mutanți refractari neteziți și mecanisme din aval de rezistență la medicamente Cancer Res 71: 435 – 444 , 2011 Crossref , Medline ,  Google Scholar
17.J Kim , JJ Lee , J Kim , etal: Arsenicul antagonizează calea Hedgehog prin prevenirea acumulării ciliare și reducerea stabilității efectorului transcripțional Gli2 Proc Natl Acad Sci SUA 107: 13432 – 13437 , 2010 Crossref , Medline ,  Google Scholar
18.K Takagi , A Yoshida , T Yamauchi , etal: Tratamentul cu succes al spondilodiscitei Aspergillus cu doze mari de itraconazol la un pacient cu leucemie mielogenă acută Leucemie 15: 1670 – 1671 , 2001 Crossref , Medline ,  Google Scholar
19.PK Sharkey , MG Rinaldi , JF Dunn , et al: doze mari de itraconazol în tratamentul micozelor severe Antimicrob Agents Chemother 35: 707 – 713 , 1991 CrossRef , Medline ,  Google Academic
20.J Kim , BT Aftab , JY Tang , etal: Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți Celula cancerului 23: 23 – 34 , 2013 Crossref , Medline ,  Google Scholar
21.AL Chang , AE Oro : Evaluarea inițială a creșterii tumorale după vismodegib în carcinomul bazocelular avansat Arch Dermatol 148: 1324 – 1325 , 2012 Crossref , Medline ,  Google Scholar
22.CM Rudin , CL Hann , J Laterra , etal: Tratamentul meduloblastomului cu inhibitor al căii arici GDC-0449 N Engl J Med 361: 1173 – 1178 , 2009 Crossref , Medline ,  Google Scholar
23.S Buonamici , J Williams , M Morrissey , etal: Interferența cu rezistența la antagoniști neteziți prin inhibarea căii PI3K în medulloblastom Sci Transl Med 2: 51ra70 , 2010 Crossref , Medline ,  Google Scholar

Eficacitatea și siguranța curcuminei în asociere cu paclitaxel la pacienții cu cancer de sân avansat, metastatic

un studiu clinic comparativ, randomizat, dublu-orb, controlat cu placebo

Tatul Saghatelyan unArmen Tananyan unNaira Janoyan oAnna Tadevosyan unHasmik Petrosyan unAraxia Hovhannisyan unLidia Hayrapetyan oMikael Arustamyan aJürgen Arnhold bAndre-Robert Rotmann cAreg Hovhannisyan dAlexander Panossian eA

https://doi.org/10.1016/j.phymed.2020.153218Obțineți drepturi și conținut

Sub Creative Commons licențăacces deschis

Repere

Acesta este primul studiu clinic care explorează eficacitatea și siguranța administrării intravenoase a curcuminei în asociere cu chimioterapie în tratamentul pacienților cu cancer.

Abstract

fundal

: Eficacitatea clinică a curcuminei nu a fost încă stabilită pentru tratamentul cancerului, în ciuda unui număr mare de dovezi din numeroase studii preclinice care sugerează potențialul terapeutic al curcuminei, în special într-o combinație sinergică cu paclitaxel. Principalul obstacol în utilizarea curcuminei pentru terapia adjuvantă a cancerului este biodisponibilitatea sa scăzută prin administrare orală.

Scop

: Am evaluat eficacitatea și siguranța perfuziei intravenoase de curcumină în combinație cu paclitaxel la pacienții cu cancer de sân metastatic și avansat.

Design de studiu

: A fost efectuat un studiu clinic comparativ randomizat, dublu-orb, controlat cu placebo, în grup paralel.

Metode

Un total de 150 de femei cu cancer de san avansat si metastatic au fost repartizati aleatoriu pentru a primi fie paclitaxel (80 mg / m 2 ) , plus placebo sau paclitaxel plus curcumin (CUC-1®, soluție de 300 mg, o dată pe săptămână) intravenos timp de 12 săptămâni cu 3 luni de urmărire. Rezultatul primar a fost determinat pe baza ratei obiective de răspuns (ORR), astfel cum a fost evaluat de criteriile de evaluare a răspunsului în tumorile solide (RECIST). Rezultatele secundare au fost supraviețuirea fără progresie (SFP), timpul până la progresia tumorii (TTP), timpul până la eșecul tratamentului tumorii (TTTF), siguranța și calitatea vieții.

Rezultate

: Analiza intenției de a trata (ITT) a relevat că ORR al curcuminei a fost semnificativ mai mare decât cea a placebo (51% vs. 33%, p <0,01) la 4 săptămâni de urmărire. Diferența dintre grupuri a fost chiar mai mare atunci când au fost incluși doar pacienții care au terminat tratamentul (61% față de 38%, cota de raport == 2,64, p <0,01). Un efect superior al curcuminei față de placebo a fost observat atât la pacienții care au terminat tratamentul, cât și la toți pacienții incluși în analiza ITT, la 3 luni după terminarea tratamentului. Nu s-au observat alte diferențe semnificative între grupurile de curcumină și cele cu placebo, cu excepția oboselii (3 vs. 10 pacienți, respectiv; raport de șanse == 3,7, p = 0,05). Cu toate acestea, performanța fizică generală auto-evaluată a pacienților a fost semnificativ mai mare cu curcumina decât placebo în timpul tratamentului și la sfârșitul urmăririi, sugerând o toleranță mai bună în grupul cu curcumină.

Concluzii

: În general, tratamentul cu curcumină în asociere cu paclitaxel a fost superior combinației paclitaxel-placebo în ceea ce privește ORR și performanța fizică după 12 săptămâni de tratament. Curcumina administrată intravenos nu a cauzat probleme majore de siguranță și nici o reducere a calității vieții și poate fi benefică în reducerea oboselii.

Progrese în cunoaștere

: Acesta este primul studiu clinic care explorează eficacitatea și siguranța administrării intravenoase a curcuminei în asociere cu chimioterapie în tratamentul pacienților cu cancer.

Abstract grafic

Administrarea intravenoasă de curcumină în asociere cu paclitaxel a fost superioară celei a combinației paclitaxel-placebo în ceea ce privește ORR și performanța fizică după 12 săptămâni de tratament la pacienții cu cancer de sân avansat și metastatic. Administrarea intravenoasă de curcumină nu a generat probleme majore de siguranță și nici o reducere a calității vieții, dar poate fi benefică în reducerea oboselii.

Imagine, abstract grafic

Abrevieri

AEeveniment adversCRFformular de raport de cazCRrăspuns completCEcomitet de eticăGCPBună practică clinicăECOGGrupul de Oncologie Cooperativă din EstICDClasificarea internațională a bolilorDFSsupraviețuire fără boliMBCcancer de sân metastaticORRrata de răspuns obiectivăSAUrăspuns obiectivPDboală progresivărelatii cu publiculrăspuns parțialRECISTCriterii de evaluare a răspunsului în tumorile solideTTPtimpul până la progresiePFSsupraviețuire fără progresieSDboală stabilăTTFeșecul timpului până la tratament

Introducere

Curcumina (diferuloylmethane) este componenta majoră a turmericului, un condiment galben derivat din planta  Curcuma longa  L. Curcuma a fost utilizată în mod tradițional în medicina chineză și ayurvedică (indiană) ca agent antiinflamator, stomac și tonic pentru tratarea durerii înjunghiate în piept și hipocondru, dureri de umăr și braț, umflături și dureri traumatice, poliartrită reumatoidă, amenoree, dismenoree, diaree, ulcere peptice, epilepsie, boli ale pielii și cancer ( Rhizoma Curcumae Longae, 1999 ;  Curcumae Longae Rhizoma, 2010 ;  Curcuma Longa , 2002 ).

Peste 4000 de  studii preclinice  in vitro și la animale pe turmeric au raportat proprietățile antioxidante, antiinflamatorii, antivirale și antitumorale ale curcuminei. S-a demonstrat că curcumina inhibă proliferarea, invazia, angiogeneza și metastaza diferitelor tipuri de cancer prin interacțiuni cu proteine ​​de semnalizare celulară multiple ( Kunnumakkara și colab., 2008 ), sugerând eficacitatea potențială în prevenirea multor tipuri diferite de cancer, inclusiv mielom multiplu și colorectal. , cancer pancreatic, sân, prostată, plămâni, cap și gât atât la modelele animale, cât și la oameni ( Devassi și colab., 2015 ).

Rezultatele multor   studii in vitro pe celule izolate sugerează că efectele terapeutice potențiale ale curcuminei în cancerul de sân pot fi mediate prin reglarea matricei metaloproteinazei (MMP) -2, a limfomului cu celule B 2 (Bcl-2), Bax, lambou semnalizarea endonuclează 1 (Fen1), factorul NF-E2 legat de factorul 2 (Nrf-2) și semnalizarea fosfoinozidicului 3-kinazei (PI3K) / protein kinazei B (Akt) ( Bharti și Aggarwal, 2002 ;  Lv și colab., 2014 ;  Kizhakkayil și colab., 2010 ;  Lowe și Lin, 2000 ;  Chen și colab., 2014 ). Curcumina reglează în jos expresia MMP-2 într-o manieră dependentă de doză și timp și inhibă fenotipul invaziv indus de H-Ras în celulele epiteliale ale sânului uman MCF10A (H-Ras MCF10A) (Kim și colab., 2001 ). Curcumina inhibă creșterea celulelor umane de cancer de sân MDA-MB-231 prin inhibarea proteinei 2 din faza S a kinazei asociate cu kinaza proteinei 2 (Skp2), care este implicată în progresia cancerului de sân, în special în cazurile de cancer ER / HER2 negativ ( Huang și colab., 2011 ). De asemenea, sa constatat că tratamentul cu curcumină suprimă proliferarea, creșterea, invazia și metastaza celulelor canceroase ( Li și colab., 2014). Curcumina modulează mai multe căi de semnalizare celulară, inclusiv calea de semnalizare apoptotică și ceilalți factori care sunt implicați în patogeneza cancerului, cum ar fi oprirea ciclului celular (G0 / G1 și / sau G2 / M oprirea ciclului celular prin reglarea în sus a Inhibitor Cdk, p21 / WAF / CIPI și p53); inhibarea factorilor de transcripție NF-κB, AP-1, TNFα, IL, STAT-3 și PPAR-γ; reglarea genei din aval a c-myc, Bcl-2, COX-2, NOS, ciclină D1, TNFa, interleukine și MMP-9; activarea factorilor de creștere bFGF, EGF, GCSF, IL-8, PDGF, TGFα, TNF și VEGF; și modularea moleculelor de adeziune celulară fibronectină, vitronectină și colagen, care sunt implicate în angiogeneză și metastază ( Kumar și colab., 2015). În general, curcumina joacă rolul unui regulator principal al comutatorului pentru inflamație prin modularea mai multor ținte moleculare importante, inclusiv factori de transcripție (de exemplu, NF-kB și AP-1), citokine (de exemplu, TNF, IL-1, IL-6, IL -18 și chemokine), kinaze (Janus kinase [JNK]), enzime pro-inflamatorii (ciclooxigenaze și lipoxigenaze) și MMP-9 ( Aggarwal și colab., 2005 ;  Aggarwal și colab., 2013 ;  Duvoix și colab., 2005 ).

Cancerul de sân este cea mai frecventă afecțiune malignă care afectează multe femei din întreaga lume. Deși s-au făcut progrese majore în tratamentul cancerului de sân în ultimele decenii, îmbunătățirea în continuare a rezultatelor tratamentului pentru cancerul de sân metastatic este un obiectiv important în cercetarea cancerului.

Paclitaxelul, care este unul dintre cei mai frecvent prescriși agenți chimioterapeutici convenționali, acționează ca un stabilizator de microtubuli și blochează celulele canceroase în faza G2 / M, împiedicându-le să sufere mitoză. Este, de asemenea, un inductor al apoptozei în celulele canceroase ( Sugimura și colab., 2004 ). Cu toate acestea, un dezavantaj al utilizării paclitaxelului este că induce supraexprimarea pompei de eflux în celulele canceroase ( Jang et al, 2001 ) și activează căile de semnalizare NF-κB, PI3K / Akt și MAPK, care inhibă apoptoza și cresc cancerul supraviețuirea celulelor. În schimb, curcumina inhibă aceste căi de semnalizare, sugerând că curcumina poate potența efectele citotoxice ale paclitaxelului prin inhibarea mecanismelor de supraviețuire a celulelor ( Ganta și Amiji, 2009). Curcumina s-a dovedit a fi implicată în reglarea expresiei proteinelor oncogene în celulele cancerului de sân ( Liu și Chen 2013 ), dar, cel mai important, curcumina poate inhiba activarea căilor PI3K / Akt și NF-κB independente una de cealaltă și poate preveni chimiorezistența prin sensibilizarea celulelor canceroase la un agent chimioterapeutic convențional ( Bava și colab., 2011 ;  Sreekanth și colab., 2011 ). Curcumina crește rata apoptotică a celulelor COC1 / DDP  prin  efect sinergic asupra apoptozei induse de paclitaxel, probabil din cauza reglării descendente a PI3KCA ( Lin și colab., 2012). Recent, Administrația SUA pentru Alimente și Medicamente a aprobat Piqray (alpelisib), primul inhibitor PI3K pentru un anumit tip de cancer de sân cauzat de o mutație genetică moștenită ( https://www.fda.gov/news-events/press-announcements/ FDA-aprobă-primul-inhibitor-pi3k-cancer-de-sân ). Medicamentul este specific pentru pacienții cu cancer mamar avansat ale căror tumori au mutația PIK3CA și sunt receptori hormonali (HR) pozitivi și HER2-negativi. Mutațiile PIK3CA se găsesc în 30% – 40% din cazurile de cancer mamar.

S-a descoperit că curcumina inhibă activarea NF-κB indusă de paclitaxel și potențează efectele inhibitoare ale creșterii paclitaxelului în celulele cancerului de sân MDA-MB-231 ( Kang și colab., 2009 ). Administrarea unei combinații de curcumină cu paclitaxel are ca rezultat o inhibare semnificativ mai mare a creșterii celulare și o apoptoză crescută decât administrarea oricărui agent. Într-un model experimental murin de cancer de sân care utilizează celule MDA-MB-231, terapia combinată cu paclitaxel și curcumină a redus semnificativ dimensiunea tumorii prin scăderea proliferării celulelor tumorale, creșterea apoptozei și scăderea expresiei MMP-9 în comparație cu cea cu oricare dintre agenți singur. Aceste rezultate sugerează în mod clar că terapia combinată curcumină-paclitaxel ar putea fi o strategie nouă pentru tratamentul cancerului de sân (Kang și colab., 2009 ). Sinergismul dintre curcumină și paclitaxel a fost observat în mai multe linii celulare canceroase (A2780, SKOV-3 și H1299) ( Boztas și colab., 2013 ). S-a demonstrat că tratamentul cu o combinație de paclitaxel cu curcumină prezintă inhibiție sinergică a creșterii și inducere semnificativă a apoptozei în celulele cancerului mamar MCF-7 ( Calaf și colab., 2018 ). Mai mult, sa constatat că tratamentul cu o combinație de paclitaxel și curcumină exercită o eficacitate crescută antitumorală la modelele de șoarece ( Zhan și colab., 2014 ).  In vivo, tratamentul combinat paclitaxel-curcumină a dus la inhibarea creșterii tumorale de 3 ori, sugerând că terapia combinată paclitaxel-curcumină ar putea avea avantaje clinice semnificative pentru tratamentul cancerelor rezistente ( Abouzeid și colab., 2014a , b ). În ansamblu, aceste date descriu potențialul terapeutic promițător al combinării paclitaxelului cu curcumina în tratamentul cancerului de sân ( Quispe-Soto și Calaf, 2016 ;  Way și colab., 2017 ).

În prezent, 205 de studii privind curcumina sunt înregistrate la ClinicalTrials.gov. Nouăzeci de studii au fost finalizate, dar doar 12 au primit rezultatele; dintre aceste studii, 11 au fost efectuate pe neoplasme de sân în diferite stadii de dezvoltare și unul a fost un studiu de fază II asupra docetaxelului cu sau fără un fitochimic în tratamentul cancerului de sân, care a fost început în 2009 și a fost oprit pentru inutilitate, având în vedere rezultatele a analizei anticipate. Motivul lipsei de eficacitate este posibil faptul că administrarea orală de curcumină, despre care se știe că are o absorbție redusă în tractul gastrointestinal, are ca rezultat o solubilitate redusă a fluidelor corporale și o biodisponibilitate scăzută ( Anand și colab., 2007). Pentru a depăși limitele administrării orale, a fost dezvoltată o formulare solubilă în apă a curcuminei pentru administrare intravenoasă ( Rose, 2014 ;  Storka și colab., 2015 ;  Abouzeid, și colab., 2014 a , b;  Alemi și colab., 2018 ). Într-un studiu clinic de fază I, farmacocinetica, siguranța și tolerabilitatea curcuminei lipozomale administrate intravenos (IV) au fost studiate la subiecți sănătoși. Administrarea pe termen scurt a curcumina lipozomale intravenos pare a fi sigur pentru până la o doză de 120 mg / m 2  ( Storka et al., 2015 ).

Acest studiu clinic comparativ randomizat, dublu-orb, controlat cu placebo, în grup paralel, a fost conceput pentru a evalua eficacitatea și siguranța unei perfuzii intravenoase de curcumină în combinație cu paclitaxel în comparație cu paclitaxel plus placebo la pacienții cu cancer de sân metastatic și avansat.

Pacienți și metode

Design de studiu

Studiul a fost realizat ca un studiu de fază II, cu o singură instituție, randomizat, controlat cu placebo, dublu-orb, paralel, cu două brațe, conceput pentru a investiga eficacitatea și siguranța curcuminei + paclitaxel (grupul curcuminei) versus paclitaxel + placebo ( grup placebo) terapie în tratamentul pacienților cu cancer de sân metastatic și avansat. Pacienții eligibili au fost randomizați 1: 1 la unul dintre cele două grupuri de studiu. Agenților de tratament li s-a administrat IV o dată pe săptămână timp de 12 săptămâni consecutive. Urmărirea a inclus două evaluări de urmărire la 4 și 12 săptămâni, după finalizarea tratamentului ( Figura 1  și  Tabelul 1 ).

figura 1

Tabelul 1. Programul examinărilor și procedurilor

VizitaAccesați 1 Linie de bază pentru testareVizitați 2 Tratament de bazăVizite 3-12 TratamentVizitează 13 tratamentVizitează 14 urmăririVizitați 15 urmăriri
Săptămâna de studiu012-11121624
Verificare de eligibilitate inițială / Informații / Consimțământ verbal inițialX
Consimțământul de informații semnatX
Tratamentul cu PaclitaxelXXX
Tratamentul cu CUC1 / placebo IVXXX
Eficacitate
Măsuri de rezultat primare
Teste ORR / RECIST: CT, RMN, raze XXXX
Măsuri secundare de rezultat
PFS, TTPXX
Testul chestionarului QOLXXXXXX
Markeri tumorali, CEA și CA 15-3XXX
Starea performanței Karnofsky, KPS%XXXX
Scorul de performanță ECOGXXXX
Siguranță
Evenimente adverseXXXXX
Teste de laboratorXXXX
GreutateXXXXXX
PulsXXXXXX
Tensiune arterialaXXXXXX

Studiul a fost realizat la Centrul Național de Oncologie, Erevan, Armenia, cu aprobarea Comitetului Etic (ERB) al Ministerului Sănătății Republica Armenia (Nr. Înregistrare: Nr 5592-17-02-23, data de aprobarea protocolului final: 2017-02-22) și a Centrului științific de expertiză în domeniul medicamentelor și tehnologiei medicale al Ministerului Sănătății Republica Armenia (data aprobării: 28.12.2017). Identificator ClinicalTrials.gov: NCT03072992  https://clinicaltrials.gov/ct2/show/NCT03072992?term=Curcumin ± în ± Combinație ± Cu ± Chimioterapie ± în ± Avansat ± Sân ± Cancer & rang = 1.

Toți pacienții au oferit consimțământul informat în scris pentru a participa la studiu înainte de includere. Informațiile despre studiu au fost puse la dispoziția participanților la studiu în conformitate cu reglementările armenești în limbile armeană și engleză. Fișa de informații pentru pacienți a detaliat procedurile implicate în studiu, inclusiv obiectivele, metodologia, riscurile potențiale și beneficiile anticipate, iar investigatorul le-a explicat fiecărui pacient. Pacienților li s-a permis apoi să ia în considerare informațiile prezentate înainte de a semna și datarea formularului de consimțământ informat pentru a indica faptul că au înțeles pe deplin informațiile și s-au oferit voluntar să participe la studiu. Pacienții au primit o copie a formularului de consimțământ informat pentru informarea lor, iar copia originală a fost păstrată într-un dosar confidențial cu formularul de raportare a cazului (CRF).

Pacienți

Populația țintă pentru acest studiu a constat în pacienți de sex feminin cu vârsta cuprinsă între 18-75 de ani cu manifestări măsurabile bidimensional de cancer de sân progresiv, local avansat sau metastatic după cel puțin un regim de chimioterapie anterior; pacienți care au progresat în timpul sau în decurs de 12 luni de la finalizarea chimioterapiei adjuvante sau neoadjuvante; sau alte cazuri de cancer mamar în care tratamentul săptămânal cu paclitaxel a fost considerat o abordare adecvată. Pacienții eligibili au avut un scor de performanță Karnofsky (KPS) ≥ 60, scor Eastern Cooperative Oncology Group (ECOG) ≤ 2 și speranță de viață ≥ 3 luni, conform estimărilor clinicianului responsabil, precum și un statut hematologic, renal și hepatic adecvat. Au fost necesare dovezi radiografice ale bolii măsurabile cu 4 săptămâni înainte de randomizare. Fără Herceptin, alte chimioterapii,sau tratamentul cu bifosfonați a fost permis cu 4 săptămâni înainte și în timpul studiului. Pacienții ar putea primi terapie hormonală înainte de tratamentele de studiu și în timpul perioadei de urmărire. Femeile aflate la vârsta fertilă au trebuit să utilizeze metode contraceptive eficiente.

Pacienți cu metastaze necontrolate ale sistemului nervos central, tulburări cardiovasculare severe, infecții active, tulburări psihiatrice sau dependente, alte boli sistemice și / sau alte boli non-maligne sau orice altă afecțiune care, în opinia investigatorului, ar putea împiedica pacientul să participe la studiu cerințe; hipersensibilitate cunoscută la oricare dintre medicamentele sau excipienții studiați; sarcină sau alăptare; sau a doua malignitate primară diagnosticată în ultimii 5 ani, nu au fost eligibile pentru înscriere.

Recrutare și screening

În cursul vizitei inițiale a pacientului la locul studiului, criteriile de includere și excludere au fost verificate în raport cu lista de verificare a eligibilității și persoanele interesate să participe au primit informații relevante despre studiu. În cazul în care indivizii erau potriviți pentru participarea la studiu, s-a făcut o programare pentru screeningul medical. Pacienții au fost inițial evaluați printr-un examen fizic efectuat de un investigator. Au fost organizate teste de laborator și radiologie relevante și consultații de specialitate, dacă este necesar. Când au fost îndeplinite criteriile de includere, pacienții au fost de acord cu studiul și au fost supuși randomizării.

Intervenție și comparator

O soluție injectabilă de 300 mg (lotul 08874-03445-B) de Curcumin® (CUC-01) și placebo au fost ambalate și etichetate de Burg Apotheke Königstein (Taunus, Germania) în conformitate cu cerințele naționale privind utilizarea pentru studiile clinice. Fiecare flacon conținea 20 ml soluție (concentrație de curcumină, 15 mg / ml) conținând în total 300 mg curcumină, care a fost diluată în 250 ml soluție fiziologică (0,9% NaCI) înainte de utilizare (volum total 270 ml soluție perfuzabilă ). Ingredientele active au fost 95% curcuminoide (numite și curcumină), extractul izolat din rizomul de curcuma  Curcuma longa (Zingiberaceae). Ingredientele inactive au fost acidul citric, etanolul și un solubilizator neionic foarte purificat, ulei de ricin polioxil (Kolliphor® ELP), care îndeplinește cerințele actuale ale monografiei Farmacopeei Europene (Ph. Eur.) Monografie pentru macrogolglicerol ricinoleat (Ph. Eur. Curr . Ed.) Și se conformează celei mai recente ediții a monografiei USP / NF pentru uleiul de ricin din polioxil 35, cu excepția vâscozității. Placebo a cuprins o soluție de riboflavină (200 mg în 20 ml; lot # 08874-03445-A) pentru injecție, care nu a fost diferită vizual de curcumina. Aspectul, mirosul și culoarea ambelor preparate au fost similare și nu se distinge organoleptic. Produsele au fost ambalate, orbite și etichetate cu numele medicamentului, codul de tratament aleatoriu și condițiile de depozitare.

Paclitaxel a fost administrat ca soluție injectabilă Neotaxan (300 mg / 50 ml, Hexal AG, lotul # GV2788).

Atât substanța pe bază de plante, cât și preparatul pe bază de plante au fost testate calitativ prin cromatografie lichidă de înaltă performanță (HPLC) (Supliment 1), în conformitate cu specificațiile, utilizând standarde de referință adecvate. Toate metodele analitice au fost validate pentru selectivitate, acuratețe și precizie. Probele de referință au fost păstrate și depozitate la QC Burg Apotheke Königstein.

Toate produsele studiate au fost păstrate într-un loc sigur în condiții adecvate de depozitare. O descriere a condițiilor adecvate de depozitare și expediere a fost specificată pe eticheta produsului de investigație și în broșura investigatorului. Depozitul a fost blocat și accesibil numai personalului autorizat.

CUC-01 a fost administrat IV o dată la 7 zile timp de 12 săptămâni. Programul săptămânal de terapie a fost: •

Perfuzie preîncărcată conținând 8 mg dexametazonă în 100 ml NaCl; •

Curcumina (300 mg) sau placebo dizolvată în 250 ml NaCI; •

Paclitaxel (80 mg / m 2 de  suprafață corporală) în 250 ml de NaCI.

Injecțiile au fost administrate în timpul zilei după micul dejun. Infuzia preîncărcată care conține dexametazonă a fost urmată de perfuzie CUC-01 / placebo, apoi perfuzie de paclitaxel. Anchetatorul a fost responsabil pentru menținerea evidențelor de răspundere a medicamentelor pentru produsele studiate. Responsabilitatea medicamentului pentru acest studiu a fost efectuată în conformitate cu procedurile standard.

Alocare, proceduri de studiu și urmărire

Randomizare și orbire

Medicamentele de studiu (pachete de  injecții placebo și  verum ) au fost etichetate de un farmacist calificat (QP) la locul de fabricație utilizând generatorul de numere aleatorii din Microsoft Excel. Tabelul conținea informațiile de codificare pentru placebo și curcumină în două coloane (A și respectiv B) umplute cu numere unice distribuite aleatoriu (codul de tratament nr.) De la 1 la 150.

Disimularea alocării

Secvențele aleatorii ale tratamentului au fost efectuate de către QP la locul de fabricație al produsului de investigație (la sponsor) până la finalizarea studiului. Acesta a fost furnizat investigatorului principal înainte de evaluarea statistică a rezultatelor, când toți pacienții au terminat tratamentul.

Implementare și orbire

La prima vizită, fiecare participant a primit un număr consecutiv începând de la 001 la 150. Participanții au fost înscriși secvențial de către anchetatorul principal și cinci oncologi medicali. Fiecare pacient a primit, de asemenea, un cod de tratament aleatoriu și a primit injecțiile în pachetul corespunzător. Secvența de alocare a pacientului (lista de participanți) care identifică pacienții și pachetele de suplimente de studiu a fost generată și menținută de cercetătorul principal, care a completat numele pacientului în CRF și pe eticheta pachetului.

Orbirea pentru subiecții din studiu a fost efectuată prin utilizarea ambalajelor etichetate care conțin flacoane cu soluții de injecție de aspect identic. Medicamentul de studiu a fost livrat clinicii pre-etichetat și codificat în conformitate cu lista de randomizare. Codul de randomizare a fost ținut secret de clinică și de anchetatorii participanți și a fost dezvăluit numai după încheierea studiului. În acest fel, anchetatorii au fost, de asemenea, orbi de medicamentele de studiu și de controlul placebo, asigurând un design dublu-orb. Informațiile legate de alocarea participanților au fost, de asemenea, păstrate în plicuri numerotate și sigilate secvențial, care au fost stocate de directorul general al organizației de cercetare contractuală.Codurile de tratament individuale care indică randomizarea tratamentului pentru fiecare participant randomizat au fost disponibile investigatorului și sponsorului într-un astfel de format încât să poată dezorbi persoanele sau întregul grup dacă ar fi necesar. Cu toate acestea, nu au existat cazuri în care acest lucru s-a produs.

Evaluarea conformității

Toate tratamentele de studiu au fost administrate de către investigatorul studiului sau de către un membru desemnat al personalului. Pentru a asigura răspunderea de droguri, anchetatorul (sau adjunctul desemnat) a ținut evidențe exacte cu privire la datele și cantitățile de droguri primite, către care a fost distribuit, și conturile oricăror bunuri care au fost distruse accidental sau în mod deliberat pe un formular de răspundere pentru droguri.

Conformitatea tratamentului a fost asigurată prin monitorizarea înregistrărilor și a fost analizată de grupul de tratament și intervalul de timp. Anchetatorii studiului au verificat conformitatea generală cu protocolul de studiu la fiecare vizită, iar restul injecțiilor neutilizate au fost numărate la sfârșitul studiului. Toate consumabilele clinice nefolosite și formularele de răspundere a medicamentelor au fost înregistrate și distruse la sfârșitul studiului (probele de referință ale lotului utilizat în acest studiu au fost păstrate în arhiva stocării sponsorului (BRIU GmbH) în Germania).

Terapia anterioară și concomitentă

Chimioterapia anterioară sau tratamentul cu bifosfonați și trastuzumab au fost permise cu 4 săptămâni înainte de atribuirea aleatorie a curcuminei. Participanții la tratament hormonal au oprit administrarea inhibitorului de antiestrogen / aromatază cu 3 zile înainte de începerea tratamentelor experimentale și au reluat după finalizarea tratamentului, în perioada de urmărire. Fișa tehnică rezumativă arată care pacienți au avut aceste tratamente cu o lună înainte de tratamentul cu curcumină și paclitaxel (Suplimentul 2).

Tratamentul săptămânal cu paclitaxel a fost obligatoriu conform protocolului de studiu. Dexametazona a fost administrată înainte de începerea tratamentului cu paclitaxel pentru a atenua unele dintre efectele secundare.

În plus față de tratamentul protocolar, au fost furnizate îngrijiri paliative și de susținere în timpul studiului, după cum s-a indicat clinic și în conformitate cu practicile standard ale locului de studiu. Toate medicamentele concomitente la începutul studiului și în timpul tratamentului au fost înregistrate în CRF. De asemenea, s-au observat orice adăugiri, ștergeri sau modificări ale dozei de medicamente.

Eficacitate și rezultate de siguranță

Rezultatul principal al studiului a fost rata de răspuns obiectivă (ORR) ( Clinical Trial Endpoints for the Approval of Cancer Drugs and Biologics. Guidance for Industry, 2007 ), după cum a fost evaluat de Criteriile de evaluare a răspunsului în tumorile solide (RECIST, versiunea 1.1) ( Eisenhauera și colab., 2009) 4 și 12 săptămâni după ultimul tratament de studiu. Cel mai bun răspuns general al unui pacient individual a fost cel mai bun răspuns înregistrat de la începutul tratamentului până la PD sau la sfârșitul studiului, oricare dintre acestea a fost primul. ORR a inclus pacienți cu răspuns complet (CR) sau răspuns parțial (PR). Leziunile țintă au fost identificate și măsurate folosind scanări tomografice computerizate. Examenul clinic, radiografiile simple, ultrasunetele și datele RMN au fost utilizate pentru a evalua bolile care nu sunt ținte și care nu pot fi măsurate.

Rezultatele secundare de eficacitate au inclus supraviețuirea fără progresie (PFS) evaluată de la înscrierea în studiu până la progresia tumorii conform criteriilor RECIST sau deces din orice cauză și timpul până la progresia tumorii (TTP) evaluat de la înscrierea studiului până la progresia tumorii.

Siguranța și tolerabilitatea au fost evaluate prin monitorizarea frecvenței, duratei și severității evenimentelor adverse prin Criteriile comune de toxicitate pentru evenimente adverse (CTCAE) versiunea 4.0, evaluarea retragerii / timpul până la eșecul tratamentului (TTF) și măsurarea semnelor vitale, parametrii hematologici și biochimici ai sângelui și efectuarea examinărilor fizice.

Alte evaluări au inclus starea de performanță Karnofsky, starea de performanță ECOG și calitatea vieții raportate de pacient (QOL). Chestionarul privind calitatea vieții (QLQ) al Organizației Europene pentru Cercetarea și Tratamentul Cancerului (EORTC) și chestionarul de autoevaluare al pacientului (QLQ-C30 versiunea 1.0) au fost utilizate ca instrumente simple pentru evaluarea QOL general și a stării fizice (PC) a pacienți. Testele antigenului carcinoembrionar (CEA) și antigenului cancerului 15-3 (Ca 15-3) au fost, de asemenea, evaluate la momentul inițial și la urmărire.

Considerații privind dimensiunea eșantionului

Mărimea eșantionului acestui studiu a fost determinată pe baza presupunerii că SFP mediană pentru pacienții cărora li se administrează paclitaxel ca tratament de primă linie este de 5,6 luni ( Gradishar și colab., 2013 ). Deoarece pacienții din tratamentele de linia a doua și a treia au fost incluși în studiu, s-a presupus o SFP de 4 luni pentru brațul de control (paclitaxel cu un singur agent). O îmbunătățire de 50% la o SFP mediană de 6 luni în brațul testat (combinație paclitaxel-curcumină) a fost considerată semnificativă clinic. Un total de 110 evenimente au fost necesare pentru a detecta o diferență în PFS median de 16  vs.. 24 de săptămâni (test unilateral, α = 0,1, 80% putere). Presupunând o perioadă de recrutare de 1 lună și o perioadă de urmărire de 3 luni, a fost necesară o dimensiune totală a eșantionului de 122 de pacienți. Pentru a ține cont de o rată de abandon de ~ 20%, un total de 150 de pacienți a fost planificat să fie randomizat.

analize statistice

Datele clinice la fiecare vizită au fost înregistrate folosind un formular standardizat de evaluare a clinicianului (Suplimentul 3). Datele editate și corectate au fost adăugate la o bază de date Excel care a fost utilizată ca intrare pentru software-ul statistic Prism (versiunea 3.03 pentru Windows; GraphPad, San Diego, CA, SUA). Analiza statistică a implicat evaluarea schimbării scorurilor pacientului de la vizita inițială (linia de bază) la vizita intermediară și vizita finală și la fiecare vizită programată în timpul studiului. Analiza a fost efectuată folosind datele „Observate”. Subiecții care au finalizat studiul au fost evaluați și analizați conform protocolului.

Populația primară a fost populația cu intenție de tratament (ITT), care a fost definită ca toți pacienții repartizați aleatoriu care au primit cel puțin o doză de medicamente de studiu. Analiza statistică a fost efectuată pe o bază ITT pentru rezultatele la momentul evenimentului.

Analiza eficacității s-a bazat pe evaluarea de către investigator a răspunsului / progresiei conform RECIST v1.1. ( Tabelul 2 ).

Tabelul 2. Criteriile de evaluare a răspunsului în tumorile solide  ( RECIST) criteriile și scorurile de evaluare

AbreviereRezultatul tratamentuluiCriteriu de evaluareScor
PDBoala progresivăCel puțin o creștere de 20% a sumei diametrelor leziunilor țintă, luând ca referință cea mai mică sumă din studiu (aceasta include suma de bază dacă aceasta este cea mai mică din studiu). Pe lângă creșterea relativă de 20%, suma trebuie să demonstreze și o creștere absolută de cel puțin 5 mm. Apariția uneia sau mai multor leziuni noi este, de asemenea, considerată progresie. Creșterea neechivocă a bolii nemăsurabile confirmată prin imagistica radiologică este, de asemenea, considerată progresie.-1
relatii cu publiculRăspuns parțialCel puțin o scădere cu 30% a sumei diametrelor leziunilor țintă, luând ca referință diametrul sumelor inițiale; confirmat la 4 săptămâni1
CRRăspuns completDispariția tuturor leziunilor țintă. Orice ganglioni limfatici patologici (fie țintă, fie ne-țintă) trebuie să aibă o reducere pe axa scurtă la <10 mm; confirmat la 4 săptămâni2
SDBoala stabilăNici o contracție suficientă pentru a se califica pentru PR, nici o creștere suficientă pentru a se califica pentru PD, luând ca referință cele mai mici diametre ale sumei în timpul studiului.0

Punctul final principal, ORR, a fost definit ca CR sau PR confirmat la 4 săptămâni de la primul răspuns. Punctul final secundar, TTP, a fost definit ca timpul de la atribuirea aleatorie până la progresia bolii rezultată din cancerul de sân. TTP median a fost calculat din curbe de incidență cumulative pentru a explica metodologia riscurilor concurente, în care decesele cauzate de cancerul de sân au fost considerate riscurile concurente. SFP a fost definit ca timpul de la atribuirea aleatorie până la progresia bolii sau moartea. Curbele Kaplan-Meier au fost generate pentru toate punctele finale, iar medianele au fost calculate din acele curbe.

Bratele de tratament au fost comparate prin teste log-rank. Au fost calculate estimările raporturilor de pericol de tratament (HR) pe baza testelor log-rank și 95% IC.

Incidența evenimentelor adverse a fost comparată în toate grupurile de tratament în scopuri descriptive și pentru a identifica diferențele posibile în profilurile de siguranță folosind două metode pentru date categorice.

Caracteristicile de bază au fost calculate folosind instrumente pentru evaluarea statisticilor coloanei și a distribuției normale a variabilelor. Testul ordinului de rang non-parametric Mann-Whitney sau măsurătorile parametrice independente  t-testul pentru două grupuri independente a fost folosit pentru a compara cele două grupuri. Pentru a analiza modificările în cadrul grupurilor de tratament pe parcursul studiului, am folosit testul Friedman pentru măsuri repetate, utilizând trei condiții repetate (date neparametrice în aceeași dimensiune a eșantionului); testul de ordine de rang ANOVA non-parametric uniparametic Kruskal-Wallis cu testul de comparație multiplă Dunn post hoc; Test Friedman pentru mai multe măsuri repetate (date non-parametrice la toți pacienții cu ITT); sau testul non-parametric Wilcoxon pentru măsuri repetate, două condiții. Eficacitatea medicației de studiu a fost realizată prin analize de varianță între două direcții (ANOVA), în care un efect de interacțiune indică un răspuns diferit în timp între cele două grupuri și, prin urmare, ar semnala un efect de tratament; statisticile raportului de probabilități (OR) ale punctelor finale conform Altman;Testul A / B al semnificației diferențelor punctelor finale la încredere de 95%; modificări medii de la momentul inițial la punctul final (diferențe înainte și după tratamentul fiecărui pacient) utilizând testul de ordine de rang non-parametric Mann-Whitney pentru compararea a două grupuri independente.

Analiza statistică a fost efectuată pe o bază ITT la pacienții incluși în studiu și la cei 65 și 62 de pacienți din grupurile cu curcumină și, respectiv, placebo, care au finalizat tratamentul. În plus, în cadrul grupului, măsurile repetate de analiză a variabilelor la pacienții care au finalizat toate testele au fost efectuate folosind testul Friedman non-parametric rank.

Rezultate

Dispunerea pacientului

Recrutarea pentru studiu a fost inițiată pe 17 martie 2017, iar ultima persoană a fost recrutată pe 7 iunie 2018. Un total de 238 de paciente de sex feminin au fost evaluate pentru eligibilitate; 150 (63%) pacienți cu cancer mamar recurent, local avansat sau metastatic au îndeplinit criteriile de includere și au fost randomizați 1: 1 în două grupuri de tratament: placebo (n == 75) și curcumină (n == 75). Dintre participanții înscriși, 17 (11,3%) au fost retrași în timpul fazei de tratament a studiului la cererea pacientului (n == 4, 2,7%) sau din cauza evenimentelor adverse (n == 5, 3,3%) sau a bolii progresive (n == 8, 5,3%).

Un total de 133 de pacienți (88,7%) și-au finalizat ciclurile de tratament respective conform protocolului; 127 au fost evaluați pentru eficacitatea tratamentului la 4 săptămâni după finalizarea tratamentului și cuprindeau subsetul principal de eficacitate. Șase pacienți au fost pierduți pentru urmărire în timpul perioadei de studiu. A doua (ultima) vizită de urmărire a fost finalizată de 93 de pacienți (62%), iar 34 de pacienți (22,7%) au fost retrași din cauza progresiei înregistrate a bolii la prima vizită de urmărire (n == 19), deces (n == 2) sau eșecul de a reveni (n == 13) ( Tabelul 3 ).

Dispoziția pacienților și distribuția între grupurile de studiu sunt prezentate în  Figura 2  și  Tabelul 3 .

Figura 2

Tabelul 3. Dispoziția pacienților

Grupa A (n == 75)Grupa B (n == 75)Total (N == 150)
Înscris7575150
A primit cel puțin o injecție7575150
Tratamente de studiu finalizate68 (90,7%)65 (86,7%)133 (88,7%)
Finalizată prima vizită FU65 (86,7%)62 (82,7%)127 (84,7%)
Am finalizat ambele vizite FU46 (61,3%)47 (62,7%)93 (62,0%)
Întrerupt în timpul tratamentului și urmăririi:29 (38,7%)28 (37,3%)57 (38,0%)
• N-a reusit sa tina pasul8 (10,7%)11 (14,7%)19 (12,7%)
• Progresie17 (22,7%)10 (13,3%)27 (18,0%)
• Cererea pacientului2 (2,7%)2 (2,7%)4 (2,7%)
• Eveniment advers2 (2,7%)3 (4,0%)5 (3,3%)
• Moartea0 (0%)2 (2,7%)2 (1,3%)

Caracteristicile de bază

Tabelul 4 ,  Tabelul 5 ,  Tabelul 6  prezintă datele demografice de bază și caracteristicile clinice ale pacienților studiați. Vârsta medie a participanților era de 57,0 ani (interval: 28-75 de ani) la momentul înscrierii. La momentul randomizării, toate caracteristicile pacienților erau bine echilibrate între grupuri.

Tabelul 4. Date demografice de bază și caracteristici clinice

CaracteristicăToți pacienții (N == 150)Grupa B (N == 75)Grupa A (N == 75)Diff. *
NRata de conversie, %NRata de conversie, %NRata de conversie, % valoarea p
Stadiul bolii la acumulareIII (avansat local)1610.7810.7810.70,5
IV (metastatic)13489.36789.36789.30,5
Subtip histologicIDC8556.74762.73850,70,068
ILC4228.02026.72229.30,64
Amestecat2315.3810.71520.00,94
Mucinoase00,000,000,00,5
Necunoscut00,000,000,00,5
Grad histologicGradul I32.011.322.70,72
Gradul II7650,74154.73546.70,163
Gradul III3120.71621.31520.00,420
Necunoscut4026.71722.72330.70,867
Subtipul molecularHR + / HER2-8556.74357.34256.00,435
HR- / HER2 +2114.01013.31114.70,593
HR + / HER2 +1711.379.31013.30,781
Triplu negativ74.756.722.70,122
Necunoscut2013.31013.31013.30,5
Metastaze la distanțăNici unul1510.0810.779.30,393
Doar oasele96.045.356.70,635
Plămân2214.71216.01013.30,322
Ficat2013.3912.01114.70,685
Alte1510.01013.356.70,085
Organe multiple6946.03242.73749.30,794
Chimioterapia anterioarăNu138.768.079.30,614
Pe bază de antraciclină5033.32736.02330.70,694
Pe bază de taxani106.756.756.70,5
Ambii6241.32938.73344,00,747
Alte1510.0810.779.30,393
Hormonoterapia anterioarăNu7046.73749.33344,00,256
da8053.33850,74256.00,744
TrastuzumabNu14898,77498,77498,70,5
da21.311.311.30,5
BifosfonațiNu10670.75472.05269.30,36
da4429.32128.02330.70,64
Boli concomitenteNu13590,06890,76789.30,393
da1510.079.3810.70,607
KPS la acumulare≥ 8010167.35472.04762.70,11
<804932.72128.02837.30,89
ECOG la acumulare074.745.334.00,349
111677.36080.05674.70,217
22718.01114.71621.30,857
Vârstă<40117.334.0810.70,943
40 – 598254.73749.34560.00,906
≥ 605738.03546.72229.30,013
Median57,0059,0056,00
Rău55,8857,5954,170,1
SD9.649,739.29
ÎnălţimeMedian157,50157,00158,00
Rău157,93157,81158.050,5
SD6,506.086,93
GreutateMedian74,0023.1474,00
Rău76.0675,7376,390,8
SD16.1115,8216.48
IMC (kg / m ^ 2)Median29,3529,7829.24
Rău30,4830.4130,550,9
SD6.146.156.16

Semnificația statistică a diferenței dintre grupuri, încredere 95%

Tabelul 5. Alte valori de bază pentru măsurători clinice critice efectuate în timpul studiului sau identificate ca indicatori importanți de prognostic sau răspuns la terapie

Grupa A Placebo n == 75SDGrupa B Curcumină n == 75SD valoarea p
Scorul general al stării fizice4.121,034.321,040,36
Scorul general al calității vieții4.251,094.481.160,26
Marker tumoral, CEA, ng / ml27,5890,858,7515.610,94
Marker tumoral, CA15-3, U / ml158.7526.292.03253,50,58

Tabelul 6. Valorile de bază pentru măsurători critice hematologice și biochimice de laborator efectuate în timpul studiului sau identificate ca indicatori importanți de prognostic sau răspuns la terapie

ParametriiUnitateGrupa A PlaceboGrupa B Curcumina valoarea p
SÂNGERăuSDRăuSD
WBC10 ^ 3u / l6.2071,8296.2191,7750,9451
RBC10 ^ 6u / l4.7540,55174.7010,61460,0791
Hbg / l131,913,76131,713.260,8678
HCT%42,483,97347.342.030,5204
MCVfl88,8558,67989,7764.8130,8558
MCHpag27,8591,74527,8211.6270,878
PLT10 ^ 3u / l270.279.12272.11110,16
NEUTROFILI10 ^ 3u / l1.8190,56416,60824,720,5851
LIMFOCITE10 ^ 3u / l1.8190,56411,8010,78250,9418
MONOCITE10 ^ 3u / l0,49950,18830,490,19240,7817
EOSINOFILE10 ^ 3u / l0,10680,10690,14320,17260,5494
BASOFIL10 ^ 3u / l0,0250,0230,0260,020,1562
RETICULOCITE0,2150,0350,2200,0300,8778
ESRmm / h23,618,6627,1813.070,804
GLUCOZĂmmol / l5.3591.2945,720,90,8808
UREEmmol / l5.3791.6456.3233.1820,0823
CREATININAumol / l77,820,9575,5614.150,9568
PROTEINA TOTALĂg / l78,283,66578,322,5830,8195
BILIRUBINAumol / l8.282.5367.5312.1090,8364
ALK PHOSu / l93,8546.21101.2104,80,3365
ALTu / l27,4123.4120,8511.360,7461
ASTu / l27,4123.4120,8511.360,4414
GGTu / l31.3618,8924,2813,640,3144
LDHu / l48,5454.0430.2319,780,4514
CALCIUmmol / l2.1550,26122.1690,33670,2253
PROTROMBINA%270,613622773,930,2527
FIBRINOGENmg%461.2119.9435.194.030,2086
URINĂ
SG1000-1020100763,9810155.2660,6688
PROTEINEnici unul0,037540,020340,033540,010,0721
RBCnormă (1-2)2.3652.7192.241.6480,7159
LEUCOCITEnormă (1-2)3,9714.5584.4114.8580,3765
EPITELIUnorma (1-3)3.132.9012.9242.6110,88718

Grupurile nu au prezentat diferențe în greutate, indicele de masă corporală, stadiul bolii, boli concomitente sau terapii anterioare, cu excepția hormonoterapiei. Un procent ușor mai mare de pacienți din grupul placebo (56%) au utilizat hormoni înainte de tratament în comparație cu grupul cu curcumină (49%;  Tabelul 4 ). De asemenea, un procent mai mare de pacienți din grupul cu curcumină au avut vârsta ≥ 60 în comparație cu cel din grupul placebo (46,7%  față de 29,3%). Cu toate acestea, nu am găsit diferențe semnificative în valorile inițiale pentru măsurători hematologice și biochimice critice de laborator efectuate în timpul studiului sau identificate ca indicatori importanți de prognostic sau răspuns terapeutic.

Eficacitate

Rezultatul primar

Cu ITT, ORR pentru toți (N == 150) pacienți a fost de 42% (IC 95%: 34,0 – 50,0,  Tabelul 7 ). Nu au existat cazuri de CR și PR a fost înregistrat la toți cei 63 de respondenți. Boala stabilă a fost înregistrată la 44 de pacienți (29,3%), iar evaluările au evidențiat o boală progresivă la 19 pacienți (12,7%).

Tabelul 7. Rezumatul analizei comparative a ratei de răspuns obiective (ORR) la vizita 14 (16 săptămâni de urmărire de la randomizare și începutul tratamentului)

Populația de paciențiToți pacienții N (100%)Grupa A (placebo) n (100%)Grupa B (curcumină) n (100%)Semnificația statistică a diferenței dintre grupuri
Numărul de pacienți alocați aleatoriu în grupele A și B1507575
Numărul de pacienți care au finalizat tratamentele și au fost disponibili pentru analiză1276562
Rata de răspuns obiectivă
ORR (CR + PR) – analiza ITT63 (42,0%)25 (33,3%)38 (50,7%)p  = 0,0145  z  = 2,18
ORR (CR + PR) – analiză la pacienții care au finalizat tratamentele63 (49,6%)25 (38,5%)38 (61,3%)p  = 0,0041  z  = 2,64
ORR, raportul cote Grup B / Grup A (PR + CR / SD + PD)2,643 IC 95% de la 1,287-5,429p  = 0,0081  z  = 2,643
Răspunsul tumorii
Răspuns complet – CR000
Răspuns parțial – PR63 (42,0%)25 (33,3%)38 (50,7%)p  = 0,0145
Boala stabilă – SD44 (29,3%)26 (34,7%)18 (24,0%)p  = 0,9257
Boala progresivă – PD19 (12,7%)14 (18,7%)5 (6,7%)p  = 0,9877
Nu poate fi evaluat24 (16,0%)10 (13,3%)14 (18,7%)p  = 0,1885
Motivul evaluărilor neevaluabile
Progresia clinică în timpul tratamentului8 (5,3%)3 (4,0%)5 (6,7%)
Retragerea la cererea pacientului4 (2,7%)2 (2,7%)2 (2,7%)
Retragerea pentru evenimente adverse5 (3,3%)2 (2,7)3 (4,0%)
Pierdut la urmărire înainte de prima evaluare de urmărire6 (4,0%)3 (4,0%)3 (4,0%)
Date radiologice insuficiente pentru evaluarea ORR1 (0,7%)0 (0%)1 (1,3%)

ORR a fost semnificativ mai mare în grupul cu curcumină decât grupul placebo ( Tabelul 7 ). OR (2,6) a fost semnificativ ( p  = 0,0081) mai mare decât 1, sugerând că curcumina + paclitaxel a fost mai eficientă decât paclitaxel + placebo în ceea ce privește ORR. Diferența a fost, de asemenea, semnificativă în subgrupul de pacienți care au finalizat toate tratamentele de studiu planificate și au fost evaluați la prima vizită de urmărire (61,30%  față de  38,50%).

ORR a fost încă mai mare în grupul cu curcumină decât grupul placebo la 3 luni după finalizarea tratamentului, sugerând că efectul superior al curcuminei este menținut la 3 luni după terminarea tratamentului ( Tabelul 8 ). OR pentru PR + CR / SD + PD la 12 săptămâni a fost de 2,1185 ( p  = 0,0726).

Tabelul 8. Rezumatul analizei comparative a ratei de răspuns obiective (ORR)

Grupa A PlaceboGrupa B CurcuminaSemnificația statistică a diferenței dintre grupuriGrupa A PlaceboGrupa B CurcuminaSemnificația statistică a diferenței dintre grupuri
Vizitați Nr / Timevizită 14/16 săptămânivizită 15/24 săptămâni
Numărul de pacienți repartizați aleatoriu în grupele A și B a75757575
Numărul de pacienți care au finalizat tratamentele și au fost disponibili pentru analiză b65625449
CR- Răspuns complet0001
PR- Răspuns parțial, scădere> 30%25381521
Numărul de pacienți cu PR + CR2538p  = 0,0145 a1522p  = 0,0911 a
SD – Boală stabilă26181512
Pacienți fără progresie5156p  = 0,18 a3034p  = 0,254 a
p  = 0,03 bp  = 0,0714 b
PD – Boală progresivă, creștere> 20%1452415
Numărul de pacienți cu PD + SD4023p  = 0,00193927p  = 0,0228
ORR, raportul cote Grup B / Grup A (PR + CR / SD + PD)2.643p  = 0,00812.118p  = 0,0726
IC 95% de la 1.287-5.429z  = 2,643IC 95% de la 0,934 la 4,807z == 1.796
RRO (CR + PR) – ITT analiză a33,30%50,70%p  = 0,0145 a20%29%p  = 0,0911 a
z  = 2,18
ORR (CR + PR) – analiza la pacienți a finalizat tratamentele b38,50%61,30%p  = 0,0041 b27,80%44,9%p  = 0,0337 b
z  = 2,64

Această concluzie este susținută de rezultatele analizei scorului RECIST auxiliar ( Figura 3 ). Scorul RECIST a fost semnificativ diferit ( p  = 0,0085) după 4 săptămâni de urmărire comparativ cu valoarea inițială în ambele grupuri de tratament.

Figura 3

Scorul RECIST în grupul cu curcumină după 3 luni de urmărire a fost semnificativ mai mare ( p  = 0,076) decât valoarea inițială, în timp ce în grupul placebo a fost semnificativ mai mic decât valoarea inițială, în ciuda unei diferențe nesemnificative între grupuri în acest moment. Valoarea RECIST a fost negativă în grupul placebo și pozitivă în grupul cu curcumină ( Figura 3 ).

O diferență semnificativă a fost observată în cohorta HR + / HER2- (tip luminal, Her2-negativ) a pacienților. În această cohortă, ORR a fost mai mare în grupul cu curcumină decât grupul placebo după 12 săptămâni de tratament și la 4 săptămâni și 3 luni de urmărire ( Tabelul 9  și  Figura 4 ).

Tabelul 9. Rezumatul ratei de răspuns obiectiv (ORR) la pacienții cu Her2 negativ de tip Luminal

Grupa A PlaceboGrupa B CurcuminaSemnificație statistică *Grupa A PlaceboGrupa B CurcuminaSemnificație statistică *
Vizitați Nr / Timevizită 14/16 săptămânivizită 15/24 săptămâni
Numărul total de pacienți cu HR + / HER2- în cohorte din grupele A și B37433743
CR- Răspuns complet0001
PR- Răspuns parțial, scădere> 30%1024613
Numărul de pacienți cu PR + CR1024p  = 0,0031614p  = 0,0406
SD – Boală stabilă2111127
PD – Boală progresivă, creștere> 20%60168
Numărul de pacienți cu PD + SD2711p  = 02815p  = 0
ORR, raportul cote Grup B / Grup A (PR + CR / SD + PD)SAU = 5,89p  = 0,0006SAU = 4,36p  = 0,0117
CI: 2.129 până la 16.299CI: 1,3879 până la 13,6688
ORR (PR + CR),%27%56%16%32%
Figura 4

Scorul ECOG nu a relevat nicio diferență semnificativă între grupurile de studiu pentru pacienții care au avut un scor ECOG de 0-1 la momentul inițial, în timp ce pacienții care au avut un scor ECOG de 2 la momentul inițial au avut un ORR mai mare cu curcumină (n == 8 pacienți, 72,3% ) decât placebo (n == 1 pacient, 6,3%;  p  <0,001), dar numărul observațiilor din subgrupuri a fost mic (11 și respectiv 16,  Tabelul 10 ).

Tabelul 10. Analiza ratei de răspuns obiective (ORR) după scorul de bază al Grupului de Oncologie Cooperativă din Est (ECOG)

Scorul ECOGgrupTotal
AB
0ORRSD + PD + retrasNumaraaa4
% în cadrul grupului66,7%50,0%57,1%
PR + CRNumaraaa3
% în cadrul grupului33,3%50,0%42,9%
TotalNumara347
% în cadrul grupului100,0%100,0%100,0%
1ORR_ grupateSD + PD + retrasNumara33 a32 a65
% în cadrul grupului58,9%53,3%56,0%
PR + CRNumara23 a28 a51
% în cadrul grupului41,1%46,7%44,0%
TotalNumara5660116
% în cadrul grupului100,0%100,0%100,0%
2 *ORR_ grupateSD + PD + retrasNumara15 ab18
% în cadrul grupului93,8%27,3%66,7%
PR + CRNumaraab9
% în cadrul grupului6,3%72,7%33,3%
TotalNumara161127
% în cadrul grupului100,0%100,0%100,0%
TotalORR_ grupateSD + PD + retrasNumara50 a37 b87
% în cadrul grupului66,7%49,3%58,0%
PR + CRNumara25 a38 b63
% în cadrul grupului33,3%50,7%42,0%
TotalNumara7575150
% în cadrul grupului100,0%100,0%100,0%

* Semnificație statistică,  p  <0,001

Diferența ORR între grupurile de curcumină și placebo nu a fost semnificativă, având în vedere alte caracteristici clinice de pre-tratament sau tratamente anterioare, care poate fi explicată prin dimensiunea studiului și numărul mic de pacienți din subgrupuri.

Rezultate secundare

La sfârșitul perioadei de studiu (24 de săptămâni), 90 de pacienți (60%) au fost cenzurați pentru SFP. Șaizeci de pacienți (40%) au avut un eveniment pentru calcularea SFP. PFS median estimat prin metoda Kaplan-Meier pentru toți pacienții (N == 150) a fost de 25,6 săptămâni (IC 95%: 23,0 – 28,2 săptămâni). PFS median în grupul cu curcumină (27,0 săptămâni) a fost cu 2,4 săptămâni mai lung decât în ​​grupul placebo (24,6 săptămâni), dar această diferență a fost nesemnificativă ( p  = 0,3495, raportul de risc: 1,278;  Figura 5 ).

Figura 5

TTP median în grupul cu curcumină (27,0 săptămâni) a fost ușor mai lung decât în ​​grupul placebo (24,6 săptămâni), dar diferența nu a fost semnificativă ( p  = 0,3026, raport de pericol: 1,319;  Figura 6 ).

Figura 6

Nu s-a observat nicio diferență semnificativă între grupuri în ceea ce privește scorurile QOL raportate de pacienți. Cu toate acestea, s-a observat o îmbunătățire semnificativă a scorurilor PC, sugerând că PC-ul general al pacienților care au primit curcumină a fost mai bun decât cel al pacienților cărora li s-a administrat placebo ( Figura 7a și b).

Figura 7

Rezultatele analizei stării ECOG medii și scorurilor KP pentru pacienții aflați în acumulare, finalizarea tratamentului și vizite de urmărire sunt prezentate în  Figura 8 a și respectiv b. Un efect de interacțiune semnificativ între timp și tratament ( p  = 0,046) a fost observat numai pentru scorul KP, sugerând că tratamentul cu curcumină a beneficiat mai mult decât placebo ( Figura 8 b).

Figura 8

Nu am găsit nicio diferență semnificativă între grupurile la momentul inițial la toți pacienții (analiza ITT) sau subseturile de pacienți care au trecut toate cele trei teste la vizitele 1, 13 și 15 ( Tabelul 5  și  Figura 9 )

Figura 9

Evaluarea siguranței

Gradul de expunere

Un rezumat al gradului de expunere în grupurile de studiu este prezentat în  Tabelul 1  din Suplimentul 5. Analiza nu a relevat nicio diferență semnificativă în ceea ce privește finalizarea tratamentului între grupuri ( Tabelul 2  din Suplimentul 5). Durata medie a tratamentului în cohorta de studiu a fost de 10,32 săptămâni (mediană: 11 săptămâni). Nu am găsit nicio diferență semnificativă între grupuri în ceea ce privește durata tratamentului ( Tabelul 3  din Suplimentul 5).

Nu s-a observat nicio diferență semnificativă în timp până la eșecul tratamentului ( Figura 10 ), indicând faptul că grupurile de studiu au fost comparabile pe întreaga perioadă de studiu, ceea ce este important pentru evaluarea cu succes a eficacității și siguranței.

Figura 10

Doza mediană cumulativă de paclitaxel pe mp BSA a fost de 960 mg / m 2  (medie 899.2 mg / m 2 ; 95% CI: 857.9-949.0 mg / m 2 ), și nici o reducere a dozei a fost înregistrată în timpul studiului ( Tabelul 4  a suplimentului 5). Toate injecțiile finalizate au administrat dozele complete planificate de paclitaxel și curcumină sau placebo. Diferența dintre dozele cumulative in placebo (903.5 mg / m 2 ) și curcumin grup (894.5 mg / m 2 ) a fost nesemnificativă ( p  > 0,05). Doza mediană cumulativă de curcumină a fost de 3600 mg (medie: 3356 mg; IC 95%: 2145 – 2373 mg).

Din 150 de pacienți înscriși, doar 5 (3,3%, 2 placebo și 3 curcumină) au avut întârzieri în tratamentele planificate ≥ 7 zile, inclusiv un singur pacient (placebo) care a avut două întârzieri, fiecare cu 7 zile ( Tabelul 5  din Suplimentul 5) . Motivul întârzierilor tratamentului a fost trombocitopenia (n == 3), papura pielii (n == 1), infecția respiratorie acută / pneumonia (n == 1) și solicitarea pacientului (n == 1).

Cele mai frecvent utilizate medicamente concomitente au fost în concordanță cu cele care se așteaptă să trateze evenimentele adverse rezultate din tratamentul studiat și simptomele bolii de bază, inclusiv antiemetice și antinauseante, analgezice, antiacide și blocante H2 și corticosteroizi (Supliment 2). Nu au existat cazuri de utilizare a medicamentelor specificate de criteriile de excludere.

Evenimente adverse

Datele privind evenimentele adverse emergente ale tratamentului (TEAE) au fost colectate pentru toți pacienții de la prima doză și până la perioada de urmărire de 4 săptămâni, indiferent de cauzalitate. Un rezumat general al TEAE observat în acest studiu este prezentat în  Tabelul 11 . Un TEAE a fost definit ca un eveniment cu data și ora de debut la sau după prima doză.

Tabelul 11. Rezumatul general al evenimentelor adverse apărute în tratament

Grupa B (curcumina)Grupa A (placebo)Total
Pacienți cu orice grad AE39 (54%)42 (56%)81 (54%)
Pacienți cu EA de grad 3-43 (4,0%)2 (2,7%)5 (3,3%)
Numărul total de AE63 (48,8%)66 (51,2%)129 (100%)
Numărul de clase 3-4 AE7 (11,1%)3 (4,5%)10 (7,7%)
Numărul de pacienți cu alte EA grave0 (0%)0 (0%)0 (0%)
Numărul de pacienți retrași pentru AE3 (4,0%)2 (2,7%)5 (3,3%)
Total cazuri de deces2 (2,7%)
0 (0%)2 (2,7%)
Cazuri de deces datorate AE0 (0%)0 (0%)0 (0%)

Un total de 81 de pacienți (54,0%) înscriși în acest studiu au raportat TEAE. În grupul cu curcumină, numărul pacienților cu TEAE (n == 39, 52,0%) a fost mai mic, deși nu semnificativ, decât în ​​grupul placebo (n == 42, 56,0%).

În general, evenimentele adverse de gradul 3-4 au fost raportate la 5 pacienți (3,3%), 2 pacienți (2,7%) în grupul placebo și 3 pacienți (4%) în grupul cu curcumină. Nu au fost raportate alte evenimente adverse grave.

Două decese au fost raportate în timpul celei de-a doua perioade de urmărire, ambele în grupul cu curcumină, cauzate de insuficiența multiplă a organelor conform informațiilor de la medicul generalist al pacientului, dar nu au existat cazuri de deces în timpul perioadei de tratament.

Numărul total al tuturor TEAE de grad care au fost raportate a fost de 129. Din cei 10 pacienți cu evenimente adverse de grad 3-4 (7,8%), 5 pacienți (3,3%) au avut TEAE care au condus la retragerea studiului.

Lista efectelor adverse observate în acest studiu și distribuția acestora între grupurile de studiu sunt prezentate în  tabelele 12  și  13  (Suplimentul 2-2).

Tabelul 12. Tratamentul evenimentelor adverse emergente în funcție de  clasa și gradul de sistem și organ MedDRA * la toți pacienții

Toți pacienții
Toate clasele%Gradul 1-2%Grad 3-4%
Tulburări gastrointestinale2318%2116%22%
Tulburări cardiace86%65%22%
Tulburări vasculare32%32%00%
Tulburări respiratorii, toracice și mediastinale86%54%32%
Tulburări ale sângelui și ale sistemului limfatic4233%4233%00%
Sistemul nervos și tulburările psihiatrice1411%1411%00%
Tulburări ale sistemului hepatobiliar54%32%22%
Tulburări generale și condiții la locul administrării1411%1411%00%
Tulburări ale sistemului imunitar11%00%11%
Tulburări musculo-scheletice43%43%00%
Tulburări metabolice și nutriționale11%11%00%
Afecțiuni ale pielii și ale țesutului subcutanat65%65%00%
Total129100%11993%109%

Abreviere: MedDRA = Dicționar medical pentru activități de reglementare

Tabelul 13. Distribuția evenimentelor adverse emergente ale tratamentului între grupuri în funcție de clasa sistemelor de organe și grad

Clasa sistemelor de organeGrupa B, curcumină (n == 75)Grupa A, placebo (n == 75)
Toate clasele% din totalGradul 1-2% din totalGrad 3-4% din totalToate clasele% din totalGradul 1-2% din totalGrad 3-4% din total
Tulburări gastrointestinale129%108%22%119%119%00%
Tulburări cardiace54%43%11%32%22%11%
Tulburări vasculare00%00%00%32%32%00%
Tulburări respiratorii, toracice și mediastinale32%11%22%54%43%11%
Tulburări ale sângelui și ale sistemului limfatic2116%2116%00%2116%2116%00%
Sistemul nervos și tulburările psihiatrice75%75%00%75%75%00%
Tulburări ale sistemului hepatobiliar32%22%11%22%11%11%
Tulburări generale și condiții la locul administrării43%43%00%108%108%00%
Tulburări ale sistemului imunitar11%00%11%00%00%00%
Tulburări musculo-scheletice32%32%00%11%11%00%
Tulburări metabolice și nutriționale11%11%00%00%00%00%
Afecțiuni ale pielii și ale țesutului subcutanat32%32%00%32%32%00%
Total6347%5643%77%6651%6349%33%

Toți pacienții au primit paclitaxel ca principal tratament anticancer, al cărui profil de toxicitate a fost investigat și elucidat în mare măsură. Prin urmare, orice evenimente adverse excesive în grupul cu curcumină peste grupul placebo care pot fi atribuite administrării intravenoase de curcumină sau celei combinate de curcumină cu paclitaxel au fost centrate în ceea ce privește siguranța tratamentului.

Termenii verbali furnizați în CRF-uri au fost convertiți în Termeni preferați MedDRA și au fost rezumați după cea mai gravă severitate (grad). Următoarele secțiuni oferă rezumate ale tuturor TEAE, indiferent de cauzalitate, evenimente adverse grave și cazurile de decese. În plus, un rezumat al TEAE care rezultă în întreruperea tratamentului de studiu este furnizat în  Tabelul 12 .

Tabelul rezumă TEAE în funcție de clasa MedDRA pe sisteme de organe (SOC) și grad la toți pacienții.

Cea mai mare incidență a evenimentelor adverse a fost în grupul tulburărilor sanguine și ale sistemului limfatic (n == 42, 33%), urmate de tulburările gastrointestinale (n == 23, 18%), ale sistemului nervos și ale tulburărilor psihiatrice (n == 14 , 11%) și tulburări generale și condiții la locul administrării (n == 14, 11%). Din 10 (8%) grad 3-4 TEAE, 3 (2%) au fost tulburări respiratorii, toracice și mediastinale, 2 tulburări cardiace, 2 tulburări gastro-intestinale, 2 tulburări hepatobiliare și 1 tulburare a sistemului imunitar. În perioada de tratament și urmărirea timpurie (vizita 14, 16 săptămâni), nu au fost înregistrate TEAE de gradul 5 (deces).

Distribuția TEAE între grupuri după SOC și grad este prezentată în  Tabelul 13 . Testarea statistică nu a relevat nicio diferență semnificativă între grupuri în ceea ce privește TEAE pe baza SOC.

Un rezumat al tuturor TEAE raportate de termenii preferați MedDRA este prezentat în  Tabelul 14 . Cel mai frecvent eveniment advers a fost anemia, care a fost înregistrată la 23 de pacienți (15,3%). Toate cazurile au fost de gradul 1-2. Puțin mai multe cazuri de anemie au fost înregistrate în grupul placebo (13  vs.  10 în grupul cu curcumină), deși diferența nu a fost semnificativă.

Tabelul 14. Rezumatul evenimentelor adverse emergente ale tratamentului

AEToți pacienții, N == 150Grupa A, n == 75Grupa B, n == 75Raportul de cote, A / BNivelul de semnificație,   valoarea p
N% dintre paciențiN% dintre paciențiN% dintre pacienți
Diaree10,7%11,3%00,0%3.04030,4981
Dispepsie42,7%11,3%34,0%0,32430,3344
Dureri gastrointestinale21,3%22,7%00,0%5.13610,2936
Greaţă138,7%68,0%79,3%0,84470,7719
Vărsături21,3%11,3%11,3%11
Mucozita orală10,7%00,0%11,3%0,32890,4981
Insuficiență cardiacă acută10,7%00,0%11,3%0,32890,4981
dureri în piept10,7%00,0%11,3%0,32890,4981
Efuziunea pericardica10,7%11,3%00,0%3.04030,4981
Tahicardie53,3%22,7%34,0%0,65750,6514
Eveniment tromboembolic10,7%11,3%00,0%3.04030,4981
Hipertensiune21,3%22,7%00,0%5.13610,2936
Insuficiență respiratorie acută10,7%00,0%11,3%0,32890,4981
Tuse10,7%11,3%00,0%3.04030,4981
Dispnee42,7%34,0%11,3%0,32430,3344
Pneumonie21,3%11,3%11,3%11
Anemie2315,3%1317,3%1013,3%1,36290,4977
Leucopenia1812,0%79,3%1114,7%0,59890,3185
Trombocitopenie10,7%11,3%00,0%3.04030,4981
Amnezie10,7%11,3%00,0%3.04030,4981
Ameţeală21,3%11,3%11,3%11
Neuropatie periferica85,3%45,3%45,3%11
Durere de cap10,7%11,3%00,0%3.04030,4981
Insomnie21,3%00,0%22,7%0,19470,2936
DILI (leziuni hepatice induse de droguri)32,0%11,3%22,7%0,49320,5674
Insuficiență hepatică21,3%11,3%11,3%11
Oboseală138,7%1013,3%34,0%3,69230,0548
Febră10,7%00,0%11,3%0,32890,4981
Reactie alergica10,7%00,0%11,3%0,32890,4981
Durere osoasă42,7%11,3%34,0%0,32430,3344
Hipocalcemie10,7%00,0%11,3%0,32890,4981
Rush / prurit al pielii64,0%34,0%34,0%11
Total1296663

Leucopenia (incluzând cazuri de neutropenie și limfopenie) a fost înregistrată la 18 pacienți (12%), fără cazuri raportate de grad 3-4, care să necesite modificarea tratamentului. Numărul pacienților cu leucopenie din grupurile placebo și curcumină a fost de 7 (9,3%) și respectiv 11 (14,7%), ceea ce nu a fost semnificativ diferit.

Oboseala a fost înregistrată la 13 pacienți (8,7%), iar mai mulți pacienți din grupul placebo au avut oboseală decât grupul cu curcumină (10  vs. 3, OR == 3,7,  p  = 0,05), sugerând că curcumina poate scădea oboseala în tratamentul cu paclitaxel. pacienți.

Greața (n == 13 pacienți, 8,7%) și neuropatia periferică (n == 8 pacienți, 5,3%) au fost alte TEAE raportate la mai mult de 5% dintre pacienți. A existat o distribuție uniformă între grupurile de studiu, fără nicio diferență în ceea ce privește incidența și severitatea. Incidența altor TEAE a fost <5% fără o diferență semnificativă între grupuri ( Tabelul 14 ).

Evenimente adverse grave (gradul 3-4) au fost observate la 5 pacienți (3,3%) în timpul studiului. Majoritatea dintre ei au fost considerați ca nefiind legați de tratament ( Tabelul 15 ). În general, 5 pacienți (2 placebo și 3 curcumină) au întrerupt tratamentele din studiu din cauza TEAE ( Tabelul 16 ). Deși unele dintre aceste evenimente au fost legate de tratament, analiza nu a sugerat niciun semn al asocierii lor cu administrarea curcuminei sau a combinației sale cu paclitaxel.

Tabelul 15. Evenimente adverse grave (gradul 3-4)

ID-ul pacientuluigrupAE termen preferatGradLegat de tratamentLegat de boliS-a rezolvatNarațiuni
TC-103AEfuziunea pericardica3NudaParţialPacientul a avut leziuni pulmonare limfogene multiple, cu afecțiuni respiratorii și revărsat pericardic la acumulare. Simptomele au devenit mai severe după cel de-al treilea ciclu de tratament. După consultarea cu un cardiolog, pacientul a fost retras din studiu.
Dispnee3NudaParţial
TC-54AInsuficiență hepatică3dadaNuPacientul a avut metastaze hepatice multiple și niveluri ușor crescute de transaminaze la acumulare. După 10 injecții cu medicamente de studiu, tratamentul a fost întrerupt din cauza insuficienței hepatice.
TC-83BReactie alergica3daNudaPacientul a fost retras. Potrivit anchetatorilor, evenimentul a fost considerat „intoleranță” față de taxani.
Greaţă3daNuda
Vărsături3daNuda
TC-110BInsuficiență hepatică3NudaNuProgresie în timpul tratamentului cu leziuni masive la nivelul ficatului.
TC122BPneumonie3NuNudaPacientul a avut antecedente medicale extinse, incluzând hipertensiune, boală coronariană ischemică și apariția pneumoniei după infecția respiratorie. Pacientul a fost retras din proces.
Infarct3NuNuda
Insuficiență respiratorie4NuNuda

Tabelul 16. Evenimente adverse care au dus la întreruperea tratamentului

ID-ul pacientuluigrupAEGradLegat de tratamentLegat de boliS-a rezolvatNarațiuni
TC-103AEfuziunea pericardica3NudaParţialPacientul a avut leziuni pulmonare limfogene multiple, cu afecțiuni respiratorii și revărsat pericardic la acumulare. Simptomele au devenit mai severe după cel de-al treilea ciclu de tratament. După consultarea cu un cardiolog, pacientul a fost retras din studiu.
Dispnee3NudaParţial
TC-54AInsuficiență hepatică3dadaNuPacientul a avut metastaze hepatice multiple și transaminaze ușor crescute la acumulare. După 10 injecții cu medicamentele studiate, tratamentul a fost întrerupt din cauza insuficienței hepatice.
TC-83BReactie alergica3daNudaPacientul a fost retras. Potrivit anchetatorilor, evenimentul a fost considerat „intoleranță” față de taxani.
Greaţă3daNuda
Vărsături3daNuda
TC122BPneumonie3NuNudaPacientul a avut antecedente medicale extinse, incluzând hipertensiune, boală coronariană ischemică și apariția pneumoniei după o infecție respiratorie. Pacientul a fost retras din proces.
Infarct3NuNuda
Insuficiență respiratorie4NuNuda
TC32BDureri în piept2ProbabilNudaPacientul a avut dureri toracice înainte de vizita 12, iar modificările ECG au indicat un infarct miocardic suspect. Pacientul a fost trimis la o clinică de cardiologie, unde examinările detaliate nu au evidențiat infarct, dar au sugerat cardiotoxicitatea paclitaxelului. Pacientul a fost retras din proces în urma recomandărilor cardiologului.
Modificări ECGProbabilNuda

Nu s-au produs decese în timpul perioadei de tratament. Au fost înregistrate două decese în timpul perioadei de urmărire la pacienții care au finalizat toate tratamentele de studiu la 35 și 69 de zile după ultimul ciclu de tratament. Niciunul dintre aceste cazuri nu a fost legat de tratamentul cu curcumină.

Narațiunile despre decese sunt descrise în Suplimentul 6.

Discuţie

Curcumina este unul dintre cei mai studiați compuși naturali chemopreventivi care induc supresia, întârzierea și inversarea carcinogenezei ( Campbell și Collett, 2005 ;  Duvoix și colab., 2005 ;  Hesari și colab., 2019 ;  Johnson și Mukhtar, 2007 ;  Park și Conteas , 2010 ). Curcumina prezintă activități antiinflamatorii, antioxidante și antitumorale, inducând apoptoza celulelor canceroase  in vitro  ( Menon și Sudheer, 2007 ;  Kunnumakkara și colab., 2008 ). Cu toate acestea, curcumina are o biodisponibilitate slabă, deoarece este insolubilă și este metabolizată rapid prin glucuronidare și sulfare în peretele intestinal și ficat și este excretată în fecale (Sharma și colab., 2007 ).  Vareed și colab. (2008)  administrat 10 g sau 12 g curcumină pe cale orală la 12 voluntari sănătoși, iar curcumina liberă a fost detectabilă la un singur subiect. Sharma și colab. (2004) au  observat o concentrație plasmatică medie de ~ 11 nmol / L la pacienții cu cancer după administrarea unei doze orale de 3,6 g curcumină. Într-un alt studiu clinic, s-au atins niveluri plasmatice de 45 de ori mai mari după administrarea a 4 g de curcumină ( Cheng și colab., 2001 ). Motivul acestor contradicții este necunoscut, dar ar fi putut contribui diverși factori, inclusiv conjugarea metabolică în peretele intestinal și ficat, metabolismul intestinal prin microflora și utilizarea diferitelor metode analitice de evaluare.

Deoarece proprietățile farmacodinamice și farmacocinetice slabe ale curcuminei sunt legate în principal de solubilitatea redusă și metabolismul rapid, una dintre strategiile pentru obținerea succesului în aplicarea curcuminei în practica clinică este dezvoltarea de forme solubile în apă pentru injecții parenterale sau perfuzie intravenoasă care pot asigură 100% biodisponibilitate. Preparatul utilizat în acest studiu este un concentrat de curcumină solubilizat în soluție de macinol glicerol ricinoleat, care este utilizat în mod normal în formulările de paclitaxel și a fost diluat cu soluție izotonică înainte de utilizare.

În special, preparatele pe bază de plante din formulările injectabile sunt utilizate în mod obișnuit în medicina oficială din multe țări. Peste 100 de produse din această categorie au fost comercializate în China (de exemplu, injecție Qingkailing (combinație de 8 plante), injecție de pulbere liofilizată Shuanghuanglian (3 combinații de plante,  Lonicera japonica, Coptis chinensis, Forsythia suspensa ), injecție Dengzhanxixin (plantă unică,  Erigeron breviscapus ), așa cum este înregistrat în Farmacopeea chineză).

Diterpenul paclitaxel (Taxol) a fost inițial izolat din scoarța tisei din Pacific  (Taxus brevifolia ) și este un medicament chimioterapeutic utilizat pe scară largă ca tratament de primă linie în cancerul de sân și de plămâni. Cu toate acestea, efectele sale terapeutice sunt rareori restaurative în stadiile avansate și metastatice ale bolii, cu supraviețuirea mediană cuprinsă între 2 – 3 ani ( Chia și colab., 2007 ). Controlul bolilor poate fi realizat pentru o perioadă limitată ( Cardoso și colab., 2014 ). Prin urmare, eforturile de a crește rata de supraviețuire și TTP și de a reduce toxicitatea generală a paclitaxelului se concentrează pe tratamentele adjuvante cu o varietate de alți agenți care vizează cancerul ( Decker și colab., 2017 ;  Di Leo și colab., 2008 ) .

Mecanismul principal de acțiune al paclitaxelului este asociat cu inhibarea diviziunii celulelor canceroase. Paclitaxel acționează ca un stabilizator de microtubuli și blochează celulele canceroase în faza G2 / M, împiedicându-le să sufere mitoză. De asemenea, induce apoptoza în celulele canceroase ( Sugimura și colab., 2004 ). Cu toate acestea, unul dintre principalele dezavantaje ale utilizării paclitaxelului este că induce supraexprimarea pompei de eflux în celulele canceroase ( Jang și colab., 2001 ) și activează căile de semnalizare NF-κB, PI3K / Akt și MAPK, care inhibă apoptoza și crește supraviețuirea celulară.

Datele preclinice din modelele de cancer mamar au arătat efecte aditive / sinergice prin adăugarea de curcumină la paclitaxel ( Ganta și Amiji, 2009 ;  Lin și colab. 2012 ;  Liu și Chen 2013 ). Curcumina potențează efectele antitumorale ale paclitaxelului prin reglarea descendentă a activării induse de paclitaxel a căilor de semnalizare a supraviețuirii celulelor cancerului mamar, NF-κB, PI3K / Akt și MAPK ( Bava și colab., 2011 ;  Sreekanth și colab., 2011 ). Acesta este fundalul rațiunii noastre pentru studierea eficacității și siguranței curcuminei în combinație cu paclitaxel la pacienții cu cancer de sân avansat și metastatic.

Obiectivul acestui studiu randomizat, controlat de fază II, a fost de a demonstra superioritatea terapiei combinate cu paclitaxel-curcumină față de monoterapia cu paclitaxel la pacienții cu cancer de sân avansat sau metastatic. Analiza ITT a arătat că efectul tratamentului a fost în favoarea combinației curcumină-paclitaxel.

În general, 238 de paciente de sex feminin au fost evaluate pentru eligibilitate, inclusiv 150 de pacienți cu cancer de sân incurabil local avansat și metastatic. Acești pacienți au fost repartizați aleatoriu în două grupuri de tratament, 133 de pacienți finalizând tratamentele studiate. Nu am găsit diferențe între grupuri în ceea ce privește datele demografice inițiale, fizice și alte măsurători clinice critice efectuate în timpul studiului sau identificate ca indicatori importanți de prognostic sau răspuns terapeutic.

Analiza ITT ( Tabelul 7 ) a arătat că ORR (procentul pacienților cu reducere completă și parțială a tumorii) a fost semnificativ mai mare în grupul cu curcumină (50,7%) decât în ​​grupul placebo (33,3%;  p  <0,05) după 12 săptămâni de tratament și 4 săptămâni de urmărire (total 16 săptămâni de la începutul tratamentului). Diferența ORR între grupuri a fost chiar mai mare atunci când numai pacienții care au finalizat tratamentul au fost incluși în analiză (61,3% în grupul cu curcumină față de 38,5% în grupul placebo; cota de raport == 2,64,  p  <0,01).

Efectele superioare ale curcuminei față de placebo au fost observate la 3 luni după terminarea tratamentului atât la pacienții care au finalizat tratamentul, cât și la toți pacienții care au fost incluși în analiza ITT  Tabelul 8 . ORR a fost încă mai mare în grupul cu curcumină (44,9%) decât în ​​grupul placebo (27,8%) la 3 luni de la terminarea tratamentului ( p  = 0,0337; raport de șanse ==  2,118 ,  p = 0,0726).

Am identificat o diferență semnificativă în analiza auxiliară a modificării scorului RECIST după 12 săptămâni de tratament cu curcumină, comparativ cu cea din grupul placebo. O diferență semnificativă ( p  <0,01) a fost observată în scorul RECIST, indicând faptul că tratamentul cu curcumină a avut un beneficiu mai mare decât placebo. Scorul RECIST în grupul cu curcumină a fost semnificativ mai mare după 3 luni de urmărire ( p  <0,05) comparativ cu valoarea inițială, în timp ce în grupul placebo, a fost semnificativ mai mic decât valoarea inițială, în ciuda unei diferențe nesemnificative între grupuri în acest moment punct.

Rezultate similare au fost observate la subgrupul hormonal pozitiv (HR + / HER2-) de pacienți. Scorurile ORR și RECIST au fost semnificativ mai mari la pacienții cu hormoni pozitivi tratați cu curcumină decât la pacienții tratați cu placebo după 12 săptămâni de tratament și 4 săptămâni de urmărire și la 3 luni după terminarea tratamentului.

PFS median în grupul cu curcumină (27,0 săptămâni, cu progresia tumorii observată la 25 de pacienți) a fost cu 2,4 săptămâni mai lung decât în ​​grupul placebo (24,6 săptămâni, cu progresia tumorii observată la 35 de pacienți), dar această diferență nu a fost semnificativă ( p  = 0,3495, raport de pericol: 1,278). De asemenea, nu am găsit nicio diferență semnificativă între grupurile placebo și curcumină în ceea ce privește TTP ( p  = 0.3026) sau TTF ( p  = 0.4428).

Ameliorarea semnificativă a fost observată la nivelurile de CEA în sângele pacienților la sfârșitul tratamentului și la 3 luni de urmărire ( p  <0,05), dar nu s-a observat nicio diferență semnificativă între grupurile de tratament cu privire la nivelurile de CEA și CA15 -3.

Starea de performanță generală a pacientului, autoevaluată, a sugerat o supraviețuire mai bună în grupul cu curcumină în comparație cu grupul placebo, ceea ce este în concordanță cu rezultatele examinării fizice a medicului a stării de performanță folosind scara Karnofsky ( Karnofsky și Burchenal, 1949 ). Nu s-a observat nicio diferență semnificativă între grupurile cu curcumină și grupul placebo în ceea ce privește manifestarea evenimentelor adverse toxice, deși curcumina poate reduce oboseala la pacienții tratați cu paclitaxel.

Dintre cele 10 TEAE grave (gradul 3-4) și două decese raportate în timpul perioadei de urmărire, niciuna nu a fost legată de administrarea curcuminei sau combinația sa cu paclitaxel. Nu au existat cazuri de alte evenimente adverse grave sau semnificative. Nu au fost identificate probleme de siguranță pentru curcumină sau combinația sa cu paclitaxel, ceea ce este în conformitate cu rezultatele din  Storka și colab. (2015)  studiul curcuminei lipozomale intravenoase și multe alte studii privind siguranța formelor de curcumină administrate oral.

Două cazuri de deces asociate cu perfuzie intravenoasă de curcumină cu ulei de ricin din polietilen glicol (PEG) 40, compus de Imprimis Rx, au fost investigate pe larg anterior ( Lasoff și colab., 2018 ;  FDA, 2017 ). Reacții de hipersensibilitate la produsele intravenoase care conțin impurități și subproduse ale polimerizării etilenglicolului cu ulei de ricin, cum ar fi oxid de etilenă și 1,4-dioxan, au fost raportate în literatura de specialitate și au făcut obiectul avertismentelor pentru un număr de medicamente aprobate de FDA ( FDA , 2017 ;  Fruijtier-Pölloth, 2005). Ancheta FDA a arătat că evenimentele adverse asociate cu produsul pentru injecție de curcumină Imprimis Rx pentru injecție s-au datorat utilizării componentelor de calitate non-farmaceutică și a ingredientelor lipsite de o monografie USP. Aceștia au indicat utilizarea unui ulei de ricin PEG 40 nemodificat, care nu este potrivit pentru consumul uman sau pentru utilizare terapeutică și ar putea conține impurități, cum ar fi dietilen glicol. Utilizarea emulsificantului farmaceutic Kolliphor® ELP în prepararea curcuminei (CUC-1) a exclus posibilele evenimente adverse și letale asociate impurităților acestui solubilizator.

Concluzie

Acest studiu randomizat, dublu-orb, controlat cu placebo, confirmă ipoteza că curcumina în combinație cu paclitaxel este eficientă în tratamentul cancerului de sân avansat și metastatic. Tratamentul cu curcumină în asociere cu paclitaxel a fost superior combinației paclitaxel-placebo în ceea ce privește ORR și performanța fizică după 12 săptămâni de tratament și urmărire pe termen scurt. Evaluarea evenimentelor adverse a sugerat că curcumina intravenoasă nu a condus la probleme majore de siguranță și la nici o reducere a calității vieții, dar a avut un ușor efect benefic în reducerea oboselii.

Aprobarea eticii și consimțământul de participare

Aprobarea etică a fost obținută de la Comitetul etic al Ministerului Sănătății al Republicii Armenia (22.02.2017). Studiul a primit aprobarea completă de reglementare de la Centrul științific de expertiză în domeniul medicamentelor și tehnologiei medicale al Ministerului Sănătății al Republicii Armenia pe 28 decembrie 2017.

Studiul a fost realizat în conformitate cu principiile bunei practici clinice conform Conferinței internaționale privind liniile directoare de armonizare. Procedurile de revizuire etică au fost efectuate în conformitate cu Declarația de la Helsinki și cu legile și reglementările locale. Consimțământul informat scris a fost obținut de la toți participanții înainte de efectuarea procedurilor specifice studiului.

Disponibilitatea datelor și a materialului

Seturile de date utilizate și / sau analizate în timpul studiului actual sunt disponibile de la autorul corespunzător, la cerere rezonabilă. Protocolul complet de încercare poate fi accesat la BRIU GmbH.

Conflictele de interese

Autorul JA are un contract de contractant independent cu BRIU GmbH. Autorul AP este fondatorul companiei de cercetare și dezvoltare Phytomed AB. Toți ceilalți autori nu declară interese concurente.

Finanțarea

Această lucrare a fost susținută parțial de BRIU GmbH, Parkstrasse 19d, 61462 Königstein, Hessen, Germania. Sponsori ai cercetării: Uwe-Bernd Rose și Brigitte Rose, BRIU GmbH, Germania, numărul grantului 2016-01. Preparatele Verum și placebo utilizate în studiu au fost donate de BRIU GmbH, Germania. Sponsorii nu au avut altă implicare în studiu.

Contribuțiile autorului

TS a contribuit la proiectarea și executarea studiului, recrutarea pacienților, pregătirea manuscriselor, analiza și gestionarea datelor, interpretarea rezultatelor și pregătirea manuscriselor.

AT a contribuit la managementul general al studiului și la pregătirea manuscriselor.

LH, NJ, AT, HP și AH au participat la recrutarea participanților, implementarea tratamentului și colectarea datelor.

MA a contribuit la colectarea și gestionarea datelor.

AHV a contribuit la executarea studiului și la buna practică clinică (GCP), la monitorizarea și conformitatea protocolului, precum și la gestionarea datelor și raportarea studiului.

JA a contribuit la concepția studiului, evaluarea, execuția și pregătirea manuscriselor.

ARR a contribuit la concepția studiului și la pregătirea manuscrisului.

AP a contribuit la proiectarea și executarea studiului, analiza datelor, interpretarea rezultatelor, elaborarea și pregătirea manuscrisului.

Toți autorii au citit și au aprobat manuscrisul final.

Mulțumiri

Autorii recunosc sprijinul BRIU GmbH, Germania, pentru furnizarea de agent de investigație și sprijin material. Autorii sunt recunoscători Luizei Panosyan pentru asistență tehnică, pentru revizuirea manuscrisului și pentru furnizarea de comentarii critice. Autorii sunt recunoscători tuturor participanților la studiu.

Apendice. Materiale suplimentare

Descărcați toate  fișierele suplimentare incluse în acest articol Ajutor

Descărcare:  Descărcați fișierul PDF Acrobat (103 KB)Descărcare:  Descărcați fișierul Acrobat PDF (660 KB)Descărcare:  Descărcare document Word (24 KB)Descărcare:  Descărcare document Word (14 KB)Descărcare:  Descărcați foaia de calcul (696 KB)Descărcare:  Descărcați foaia de calcul (80 KB)

Referințe

Abouzeid et al., 2014aA.H. Abouzeid, N.R. Patel, C. Sarisozen, V.P. TorchilinTransferrin-targeted polymeric micelles co-loaded with curcumin and paclitaxel: efficient killing of paclitaxel-resistant cancer cellsPharm Res, 31 (2014), pp. 1938-1945CrossRefView Record in ScopusGoogle ScholarAbouzeid et al., 2014bA.H. Abouzeid, N.R. Patel, V.P. TorchilinPolyethylene glycol-phosphatidylethanolamine (PEG-PE)/vitamin E micelles for co-delivery of paclitaxel and curcumin to overcome multi-drug resistance in ovarian cancerInt J Pharm, 464 (2014), pp. 178-184ArticleDownload PDFView Record in ScopusGoogle ScholarAggarwal et al., 2013B.B. Aggarwal, S.C. Gupta, B. SungCurcumin: an orally bioavailable blocker of TNF and other pro-inflammatory biomarkersBr J Pharmacol, 169 (2013), pp. 1672-1692 Download PDFCrossRefView Record in ScopusGoogle ScholarAggarwal et al., 2005B.B. Aggarwal, S. Shishodia, Y. Takada, S. Banerjee, R.A. Newman, C.E. Bueso-Ramos, JE. PriceCurcumin suppresses the paclitaxel-induced nuclear factor-kappa pathway in breast cancer cells and inhibits lung metastasis of human breast cancer in nude miceClin Cancer Res., 11 (2005), pp. 7490-7498 Download PDFView Record in ScopusGoogle ScholarAlemi et al., 2018A. Alemi, Zavar Reza, Haghiralsadat J., Zarei Jaliani F., Haghi Karamallah M. H., S.A. Hosseini, S. Haghi KaramallahPaclitaxel and curcumin coadministration in novel cationic PEGylated niosomal formulations exhibit enhanced synergistic antitumor efficacyJ Nanobiotechnology, 16 (2018), p. 28, 10.1186/s12951-018-0351-4 Download PDFView Record in ScopusGoogle ScholarAnand et al., 2007P. Anand, A.B. Kunnumakkara, R.A. Newman, B.B. AggarwalBioavailability of curcumin: problems and promisesMolecular Pharmaceutics, 4 (2007), pp. 807-818CrossRefView Record in ScopusGoogle ScholarBava et al., 2011S.V. Bava, C.N. Sreekanth, A.K.T. Thulasidasan, N.P. Anto, V.T. Cheriyan, V.T. Puliyappadamba, S.G. Menon, S.D. Ravichandran, R.J. AntoAkt is upstream and MAPKs are downstream of NF-kappa B in paclitaxel-induced survival signaling events, which are down-regulated by curcumin contributing to their synergismInt. J. Biochem. Cell Biol., 43 (2011), pp. 331-341ArticleDownload PDFView Record in ScopusGoogle ScholarBharti and Aggarwal, 2002A.C. Bharti, B.B. AggarwalNuclear factor-kappa B and cancer: its role in prevention and therapyBiochemPharmacol, 64 (2002), pp. 883-888ArticleDownload PDFView Record in ScopusGoogle ScholarBoztas et al., 2013A.O. Boztas, O. Karakuzu, G. Galante, Z. Ugur, F. Kocabas, C.Z. Altuntas, A.O. YazaydinSynergistic interaction of paclitaxel and curcumin with cyclodextrin polymercomplexation in human cancer cellsMol Pharm, 10 (2013), pp. 2676-2683CrossRefView Record in ScopusGoogle ScholarCalaf et al., 2018G.M. Calaf, R. Ponce-Cusi, F. CarriónCurcumin and paclitaxel induce cell deathin breast cancer cell linesOncol Rep, 40 (2018), pp. 2381-2388 Download PDFView Record in ScopusGoogle ScholarCampbell and Collett, 2005F.C. Campbell, G.P. CollettChemopreventive properties of curcuminFuture Oncol, 1 (2005), pp. 405-414CrossRefView Record in ScopusGoogle ScholarCardoso et al., 2014F. Cardoso, A. Costa, L. Norton, E. Senkus, M. Aapro, F. André, C.H. Barrios, J. Bergh, L., Biganzoli, K.L. Blackwell, M.J. Cardoso, T. Cufer, N. El Saghir, L. Fallowfield, D. Fenech, P. Francis, K. Gelmon, S.H. Giordano, J. Gligorov, A. Goldhirsch, N. Harbeck, N. Houssami, C. Hudis, B. Kaufman, I. Krop, S. Kyriakides, U.N. Lin, M. Mayer, S.D. Merjaver, E.B. Nordström, O. Pagani, A. Partridge, F. Penault-Llorca, M.J. Piccart, H. Rugo, G. Sledge, C. Thomssen, L. Van’t Veer, D. Vorobiof, C. Vrieling, N. West, B. Xu, E. WinerESO-ESMO 2nd international consensus guidelines for advanced breast cancer (ABC2) daggerAnn Oncol, 25 (2014), pp. 1871-1888ArticleDownload PDFCrossRefView Record in ScopusGoogle ScholarChen et al., 2014B. Chen, Y. Zhang, Y. Wang, J. Rao, X. Jiang, Z. XuCurcumin inhibits proliferation of breast cancer cells through Nrf2-mediated down-regulation of Fen1 expressionJ Steroid Biochem Mol Biol, 143 (2014), pp. 11-18ArticleDownload PDFView Record in ScopusGoogle ScholarCheng et al., 2001A.L. Cheng, C.H. Hsu, J.K. Lin, M.M. Hsu, Y.F. Ho, T.S. Shen, J.Y. Ko, J.T. Lin, B.R. Lin, W. Ming-Shiang, H.S. Yu, S.H. Jee, G.S. Chen, T.M. Chen, C.A. Chen, M.K. Lai, Y.S. Pu, M.H. Pan, Y.J. Wang, C.C. TsaiPhase I clinical trial of curcumin, a chemopreventive agent, in patients with high-risk or pre-malignant lesionsAnticancer Res, 21 (2001), pp. 2895-2900Google ScholarChia et al., 2007S.K. Chia, C.H. Speers, Y. D’Yachkova, A. Kang, S. Malfair-Taylor, J. Barnett, A. Coldman, K.A. Gelmon, S.E. O’Reilly, I.A. OlivottoThe impact of new chemotherapeuticand hormone agents on survival in a population-based cohort of women withmetastatic breast cancerCancer, 110 (2007), pp. 973-979 Download PDFCrossRefView Record in ScopusGoogle ScholarClinical Trial Endpoints for the Approval of Cancer Drugs and Biologics. Guidance for Industry 2007Clinical Trial Endpoints for the Approval of Cancer Drugs and Biologics. Guidance for Industry2007. U.S. Department of Health and Human Services Food and Drug Administration Center for Drug Evaluation and Research (CDER) Center for Biologics Evaluation and Research (CBER). pp. 1-19.Google ScholarCurcuma Longa 2002Curcuma LongaIndian Herbal Pharmacopoeia, Revised new editionIndian Drug Manufacturers Association, Mumbai (2002), pp. 169-180Google ScholarCurcumae Longae Rhizoma 2010Curcumae Longae RhizomaPharmacopoeia of the People’s Republic of China(English ed. X) (2010), pp. 139-140Google ScholarDecker et al., 2017T Decker, F. Overkamp, S. Rösel, A. Nusch, T. Göhler, M. Indorf, J. Sahlmann, T. TrarbachA randomized phase II study of paclitaxel alone versus paclitaxel plus sorafenib in second- and third-line treatment of patients with HER2-negative metastatic breast cancer (PASO)BMC Cancer, 17 (1) (2017), p. 499, 10.1186/s12885-017-3492-1doi: ker Download PDFView Record in ScopusGoogle ScholarDevassy et al., 2015J.G. Devassy, I.D. Nwachukwu, P.J. JonesCurcumin and cancer: barriers to obtaininga health claimNutr Rev, 73 (2015), pp. 155-165 Download PDFCrossRefView Record in ScopusGoogle ScholarDi Leo et al., 2008A. Di Leo, H.L. Gomez, Z. Aziz, Z. Zvirbule, J. Bines, M.C. Arbushites, S.F. Guerrera, M. Koehler, C. Oliva, S.H. Stein, L.S. Williams, J. Dering, R.S. Finn, M.F. PressPhase III, double-blind, randomized study comparing lapatinib plus paclitaxel with placebo plus paclitaxel as first-line treatment for metastatic breast cancerJ Clin Oncol, 26 (2008), pp. 5544-5552, 10.1200/JCO.2008.16.2578 Download PDFView Record in ScopusGoogle ScholarDuvoix et al., 2005A. Duvoix, R. Blasius, S. Delhalle, M. Schnekenburger, F. Morceau, E. Henry, M. Dicato, M. DiederichChemopreventive and therapeutic effects of curcuminCancer Lett, 223 (2005), pp. 181-190ArticleDownload PDFView Record in ScopusGoogle ScholarDuvoix et al., 2005A. Duvoix, R. Blasius, S. Delhalle, M. Schnekenburger, F. Morceau, E. Henry, M. Dicato, M. DiederichChemopreventive and therapeutic effects of curcuminCancer Lett, 223 (2005), pp. 181-190ArticleDownload PDFView Record in ScopusGoogle ScholarEisenhauera et al., 2009E.A. Eisenhauera, P. Therasse, J. Bogaerts, L.H. Schwartz, D. Sargent, R. Ford, J. Dancey, S. Arbuck, S. Gwyther, M. Mooney, L. Rubinstein, L. Shankar, L. Dodd, R. Kaplan, D. Lacombe, J. VerweijNew response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1)Eur J Cancer., 45 (2009), pp. 228-247Google ScholarFDA 2017FDAAn FDA Investigation into Two Serious Adverse Events Associated with ImprimisRx’s Compounded Curcumin Emulsion Product for InjectionFDA (2017)8 August 2017https://www.fda.gov/drugs/guidancecomplianceregulatoryinformation/pharmacycompounding/ucm570192.htmGoogle ScholarFruijtier-Pölloth, 2005C. Fruijtier-PöllothSafety assessment on polyethylene glycols (PEGs) and their derivatives as used in cosmetic productsToxicology, 214 (2005), pp. 1-38ArticleDownload PDFView Record in ScopusGoogle ScholarGanta and Amiji, 2009S. Ganta, M. AmijiCoadministration of Paclitaxel and curcumin in nanoemulsionformulations to overcome multidrug resistance in tumor cellsMol Pharm, 26 (2009), pp. 928-939CrossRefView Record in ScopusGoogle ScholarGradishar et al., 2013W.J. Gradishar, V. Kaklamani, T.P. Sahoo, D. Lokanatha, V. Raina, S. Bondarde, M. Jain, S.K. Ro, N.A. Lokker, L. SchwartzbergA double-blind, randomised, placebocontrolled,phase 2b study evaluating sorafenib in combination with paclitaxelas a first-line therapy in patients with HER2-negative advanced breast cancerEur J Cancer, 49 (2013), pp. 312-322ArticleDownload PDFView Record in ScopusGoogle ScholarHesari et al., 2019A. Hesari, M. Azizian, A. Sheikhi, A. Nesaei, S. Sanaei, N. Mahinparvar, M. Derakhshani, P. Hedayt, F. Ghasemi, H. MirzaeiChemopreventive and therapeutic potential of curcumin in esophageal cancer: Current and future statusInt J Cancer, 144 (2019), pp. 1215-1226 Download PDFCrossRefView Record in ScopusGoogle ScholarHuang et al., 2011H.C. Huang, C.L. Lin, J.K. Lin1,2,3,4,6-penta-O-galloyl-β-D-glucose, quercetin, curcumin and lycopene induce cell-cycle arrest in MDA-MB-231 and BT474 cells through downregulation of Skp2 proteinJ Agric Food Chem, 59 (2011), pp. 6765-6775CrossRefView Record in ScopusGoogle ScholarJang et al., 2001S.H. Jang, M.G. Wientjes, J.L. AuKinetics of P-glycoprotein-mediated efflux of paclitaxelJ. Pharmacol. Exp. Ther., 298 (2001), pp. 1236-1242 Download PDFView Record in ScopusGoogle ScholarJohnson and Mukhtar, 2007J.J. Johnson, H. MukhtarCurcumin for chemoprevention of colon cancerCancer Lett, 255 (2007), pp. 170-181ArticleDownload PDFView Record in ScopusGoogle ScholarKang et al., 2009H.J. Kang, S.H. Lee, J.E. Price, L.S. KimCurcumin suppresses the paclitaxel-induced nuclear factor-kappaB in breast cancer cells and potentiates the growth inhibitory effect of paclitaxel in a breast cancer nude mice modelBreast J, 15 (2009), pp. 223-229CrossRefView Record in ScopusGoogle ScholarKarnofsky and Burchenal, 1949D. Karnofsky, J. BurchenalThe clinical evaluation of chemotherapeutic agents in cancerC. MacLeod (Ed.), Evaluation of Chemotherapeutic Agents, Columbia University Press, New York (1949), pp. 191-205View Record in ScopusGoogle ScholarKim et al., 2001M.S. Kim, H.J. Kang, A. MoonInhibition of invasion and induction of apoptosis by curcumin in H-ras-transformed MCF10A human breast epithelial cellsArch Pharm Res, 24 (2001), pp. 349-354View Record in ScopusGoogle ScholarKizhakkayil et al., 2010J. Kizhakkayil, F. Thayyullathil, S. Chathoth, A. Hago, M. Patel, S. GaladariModulation of curcumin-induced Akt phosphorylation and apoptosis by PI3K inhibitor in MCF-7 cellsBiochemBiophys Res Commun, 394 (2010), pp. 476-481ArticleDownload PDFView Record in ScopusGoogle ScholarKumar et al., 2015P. Kumar, A. Kadakol, P.K. Shasthrula, N.A. Mundhe, V.S. Jamdade, C.C. Barua, A.B. GaikwadCurcumin as an adjuvant to breast cancer treatmentAnticancer Agents Med Chem, 15 (2015), pp. 647-656CrossRefView Record in ScopusGoogle ScholarKunnumakkara et al., 2008A.B. Kunnumakkara, P. Anand, B.B. AggarwalCurcumin inhibits proliferation, invasion, angiogenesis and metastasis of different cancers through interactionwith multiple cell signaling proteinsCancer Lett, 269 (2008), pp. 199-225ArticleDownload PDFView Record in ScopusGoogle ScholarLasoff et al., 2018D.R. Lasoff, F.L. Cantrell, B.T. LyDeath associated with intravenous turmeric (Curcumin) preparationClin Toxicol (Phila), 56 (2018), pp. 384-385CrossRefView Record in ScopusGoogle ScholarLi et al., 2014X. Li, W. Xie, C. Xie, C. Huang, J. Zhu, Z. Liang, F. Deng, M. Zhu, W. Zhu, R. Wu, J. Wu, S. Geng, C.. ZhongCurcumin modulates miR-19/PTEN/AKT/p53 axis to suppress bisphenol A-induced MCF-7 breast cancer cell proliferationPhytother Res, 28 (2014), pp. 1553-1560View Record in ScopusGoogle ScholarLin et al., 2012L. Lin, P. Wang, X.L. ZhaoStudy on curcumin-induced apoptosis in ovarian cancer resistant cell lines COC1/DDPSichuan Da XueXue Bao Yi Xue Ban, 43 (2012), pp. 335-339Chinese. PubMed PMID: 22812232View Record in ScopusGoogle ScholarLiu and Chen, 2013D. Liu, Z. ChenThe effect of curcumin on breast cancer cellsJ Breast Cancer, 16 (2013), pp. 133-137 Download PDFCrossRefView Record in ScopusGoogle ScholarLowe and Lin, 2000S.W. Lowe, A.W. LinApoptosis in cancerCarcinogenesis, 21 (2000), pp. 485-495 Download PDFView Record in ScopusGoogle ScholarLv et al., 2014Z.D. Lv, X.P. Liu, W.J. Zhao, Q. Dong, F.N. Li, H.B. Wang, B. KongCurcumin induces apoptosis in breast cancer cells and inhibits tumor growth in vitro and in vivoInt J Clin Exp Pathol, 7 (2014), pp. 2818-2824View Record in ScopusGoogle ScholarMenon and Sudheer, 2007V.P. Menon, A.R. SudheerAntioxidant and anti-inflammatory properties of curcuminAdv Exp Med Biol, 595 (2007), pp. 105-125CrossRefView Record in ScopusGoogle ScholarPark and Conteas, 2010J. Park, C.N. ConteasAnti-carcinogenic properties of curcumin on colorectal cancerWorld J Gastrointest Oncol, 2 (2010), pp. 169-176View Record in ScopusGoogle ScholarQuispe-Soto and Calaf, 2016E.T. Quispe-Soto, G.M. CalafEffect of curcumin and paclitaxel on breast carcinogenesisInt J Oncol, 49 (2016), pp. 2569-2577 Download PDFCrossRefView Record in ScopusGoogle ScholarRhizoma Curcumae Longae 1999Rhizoma Curcumae Longae, in: WHO monographs on selected medicinal plants. — World Health Organization. 1999, Vol. 1, 115-124.Google ScholarRose, 2014Rose, U-B., 2014. PharmazeutischeFormulierungenhaltened Curcumin,Patent DE 10 2012 2019 291 A1, 2014.05.28.Google ScholarSharma et al., 2004R.A. Sharma, S.A. Euden, S.L. Platton, D.N. Cooke, A. Shafayat, H.R. Hewitt, T.H. Marczylo, B. Morgan, D. Hemingway, S.M. Plummer, M. Pirmohamed, A.J. Gescher, W.P. StewardPhase I clinical trial of oral curcumin: biomarkers of systemic activity and complianceClin Cancer Res, 10 (2004), pp. 6847-6854 Download PDFView Record in ScopusGoogle ScholarSharma et al., 2007R.A. Sharma, W.P. Steward, A.J. GescherPharmacokinetics and pharmacodynamics of curcuminAdv Exp Med Biol, 595 (2007), pp. 453-470CrossRefView Record in ScopusGoogle ScholarSreekanth et al., 2011C.N. Sreekanth, S.V. Bava, E. Sreekumar, R.J. AntoMolecular evidences for the chemosensitizing efficacy of liposomal curcumin in paclitaxel chemotherapy in mouse models of cervical cancerOncogene, 30 (2011), pp. 3139-3152 Download PDFCrossRefView Record in ScopusGoogle ScholarStorka et al., 2015A. Storka, B. Vcelar, U. Klickovic, G. Gouya, S. Weisshaar, S. Aschauer, G. Bolger, L. Helson, M. WolztSafety, tolerability and pharmacokinetics of liposomalcurcumin in healthy humansInt J Clin Pharmacol Ther., 53 (1) (2015), pp. 54-65CrossRefView Record in ScopusGoogle ScholarSugimura et al., 2004M. Sugimura, S. Sagae, S. Ishioka, Y. Nishioka, K. Tsukada, R. KudoMechanisms of paclitaxel-induced apoptosis in an ovarian cancer cell line and its paclitaxel-resistant cloneOncology, 66 (2004), pp. 53-61View Record in ScopusGoogle ScholarVareed et al., 2008S.K. Vareed, M. Kakarala, M.T. Ruffin, J.A. Crowell, D.P. Normolle, Z. Djuric, D.E. BrennerPharmacokinetics of curcumin conjugate metabolites in healthy human subjectsCancer Epidemiol Biomarkers Prev, 17 (2008), pp. 1411-1417 Download PDFCrossRefView Record in ScopusGoogle ScholarWei et al., 2017Y. Wei, X. Pu, L. ZhaoPreclinical studies for the combination of paclitaxel andcurcumin in cancer therapy (Review)Oncol Rep, 37 (2017), pp. 3159-3166 Download PDFCrossRefView Record in ScopusGoogle ScholarZhan et al., 2014Y. Zhan, Y. Chen, R. Liu, H. Zhang, Y. ZhangPotentiation of paclitaxel activity by curcumin in human breast cancer cell by modulating apoptosis and inhibiting EGFR signalingArch Pharm Res, 37 (2014), pp. 1086-1095CrossRefView Record in ScopusGoogle Scholar