Rolul melatoninei în schizofrenie

Abstract

Schizofrenia este o boală psihică cronică care tulbură mai multe funcții cognitive, cum ar fi memoria, gândirea, percepția și voința. Etiologia biologică a schizofreniei este multifactorială și este încă în curs de investigare. Melatonina a fost implicată în schizofrenie încă din primele decenii ale secolului XX. Cercetările asupra melatoninei privind schizofrenia au urmat două abordări diferite. Prima abordare este legată de utilizarea melatoninei ca marker biologic. A doua abordare tratează aplicațiile clinice ale melatoninei ca tratament medicamentos. În această lucrare sunt revizuite ambele aspecte ale aplicării melatoninei. Utilizarea sa clinică în schizofrenie este accentuată.

Logo-ul lui ijms

Link to Publisher's site
Int J Mol Sci . 2013 mai; 14 (5): 9037–9050.
Publicat online 2013 aprilie 25. doi: 10.3390 / ijms14059037
PMCID: PMC3676771
PMID: 23698762

1. Introducere

Schizofrenia este o boală mentală cronică și complexă, care tulbură mai multe funcții cognitive, cum ar fi memoria, gândirea, percepția și voința. Schizofrenia este o boală care evoluează de obicei odată cu focare și afectează aproximativ 0,5% –1% din populația mondială. Etiologia sa biologică este multifactorială și este încă în curs de investigare [ 1 ].

Se acceptă faptul că schizofrenia nu este o singură boală, ci diferite subgrupuri de entități eterogene clinic și biologic [ 2 ]. Rămâne o problemă de dezbatere dacă armamentariul de diagnostic actual (magnetica prin rezonanță magnetică (IRM) și studiile tomografiei cu emisie de pozitroni (PET), teste de laborator, studii genetice etc. ) ar putea ajuta clinicienii cu diagnosticul, tratamentul și prognosticul.

Ideile inițiale despre relațiile dintre glanda pineală și condițiile psihiatrice provin de la Descartes, care a plasat în glanda pineală sediul gândirii raționale și legătura dintre corp și suflet [ 3 ]. Aceasta a fost rațiunea de a trata bolile psihiatrice cu extracte de glanda pineală. Poate că prima lucrare de acest tip poate fi urmărită până la începutul secolului XX [ 4 ], când un grup de pacienți psihiatrici a fost tratat cu extracte de glande pineale. În a doua jumătate a secolului XX, a existat un interes reînnoit pentru eficacitatea terapeutică a extractelor de pineala, care au fost administrate ca tratament pentru stările psihotice [ 5 , 6 ]. Principalul produs hormonal al glandei pineale este melatonina (MLT). Aproximativ 80% din secreția pineală are forma MLT, deși un alt produs, cum ar fi 5-metoxitriptamina, este secretat și el de glanda pineală [ 7 ].

Cercetările asupra MLT ca marker biologic al schizofreniei au mers paralel cu dezvoltarea tehnicilor de laborator care permit cercetătorilor să cuantifice MLT într-o manieră validă și fiabilă. Primele tehnici de măsurare a MLT au fost semi-cantitative, bazate pe capacitatea MLT de albire a mormolelor și a pielii broaștei [ 8 , 9 ]. Abia la sfârșitul anilor șaptezeci ai secolului trecut au fost dezvoltate alte tehnici cantitative pentru determinarea MLT în mai multe fluide biologice [ 10 – 12 ].

Cercetările MLT ca marker biologic al schizofreniei au raportat rezultate controversate. S-a descoperit că sângele pacienților schizofrenici a crescut [ 13 , 14 ], a scăzut [ 15 , 16 ] sau a fost afectat [ 17 , 18 ] nivelurile de MLT. Pe de altă parte, utilizarea schizofreniei MLT ca agent terapeutic s-a concentrat în principal pe tulburările de somn și tratamente de discinezie tardivă [ 19 , 20 ]. Scopul acestei cercetări este de a revizui utilizarea MLT în schizofrenie, în ambele aspecte, ca marker biologic și ca agent terapeutic.

La mamifere, informațiile despre condițiile de iluminare a mediului, care sunt percepute în mod neutru de retină, sunt în cele din urmă transformate în sinteza crescută nocturnă a produsului principal de secreție pineală, MLT. Glanda pineală este un organ foto-neuroendocrin, care transformă stimulii luminoși externi într-o secreție hormonală responsabilă de sincronizarea homeostazei interne și a condițiilor de mediu [ 21 ]. În glanda pineală foto-receptivă, mesajul întunericului se bazează pe stimulatorul stimulator circadian, nucleul suprachiasmatic (SCN). Controlul SCN asupra ritmului circadian în țesuturile periferice poate fi direct, mediat neuronal (sistemul nervos autonom) și indirect, hormonal-mediat (secreția MLT pineală). Activitatea circadiană a SCN este sincronizată cu ciclul lumină / întuneric în principal prin lumina percepută de retină [ 22 ]. În absența luminii (faza întunecată), creșterea biosintezei MLT în glanda pineală este stimulată de semnale electrice provenite de la neuronii SCN [ 23 ]. Principalul neurotransmițător al terminalului nervului simpatic postganglionic este norepinefrina (NE) [ 24 ]. În timpul zilei, eliberarea NE din fibrele simpatice este suprimată de o activitate electrică crescută în SCN. Noaptea, când activitatea SCN este inhibată, eliberarea de NE este îmbunătățită [ 25 ]. MLT este un metabolit al triptofanului (TRP). Limita pasului la această cale metabolică este alchilarea serotoninei prin AANAT (aril-alchilamină-N-acetil-transferază; CE 2.3.1.87) [ 26 ].

În afară de sânge, salivă și urină, MLT a fost detectată în LCR a mamiferelor și a camerei anterioare a ochiului [ 27 ]. MLT se găsește, de asemenea, în multe fluide legate de reproducere [ 28 ]. În creier, cel puțin la modelele animale, s-a raportat că MLT este concentrat în mai multe regiuni ale cortexului, cerebelului, talamului și nucleelor ​​paraventriculare ale hipotalamusului [ 29 ]. Mai mult, cea mai mare concentrație de MLT la om este localizată pe porțiunea superioară a tractului gastrointestinal (GIT). Concentrațiile de MLT în mucoasa GIT depășesc nivelul de sânge de 400 de ori și apar mai ales după aportul alimentar, bogat în proteine ​​și conținut ridicat de triptofan [ 30 ], cu independență de ritmurile circadiene.

MLT este distribuit pe scară largă de-a lungul țesuturilor umane, permițând îndeplinirea funcțiilor sale pleiotropice [ 31 ]. La om, rolurile MLT sunt numeroase și includ, printre altele, controlul ritmului circadian care acționează ca neuromodulator, hormon, citokină și mediator de răspuns biologic [ 32 ]. De asemenea, afectează funcțiile cerebrale, imune, gastrointestinale, cardiovasculare, renale, osoase și endocrine și acționează ca o moleculă naturală oncostatică și anti-îmbătrânire [ 33 – 36 ].

În ceea ce privește efectele posibile ale administrării de MLT la oameni și sinteza diferiților hormoni, există unele controverse și coincidențe. Majoritatea autorilor se potrivesc cu o corelație negativă între MLT și hormonul luteinizant (LH) și testosteron [ 37 , 38 ]. În ceea ce privește hormonii tiroidieni, datele existente în literatura de specialitate sunt contradictorii, a fost raportată o corelație inversă sau o lipsă de corelație între MLT și hormonii tiroidieni [ 37 , 38 ]. În studiul clasic al lui Seabra și colab . 39 ], 40 de voluntari au primit 10 mg de MLT în 28 de zile într-un studiu clinic dublu orb. Examenele de laborator au inclus o analiză completă a sângelui cu privire la hormoni, cum ar fi, T4, TSH, LH, FSH și cortizol. Nu au fost observate diferențe semnificative între grupurile placebo și MLT.

Multe acțiuni ale MLT sunt mediate prin interacțiunea cu receptorii specifici cu membrana legată. Până în prezent, doi receptori MLT de mamiferi legați de membrană au fost identificați și caracterizați: MT 1 sau MEL 1a și MT 2 sau MEL 1b [ 40 ]. Mai mult, MLT ca moleculă lipofilă poate acționa printr-un mecanism mediat non-receptor. Respectând această acțiune, proprietatea mai reprezentativă este ca un spălător radical pentru speciile de oxigen reactiv (ROS) și speciile de azot reactiv (RNS) [ 41 ]. Speciile reactive la oxigen sau azot eliminate prin MLT includ radicalul hidroxil (OH  ), peroxidul de hidrogen (H 2 O 2 ) și derivații radicalilor liberi ai oxidului nitric (NO) [ 42 , 43 ]. În plus, MLT stimulează activitatea enzimelor antioxidante și expresia genelor; trei dintre aceste enzime antioxidante principale sunt glutationa peroxidază (GPx), superoxid dismutaza (SOD) și catalază (CAT) [ 44 ].

2. Rolul MLT în schizofrenie

Halucinațiile și amăgirea sunt simptome pozitive de bază ale schizofreniei [ 45 ]. Prima încercare de a lega MLT-ul cu schizofrenia a fost pusă de McIsaac în 1961 [ 46 ], când a propus că structura chimică a MLT este foarte similară cu structura alcaloizilor halalinogeni halalinoizi, a armoniei și a harmalinei. Formarea unui astfel de alcaloid, 10-metoximharmalan, ar putea fi produsă prin îndepărtarea MLT a unei molecule de apă prin ciclodehidratare. Alcaloizii Harmala sunt inhibitori puternici ai monoaminooxidazei (MAO) și ar putea împiedica descompunerea normală a 5HT, ceea ce ar determina închiderea căilor metabolizării 5HT, ceea ce ar duce la producerea de mai mult 5-metoxitriptamină, MLT și 10-metoxifalan. Făcând acest lucru, odată ce se formează 10-metoxifarmanul, are tendința de a-și menține (feedback pozitiv) propria formare. După cunoștința noastră, nu există nicio cercetare la oameni care să fi susținut această ipoteză.

De la izolarea MLT în 1958 [ 47 ], a existat un interes crescut pentru cercetarea MLT și psihiatrie. Deoarece izolarea chimică a MLT din extractele glandelor pineale a durat câțiva ani, studiile timpurii au fost efectuate folosind extracte de glande pineale, în principal din glandele pineale bovine [ 48 ]. S-a recunoscut cu ușurință că ceea ce se credea, că glanda pineală nu avea o funcție clar definită [ 49 ], a fost curând reformulat și mai multe cercetări au început să sublinieze mecanismele fiziologice ale acțiunii MLT [ 48 , 50 – 53 ]. În curând a devenit clar că există două domenii de cercetare delimitate în mod clar în psihiatrie în ceea ce privește MLT. Prima zonă a fost legată de utilizarea MLT ca marker biologic al patologiilor psihiatrice. Al doilea domeniu a fost legat de utilizările clinice ale MLT ca posibil agent terapeutic psihiatric. Ambele domenii au crescut împreună și, în același timp, cu mai mult sau mai puțin succes, în funcție de modul în care se obțineau cunoștințele privind funcțiile MLT. În ceea ce privește schizofrenia, studiile inițiale folosind injecții de extracte ale glandei pineale bovine [ 5 , 6 , 54 ] au dat curând loc utilizării preparatelor MLT pentru tratarea tulburărilor de somn schizofrenie [ 19 , 55 ] și dischineziei tardive [ 20 , 56 ]. În următoarele două secțiuni, ambele aspecte ale MLT, ca marker și ca agent terapeutic, vor fi revizuite în profunzime.

3. MLT ca marker al schizofreniei

Două aspecte ale MLT ca marker al schizofreniei merită să fie menționate. În primul rând, cercetările studiază nivelul MLT în anumite perioade de timp sau doar puncte de timp specifice [ 57 – 59 ]. Acest tip de cercetare nu este dificil de efectuat, deoarece pacienții sunt prelevate de câteva ori pe parcursul zilei. Al doilea grup de cercetare a încercat să studieze parametrii ritmului circadian al MLT, cum ar fi MESoR, debutul MLT cu lumină slabă (DLMO), decalarea slabă a MLT (DLMOff) și acrofaza sau nadirul, doar pentru a menționa unele dintre lor. Aceste tipuri de studii necesită eșantionarea pacienților de mai multe ori în timpul zilei și noaptea [ 17 , 60 ]. Ținând cont de faptul că acești subiecți sunt bolnavi, uneori bolnavi de acut, nu este ușor să obțineți mai multe măsuri ale probei biologice (sângele, urina și saliva sunt cele mai frecvente fluide biologice prelevate) unde trebuie măsurată MLT.

Cel mai frecvent rezultat raportat al MLT ca marker al bolii este faptul că pacienții schizofrenici prezintă niveluri mai mici de MLT pe timp de noapte decât controalele sănătoase [ 15 , 59 – 62 ]. Un ritm normal de zi / noapte MLT [ 18 , 63 ], mai mic dimineața devreme (07: 00-08: 00 am) Nivelurile de MLT [ 58 ] și nici o diferență între subiecții sănătoși și schizofreni [ 64 , 65 ] au fost de asemenea raportate. O posibilă explicație pentru „sindromul MLT scăzut” prezent la unii pacienți schizofrenici poate rezulta din studiul enzimelor implicate în producția de MLT de la 5HT, AANAT și hidroxindol- O -metil-transferază (HIOMT). Smith și colab . 66 ] a studiat activitatea enzimelor pineale a serotoninei N-acetiltransferaza (SNAT) și HIOMT din autopsia creierului a 11 pacienți schizofreni și 67 de subiecți care nu sunt schizofrenici. Ei au descoperit că schizofrenicii comparativ cu controalele au ridicat activitatea HIOMT cu aproximativ 25%. Autorii sugerează că o lipsă de substrat sau o activitate anormal de scăzută a unei enzime înainte de HIOMT în biosinteza MLT ar putea explica concentrațiile scăzute de MLT observate.

Nivelurile MLT au fost, de asemenea, utilizate pentru a diferenția subtipurile clinice de schizofrenie. Sa raportat că subtipul paranoic are niveluri mai mici de MLT decât subiecții sănătoși [ 61 ], precum și niveluri similare cu controalele sănătoase [ 64 ]. Studiile efectuate cu alte subtipuri clinice includ probe mici [ 62 ]; prin urmare, orice concluzie provenită din ele este greu de generalizat.

Efectul medicației antipsihotice asupra MLT a fost, de asemenea, studiat. S-a raportat că tratamentul antipsihotic crește concentrațiile de MLT in vivo [ 14 ] și in vitro [ 67 ]. Cu toate acestea, studiul medicamentelor naive (pacienți care nu au fost niciodată tratați cu antipsihotice) sau a pacienților fără medicamente nu este o sarcină ușoară în psihiatrie din motive etice. Nu au fost raportate diferențe în concentrațiile de CSF ale MLT în rândul pacienților medicate și fără medicamente și controale sănătoase [ 64 ]. Pacienții schizofrenici fără medicamente nu prezintă modificări ale nivelului lor de MLT după ce au fost tratați cu antipsihotice tipice [ 16 , 62 ]. Tratamentul cu olanzapină, un antipsihotic atipic, nu a afectat ritmul circadian MLT al unui grup de pacienți schizofrenici fără medicamente [ 18 ]. Quetiapina, un alt antipsihotic atipic, nu afectează secreția MLT la subiecții sănătoși [ 68 ]. Pacientii naivi, retrasi si tratati cu medicamente (schizofrenic si schizoafectiv) pe antipsihoticele tipice au niveluri similare de concentratii de MLT din sange [ 58 ]. Considerăm că problema studierii efectului antipsihoticelor asupra nivelurilor MLT provine de la faptul că politerapia (folosind mai multe medicamente în același timp) în loc de monoterapie în tratamentele de schizofrenie este regula, nu excepția [ 69 ]. Pentru a evita această problemă, conversia diferitelor doze antipsihotice într-o doză echivalentă de clorpromazină a fost făcută de unii autori [ 56 , 60 , 70 ]. Această abordare ar putea ajuta la compararea diferitelor doze antipsihotice, dar informațiile despre specificul fiecărui antipsihotic s-ar pierde. De exemplu, olanzapina (un antipsihotic atipic) a fost raportată să nu afecteze nivelurile de MLT la pacienții tratați cu schizofrenie [ 18 ], în timp ce pacienții tratați cu clorpromazină (un tip antipsihotic tipic) au prezentat concentrații crescute de MLT [ 13 ].

Simptomele psihiatrice (psihopatologie) au fost, de asemenea, legate de concentrațiile de MLT. Scorul total al Scalei scurte de evaluare psihiatrică (BPRS) s-a corelat pozitiv cu concentrațiile de CSF ale MLT [ 64 ]. Nu au fost raportate corelații între scorul total al BPRS și MLT [ 60 , 61 ]. Simptomele pozitive și negative, măsurate cu Scala pentru evaluarea simptomelor pozitive (SAPS) și Scala pentru evaluarea simptomelor negative (SANS) nu s-au corelat cu zona MLT de sub curbă (ASC) [ 62 ]. Nu au fost raportate corelații între nivelurile MLT și SANS, SAPS și Scala sindromului pozitiv și negativ (PANSS) [ 71 ]. Simptomele negative măsurate cu subscala negativă a PANSS nu se corelează cu concentrațiile de MLT [ 18 ]. Rezumând, psihopatologia, măsurată ca cele două mari sindroame schizofrenice (pozitive / negative), nu pare să fie legată de concentrațiile de MLT. În opinia noastră, rezultatele negative se pot datora faptului că scalele pe care le folosesc psihiatrii sunt concentrate mai mult pe studiul sindroamelor schizofrenice (pozitive / negative) decât pe studiul simptomelor specifice. Prezența / absența corelațiilor dintre concentrațiile MLT și scala totală a scorurilor (BPRS, PANSS) este dificil de interpretat, deoarece acestea nu măsoară sindroamele schizofrenice, ci gravitatea simptomelor globale.

Numărul de studii publicate pe MLT ca marker al ritmului circadian al schizofreniei este scăzut în comparație cu studiile publicate pe MLT ca un marker al ritmului circadian al schizofreniei. Mai mult, majoritatea datelor privind MLT ca marker ritmic circadian în schizofrenie au fost publicate pe studii efectuate pe probe relativ mici. A fost raportat un avans de fază al ritmului MLT la pacienții schizofrenici fără tratament medicamentos și antipsihotic [ 17 , 60 , 72 ]. Au fost raportate și alte modele de secreție anormală de MLT. Vârfurile anormale ale MLT diurne la orele 10:00 și 18:00 și o eliminare completă a secreției nocturne de MLT au fost de asemenea raportate [ 60 ]. În gemenii monozigotici discordanți pentru schizofrenie, gemenii cu schizofrenie au prezentat o producție de MLT mai mică și un prag scăzut de DLMO (DLMO ❤ pg / ml) în comparație cu gemenul neafectat, care a prezentat o creștere normală nocturnă [ 73 ]. Cu toate acestea, într-un alt studiu publicat un an mai târziu [ 65 ], aceiași autori nu au raportat diferențe între pacienții schizofrenici și subiecții sănătoși în DLMO, precum și nivelul de MLT măsurat pe oră în salivă de la 20:00 la 23:00 pm. În cele din urmă, un document recent [ 70 ] a raportat existența a două subgrupuri de pacienți cu schizofrenie paranoidă. Subgrupa I a avut un model similar de secreție MLT cu grupul de control, în timp ce subgrupul II a avut un avans de fază a secreției de MLT în comparație cu faza MLT a subiecților sănătoși. Tabelul 1 rezumă rolul MLT ca marker de schizofrenie.

tabelul 1

Rolul melatoninei ca marker al schizofreniei.

Utilizare Referințe
Marker biologic al bolii 15 , 18 , 57 – 65 ]
Subtipuri de schizofrenie clinică 61 , 62 , 64 ]
Efect antipsihotic 13 , 14 , 16 , 18 , 56 , 58 , 60 , 62 , 64 , 70 ]
Simptome psihiatrice 18 , 60 – 62 , 64 , 71 ]
Ritmurile circadiene 17 , 60 , 65 , 70 , 72 , 73 ]

Informațiile clinice actuale ale MLT ca marker biologic al schizofreniei sunt controversate. În opinia noastră, cercetările viitoare privind MLT ca marker al schizofreniei ar trebui să țină seama de următoarele recomandări:

  1. Trebuie evitat amestecul de diagnostic clinic (schizofrenie, tulburări de spectru schizoafrenic și schizofrenie). Din punct de vedere clinic, deși diagnosticele menționate anterior sunt psihiatrice, tulburările schizoafective sunt subdivizate în alte tipuri (maniacale, depresive și mixte), în timp ce tulburările din spectrul schizofreniei cuprind diferite categorii (tulburare schizofreniformă, tulburare delirantă, schizotip, schizoid și ersonalitate paranoidă) ). Prin urmare, a avea diagnosticul clinic cel mai omogen ar contribui la clarificarea relațiilor dintre schizofrenie și MLT.

  2. Pentru a cunoaște diferențele posibile ale MLT între tipurile clinice de schizofrenie, studiile ar trebui să cuprindă toate subtipurile de schizofrenie. Deoarece schizofrenia paranoidă este cel mai răspândit subtip de schizofrenie, ar trebui să se depună eforturi pentru a aduna subtipurile de schizofrenie mai puțin răspândite (de exemplu, catatonice, hebrafrenice, reziduale etc. ). În acest punct nu se poate ajunge la nici o concluzie dacă studiile care conțin acele subtipuri de schizofrenie conțin doar câțiva subiecți.

  3. Studiile de cercetare nu trebuie să se concentreze doar pe sindroame psihotice, ci și pe simptome psihotice. Raportarea scorurilor totale ne oferă o idee globală despre intensitatea psihopatologiei, dar studiul simptomelor specifice (iluzii, halucinații, afectare contondentă etc. ) ar adăuga informații mai valoroase decât o simplă măsură globală care are o interpretare mai dificilă din punct de vedere clinic. În plus, problema utilizării unor scale diferite pentru măsurarea psihopatologiei ar fi rezolvată, cel puțin parțial, deoarece simptomele individuale ar putea fi comparate fără interferența folosirii unor scale diferite.

  4. Studiile clinice ar trebui să se concentreze pe măsurile totale ale MLT (urina este mai puțin invazivă) și nu ritmurile circadiene, deoarece acestea sunt mai complexe în implementarea lor. În ceea ce ne privește, mediul clinic, ca pacienți internați sau ambulatori, este un mediu dificil în care intervențiile continue (colectarea regulată a probelor biologice) sunt o sarcină dificilă de îndeplinit, din cauza stării mentale a pacienților. În experiența noastră, cu excepția cazului în care există un interes specific pentru studierea parametrilor circadieni (DLMO, DLMOff, acrofază etc. ), o măsură globală de MLT, de exemplu, colectarea urinei la fiecare 8 sau 12 ore, este o măsură rezonabilă a producției de MLT care poate fi utilizat cu ușurință în contextul clinic (ca marker biologic al simptomelor sau ca marker al răspunsului la tratament).

  5. Când este posibil, utilizarea monoterapiei este preferabilă folosirii politoterapiei. Mai mult, trebuie luat în considerare controlul altor medicamente psihiatrice, în afară de antipsihotice, deoarece antidepresivele, benzodiazepinele și stabilizatorii de dispoziție pot afecta concentrațiile de MLT.

  6. Probleme metodologice mai generale (controlul posturii corporale, expunerea la lumină, anticoagulante utilizate la recoltarea probelor de sânge etc. ) ar trebui incluse în studiul protocolului.

  7. În cele din urmă, nerespectarea reprezintă o mare problemă în psihiatrie (tratamente, diete, întâlniri etc. ). Nerespectarea protocolului de eșantionare ar trebui să fie luat în serios în considerare la efectuarea acestui tip de studii. Într-un context ambulatoriu, trebuie luate în considerare controale speciale cu procedura de eșantionare.

4. MLT ca agent terapeutic în schizofrenie

Utilizarea MLT ca agent terapeutic poate fi urmărită până în 1920, când un grup de pacienți cu „demență praecox” a fost tratat cu extracte de pină [ 4 ]. Între deceniile 1950 până la mijlocul anilor șaptezeci, MLT a fost utilizat sub formă de injecții de extract de pineal [ 5 , 54 ]. Mai multe lucrări de revizuire au fost publicate pe MLT și psihiatrie [ 3 , 74 ], dar foarte puține despre utilizarea MLT ca agent terapeutic în psihiatrie [ 75 , 76 ].

Unul dintre primele mecanisme de acțiune a MLT a fost legat de proprietățile sale hipnogene [ 77 ]. În afară de proprietățile hipnogene, MLT are și acțiuni de resincronizare. MLT a fost utilizat pentru a trata tulburările de ritm alergării libere [ 78 ], jet lag [ 79 ] și sindromul întârziat al fazei de somn [ 80 ], printre alte tulburări de ritm circadian.

Mai multe studii privind efectul terapeutic al MLT în schizofrenie au fost efectuate pe utilizarea MLT pentru tratamentul tulburărilor de somn. Efectul de 2 mg de control a eliberat MLT asupra mai multor parametri de somn la pacienții schizofrenici care s-au plâns de o calitate slabă a somnului și au îndeplinit criteriile de insomnie DSM-IV a fost studiat [ 19 ]. Eficiența somnului (procent din timpul total adormit în timp total în pat) s-a îmbunătățit semnificativ după tratamentul MLT comparativ cu tratamentul cu placebo. Cu toate acestea, latența somnului (cantitatea de timp necesară pentru a adormi după ce s-au stins luminile), timpul total de somn (timpul petrecut adormit după debutul somnului), trezirea după durata debutului somnului (timpul de excitare la somn după debutul somnului), indicele de fragmentare (procentul de episoade liniștite care sunt mai mici de 1 m față de numărul total de episoade liniștite în timpul patului) și numărul de treziri (numărul total de treziri în timpul somnului) nu au diferit semnificativ de placebo. S-a studiat și efectul a 3 mg de MLT la pacienții cu schizofrenie paranoică care s-au plâns de insomnie inițială [ 55 ]. Pacienții tratați cu MLT au arătat o reducere semnificativă a numărului de treziri nocturne și au dormit mai mult decât au făcut pacienții tratați cu placebo. În plus, în conformitate cu rezultatele chestionarelor de somn, subiecții care iau MLT în comparație cu placebo au redus semnificativ latența somnului, au îmbunătățit calitatea și profunzimea somnului și au experimentat o prospețime mai mare dimineața. MLT a fost, de asemenea, utilizat în studiul First Night Effect (FNE) (tendința pentru indivizi să doarmă mai rău decât normal în prima noapte de evaluare polisomnografică a somnului) la pacienții cu schizofrenie cronică81 ]. Placebo sau 2 mg de MLT eliberat de control au fost administrate pacienților înainte de un studiu polisomnografic în două zile consecutive. Comparativ cu placebo, tratamentul MLT a crescut latența rapidă a mișcării oculare (REM), scăderea eficienței somnului și durata de veghe în timpul somnului a fost mai mică în prima noapte decât în ​​a doua noapte. Aceste efecte nu au fost găsite atunci când pacienții au primit un placebo. Aceste rezultate arată că tratamentul MLT exagerează FNE la pacienții cu schizofrenie cronică.

MLT are proprietăți antioxidante directe și indirecte [ 82 – 84 ]. Deoarece pacienții schizofrenici sunt biochimic mai oxidati [ 85 – 87 ], nivelurile scăzute de MLT ar putea fi rezultatul reacției organismului care încearcă să compenseze statutul hiperooxidativ. Lucrări anterioare ale lui Altschule și colab . 48 , 88 ] au raportat că pacienții schizofrenici aveau un nivel scăzut de glutation, iar injecțiile de extracte de pin au corectat aceste deficiențe [ 48 ]. Pe baza rezultatelor studiilor in vitro , în care MLT a redus cu aproximativ 83% oxidarea enzimatică a dopaminei (DA) și cu aproximativ 35,7% autoxidarea DA, Hartley și Smith [ 89 ] au propus că MLT poate acționa ca un radical liber. scavenger, încetinind astfel rata de autoxidare.

Dischinezia tardivă (TD) este un efect secundar de debut tardiv asociat cu tratamentul antipsihotic tipic. În primii cinci ani de expunere la antipsihoticele tipice, se estimează că 3% -5% dintre pacienți vor dezvolta TD. Prevalența TD a fost estimată între 15% și 20% [ 90 ]. Fiziopatologia TD nu este bine definită. S-a sugerat că TD se datorează creșterii daunelor oxidative cauzate de generarea radicalilor liberi [ 91 ]. Au fost efectuate trei studii clinice pentru a evalua eficacitatea MLT ca antioxidant în tratamentul TD [ 20 , 56 , 92 ]. Au fost studiate câteva doze de MLT, precum și două formulări diferite. Două studii au utilizat MLT eliberat de control, 2 sau 10 mg20 , 92 ], în timp ce un studiu a utilizat 20 mg de MLT eliberata rapid56 ]. Dozele mici de MLT nu produc o îmbunătățire a mișcărilor anormale, în timp ce dozele mai mari produc o ameliorare a mișcărilor anormale. Studiile pe animale indică aceeași direcție. Șobolanii tratați cronic cu haloperidol au dezvoltat mișcări orale anormale, denumite mișcări de mestecare vacuoase (un model animal de TD). Numărul mișcărilor de mestecare vacu a fost inversat într-o manieră dependentă de doză MLT (1, 2 și 5 mg / kg) [ 93 ].

Creșterea benzodiazepinelor (BZD) nu este neobișnuită în tratamentul schizofreniei, în ciuda lipsei de dovezi ale utilității sale [ 94 ]. Utilizarea BZD nu este fără riscuri, dependența fiind una dintre ele [ 95 ]. MLT a fost utilizat pentru detoxifierea dependenței de BZD [ 96 , 97 ]. Există un studiu clinic aprobat conceput pentru a studia întreruperea BZD cu MLT la pacienții cu schizofrenie [ 98 ]. Din câte știm, singura lucrare publicată în care un agonist MLT (agomelatină) a fost utilizat pentru a suspenda tratamentul cu BZD la un pacient schizofrenic tratat cu antipsihotice și o doză mare de diazepam a fost publicată în 2010 [ 99 ]. Prin urmare, numărul mic de studii publicate pe întreruperea BZD în schizofrenie împiedică orice concluzie definitivă. Așteptăm cu nerăbdare rezultatele studiului clinic menționate mai sus. Tabelul 2 rezumă rolul MLT ca agent terapeutic al schizofreniei.

tabel 2

Rolul melatoninei ca agent terapeutic al schizofreniei.

Tratament Referințe
Schizofrenie tulburări de somn 19 , 55 , 81 ]
Dischinezie tardivă 20 , 56 , 92 ]
Întreruperea benzodiazepinelor 99 ]

Din punctul nostru de vedere, cercetările viitoare privind MLT ca opțiune de tratament în schizofrenie ar trebui să încerce să răspundă la următoarele întrebări:

  1. Care doze / doze sunt / sunt terapeutice?

  2. Există aspecte specifice ale bolii (simptome, subtipuri clinice, complicații etc. ) care ar putea beneficia de tratamentul MLT?

  3. Diferitele formulări ale MLT, de exemplu, eliberarea lentă / de control, eliberarea rapidă sau o combinație a ambelor, sunt la fel de eficiente?

Cantitatea mică de studii clinice care au fost publicate despre utilizarea MLT ca agent terapeutic în schizofrenie este surprinzătoare. Într-o recenzie recentă despre studiile umane în care s-a evaluat utilizarea clinică a MLT [ 100 ], nu există nicio referire la rolul MLT ca agent terapeutic în schizofrenie.

5. Concluzii și direcții viitoare

În rezumat, în ciuda faptului că MLT a fost descoperit și izolat în urmă cu mai bine de cincizeci de ani [ 47 ], rezultatele studiilor referitoare la MLT la schizofrenie par a fi destul de neconcludente. Este de remarcat faptul că utilizarea MLT ca medicament a fost aprobată de Agenția Europeană a Medicamentului în 2007 [ 101 ], însă cercetările privind aplicațiile sale terapeutice sunt foarte rare în comparație cu cercetările efectuate cu privire la rolul MLT ca marker al schizofreniei. În prezent, MLT poate fi măsurat cu tehnici biochimice ușoare și ieftine. Din câte știm, la om nu s-au raportat efecte dăunătoare importante când s-a administrat MLT în contextul clinic [ 39 , 102 ]. Este probabil ca atunci când utilizarea MLT ar fi mai generalizată în practica clinică, măsurarea MLT ar deveni un test de rutină, iar costurile ar fi chiar mai ieftine. Odată cu apariția recentă a noilor medicamente care vizează receptorii MLT (ramelteon, agomelatină, tasimelteon, etc ). Probabil vom ajuta în următorii ani o explozie care afectează această zonă de cercetare, în cercetarea de bază, studiile clinice și noile indicații clinice.

Referințe

1. Freedman R. Schizofrenia. N. Engl. J. Med. 2003; 349 : 1738–1749. PubMed ] Google Scholar ]
2. Wyatt RJ, Potkin SG, Kleinman JE, Weinberger DR, Luchins DJ, Jeste DV Sindromul schizofreniei. Exemple de instrumente biologice pentru subclasificare. J. Nerv. Ment. Dis. 1981; 169 : 100–112. PubMed ] Google Scholar ]
3. Mullen PE, Silman RE Pineala și psihiatria: o recenzie. Psychol. Med. 1977; 7 : 407–417. PubMed ] Google Scholar ]
4. Becker WH Epiglandol be demența praecox. Ther. Halbmonast. 1920; 34 : 667–668. Academic Google ]
5. Altschule MD Unele efecte ale extractelor apoase de substanță-pină de vită uscată cu acetonă în schizofrenia cronică. N. Engl. J. Med. 1957; 257 : 919–922. PubMed ] Google Scholar ]
6. Eldred SH, Bell NW, Sherman LJ Un studiu pilot care a comparat efectele extractului de pin și a unui placebo la pacienții cu schizofrenie cronică. N. Engl. J. Med. 1960; 263 : 1330–1335. PubMed ] Google Scholar ]
7. Metodologia Hardeland R. Melatonina în sistemul nervos central. Curr. Neuropharmacol. 2010; 8 : 168–181. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
8. McCord CP, Allen FP Evidențe care asociază funcția glandei pineale cu modificări ale pigmentării. J. Exp. Zool. 1917; 23 : 207–224. Academic Google ]
9. Bors O., Ralston WC O analiză simplă a extractelor de pin mamifere. Proc. Soc. Exp. Biol. Med. 1951; 77 : 807–808. PubMed ] Google Scholar ]
10. Lewy AJ, Markey SP Analiza melatoninei în plasma umană prin cromatografie în gaze spectrometrie de masă cu ionizare chimică negativă. Ştiinţă. 1978; 201 : 741–743. PubMed ] Google Scholar ]
11. Lynch HJ, Ozaki Y., Wurtman RJ Măsurarea melatoninei în țesuturile de mamifere și fluidele corporale. J. Transmul neural. Suppl. 1978; 13 : 251–264. PubMed ] Google Scholar ]
12. Thoresen TS Radioimunoanaliză pentru melatonină în serul uman. Scand. J. Clin. Lab. Investig. 1978; 38 : 687–692. PubMed ] Google Scholar ]
13. Smith JA, Mee TJ, Barnes JL Concentrații crescute de ser de melatonină la pacienții psihiatri tratați cu clorpromazină. J. Pharm. Pharmacol. 1977; 29 : 30. PubMed ] Google Scholar ]
14. Smith JA, Barnes JL, Mee TJ Efectul medicamentelor neuroleptice asupra concentrațiilor de melatonină din serul și lichidul cefalorahidian la subiecții psihiatrici. J. Pharm. Pharmacol. 1979; 31 : 246–248. PubMed ] Google Scholar ]
15. Fanget F., Claustrat B., Dalery J., Brun J., Terra JL, Marie-Cardine M., Guyotat J. Niveluri nocturne de melatonină în plasmă la pacienții schizofrenici. Biol. Psihiatrie. 1989; 25 : 499–501. PubMed ] Google Scholar ]
16. Robinson S., Rosca P., Durst R., Shai U., Ghinea C., Schmidt U., Nir I. Niveluri de melatonină serică la pacienții internați schizofreni și schizoafectivi. Acta Psihiatru. Scand. 1991; 84 : 221–224. PubMed ] Google Scholar ]
17. Rao ML, Gross G., Strebel B., Halaris A., Huber G., Braunig P., Marler M. Ritmul circadian al triptofanului, serotoninei, melatoninei și hormonilor hipofizari în schizofrenie. Biol. Psihiatrie. 1994; 35 : 151–163. PubMed ] Google Scholar ]
18. Mann K., Rossbach W., Muller MJ, Muller-Siecheneder F., Pott T., Linde I., Dittmann RW, Hiemke C. Profilele hormonale nocturne la pacienții cu schizofrenie tratate cu olanzapină. Psychoneuroendocrinology. 2006; 31 : 256–264. PubMed ] Google Scholar ]
19. Shamir E., Laudon M., Barak Y., Anis Y., Rotenberg V., Elizur A., ​​Zisapel N. Melatonin îmbunătățește calitatea somnului pacienților cu schizofrenie cronică. J. Clin. Psihiatrie. 2000; 61 : 373–377. PubMed ] Google Scholar ]
20. Shamir E., Barak Y., Shalman I., Laudon M., Zisapel N., Tarrasch R., Elizur A., ​​Weizman R. Melatonin tratament pentru dischinezie tardivă: Un studiu dublu-orb, controlat cu placebo, crossover . Arc. Gen. Psihiatrie. 2001; 58 : 1049–1052. PubMed ] Google Scholar ]
21. Csernus V., Mess B. Bioritmi și glanda pineală. Neuro Endocrinol. Lett. 2003; 24 : 404–411. PubMed ] Google Scholar ]
22. Morin LP, Allen CN Sistemul vizual circadian. Rez. Creier Rev. 2006; 51 : 1-60. PubMed ] Google Scholar ]
23. Moore RY Controlul neuronal al glandei pineale. Behav. Rez. Creier 1996; 73 : 125–130. PubMed ] Google Scholar ]
24. Klein DC, Weller JL, Moore RY Metabolismul melatoninei: Reglarea neurală a serotoninei pineale: Acenzilacenzima o activitate N-acetil-transferază. Proc. Nat. Acad. Sci. STATELE UNITE ALE AMERICII. 1971; 68 : 3107–3110. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
25. Klein DC, Schaad NL, Namboordiri MA, Yu L., Weller JL Reglarea activității serotoninei pineale N-acetiltransferază. Biochem. Soc. Trans. 1992; 20 : 299–304. PubMed ] Google Scholar ]
26. Klein DC, Coon SL, Roseboom PH, Weller JL, Bernard M., Gastel JA, Zatz M., Iuvone PM, Rodriguez IR, Bégay V., și colab. Enzima generatoare de ritm de melatonină: Reglarea moleculară a serotoninei N-acetiltransferaza în glanda pineală. Progresul recent Horm. Res. 1997; 52 : 307–357. PubMed ] Google Scholar ]
27. Martin XD, Malina HZ, Brennan MC, Hendrikson PH, Lichter PR Corpul ciliar al treilea organ găsit pentru a sintetiza indoleaminele la om. Euro. J. Oftalmol. 1992; 2 : 67–72. PubMed ] Google Scholar ]
28. Cagnacci A. Melatonina în raport cu fiziologia la omul adult. J. Pineal Res. 1996; 21 : 200–213. PubMed ] Google Scholar ]
29. Menendez-Pelaez A., Reiter RJ Distribuția melatoninei în țesuturile mamiferelor: Importanța relativă a localizării nucleare versus citosolice. J. Pineal Res. 1993; 15 : 59–69. PubMed ] Google Scholar ]
30. Konturek SJ, Konturek PC, Brzozowski T., Bubenik GA Rolul melatoninei în tractul gastrointestinal superior. J. Physiol. Pharmacol. 2007; 58 : 23–52. PubMed ] Google Scholar ]
31. Radogna F., Diederich M., Ghibelli L. Melatonina: o moleculă pleiotropă care reglează inflamația. Biochem. Pharmacol. 2010; 80 : 1844–1852. PubMed ] Google Scholar ]
32. Reiter RJ Melatonina: expresia chimică a întunericului. Mol. Cell. Endocrinol. 1991; 79 : C153 – C158. PubMed ] Google Scholar ]
33. Leja-Szpak A., Jaworek J., Pierzchalski P., Reiter RJ Melatonina induce o cale de semnalizare pro-apoptotică în celulele carcinomului pancreatic uman (PANC-1) J. Pineal Res. 2010; 49 : 248–255. PubMed ] Google Scholar ]
34. Dominguez-Rodriguez A., Abreu-Gonzalez P., Sanchez-Sanchez JJ, Kaski JC, Reiter RJ Melatonină și biologie circadiană în bolile cardiovasculare umane. J. Pineal Res. 2010; 49 : 14–22. PubMed ] Google Scholar ]
35. Hardeland R. Neurobiologie, fiziopatologie și tratamentul deficienței și disfuncției de melatonină. Sci. World J. 2012; 2012 doi: 10.1100 / 2012/640389. Articol gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
36. Sanchez-Barcelo EJ, Mediavilla MD, Alonso-Gonzalez C., Reiter RJ Melatonina folosește în oncologie: prevenirea cancerului de sân și reducerea efectelor secundare ale chimioterapiei și radiațiilor. Opinia expertului. Investig. Droguri. 2012; 21 : 819–831. PubMed ] Google Scholar ]
37. Bellipanni G., Bianchi P., Pierpaoli W., Bulian D., Llya E. Efectele melatoninei la femeile cu perimenopauză și menopauză: Un studiu randomizat și controlat cu placebo. Exp. Gerontol. 2001; 36 : 297–310. PubMed ] Google Scholar ]
38. Nonomiya T., Iwatani N., Tomoda A., Miike T. Efectele melatoninei exogene asupra hormonilor hipofizari la om. Clin. Physiol. 2001; 21 : 292-299. PubMed ] Google Scholar ]
39. Seabra ML, Bignotto M., Pinto LR, Tufik S. Studiu clinic randomizat, dublu-orb, controlat cu placebo, al toxicologiei tratamentului cu melatonină cronică. J. Pineal Res. 2000; 9 : 193–200. PubMed ] Google Scholar ]
40. Dubocovich ML, Delagrange P., Krause DN, Sugden D., Cardinali DP, Olcese J. Uniunea Internațională de Farmacologie de bază și clinică. LXXV. Nomenclatura, clasificarea și farmacologia receptorilor G de melatonină cuplată cu proteine ​​G. Pharmacol. Rev. 2010; 62 : 343–380. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
41. Tan DX, Manchester LC, Terron MP, Flores LJ, Reiter RJ O moleculă, multe derivate: O interacțiune fără sfârșit de melatonină cu oxigen reactiv și specii de azot? J. Pineal Res. 2007; 42 : 28–42. PubMed ] Google Scholar ]
42. Galano A., Tan DX, Reiter RJ Melatonina ca un aliat natural împotriva stresului oxidativ: Un examen fizico-chimic. J. Pineal Res. 2011; 51 : 1–16. PubMed ] Google Scholar ]
43. Tan DX, Manchester LC, Hardeland R., Lopez-Burillo S., Mayo JC, Sainz RM, Reiter RJ Melatonina: un hormon, un factor tisular, un autocoid, un paracoid și o vitamină antioxidantă. J. Pineal Res. 2003; 34 : 75–78. PubMed ] Google Scholar ]
44. Rodriguez C., Mayo JC, Sainz RM, Antolín I., Herrera F., Martín V., Reiter RJ Reglarea enzimelor antioxidante: Un rol semnificativ pentru melatonină. J. Pineal Res. 2004; 36 : 1–9. PubMed ] Google Scholar ]
45. Rosen C., Grossman LS, Harrow M., Bonner-Jackson A., Faull R. Semnificația diagnostică și prognostică a simptomelor de prim rang schneiderian: Un studiu longitudinal de 20 de ani al schizofreniei și tulburării bipolare. Compr. Psihiatrie. 2011; 52 : 126–131. PubMed ] Google Scholar ]
46. McIsaac WM Un concept biochimic al bolilor mintale. Dupa absolvire. Med. 1961; 30 : 111–118. PubMed ] Google Scholar ]
47. Lerner AB, Cazul JD, Takahashi Y., Lee TH, Mori W. Izolarea melatoninei, factorul glandei pineale care luminează melanocitele. J. Am. Chem. Soc. 1958; 80 : 2587. Academic Google ]
48. Altschule MD, Siegel EP, Goncz RM, Murname JP Efectul extractelor pineale asupra nivelului de glutation din sânge la pacienții psihotici. Arh. AMA Neural. Psihiatrie. 1954; 71 : 615–618. PubMed ] Google Scholar ]
49. Miles A., Philbrick DR Melatonină și psihiatrie. Biol. Psihiatrie. 1988; 23 : 405–425. PubMed ] Google Scholar ]
50. Barchas J. Studii privind relația melatoninei cu somnul. Proc. West. Pharmacol. Soc. 1968; 11 : 22. PubMed ] Google Scholar ]
51. Hipkin LJ Efectul 5-metoxitriptopolului și melatoninei asupra răspunsurilor în greutate uterină la gonadotrofina corionică umană. J. Endocrinol. 1970; 48 : 287–288. PubMed ] Google Scholar ]
52. Smythe GA, Lazarus L. Supresia secreției de hormoni de creștere umană prin melatonină și cyproheptadină. J. Clin. Investig. 1974; 54 : 116–121. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
53. Nordlund JJ, Lerner AB Efectele melatoninei orale asupra culorii pielii și asupra eliberării hormonilor hipofizari. J. Clin. Endocrinol. Metab. 1977; 45 : 768–774. PubMed ] Google Scholar ]
54. Bigelow LB Efectele extractului apos de pin în schizofrenia cronică. Biol. Psihiatrie. 1974; 8 : 5–15. PubMed ] Google Scholar ]
55. Suresh Kumar PN, Andrade C., Bhakta SG, Singh NM Melatonina în ambulatorii schizofrenici cu insomnie: Un studiu dublu-orb, controlat cu placebo. J. Clin. Psihiatrie. 2007; 68 : 237–241. PubMed ] Google Scholar ]
56. Castro F., Carrizo E., Prieto de RD, Rincon CA, Asian T., Medina-Leendertz S., Bonilla E. Eficacitatea melatoninei în dischinezia tardivă. Investi. Clin. 2011; 52 : 252–260. PubMed ] Google Scholar ]
57. Diaz-Mesa E., Morera-Fumero AL, Abreu-Gonzalez P., Jimenez-Sosa A., Henry M., Fernandez-Lopez L., Intxausti A., Gracia-Marco R. Sezonul concentrațiilor serice de melatonină în internat schizofrenic paranoic. Euro. Neuropsychopharmacol. 2010; 20 : S452. Academic Google ]
58. Rao ML, Gross G., Strebel B., Braunig P., Huber G., Klosterkotter J. Aminoacizi serici, monoamine centrale și hormoni la pacienții schizofrenici fără droguri și fără tratament cu neuroleptice și sanatosi subiecți. Psihiatrie Res. 1990; 34 : 243–257. PubMed ] Google Scholar ]
59. Ferrier IN, Johnstone EC, Crow TJ, Arendt J. Melatonină / cortizol în bolile psihiatrice. Lancet. 1982; 1 : 1070. PubMed ] Google Scholar ]
60. Jiang HK, Wang JY Profilele secreției de melatonină diurnă și cortizol la pacienții cu schizofrenie medicate. J. Formos. Med. Conf. 1998; 97 : 830–837. PubMed ] Google Scholar ]
61. Monteleone P., Maj M., Fusco M., Kemali D., Reiter RJ Depresionează nivelurile nocturne de melatonină plasmatică în schizofrenicele paranoide fără medicamente. Schizophr. Res. 1992; 7 : 77–84. PubMed ] Google Scholar ]
62. Monteleone P., Natale M., La Rocca A., Maj M. Scăderea secreției nocturne de melatonină în schizofrenicele fără medicamente: Nicio schimbare după tratamentul subcronic cu antipsihotice. Neuropsychobiology. 1997; 36 : 159–163. PubMed ] Google Scholar ]
63. Vigano D., Lissoni P., Rovelli F., Roselli MG, Malugani F., Gavazzeni C., Conti A., Maestroni G. Un studiu al ritmului ușor / întunecat al melatoninei în raport cu secreția de cortizol și prolactină în schizofrenie . Neuro Endocrinol. Lett. 2001; 22 : 137–141. PubMed ] Google Scholar ]
64. Beckmann H., Wetterberg L., Gattaz WF Imunoreactivitate la melatonină în lichidul cefalorahidian al pacienților schizofreni și controale sănătoase. Psihiatrie Res. 1984; 11 : 107–110. PubMed ] Google Scholar ]
65. Afonso P., Figueira ML, Paiva T. Acțiune care favorizează somnul melatoninei endogene în schizofrenie în comparație cu controalele sănătoase. Int. J. Clinica de psihiatrie. Pract. 2011; 15 : 311–315. PubMed ] Google Scholar ]
66. Smith JA, Mee TJ, Padwick DJ, Spokes EG Activitate umană post-mortem enzimă pineală. Clin. Endocrinol. 1981; 14 : 75–81. PubMed ] Google Scholar ]
67. Nir I., Hirschmann N. Efectul medicamentelor psihotrofe asupra metabolismului triptofanului [14C] în glanda pineală a șobolanului cultivat. Biochem. Pharmacol. 1983; 32 : 2139–2141. PubMed ] Google Scholar ]
68. Cohrs S., Pohlmann K., Guan Z., Jordan W., Meier A., ​​Huether G., Ruther E., Rodenbeck A. Quetiapina reduce excreția nocturnă de cortizol urinar la subiecți sănătoși. Psychopharmacology. 2004; 174 : 414–420. PubMed ] Google Scholar ]
69. Tani H., Uchida H., Suzuki T., Fujii Y., Mimura M. Intervenții pentru reducerea polifarmaciei antipsihotice: o revizuire sistematică. Schizophr. Res. 2013; 143 : 215–220. PubMed ] Google Scholar ]
70. Wulff K., Dijk DJ, Middleton B., Foster RG, Joyce EM Sleep și perturbarea ritmului circadian în schizofrenie. Br. J. Psihiatrie. 2012; 200 : 308–316. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
71. Bersani G., Mameli M., Garavini A., Pancheri P., Nordio M. Reducerea diferenței de noapte / zi în nivelurile de sânge de melatonină ca posibil indice legat de boală în schizofrenie. Neuro Endocrinol. Lett. 2003; 24 : 181-184. PubMed ] Google Scholar ]
72. Wirz-Justice A., Cajochen C., Nussbaum P. Pacient schizofrenic cu un ciclu de activitate de odihnă circadiană. Psihiatrie Res. 1977; 73 : 83–90. PubMed ] Google Scholar ]
73. Afonso P., Brissos S., Figueira ML, Paiva T. Niveluri discrete de melatonină nocturnă în gemenii monozigotici discordanți pentru schizofrenie și impactul acesteia asupra somnului. Schizophr. Res. 2010; 120 : 227–228. PubMed ] Google Scholar ]
74. Pacchierotti C., Iapichino S., Bossini L., Pieraccini F., Castrogiovanni P. Melatonina în tulburări psihiatrice: O revizuire a implicării melatoninei în psihiatrie. Față. Neuroendocrinol. 2001; 22 : 18–32. PubMed ] Google Scholar ]
75. Morera A., Henry M., Abreu P., Gracia R. Melatonină Utilizare terapeutică în psihiatrie: Un studiu bibliografic de 39 de ani. Actas Esp Psiquiatr. 2006; 34 : 344–351. PubMed ] Google Scholar ]
76. Maldonado MD, Reiter RJ, Perez-San-Gregorio MA Melatonina ca potențial agent terapeutic în bolile psihiatrice. Zumzet. Psychopharmacol. 2009; 24 : 391–400. PubMed ] Google Scholar ]
77. Lushington K., Pollard K., Lack L., Kennaway DJ, Dawson D. Administrarea melatoninei în timpul zilei la adormi bătrâni buni și săraci: Efecte asupra temperaturii nucleare și latenței somnului. Dormi. 1997; 20 : 1135–1144. PubMed ] Google Scholar ]
78. Arendt J., Aldhous M., Wright J. Sincronizarea unui ciclu perturbat de somn-veghe la un orb prin tratament cu melatonină. Lancet. 1988; 1 : 772–773. PubMed ] Google Scholar ]
79. Arendt J., Aldhous M., Marcaje V. Alleviarea jet lag-ului prin melatonină: Rezultate preliminare ale studiului dublu orb controlat. BMJ. 1986; 292 : 1170. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
80. Kayumov L., Brown G., Jindal R., Buttoo K., Shapiro CM Studiu crossover randomizat, dublu-orb, controlat cu placebo, al efectului melatoninei exogene asupra sindromului întârziat al fazei de somn. Psychosom. Med. 2001; 63 : 40–48. PubMed ] Google Scholar ]
81. Shamir E., Rotenberg VS, Laudon M., Zisapel N., Elizur A. Efectul primei nopți a tratamentului cu melatonină la pacienții cu schizofrenie cronică. J. Clin. Psychopharmacol. 2000; 20 : 691–694. PubMed ] Google Scholar ]
82. Antolin I., Rodriguez C., Sainz RM, Mayo JC, Uria H., Kotler ML, Rodriguez-Colunga MJ, Tolivia D., Menendez-Pelaez A. Melatonina neurohormone previne deteriorarea celulelor: Efectul asupra expresiei genice pentru enzimele antioxidante . FASEB J. 1996; 10 : 882–890. PubMed ] Google Scholar ]
83. Tan DX, Manchester LC, Reiter RJ, Plummer BF 3-hidroximelatonină ciclică: un metabolit melatonină generat ca urmare a scăpării radicalilor hidroxil. Biol. Recepția semnalelor. 1999; 8 : 70–74. PubMed ] Google Scholar ]
84. Millan-Plano S., Piedrafita E., Miana-Mena FJ, Fuentes-Broto L., Martinez-Ballarin E., Lopez-Pingarron L., Saenz MA, Garcia JJ Melatonina și compușii legați structural protejează membranele sinaptosomale de deteriorarea radicalilor liberi. Int. J. Mol. Sci. 2010; 11 : 312–328. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
85. Dietrich-Muszalska A., Olas B., Rabe-Jablonska J. Stres oxidativ în trombocitele de sânge de la pacienții schizofrenici. Trombocitele. 2005; 16 : 386–391. PubMed ] Google Scholar ]
86. Yao JK, Leonard S., Reddy R. Alterarea stării redox a glutationului în schizofrenie. Dis. Markeri. 2006; 22 : 83–93. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
87. Korotkova EI, Misini B., Dorozhko EV, Bukkel MV, Plotnikov EV, Linert W. Studiul radicalilor OH în sângele seric al persoanelor sănătoase și al celor cu schizofrenie patologică. Int. J. Mol. Sci. 2011; 12 : 401–410. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
88. Altschule MD, Siegel EP, Hennneman DH Nivelul glutationului din sânge în boli mintale înainte și după tratament. Arh. AMA Neural. Psihiatrie. 1952; 67 : 64–68. PubMed ] Google Scholar ]
89. Hartley R., Smith JA Inhibarea oxidării catecolaminei prin indoli. Biochem. Pharmacol. 1972; 21 : 2007–2012. PubMed ] Google Scholar ]
90. Kane JM, Woerner M., Lieberman J. Diskinezie tardivă: prevalență, incidență și factori de risc. Psychopharmacology. 1985; 2 : 72–78. PubMed ] Google Scholar ]
91. Cadet JL, Kahler LA Mecanisme radicale libere în schizofrenie și dischinezie tardivă. Neurosci. Biobehav. Rev. 1994; 18 : 457–467. PubMed ] Google Scholar ]
92. Shamir E., Barak Y., Plopsky I., Zisapel N., Elizur A., ​​Weizman A. Este eficient tratamentul cu melatonină pentru dischinezia tardivă? J. Clin. Psihiatrie. 2000; 61 : 556–558. PubMed ] Google Scholar ]
93. Naidu PS, Singh A., Kaur P., Sandhir R., Kulkarni SK Mecanism posibil de acțiune în atenuarea melatoninei dischineziei orofaciale indusă de haloperidol. Pharmacol. Biochem. Behav. 2003; 74 : 641–648. PubMed ] Google Scholar ]
94. Volz A., Khorsand V., Gillies D., Leucht S. Benzodiazepine pentru schizofrenie. Baza de date Cochrane Syst. Rev. 2007; 2007 : CD006391. PubMed ] Google Scholar ]
95. Petursson H., Lader MH Retragere din tratamentul pe termen lung cu benzodiazepină. Br. Med. J. 1981; 283 : 643–645. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
96. Dagan Y., Zisapel N., Nof D., Laudon M., Atsmon J. Inversarea rapidă a toleranței la hipnoticele benzodiazepinei prin tratament cu melatonină orală: Un raport de caz. Euro. Neuropsychopharmacol. 1997; 7 : 157–160. PubMed ] Google Scholar ]
97. Garfinkel D., Zisapel N., J. Wainstein, Laudon M. Facilitarea întreruperii benzodiazepinei prin melatonină: O nouă abordare clinică. Arc. Intern. Med. 1999; 159 : 2456–2460. PubMed ] Google Scholar ]
98. Baandrup L., Fagerlund B., Jennum P., Lublin H., Hansen JL, Winkel P., Gluud C., Oranje B., Glenthoj BY Melatonină cu eliberare prelungită față de placebo pentru întreruperea benzodiazepinei la pacienții cu schizofrenie: A studiu clinic randomizat – Protocolul de studiu SMART. BMC Psihiatrie. 2011; 11 : 160. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
99. Morera-Fumero AL, Diaz-Mesa E., Abreu-Gonzalez P., Henry M., Yelmo S., Fernandez-Lopez L., Gracia-Marco R. Agomelatina facilitează întreruperea benzodiazepinei în schizofrenie cu insomnie severă. Euro. Psihiatrie. 2010; 25 : 932. Academic Google ]
100. Sanchez-Barcelo EJ, Mediavilla MD, Tan DX, Reiter RJ Utilizări clinice ale melatoninei: Evaluarea studiilor umane. Curr. Med. Chem. 2010; 17 : 2070–2095. PubMed ] Google Scholar ]
101. Agenția Europeană a Medicamentelor (EMA) Melatonină. EMA; Londra, Marea Britanie: 2007. Google Scholar ]
102. Morera AL, Henry M., de La Varga M. Siguranța în utilizarea melatoninei. Actas Esp Psiquiatr. 2001; 29 : 334–337. PubMed ] Google Scholar ]

Articole din Jurnalul Internațional de Științe Moleculare sunt oferite aici, prin autoritatea Institutului Multidisciplinar de Editare Digitală (MDPI)

IMPORTANTA DETOXIFIERII CANCER

Cancerul este o boala degenerativa si toate bolile degenerative trebuie să fie tratate în așa fel încât întregul corp sa fie detoxificat. Un corp toxic și necurat slăbește sistemul imunitar al organismului – prima linie de apărare.

Prin definitie, daca aceti cancer aveti deja un corp foarte acid si toxic ce a permis cancerului sa apara. Cancerul, odata intalat, cauzeaza si mai multe toxine si aciditate.

Chimioterapia este, de asemenea, prin definitie, foarte toxica->intoxica tot corpul, nu face diferenta.

Dar si tratementele alternative ce omoara celulele canceroase elibereaza o cascadă de toxine care sunt eliberate atunci când celulele canceroase mor.

Continuă lectura

Tratamente pe baza de miere ca transportor

miere

A se vedea cauzele cancerului- glucoza si  celulele canceroase , pentru a intelege cum actioneaza acest tratament cancer .

Voi rezuma:

celulele canceroase nu pot utiliza oxigenul la arderi si produce energie si, pentru a supravietui fermenteaza glucoza ca sursa principala de energie ATP. Acestea au nevoei si folosesc de pina la 15 ori mai multa glucoza decat celulele sanatoase pentru a supravietui. Mierea este un glucid.

Mierea este atât anti-cancerigena și duce ucigasii de cancer, amestecati in ea, in interiorul celulelor canceroase.

Celule sanatoase nu sunt afectate iar celulele canceroase sunt vindecate, nu sunt omorate (sunt omorati doar microbii din ele care le modifica respiratia).

Alaturi de cura de struguri (click aici) si unele tratamente cancer electromedicale descrise in carte acesta este cel mai SIGUR (NON- toxic) mod pentru organism a vindeca de cancer.

Datorita NON -toxicitatii, dozele pentru astfel de tratamente  cancer pot fi crescute foarte mult, ele pot fi combinate intre ele si se pot include alaturi de aproape orice alt tratament cancer.

Continuă lectura

Prelungirea vietii de pina la 16 ori Vitamina C in cancer – Dr. Avram Hoffer,Dr. Linus Pauling,Dr Ewan Cameroon, Dr . Tomas Levy protocoalele vitamina c IntraVenos dr Riordan, Dr Rath

pentru ca unii ‘specialisti cu diploma’ spun NU la vitamina c in cancer propun celor sceptici urmatoarele :

Vitamina C intravenoasă și cancer – O analiză sistematică

cercetarile efectuate de SINGURUL LAUREAT A DOUA PREMII NOBEL NEDIVIZATE (LINUS PAULING) precum si de

DR RIORDAN ( peste 40.000 cazuri tratate cu vitamina C IV)  si de

Dr Rath si

alte cazuri clinice

in plus iata ce declara in consens intr-un studiu/revizuire studii PubMed din 2017 35 oncologi SUA referitor aplicabilitatea/eficienta vitamina C in cancer -citez :

rezumat

Ascorbatul farmacologic a fost propus ca un potențial agent anticancer când este combinat cu radiații și chimioterapie. Efectele anticanceroase ale ascorbatului sunt presupuse a implica autoxidarea ascorbatului conducând la creșterea concentrațiilor de H 2 O 2 la starea de echilibru; cu toate acestea, mecanismul (mecanismele) pentru toxicitatea selectivă a celulelor canceroase rămâne necunoscut. Studiul actual arată că modificările metabolismului oxidativ mitocondrial al celulelor canceroase care au ca rezultat creșterea nivelurilor de O2 • – și H 2 O 2 sunt capabile să perturbe metabolismul intracelular al fierului, sensibilizând selectiv cancerul pulmonar fara celule mici (NSCLC) și celulele glioblastom (GBL) pentru a ascorba prin chimie pro-oxidanta implicând fier labil activ activ redox și H 2 O 2 . În plus, studiile preclinice și studiile clinice demonstrează fezabilitatea, toxicitatea selectivă, tolerabilitatea și eficacitatea potențială a ascorbatului farmacologic în terapia GBM și NSCLC.

Semnificaţie

În ciuda progreselor înregistrate în strategiile de tratament, supraviețuirea globală de 5 ani la NSCLC și GBM nu a crescut semnificativ în ultimii 20 de ani. Aici, demonstrăm că ascorbatul farmacologic reprezintă un agent ușor de aplicat și netoxic, care poate crește eficacitatea tratamentului când este combinat cu radiochimoterapia standard în tratamentul NSCLC și GBM. Mai mult decât atât, mecanismul prin care ascorbatul este selectiv toxic pentru celulele canceroase față de celulele normale este dovedit a implica modificări în metabolismul fier activ redox mediat de O2 • – și H202 mitocondrial. Deoarece defectele fundamentale ale metabolismului oxidativ, care conduc la creșterea nivelului staționar al O 2• – și H 2 O 2, apar ca semne distinctive ale celulelor canceroase, concluziile actuale susțin un mecanism generalizat pentru aplicarea ascorbatului farmacologic în tratamentul cancerului.

Repere

  • Ascorbatul cu doză ridicată sensibilizează celulele NSCLC și GBM la radiochimie
  • 2 • – și H 2 O 2 cresc fierul instabil, determinând toxicitatea ascorbată selectivă a celulelor canceroase
  • Nivelurile terapeutice ale ascorbatului sunt realizabile și bine tolerate în GBM și NSCLC
  • Celulele metabolice oxidative ale celulelor canceroase pot fi vizate cu ascorbat pentru terapia cancerului

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5497844/

 

acum sa o luam pas cu pas de la adminsitrarea orala care NU are efect antitumoral la adminsitrarea IntraVenoasa in doze pina la peste 30 grame odata(minim 350 mg/kg corp) care au efect antitumoral :

Dr. Avram Hoffer, MD, Ph.D. este un psihiatru care are multi pacienti cu cancer trimisi la el pentru depresie și anxietate. Ca parte a tratamentului pentru aceste probleme psihologice / emoționale el prescrie o varietate de suplimente nutritive. Surprinzator, pacienții cu cancer care au urmat programul său nutrițional traiesc de 16 ori mai mult in comparatie cu pacientii sai, cu cancer, care nu respectă programul nutritional!

Continuă lectura

Cura Johanna BRANDT cu struguri inchis colorati( Negrii, Violet, Rosii ) – tratament cancer ETAPA IV

Această prezentare necesită JavaScript.

Strugurii colorati (rosii, violet, negrii, orice soi numai nu albi) (cu tot cu pielea lor și semințe),  sunt cunoscuti pentru a distruge celulele canceroase. Aceste tipuri de struguri contin substante nutritive pentru a ucide microbii din interiorul celulelor de  cancer(acestea redevenind celule sanatoase) dar sunt si alcalini opresc raspandirea cancerului.

Detoxifica organismul( in special ficatul ).

Strugurii intens colorati(negri,violet,rosii ) conțin foarte mai mulți nutrienți ucigasi majori de canceri:

Acid elagic, catesine, quercetin, proantocianidine oligomerice (OPC) sau oligomeri procyanidolic (PCO), numit inițial: Pycnogenol (in semințe), resveratrol (culorarea pielii din struguri roșii), pterostilbene, seleniu, licopen, luteina, laetrile (amigdalină sau Vitamina B17) (in semințe), beta-caroten, acid cafeic și / sau acid ferulic (împreună ucide celulele canceroase), acid galic, vitamina C si multi antioxidanti si nutrienti (vitamine precum E-grasimi omega, minerale, enzime, etc)!

 

Un arsenal incredibil! Aproximativ 15 agenti anticancerigeni DEMONSTRATI de studii stiintifice (click aici pentru a consulta baza de date cu studii stiintifice referitoare la fiecare dintre anticancerigenii mentionati anterior ), cu fiecare cu importanta  in tratarea cancerului .

In plus, strugurii sunt in marea lor parte un glucid,si celulele canceroase intercepteaza  glucoza (cu ajutorul  invelisului proteic specific acestora ) si  au nevoie de15-17 ori mai multa decat celulele normale pentru a supravietui (cititi cauzele cancerului -click aici)  .

 

Iata de ce suplimente extract precum resveratrol nu vor egala in eficienta alimentul integral- sturgurele inchis colorat(ar trebui un extracvt de15 X15 ori mai concentrat; in plus, cu banii cheltuiti pe achizitionarea uni flacon resveratrol achizitionati zeci de  kg de struguri chair si cand nu e sezon  .alegrea ramane totusi a dvs.)  

Continuă lectura

Pau D ‘Arco (Tabebuia altissima) tratament cancer

 „Ceea ce este nou nu este neapărat adevărat, ceea ce este adevărat, nu este neapărat nou.”
Louise Tenney

Sub conducerea Dr. Teodoro Meyer şi a medicilor Pau D ‘ Arco fost distribuit la pacienţii cu cancer în întreaga Argentina, în oraşe precum Buenos Aires, Mar del Plata, La Rioja, şi Tucuman. Dr. Meyer spune ca planta vindeca ranile, combate infectia, stimuleaza apetitul şi acţionează ca un tonic general. Cu toate acestea, este utila in cazurile considerate ca fiind fără speranţă de către medicina tradiţională ; medicii au găsit Pau D Arco a câştigat un război împotriva neobişnuitelor surse de boală şi de povestiri fantastice generate de vindecari.

Minim 20 de bolnavi de cancer, diagnosticati ca „Terminal” au avut o medie de 3 1/2 la 4 luni pentru a arăta nici o urmă de cancer Rapoartele de la pacienti indică o creştere a energiei în una până la două săptămâni. Ei au o stare generala de bine, după câteva săptămâni.

Continuă lectura

Aplicarea albastru de metilen , vitamina C , N-acetil cisteină pentru tratamentul pacienților bolnavi COVID-19 în stare critica, raport al unui studiu clinic de fază I.

COVID-19 este un eveniment catastrofal global care provoacă sindrom respirator acut sever. Mecanismul bolii rămâne neclar, iar hipoxia este una dintre principalele complicații. În prezent, nu există un protocol aprobat pentru tratament. Amenințarea microbiană indusă de COVID-19 determină activarea macrofagelor pentru a produce o cantitate imensă de molecule inflamatorii și oxid nitric (NO). Activarea populației de macrofage într-un fenotip proinflamator induce un ciclu de auto-întărire. Stresul oxidativ și NO contribuie la acest ciclu, stabilind o stare inflamatorie în cascadă care poate ucide pacientul. Întreruperea acestui ciclu vicios printr-un remediu simplu poate salva viața pacienților critici.

Nitrit, azotat (metaboliții NO), methemoglobină,și nivelurile echilibrului prooxidant-antioxidant au fost măsurate la 25 de pacienți ICU COVID-19 și la 25 de persoane sănătoase. Ca ultimă opțiune terapeutică, la cinci pacienți li s-a administrat albastru de metilen-vitamina C si N-acetil cisteină (MCN).

Nitriții, nitrații, methemoglobina și stresul oxidativ au crescut semnificativ la pacienți în comparație cu persoanele sănătoase.

Patru din cei cinci pacienți au răspuns bine la tratament.

În concluzie, Oxidul Nitric, methemoglobina și stresul oxidativ pot juca un rol central în patogeneza bolii critice COVID-19. Tratamentul cu MCN pare să crească rata de supraviețuire a acestor pacienți. Luând în considerare ciclul vicios al activării macrofagelor care duce la NO mortal, stres oxidativ și sindromul cascadei de citokine; efectul terapeutic al MCN pare a fi rezonabil. În consecință, a fost conceput un studiu clinic mai amplu.Trebuie remarcat faptul că protocolul folosește medicamente ieftine pe care FDA le-a aprobat pentru alte boli.

NUMĂR ÎNREGISTRARE ÎNCERCARE: NCT04370288.

Obțineți PDF cu LibKey

1. Introducere

Răspândirea rapidă a mortalului COVID-19 cauzată de SARS-CoV-2 este în prezent un coșmar pentru toată lumea. COVID-19 este responsabil pentru această boală pandemică catastrofală. OMS a raportat că 14% dintre pacienții infectați au boli severe și necesită spitalizare, 5% dintre pacienții infectați au afecțiuni foarte severe și necesită internare în terapie intensivă (în special pentru ventilație) și 4% dintre pacienții infectați mor ( Grech, 2020 ).

S-au făcut eforturi uriașe pentru găsirea fiziopatologiei și tratamentul bolii critice COVID-19. Au fost sugerate multe proceduri terapeutice, cu puțin succes. Nu există un protocol global aprobat pentru tratamentul pacienților cu afecțiuni critice care să ducă la o rată de supraviețuire foarte scăzută și la un tratament prelungit în terapia intensivă. Acest lucru adesea nu are succes în îngrijirea ICU, provoacă o povară mare pentru sistemele de sănătate, chiar și în cele mai dezvoltate și bogate țări. Mecanismul exact al leziunii țesuturilor rămâne neclar, iar managementul pacienților subliniază în principal furnizarea de îngrijire de susținere, de exemplu, oxigenare, ventilație și terapie cu fluide ( Galluccio și colab., 2020). A better understanding of the pathogenesis of the critical disease state is crucial to develop rationale-based clinical therapeutic strategies and to determine which subsets of patients are at high risk of the severity of the disease. It is critical to start measuring factors involved in the pathways of disease which can be modulated by the different therapies currently used as a standard of care or in clinical trials.

SARS-CoV-2 determină activarea macrofagelor pentru a produce o cantitate imensă de molecule inflamatorii, care sindromul furtunii de citokine este principala cauză a decesului la pacienții cu COVID-19 ( Alunno și colab., 2020 ). De asemenea, se știe în alte boli că supraproducția de oxid nitric inductibil (iNO) ( Miclescu și Wiklund, 2010 ) și speciile de oxigen reactiv (ROS) ( Shehat și Tigno-Aranjuez, 2019 ) se întâmplă la activarea macrofagelor, ceea ce duce la un ciclu vicios. activării macrofagelor pentru supraproducția de citokine ( Wang și Ma, 2008 ).

Ar putea NO și stresul oxidativ să joace un rol central în creșterea hipoxiei, care este una dintre principalele complicații la pacienții cu COVID-19? Ar putea fi întrerupt acest ciclu vicios de NO și ROS folosind o terapie eficientă și intensă anti-NO și anti-oxidant?

În medicină, albastrul de metilen (MB, forma oxidată, culoare albastră), dar nu și forma redusă (LMB: albastru de leucometilen, incolor), a fost utilizat în diferite boli, cum ar fi malaria, chirurgia, ortopedia, infecțiile bacteriene, virale și et. cetera ( Hamidi Alamdari și colab., 2020 ).

Un motiv probabil pentru hipoxie la pacienții cu COVID-19 este methemoglobinemia care rezultă din oxidarea fierului conținut în hemoglobină de la forma feroasă la cea ferică. Oxidarea este asociată cu o scădere a capacității hemoglobinei de a transporta oxigenul ( Hamidi Alamdari și colab., 2020 ).

În acest studiu, nitritul, nitrații (metaboliții NO), methemoglobina (met-Hb) și echilibrul prooxidant-antioxidant (PAB) au fost considerați ca factori care implică intensificarea hipoxiei la pacienții cu terapie intensivă. Cinci pacienți cu COVID 19 bolnavi critici, după îngrijiri standard, caracterizați ca fiind în stadiul final de către medicii lor, au fost administrați cu MB, vitamina C și N-acetil cisteină ca terapie de compasiune și incluși într-un studiu clinic mai amplu, care este deja ruleaza/ in desfasurare

2. Material și metode

Acest studiu a fost efectuat la Universitatea de Științe Medicale din Mashhad, Mashhad, Iran în 2020, după aprobarea comitetului de etică (  identificator ClinicalTrials.gov : NCT04370288; 19 aprilie 2020) și luând consimțământul scris în cunoștință de cauză. De asemenea, studiul clinic a fost aplicat pentru înregistrare în IRCT (Trial Id 49.767).

Acest studiu efectuat pe 25 de persoane sănătoase și 25 de pacienți cu pneumonie COVID-19 care au fost admiși la ICU cu Pa02 / Fi02 <200. Pentru toate locurile pacienților au fost măsurate gazele sanguine, CBC, LDH, CRP și tomografia computerizată de înaltă rezoluție ( HRCT) s-a făcut.

2.1. Măsurarea nitritului, azotatului în probele de plasmă

NO, datorită duratei sale scurte de viață (câteva milisecunde), a fost determinat pe baza cantității de produse de oxidare: nitrit și azotat. Nitriții și nitrații au fost măsurați în conformitate cu metodele descrise de Yegın care au folosit testul de reacție Griess pentru probele de plasmă ( Yegın și colab., 2015 ).

2.2. Met-Hb

Sângele proaspăt a fost colectat folosind EDTA-K2 ca anticoagulant și transferat în laborator pe gheață. Met-Hb a fost măsurat conform metodei descrise de Sato ( Sato și colab., 1981 ).

2.3. PAB

PAB a fost măsurat în conformitate cu metoda descrisă de Alamdari DH ( Alamdari și colab., 2007 ).

2.4. Pacienți cu studii clinice

Ca ultimă opțiune terapeutică, cinci din 25 de pacienți ICU COVID-19 au fost recrutați în studiile clinice și în tratamentul cu MCN. 

Pacienților li s-a administrat MB (1 mg / kg) împreună cu vitamina C (1500 mg / kg) și N-acetil cisteină (1500 mg / kg) pe cale orală sau intravenoasă, așa cum este descris pentru fiecare caz.

2.5. Criteriile studiilor clinice

Criteriile de incluziune au fost: Cazul confirmat de Covid-19 (prin RT-PCR pe tamponul nazofaringian colectat sau caracteristicile clinice și HR-CT) și vârsta peste 18 ani. Criteriile de excludere au fost: antecedente de deficit de G6PDH, insuficiență renală severă, ciroză, hepatită cronică activă, pacienți cu antecedente de reacție alergică la MB, tratament cu agenți imunosupresori și femeile însărcinate sau care alăptează.

3. Rezultate

Caracterizările demografice ale pacienților și ale persoanelor sănătoase, precum și rezultatele de laborator sunt prezentate în  Tabelul 1 . Datele pacienților înainte și după tratamentul cu albastru de metilen sunt prezentate în  Tabelul 2 .

Tabelul 1. Caracterizări demografice ale pacienților, indivizilor sănătoși (HI) și rezultatelor de laborator.

HI (n = 25)Grup de pacienți (n = 25) Valoarea P
Vârsta (ani)56,6 ± 11,459,9 ± 13,60,22
Masculin Feminin12/1314.110,74
NO2   (μmol / l)7,6 ± 3,910,7 ± 7,90,01  a
NO3   (μmol / l)22,4 ± 15,344,7 ± 30,10,002  a
Met-Hb (%)2,5 ± 0,916,4 * ± 9,10,0001  a
PAB (HK)35,8 ± 15,388,4 * ± 28,40,0001  a
CRP (mg / dl)8,7 ± 4,594,3 * ± 49,50,0001  a
LDH (U / l)251,6 ± 139,91036,6 * ± 348,80,0001  a

Datele sunt prezentate ca medie ± SDa

A existat o diferență semnificativă între pacienți și HI ( p  <0,05).

Tabelul 2. Datele a 4 pacienți înainte și după tratament.

Înainte de tratament (n = 4)După tratament (n = 4) Valoarea P
NO2   (μmol / l)2,8 ± 13,17,0 ± 1,40,009  a
NO3   (μmol / l)68,2 ± 44,740,7 ± 25,20,05  a
Met-Hb (%)14,7 ± 2,24,5 ± 0,50,001  a
PAB (HK)90,5 ± 6,451,7 ± 21,70,001  a
CRP (mg / dl)99,0 ± 31,017,7 ± 2,90,005  a
LDH (U / l)859,75 ± 219,6245,0 ± 100,70,002  a

Datele sunt prezentate ca medie ± SDa

A existat o diferență semnificativă între pacienți și HI ( p  <0,05).

3.1. Cazul 1

1.

La 13 aprilie 2020, un bărbat în vârstă de 49 de ani a fost internat la ICU din cauza febrei, a nivelului scăzut de conștiență, a scăzut SPO2 și a secreției traheale foarte purulente. La internare, pacientul avea RASS -4 (Richmond Agitation Sedation Score), și sub ventilație mecanică cu febră, tahicardie, SPO2 86-88%. Tensiunea sa arterială era în limitele normale.

Nu a avut comorbiditate în istoricul său medical trecut 3.

Pacientul a fost internat anterior pe 15 februarie 2020, la o altă terapie intensivă, din cauza cefaleei, tusei, mialgiei, febrei și dispneei care au început cu 14 zile înainte de internare.

HRCT pulmonar a relevat opacități bilaterale difuze de sticlă macinată (GGO) și consolidare în regiunile pulmonare periferice. Au fost implicați atât lobii superiori, cât și cei inferiori.

WBC: 16 × 103 / μl cu 88% neutrofile și 3,6% limfocite, număr de trombocite: 221 × 103 / μl, LDH: 906 UI / l, CRP: 82 mg / dl, D-dimer: 2078 ng / ml, bilirubină totală : 2 mg / dl, AST: 134 UI / l și ALT: 89 UI / l. RT-PCR a fost pozitiv pentru SARS-CoV-2.6.

El a fost tratat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și meropenem 1 gr TDS.7.

Traheostomia a fost făcută din cauza perioadei lungi de intubație.

Cultura secreției traheale a relevat microorganisme cu rezistență multiplă, cum ar fi Acinetobacter și Pseudomonas.

După trei zile, din cauza suferinței respiratorii progresive, Kaletra (lopinavir / ritonavir, 200/50 mg) și hidrocortizon au fost adăugate la protocolul de tratament.10.

Nitriții și nitrații, met-Hb și PAB au fost de 10,2 μmol / l, 35,1 μmol / l, 14% și respectiv 95 HK.

Pe 24 mai 2020, din cauza unui răspuns slab la antibiotice după 45 de zile și a eșecului de înțărcare, am început să administrăm MB orală (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) în 100 ml dextroză pentru de două ori pe zi.12.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.13.

În aceeași zi de administrare a MB, pacientul a fost decanulat și traheostomia a fost îndepărtată și oxigenoterapia a fost începută cu o mască de sac de rezervă.

Terapia cu antibiotice a fost continuată și a început dexametazona (8 mg QID).

A doua zi după începerea terapiei MB, pacientul a avut un volum mare de secreție traheală de la locul traheostomiei, dar SPO2 a fost de 90-92% la oxigenul cu flux mare.16.

În a doua și a treia zi după începerea terapiei MB, pacientul s-a îmbunătățit semnificativ și SPO2 la 96 printr-o mască simplă.

Din a patra zi după terapia MB, dexametazona a fost redusă și conștiința pacientului a fost îmbunătățită, secreția traheală a scăzut, dar pacientul a avut un grad scăzut de febră.

În a șasea zi după începerea albastrului de metilen, terapia cu oxigen a fost întreruptă.

În a douăzeci și treia zi, el a fost externat din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 6,6 μmol / l, 24,30 μmol / l, 4% și respectiv 62 HK.

3.2. Cazul 2

1.

La 7 mai 2020, o femeie în vârstă de 64 de ani a fost internată în ATI din cauza nivelului scăzut de conștiență și al suferinței respiratorii. Ea a fost imediat intubată.

A avut în trecut un istoric medical de depresie3.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a prezentat o formă moderată a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

HRCT pulmonar a dezvăluit opacități de sticlă macinată (GGO) în plămânul stâng.

WBC: 12 × 103 / μl cu 78% neutrofile și 12,5% limfocite, număr de trombocite: 196 × 103 / μl, LDH: 670 UI / l, CRP: 79 mg / dl, D-dimer:> 5000 ng / ml, total bilirubină: 1 mg / dl, AST: 116 UI / l și ALT: 76 UI / l și SPO2 96%. RT-PCR a fost pozitiv pentru SARS-CoV-2.6.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.7.

Nitriții și nitrații, met-Hb și PAB au fost de 17 μmol / l, 24,3 μmol / l, 16% și, respectiv, 84 HK.

La 11 mai 2020, MB (1 mg / kg / ) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și administrate prin tub nazogastric q12 h timp de 7 zile.

Nu au existat efecte secundare și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.10.

În a doua zi, după terapia MB, pacientul a fost afebril.

În a cincea zi de terapie MB, pacientul a fost întrerupt de la ventilație mecanică și extubat.12.

În a noua zi, a fost externată din UCI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 8,5 μmol / l, 18,9 μmol / l, 5% și respectiv 53 HK.

3.3. Cazul 3

1.

La 1 mai 2020, o femeie în vârstă de 60 de ani a fost internată în UTI din cauza febrei și a suferinței respiratorii.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a avut o formă moderată a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

A avut în trecut un istoric medical de diabet zaharat.

HRCT pulmonar a dezvăluit opacități bilaterale de sticlă macinată (GGO) .5.

WBC: 8,9 × 10 3 / μl cu 79% neutrofile și 13% limfocite, număr de trombocite: 275 × 10 3 / μl, LDH: 712 UI / l, CRP: 90 mg / dl, D-dimer: 1508 ng / ml, bilirubină totală: 1,8 mg / dl, AST: 125 UI / l și ALT: 95 UI / l. RT-PCR a fost negativ pentru SARS-CoV-2.6.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.7.

Nitriții și nitrații, met-Hb și PAB au fost de 12 μmol / l, 109,2 μmol / l, 12% și, respectiv, 86 HK.

La 4 mai 2020, MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) în 100 ml dextroză au fost injectate intravenos timp de 30 de minute și au continuat la fiecare 12 ore timp de 2 zile.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.10.

În a doua zi, după terapia MB, SPO2 a crescut de la 84% la 93% după ce pacientul a fost supus terapiei cu oxigen printr-o mască simplă.

În a patra zi de terapie MB, pacientul a fost externat din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 7,8 μmol / l, 74,5 μmol / l, 5% și respectiv 71 HK.

3.4. Cazul 4

1.

La 22 aprilie 2020, un bărbat de 66 de ani a fost internat în secția internă a spitalului din cauza febrei și a suferinței respiratorii.

Nu avea antecedente medicale anterioare ale bolii.

HRCT pulmonar a relevat opacități bilaterale difuze de sticlă macinată (GGO) și consolidare.

WBC: 5,4 × 10 3 / μl cu 59% neutrofile și 34% limfocite, număr de trombocite: 154 × 10 3 / μl, LDH: 906 UI / l, CRP: 124 mg / dl, D-dimer: 1405 ng / ml, bilirubină totală: 0,6 mg / dl, AST: 37 UI / l și ALT: 92 UI / l, SPO2 88%. RT-PCR a fost pozitiv pentru SARS-CoV-2.5.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.6.

După trei zile, din cauza suferinței respiratorii progresive, Ribavirin, Kaletra și dexametazonă au fost adăugate la protocolul de tratament.

După patru zile de internare, pacientul a fost transferat la UCI și a primit o singură dată terapie cu plasmă.

La o săptămână după terapia cu plasmă, starea de oxigenare a pacientului sa înrăutățit (SPO2 59% cu ventilație neinvazivă și 100% FIO2) 9.

Nitriții și nitrații, met-Hb și PAB au fost de 45,1 μmol / l, 89,2 μmol / l, 22% și respectiv 100 HK.

MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și prescrise intravenos. Înainte de injectare, SPO2 era de 54%, iar după 30 de minute de injectare, SPO2 se îmbunătățea la 74% și durează 12 ore. Din cauza limitărilor neașteptate pentru prepararea albastrului de metilen, medicamentul nu a fost continuat.

Nu a existat niciun efect secundar și o reacție alergică.

În a doua zi, acest pacient a întâmpinat șoc septic sever, insuficiență multi-organ și a decedat Acest scenariu se poate datora unei doze tardive și incomplete de albastru de metilen.

3.5. Cazul 5

1.

La 13 mai 2020, o femeie în vârstă de 75 de ani a suferit o operație de urgență pentru grefa de bypass a arterei coronare și două zile mai târziu a prezentat o scădere a SPO2 și a suferinței respiratorii.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a prezentat o formă severă a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

HRCT pulmonar a dezvăluit opacități de sticlă macinată (GGO). Avea o combinație de consolidare și GGO-uri. Distribuția anomaliilor a fost bilaterală în regiunile pulmonare subpleurale. Au fost implicați atât lobii superiori, cât și cei inferiori.

A avut antecedente medicale de diabet și hipertensiune.

WBC: 8,9 × 10 3 / μl cu 80% neutrofile și 12,6% limfocite, număr de trombocite: 276 × 10 3 / μl, LDH: 1151 UI / l, CRP: 145 mg / dl, D-dimer: 1374 ng / ml, bilirubină totală: 1,5 mg / dl, AST: 115 UI / l și ALT: 90 UI / l. RT-PCR a fost negativ pentru SARS-CoV-2.6.

Pe 15 mai 2020, s-a transferat la ICU, avea o hemodinamică stabilă. SPO2 a fost 65-68% fără oxigenoterapie și 78-80% cu oxigenoterapie printr-o pungă de rezervă.7.

După declararea ventilației neinvazive (NIV) SPO2 a ajuns la 87-88% .8.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), lopinavir / ritonavir (200/50 mg, 2 comprimate × bid), hidroxiclorochină (400 mg stat), heparină 5000 UI (qidintravenos)., Hidrocortizon (doza inițială 100 mg TDS, în ultimul timp conic) și a continuat timp de cinci zile.9.

Nitriții și nitrații, met-Hb și PAB au fost de 13,5 μmol / l, 104,3 μmol / l, 17% și, respectiv, 97.10.

Pe 16 mai 2020, MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și prescrise pe cale orală.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.12.

Datorită operației cardiace și a leucocitozei, a fost administrat antibioticul profilactic.

În prima zi, după terapia MB, nu a existat nicio modificare semnificativă în SPO214.

În a doua zi de terapie MB SPO2 a crescut și durata ventilației neinvazive (VNI) a scăzut.

În a patra zi de terapie MB, pacientul nu avea nevoie de NIV, iar SPO2 a fost de 80-82% fără oxigenoterapie și a ajuns la 97-99% cu oxigenoterapie.16.

În a cincea zi de terapie MB, pacientul nu avea nevoie de oxigenoterapie și SPO2 era de 90-92% și era complet treaz și a început hrănirea orală.17.

În a șaptea zi, a fost externată din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost 5,1 μmol / l, 45,2 μmol / l, 4% și, respectiv, 21.

4. Discutie

Acest studiu a arătat că nitritul, nitrații, met-Hb și stresul oxidativ sunt semnificativ crescute la pacienți în comparație cu persoanele sănătoase. Acest lucru este compatibil cu procesul inflamator și activarea macrofagelor care au fost observate în boala COVID 19 ( Alunno și colab., 2020 ;  Wang și Ma, 2008 ).

Motivul pentru luarea în considerare a acestor factori implicați în fiziopatologia inducerii hipoxiei sunt următoarele: 1

Amenințarea microbiană este indusă de coronavirus care determină activarea macrofagelor pentru a produce o cantitate imensă de mediatori inflamatori și alte molecule, cum ar fi oxidul azotic (NO). NO acționează ca agent pro-inflamator și antiinflamator, în funcție de cantitatea de NO generată și de sursa sa ( Kobayashi și Murata, 2020 ). Este documentat faptul că oxidul nitric sintază inducibil de macrofage (iNOS) circulă inflamația ( Wang și colab., 2018 ). Se raportează că, după administrarea de citokine, niveluri crescute de nitriți au fost detectate în multe boli, cum ar fi sepsis, colită ulcerativă, artrită, scleroză multiplă și diabet de tip I ( Hibbs și colab., 1992 ). De asemenea, se produce NO excesiv în timpul unei varietăți de boli inflamatorii (Clancy și Abramson, 1995 ). Se raportează că există un rol cheie pentru monocite și macrofage pentru inflamația patologică; și există o discuție în curs de desfășurare cu privire la strategiile terapeutice prospective de modulare a activării macrofagelor la pacienții cu COVID-19 ( Merad și Martin, 2020 ) .2

Rezultatele noastre au arătat creșterea nivelului de nitriți și nitrați ai sângelui la pacienții cu COVID-19. Oxidul azotic sintază inductibil de macrofage (iNOS) poate fi indus de 2 până la 3 ordine de mărime în urma inflamației care eliberează cantități mari de NO ducând la creșteri locale și sistemice de nitriți. ( Kleinbongard și colab., 2003 ) .3

Rezultatele noastre au arătat, de asemenea, niveluri crescute de stres oxidativ la pacienții cu COVID-19. NU este una dintre resursele majore ale stresului oxidativ / nitrosativ. NU poate reacționa cu specii reactive de oxigen, cum ar fi superoxidul (O2 • – ), pentru a forma peroxinitrit (ONOO  ), o specie foarte reactivă care dăunează celulelor. Pe de altă parte, coagulopatia asociată COVID-19 este raportată ca apariție a evenimentelor trombotice venoase și arteriale, inclusiv tromboza venoasă profundă (TVP), embolie pulmonară (PE), accident vascular cerebral ischemic, infarct miocardic (așa cum s-a observat probabil în cazul nostru de Nr. 5) și evenimente arteriale sistemice ( Becker, 2020). Oxidul nitric (NO), generat de iNOS, este considerat un mediator critic al anomaliilor coagulării și al disfuncției organelor. . S-a dovedit că inhibarea selectivă a iNOS este asociată cu atenuarea coagulării induse de sepsis și a disfuncției endoteliale. Reducerea stresului oxidativ / nitrosativ contribuie probabil la efectele benefice oferite de blocarea iNOS ( Matejovic și colab., 2007 ). Numeroase studii au arătat că atât formarea trombului, cât și liza cheagului său sunt reglementate de stresul oxidativ. După rezolvarea trombozei venoase profunde, D-dimerul va fi crescut, iar stresul oxidativ ar putea promova rezoluția ( Gutmann și colab., 2020 ). Am văzut stres oxidativ crescut și D-dimer în cazurile noastre

NO este oxidat rapid în nitrit în sânge de ceruloplasmină. Nitriții și nitrații sunt considerați ca markerul generării de NO și un produs final relativ inert al metabolismului NO ( Shiva și colab., 2006 ). Există o corelație semnificativă între CRP și nitriți în bolile inflamatorii. Se sugerează că măsurarea azotaților ar putea fi un instrument de diagnostic, precum și de prognostic, în timpul tratamentului acestei boli ( Ersoy și colab., 2002 ). De asemenea, am observat o creștere a nivelului de nitriți și CRP la pacienții probabil secundari pentru a crește stresul oxidativ

Nitritul trece prin membrana RBC. Se știe că anionul nitrit oxidează Hb la Met-Hb și degradează Hb, ceea ce a dus la creșterea hipoxiei, a bilirubinei și a fierului. Met-Hb joacă un rol central în inducerea unei hipoxii mai mari, iar corectarea Met-Hb poate fi un punct critic pentru tratament ( Vitturi și colab., 2009 ). În acest studiu, met-Hb a crescut semnificativ la pacienți în comparație cu persoanele sănătoase, ceea ce provoacă hipoxemie. Tratamentul pacienților cu MB a scăzut probabil nivelul met-Hb și ulterior nivelul de hipoxemie, așa cum am observat în rapoartele noastre de caz.6

În plus față de NO, stresul oxidativ duce și la oxidarea hemoglobinei (Fe 2+ ) la met-Hb (Fe 3+ ) ( Gutmann și colab., 2020 ). Rezultatele noastre au arătat creșterea stresului oxidativ și met-Hb la pacienți

Stresul oxidativ și inflamația interacționează simultan una cu cealaltă și le exacerbează efectele prin crearea unui ciclu vicios pentru agravarea bolilor prin supra-producția de oxigen și azot reactiv (ROS și RNS) care contribuie la deteriorarea organelor prin oxidare și nitrozare a diferitelor ținte biologice și componente ale celulei, inclusiv lipide, tioli, resturi de aminoacizi, baze ADN și antioxidanți cu greutate moleculară mică ( Yegın și colab., 2015). După cum am menționat, reducerea MB transformă forma de culoare albastră în una incoloră. După 8-12 ore de consum, am observat că culoarea urinei s-a transformat în albastru sau verde. Acest lucru arată probabil că agenții oxidanți din sânge oxidază forma redusă de MB (incoloră) la forma oxidată (culoare albastră). Această reacție chimică scade probabil stresul oxidativ și ulterior mediatorii inflamatori

Dovezile au arătat că persoanele în vârstă și cele cu condiții multi-morbide preexistente pot prezenta un risc mai mare de a dezvolta consecințe grave asupra sănătății din cauza COVID-19. „Oxi-inflam-îmbătrânire” se referă la fenomenul de inflamație cronică sistemică de grad scăzut care însoțește îmbătrânirea. Celulele în vârstă au o capacitate scăzută de a prolifera, ceea ce această celulă de senescență stimulează secreția de citokine pro-inflamatorii care provoacă inflamație cronică independentă de activarea celulelor imune. Această inflamație duce, de asemenea, la niveluri crescute de ROS și RNS, care ar putea induce stres oxidativ / nitrosativ. Stresul oxidativ / nitrosativ poate duce, de asemenea, la activarea căilor pro-inflamatorii în organism, contribuind la patogeneza multor boli legate de vârstă. Prin urmare, inflamația legată de vârstă agravează producția de NO (de către iNOS),care induce un stres puternic oxidativ / nitrosativ (Matsushita și colab., 2020 ).

În protocolul nostru recent sugerat ( Hamidi Alamdari și colab., 2020 ), am explicat în detaliu rațiunea utilizării MB, vitamina C și N-acetil cisteină pentru tratamentul pacienților în cadrul studiului clinic și vom explica alte motive în următoarele: (1)

Este documentat că MB are efecte inhibitorii directe asupra sintazelor de oxid nitric (NOS), atât constitutive, cât și inductibile, și previne acumularea de guanozin monofosfat ciclic (cGMP) prin inhibarea enzimei guanilat ciclază ( Miclescu și Wiklund, 2010 ). Într-un studiu clinic, este documentat că NO este un potențial mediator al modificărilor hemodinamice asociate cu sepsis. Efectul advers al NO asupra hemodinamiei poate fi parțial antagonizat de albastru de metilen, prin inhibarea enzimei guanilat ciclază ( Brown și colab., 1996 ). (2)

MB crește activitatea căii NADPH-methemoglobin reductazei lente în mod normal, care scade hipoxia prin reducerea met-Hb. O cantitate mică de met-Hb se formează întotdeauna, dar este redusă în interiorul eritrocitului de către aceste enzime: (1) citocrom-b5 reductază NADH, (2) NADPH-methemoglobin reductază. Unul dintre tratamentele FDA pentru methemoglobinemie este aplicarea MB (1-2 mg / kg IV peste 5-30 min) și alte tratamente sunt acidul ascorbic și glutationul redus ( McPherson, 2017 ). (3)

Nivelurile crescute de methemoglobină sunt secundare activității reduse (citocrom-b5 reductazei NADH ereditare sau dobândite) (A); în deficitul de homozigot NADH-citocrom-b5 reductază, nivelurile de met-Hb sunt de 10% –50% (cianotice). Concentrațiile de Met-Hb de 10% -25% nu pot da simptome aparente; nivelurile de 35% -50% duc la simptome ușoare, cum ar fi dispneea de efort și durerile de cap; iar nivelurile care depășesc 70% sunt probabil letale; (B) producția crescută de met-Hb poate fi indusă de medicamente sau agenți chimici precum nitriți, nitrați, clorați, chinone și compuși aromatici amino și nitro. 26  Nivelul mediu de met-Hb la cei 25 de pacienți cu terapie intensivă a fost crescut ( Tabelul 1 ). (4)

Am emis ipoteza ( Wang și Ma, 2008 ) că forma redusă de MB (Leucometilen: LMB) poate reduce, de asemenea, methemoglobinemia la pacienții cu COVID-19 prin aceste mecanisme: (A) Efect direct rapid: reducerea met-Hb (așa cum am văzut în cazul 4); (B) Scăderea stresului oxidativ: LMB, ca agent reducător, stinge ROS, cu toate acestea MB (forma oxidată) induce stresul oxidativ prin absorbția electronului (ca un radical liber) din alte molecule (NADH-H + , NADPH-H + , GSH) și apoi scade met-Hb prin mecanism enzimatic ( McPherson, 2017). Prin urmare, am folosit forma redusă de MB care nu putea induce stresul oxidativ. (C) Scăderea inflamației: Aceasta reduce stresul oxidativ și invers. Studiile clinice și experimentale au arătat, de asemenea, că MB scade inflamația ( Shehat și Tigno-Aranjuez, 2019 ). (5)

MB poate interzice efectul citopatic și reduce propagarea virusului ARN (cum ar fi poliovirusul) prin aceste moduri: (1) efect mecanic de MB ușor de pătruns, care ar putea ocupa competitiv site-urile celulare necesare pentru atașarea, penetrarea și / sau multiplicarea virusului; (2) Scăderea stresului oxidativ prin decuplarea oxidării și fosforilării; (3) efectul virucid al MB, o substanță lipofilă, prin intrarea în virus prin membrana lipidică și legarea de ARN ( Kovács, 1960 ). (6)

Proprietăți antibacteriene: MB a constituit baza chimioterapiei antimicrobiene – în special în zona antimalarică – și a familiilor de medicamente neuroleptice. Este utilizat într-un pansament antibacterian cu spumă pentru gestionarea rănilor cronice cu infecție locală ( Woo și Heil, 2017 ). (7)

MB este un puternic eliminator de oxigen care elimină rapid acest ion pentru a nu deteriora țesutul. Acest anion este produs în timpul ischemiei-reperfuziei în condiții precum infarctul miocardic acut și așa mai departe. ( Wülfert și colab., 2003 ). Un alt efect antioxidant al MB este blocarea enzimelor care conțin fier, cum ar fi xantina oxidaza, care împiedică producerea ROS ( Miclescu și Wiklund, 2010 ). (8)

MB previne activarea, aderența și agregarea trombocitelor prin inhibarea metabolismului acidului arahidonic din trombocite ( Miclescu și Wiklund, 2010 ). Acest lucru este foarte important la pacienții cu COVID-19, deoarece una dintre principalele complicații sunt evenimentele trombotice ( Becker, 2020 ).

5. Concluzie

Rezultatele preliminare ale acestui studiu clinic au arătat că tratamentul COVID-19 sever cu un amestec de MB, vitamina C și N-acetil cisteină este sigur și fezabil. MB redus are efecte rapide și întârziate. Efectul rapid crește SPO2% (Toți pacienții au primit 100% oxigen) prin reducerea met-Hb. Efectele întârziate sunt prin accelerarea normală a NADPH-methemoglobin reductazei, îmbunătățirea markerilor inflamatori, cum ar fi nivelul CRP și LDH, scăderea severității bolii care se poate datora și efectului antimicrobian. Vă sugerăm că timpul optim de administrare redusă cu albastru de metilen (LMB) ar trebui să fie înainte de a intra în pacient într-un stadiu foarte sever al bolii și implicarea și eșecul multi-organe.Este de părerea autorilor că rezultatele observate dacă sunt verificate la mai mulți pacienți și un studiu clinic multicentric randomizat ar putea reduce semnificativ mortalitatea infecției cu COVID-19 și durata medie a șederii ICU/ATI.

Aprobare etică

IR.MUMS.REC.1399.122;  Identificator Clinic  Trials.gov : NCT04370288; 19 aprilie 2020.

Informații de finanțare

Această lucrare a fost susținută de un grant de la Universitatea de Științe Medicale din Mashhad (numărul grantului:  990096 ). Brevetul a fost solicitat pentru o formulare specială (IR-139950140003002083), (1 iunie 2020, PCT).

Date de cercetare

Orice medic dorește să efectueze un studiu clinic randomizat ca studiu multicentric, autorii dornici să împărtășească experiențele lor și ultima actualizare a informațiilor lor.

Declarație de contribuție a autorului CRediT

Daryoush Hamidi Alamdari:  Conceptualizare, Curarea datelor, Analiza formală, Achiziționarea de fonduri, Investigație, Metodologie, Administrarea proiectelor, Resurse, Software, Supraveghere, Validare, Vizualizare, Scriere – schiță originală, Scriere – revizuire și editare.  Ahmad Bagheri Moghaddam:  Conceptualizare, conservarea datelor, analiză formală, investigație, metodologie, supraveghere, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Shahram Amini:  Conceptualizare, curatarea datelor, investigație, validare, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Mohammad Reza Keramati:  Conceptualizare, conservarea datelor, metodologie, scriere – schiță originală, scriere – recenzie și editare.  Azam Moradi Zarmehri: Conceptualizare, conservarea datelor, metodologie, scriere – schiță originală, scriere – recenzie și editare.  Aida Hamidi Alamdari: Curarea  datelor, investigații, metodologie, scriere – versiune originală, scriere – recenzie și editare.  Mohammadamin Damsaz: Curarea  datelor, metodologie, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Hamed Banpour:  Analiză formală, software, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Amir Yarahmadi:  achiziționarea de fonduri, metodologie, validare, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  George Koliakos:  Conceptualizare, Curarea datelor, Metodologie, Scriere – schiță originală, Scriere – recenzie și editare.

Declarație de interes concurent

Nu există conflicte de interese la toți autorii.

Mulțumiri

Autorii recunosc cu recunoștință tuturor asistentelor medicale ale spitalului Imam Reza pentru cooperarea lor excelentă.

Referințe

Alamdari și colab., 2007 D.H. Alamdari, K. Paletas, T. Pegiou, M. Sarigianni, C. Befani, G. Koliakos O nouă analiză pentru evaluarea echilibrului prooxidant-antioxidant, înainte și după administrarea de vitamine antioxidante în tipul II bolnavi de diabet Clin. Biochem., 40 (2007), pp. 248-254 Articol Descărcați PDF Vizualizați înregistrarea în Scopus Google Academic Alunno și colab., 2020 A. Alunno, F. Carubbi, J. Rodríguez-Carrio Storm, taifun, ciclon sau uragan la pacienți cu COVID-19? Feriți-vă de aceeași furtună care are o origine diferită RMD Open, 6 (2020), articolul e001295 CrossRef Google Scholar Becker, 2020 R.C. BeckerActualizare COVID-19: coagulopatie asociată cu Covid-19 J. Thromb. Thrombolysis, 1 (2020) Google Scholar Brown și colab., 1996 G. Brown, D. Frankl, T. Phang Infuzie continuă de albastru de metilen pentru șocul septic Postgrad. Med., 72 (1996), pp. 612-614 CrossRef View Record in Scopus Google Scholar Clancy și Abramson, 1995 R.M. Clancy, SB Abramson Oxidul nitric: un nou mediator al inflamației PSEBM (Proc. Soc. Exp. Biol. Med.), 210 (1995), pp. 93-101 Vizualizați înregistrarea în Scopus Google Scholar Ersoy și colab., 2002 Y. Ersoy, E. Özerol, Ö. Baysal, I. Temel, R. MacWalter, Ü. Meral, Z. AltayNivelul nitratului seric și al nitriților la pacienții cu poliartrită reumatoidă, spondilită anchilozantă și osteoartrită Ann. Rheum. Dis., 61 (2002), pp. 76-78 Vizualizați înregistrarea în Scopus Google Scholar Galluccio și colab., 2020 F. Galluccio, T. Ergonenc, AG Martos, AE-S. Allam, M. Pérez-Herrero, R. Aguilar, G. Emmi, M. Spinicci, IT Juan, M. Fajardo-Pérez Algoritm de tratament pentru COVID-19: un punct de vedere multidisciplinar Clin. Rheumatol., 1 (2020) Google Scholar Grech, 2020 V. Grech Necunoscute necunoscute – COVID-19 și potențială mortalitate globală Early Hum. Dev. (2020), p. 105026 Articol Descărcați PDF Google Scholar Gutmann și colab., 2020C. Gutmann, R. Siow, AM Gwozdz, P. Saha, A. Smith Specii reactive de oxigen în tromboza venoasă Int. J. Mol. Sci., 21 (2020), p. 1918 CrossRef Google Scholar Hamidi Alamdari și colab., 2020 D. Hamidi Alamdari, A. Bagheri Moghaddam, S. Amini, A. Hamidi Alamdari, M. Damsaz, A. Yarahmadi Aplicarea unui colorant redus utilizat în ortopedie ca tratament nou împotriva coronavirusului (COVID-19): un protocol terapeutic sugerat Arh. Bone Joint Surg., 8 (2020), pp. 291-294 Google Scholar Hibbs și colab., 1992 J. Hibbs, C. Westenfelder, R. Taintor, Z. Vavrin, C. Kablitz, R. Baranowski, J. Ward , R. Menlove, M. McMurry, J. KushnerDovezi pentru sinteza oxidului nitric inductibil de citokine de la L-arginină la pacienții care primesc terapie interleukină-2 The Journal of clinic research, 89 (1992), pp. 867-877 CrossRef View Record in Scopus Google Scholar Kleinbongard et al., 2003 P. Kleinbongard, A. Dejam, T. Lauer, T. Rassaf, A. Schindler, O. Picker, T. Scheeren, A. Gödecke, J. Schrader, R. Schulz Nitritul plasmatic reflectă activitatea constitutivă a oxidului nitric sintază la mamifere Radic liber. Biol. Med., 35 (2003), pp. 790-796 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Kobayashi și Murata, 2020 J. Kobayashi, I. MurataInhalarea oxidului nitric ca terapie de salvare intervențională pentru sindromul de detresă respiratorie acută indusă de COVID-19 Ann. Terapie intensivă, 10 (2020), pp. 1-2 CrossRef View Record în Scopus Google Scholar Kovács, 1960 E. Kovács Prevenirea efectului citopatic și propagarea poliovirusului prin albastru de metilen Z. Naturforsch. B Chem. Sci., 15 (1960), pp. 588-592 CrossRef View Record in Scopus Google Scholar Matejovic et al., 2007 M. Matejovic, A. Krouzecky, J. Radej, H. Kralova, P. Radermacher, I. Novak Coagulation și disfuncție endotelială în timpul bacteriemiei porcine hiperdinamice pe termen lung – efectele inhibării selective a oxidului nitric sintază inductibilăTromb. Haemostasis, 97 (2007), pp. 304-309 Vizualizare înregistrare în Scopus Google Scholar Matsushita și colab., 2020 K. Matsushita, N. Ding, M. Kou, X. Hu, M. Chen, Y. Gao, Y. Honda, D. Dowdy, Y. Mok, J. Ishigami Relația severității COVID-19 cu bolile cardiovasculare și factorii de risc tradiționali: o revizuire sistematică și meta-analiză medRxiv (2020) Google Scholar McPherson, 2017 R.A. McPherson Henry’s Clinical Diagnosis and Management by Laboratory Methods: First South Asia Edition_e-Book Elsevier India (2017) Google Scholar Merad și Martin, 2020 M. Merad, JC MartinInflamația patologică la pacienții cu COVID-19: un rol cheie pentru monocite și macrofage Nat. Pr. Immunol. (2020), pp. 1-8 Google Scholar Miclescu și Wiklund, 2010 A. Miclescu, L. Wiklund Albastru de metilen, un medicament vechi cu indicații noi J Rom Anest Terap Int, 17 (2010), pp. 35-41 View Record în Scopus Google Scholar Sato și colab., 1981 K. Sato, Y. Katsumata, M. Aoki, M. Oya, S. Yada, O. Suzuki O metodă practică pentru determinarea exactă a methemoglobinei în sânge care conține carboxihemoglobină Forensic Sci. Int., 17 (1981), pp. 177-184 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Shehat și Tigno-Aranjuez, 2019MG Shehat, J. Tigno-Aranjuez Măsurarea citometrică a fluxului producției ROS în macrofage ca răspuns la reticularea FcγR JoVE (2019), articolul e59167 Google Scholar Shiva și colab., 2006 S. Shiva, X. Wang, LA Ringwood, X Xu, S. Yuditskaya, V. Annavajjhala, H. Miyajima, N. Hogg, ZL Harris, MT Gladwin Ceruloplasmin este o NO oxidază și nitrit sintază care determină endocrin NO homeostazie Nat. Chem. Biol., 2 (2006), pp. 486-493 CrossRef View Record in Scopus Google Scholar Vitturi et al., 2009 D.A. Vitturi, X. Teng, JC Toledo, S. Matalon, JR Lancaster Jr., RP Patel Reglarea transportului nitriților în celulele roșii din sânge prin saturația fracțională a oxigenului hemoglobineiA.m. J. Fiziol. Heart Circ. Physiol., 296 (2009), pp. H1398-H1407 CrossRef View Record in Scopus Google Scholar Wang and Ma, 2008 H. Wang, S. Ma Furtuna de citokine și factorii care determină secvența și severitatea disfuncției organelor în sindromul disfuncției organelor multiple A.m. J. Emerg. Med., 26 (2008), pp. 711-715 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Wang și colab., 2018 X. Wang, Z. Gray, J. Willette-Brown, F. Zhu, G. Shi, Q. Jiang, N.-Y. Song, L. Dong, Y. Hu oxid nitric sintaz inductibil de macrofage circulă inflamația și promovează carcinogeneza pulmonară Moartea celulară Discov., 4 (2018), pp. 1-12 Articol Descărcați PDFCrossRef View Record în Scopus Google Scholar Woo and Heil, 2017 K.Y. Woo, J. Heil O evaluare prospectivă a pansamentului cu albastru de metilen și violetă de gențiană pentru tratarea rănilor cronice cu infecție locală Int. Wound J., 14 (2017), pp. 1029-1035 CrossRef View Record in Scopus Google Scholar Wülfert și colab., 2003 E. Wülfert, A. Atkinson, A. Salomon Utilizarea terapeutică și profilactică a formelor reduse de compuși farmaceutici Google Brevete (2003), pp. 1-6 Vizualizare înregistrare în Scopus Google Scholar Yang și colab., 2020 W. Yang, A. Sirajuddin, X. Zhang, G. Liu, Z. Teng, S. Zhao, M. LuRolul imagisticii în 2019 pneumonie cu coronavirus (COVID-19) Eur. Radiol. (2020), pp. 1-9 CrossRef View Record in Scopus Google Scholar Yegın et al., 2015 S.Ç. Yegın, F. Yur, S. Çetın, A. Güder Efectul licopenului asupra nivelului seric de nitriți-nitrați la șobolanii diabetici Indian J. Pharmaceutical. Sci., 77 (2015), p. 357 CrossRef View Record in Scopus Google Scholar 

Vizualizați articolul @ European Journal of Pharmacology (poate fi necesară conectarea)

Flora intestinala (probioticele ) in tratarea covid-19

Provocări în gestionarea infecției cu SARS-CoV2: rolul bacterioterapiei orale ca strategie terapeutică complementară pentru a evita progresia COVID-19

Gabriella d’Ettorre  , Giancarlo Ceccarelli  , Massimiliano Marazzato 1 , Giuseppe Campagna 2 , Claudia Pinacchio 1 , Francesco Alessandri 3 , Franco Ruberto 3 , Giacomo Rossi 4 , Luigi Celani 1 , Carolina Scagnolari 5 , Cristina Mastropietro 1 , Vito Trinchieri 1 , Gregorio Egidio Recchia 1 , Vera Mauro 1Guido Antonelli 5 , Francesco Pugliese 3 și Claudio Maria Mastroianni 1

  • 1 Departamentul de Sănătate Publică și Boli Infecțioase, Universitatea Sapienza din Roma, Roma, Italia
  • 2 Departamentul de Medicină Clinică și Moleculară, Universitatea Sapienza din Roma, Roma, Italia
  • 3 Departamentul de anestezie și medicină de terapie intensivă, Universitatea Sapienza din Roma, Roma, Italia
  • 4 Scoala de Biostiinte, Universitatea de Medicina Veterinara din Camerino, Camerino, Italia
  • 5 Laborator de virologie, Departamentul de Medicină Moleculară, afiliat la Istituto Pasteur Italia – Fundația Cenci Bolognetti, Universitatea Sapienza, Roma, Italia

Context: Tulburările gastro-intestinale sunt frecvente în COVID-19 și s-a presupus că SARS-CoV-2 are impact asupra florei microbiene ale gazdei și a inflamației intestinului, infectând celulele epiteliale intestinale. Deoarece în prezent nu există terapii codificate sau linii directoare pentru tratamentul COVID-19, acest studiu a avut ca scop evaluarea rolului posibil al unei bacterioterapii orale specifice ca strategie terapeutică complementară pentru a evita progresia COVID-19.

Metode: Oferim un raport de 70 de pacienți pozitivi pentru COVID-19, internați între 9 martie și 4 aprilie 2020. Toți pacienții au avut febră, au necesitat terapie cu oxigen neinvaziv și au prezentat o implicare pulmonară CT la imagistică mai mare de 50%. Patruzeci și doi de pacienți au primit hidroxiclorochină, antibiotice și tocilizumab, singure/monoterapii sau în combinație. Un al doilea grup de 28 de subiecți a primit aceeași terapie cu adăugare de bacterioterapie orală, utilizând o formulare multistrain/multitulpini (de bacterii intestinale)

Rezultate: Cele două cohorte de pacienți au fost comparabile pentru vârstă, sex, valori de laborator, patologii concomitente și modalitatea de susținere a oxigenului. În termen de 72 de ore, aproape toți pacienții tratați cu bacterioterapie au prezentat remisiunea diareei și a altor simptome, comparativ cu mai puțin de jumătate din grupul care nu a fost suplimentat.

Riscul estimat de a dezvolta insuficiență respiratorie a fost de opt ori mai mic la pacienții care au primit bacterioterapie orală. Atât prevalența pacienților transferați la ATI, cât și mortalitatea au fost mai mari în rândul pacienților care nu au fost tratați cu bacterioterapie orală.

Concluzii: O formulare bacteriană specifică a arătat un impact semnificativ ameliorator asupra condițiilor clinice ale pacienților pozitivi pentru infecția cu SARS-CoV-2. Aceste rezultate subliniază, de asemenea, importanța axei intestin-plămân în controlul bolii COVID-19.

Introducere

Înțelegerea procesului invaziv al SARS-COV-2 este esențială. Știm că punctele de intrare ale virusului în organism, cum ar fi receptorii ACE2, sunt enzime care sunt legate de celulele intestinale. Coronavirusurile își schimbă în mod constant tiparele de legare pe măsură ce evoluează, iar ținta potențială din plămâni variază, de asemenea, dar nu și în intestinul subțire, unde rămâne constantă. Prin urmare, celulele mucoasei intestinale (enterocite) ar putea fi un rezervor pentru coronavirusuri ( 1 ). În faza acută, doar 10% dintre pacienții cu boală coronavirus 19 (COVID-19) prezintă ADNc viral în sânge, dar aproape 50% dintre ei îl excretă în scaune. Forma infecțioasă a virusului a fost chiar identificată de mai multe ori, sugerând că calea orofecală este un mod de contaminare ( 1). Implicarea intestinului ar putea explica variația mare a încărcăturii virale de la un test la altul la aceeași persoană ca și cum virusul s-ar ascunde acolo ( 2 ). Cercetătorii chinezi au investigat modificările microbiotei la pacienții care au murit pentru infecția cu COVID-19. Secvențierea microbiotei lor a relevat o scădere semnificativă a bifidobacteriilor și lactobacililor , principalele familii de bacterii simbiotice, precum și o creștere a bacteriilor oportuniste precum  Corynebacterium  sau  Ruthenibacterium 1 ). Disbioza intestinală are un impact imun de lungă durată asupra sistemului imunitar pulmonar ( 3) și, prin urmare, ar putea fi un risc suplimentar pentru suferința respiratorie indusă de COVID-19. În acest context, utilizarea bacterioterapiei orale ar putea fi o opțiune. Unele tulpini de lactobacili și bifidobacterii au un rol protector împotriva virusului gripal, rinovirusului, virusului sincițial respirator, adenovirusului și pneumovirusului ( 4 , 5). Raportăm aici observația noastră asupra pacienților suplimentați cu bacterioterapie orală în plus față de tratamentul actual anti-COVID-19 (hidroxiclorochină, azitromicină, tocilizumab). Grupul de comparație a fost subiecții COVID-19 pozitivi care nu au fost tratați cu bacterioterapie orală, internați în aceeași clinică în același timp. Rezultatele noastre subliniază importanța axei intestin-plămân în controlul bolii COVID-19 ( 6 , 7 ).

Studiata populație, setările și culegerea datelor

Pacienții evaluați în acest studiu au fost internați la Departamentul de Boli Infecțioase, Policlinico Umberto I, Universitatea „Sapienza” din Roma, Italia, între 9 martie 2020 și 4 aprilie 2020 (unitate de îngrijire subintensivă pentru COVID-19). Aprobarea etică a fost obținută de la Comitetul de etică al Policlinico Umberto I (numărul aprobării / ID Prot. 109/20209). Toți pacienții stăteau acasă înainte de a fi direcționați la secția de urgență și de acolo la secția noastră. Tampoanele orofaringiene și nazofaringiene pentru diagnosticarea COVID-19 au fost efectuate în duplicat pentru gena SARS-CoV-2 E și S printr-o reacție în lanț cu transcriptază inversă polimerază (RT-PCR). Toți pacienții au fost pozitivi pentru COVID-19 și au îndeplinit următoarele criterii clinice: febră:> 37,5 ° C, nevoie de terapie cu oxigen neinvaziv și implicare CT pulmonară la imagistică mai mare de 50%.Au fost diagnosticați cu starea simptomatică a bolii COVID-19, care, totuși, la momentul evaluării nu necesita intubație endotraheală și ventilație mecanică invazivă. Terapia cu oxigen a fost administrată prin masca Venturi la pacienții cu respirație spontană; dacă hipoxemia a persistat, s-a aplicat presiunea continuă pozitivă a căilor respiratorii (CPAP). Dispneea a fost definită ca „o experiență subiectivă de disconfort respirator care constă în senzații calitativ distincte, care variază ca intensitate” (Dispneea a fost definită ca „o experiență subiectivă de disconfort respirator care constă în senzații calitativ distincte, care variază ca intensitate” (Dispneea a fost definită ca „o experiență subiectivă de disconfort respirator care constă în senzații calitativ distincte, care variază ca intensitate” (8 ). Diareea acută a fost definită ca un scaun cu un conținut crescut de apă, volum sau frecvență care durează <14 zile ( 9 ). Scanarea CT de înaltă rezoluție a fost utilizată pentru a identifica implicarea pulmonară în conformitate cu protocolul oficial de diagnostic și tratament (ediția a 6-a) declarat de Comisia Națională de Sănătate din China. Constatările CT tipice ale COVID-19 sunt (1) opacități de sticlă măcinată, (2) consolidare, (3) model reticular, (4) model de pavaj nebun ( 10)). Pacienții cu hipoxemie acută severă datorată pneumoniei COVID-19 și care au nevoie de ventilație mecanică invazivă au fost direcționați către Unitatea de terapie intensivă (UCI) a Policlinico Umberto I. Deoarece nu există, în prezent, terapii codificate sau îndrumări pentru tratamentul medical al COVID -19, pacienții au fost tratați cu hidroxiclorochină (HCQ) 200 mg bid, antibiotice (ABX) (azitromicină 500 mg) și doza de Tocilizumab (TCZ) este de 8 mg / kg (până la maxim 800 mg per doză) cu un interval de 12 ore de două ori, eventual plus oxigen. În plus față de tratamentele de mai sus, pacienții aleși aleatoriu au inițiat bacterioterapia orală pe 13 martie. Pentru fiecare pacient, indicele de comorbiditate Charlson ( 11), cerința de susținere a oxigenului, precum și valorile de laborator cuprinzând alanina aminotransferază (ALT), aspartat aminotransferază (ALT), hemoglobină (Hb), pH, hidrogen carbonat (HCO-3HCO3-), Lactic presiune anhidrida acidului carbon și arterial (PaCO 2 ) au fost determinate la momentul inițial. Presiunea parțială observată a oxigenului arterial (PaO 2 ), fracția de oxigen inspirat FiO 2 , dispariția simptomelor asociate COVID-19, evenimentele adverse și numărul de pacienți transferați la ICU au fost colectate la 24 h, 48 h, 72 de ore și 7 zile de la începerea bacterioterapiei orale și a spitalizării pentru toți pacienții independent de tratamente. Pacienții au fost considerați pozitivi pentru insuficiență respiratorie atunci când s-a determinat PaO 2 / FiO 2raportul a fost <300. Deoarece aceasta este o colectare retrospectivă a datelor de urgență din viața reală, unele date de laborator nu erau disponibile. În special, în cazul îmbunătățirii semnificative a schimbului de gaze clinice și respiratorii, uneori clinicianul nu a repetat analiza de urmărire a gazelor din sânge, considerând că este o procedură invazivă dureroasă inutilă.

Bacterioterapie orală

Formularea administrată în acest studiu conținea: Streptococcus thermophilus DSM 32345 , L.acidophilus DSM 32241 , L. helveticus DSM 32242 , L. paracasei DSM 32243, L. plantarum DSM 32244, L. brevis DSM 27961, B. lactis DSM 32246, B lactis DSM 32247. Ormendes SA, Lausanne, Elveția, care a dăruit produsul Sivomixx® (SivoBiome® în SUA) este responsabilă pentru standardizarea produsului în ceea ce privește conținutul enzimatic, profilul biochimic și imunologic. 

Bacterioterapia orală a implicat utilizarea a 2.400 miliarde de bacterii pe zi. 

Formularea a fost administrată în trei doze egale pe zi.

Analize statistice

Nu s-au efectuat calcule privind mărimea eșantionului. Variabilele categorice au fost comparate folosind testul χ 2 și s-au arătat ca frecvențe absolute și procent. Testul Shapiro – Wilk a fost utilizat pentru a testa normalitatea distribuției variabilelor continue. Când nu au fost distribuite în mod normal, transformarea logaritmică a fost efectuată în conformitate cu transformarea BoxCox cu -0,25 ≤ λ ≤ 0,25. Pentru variabilele continue distribuite în mod normal, valorile medii între două grupuri au fost comparate cu t Student-test și a arătat ca medie ± SD (deviație standard); pentru datele care nu au fost distribuite în mod normal, a fost utilizat testul Mann – Whitney și indicat ca median (25-75). Analiza longitudinală a datelor referitoare la insuficiența respiratorie în raport cu grupul „netratat vs. tratat” a fost efectuată de un model mixt general liniar cu procedura GLIMMIX considerând binarul ca distribuție și logitul ca funcție de legătură. Corecția Benjamini – Hochberg False Discovery Rate (FDR) a fost utilizată pentru a ține cont de testarea multiplelor ipoteze atunci când este necesar. Un p <0,05 a fost considerat semnificativ statistic. Toate analizele statistice au fost efectuate utilizând SAS v.9.4 și JMP v. 14 (SAS Institute Inc., Cary, NC, SUA).

Rezultate

Datele relative la 70 de subiecți pozitivi la testul SARS-CoV-2 (vârsta mediană, 59 de ani, interval interquartil, 50-70) au fost colectate în perioada 9 martie – 4 aprilie 2020. Niciunul dintre pacienți nu a călătorit recent în China sau Coreea de Sud sau Iranul. Pacienții nu au putut confirma dacă au avut contact cu persoane infectate cu COVID-19 și, de asemenea, nu au fost exacți în amintirea duratei exacte a simptomelor înainte de internarea în spital. Proporția de femei (29, 41,4%) a fost mai mică față de procentul de bărbați (41, 58,6%). Simptomatologia pacienților la internare a fost: febră (66, 94,3%), tuse (54, 77,1%), dispnee (44, 62,9%), cefalee (11, 15,7%), astenie (15, 21,4%), mialgie (4 , 5,7%), diaree (33, 47,1%), în timp ce 56 (80,0%), au prezentat comorbidități într-un interval de la 1 la 6. Un grup de 28 de subiecți au primit bacterioterapie orală (OB +),în timp ce un alt grup de 42 de indivizi care nu au fost suplimentați cu bacterioterapie orală (OB–) a fost grupul de comparație.tabelul 1arată caracteristicile pacienților la internare. Nu s-au observat diferențe semnificative statistic între grupul OB + și OB – unul în ceea ce privește sexul, vârsta, AST, ALT, Hb, indicele de masă corporală (IMC) și indicele de comorbiditate Charlson la momentul inițial. Nu s-au găsit diferențe semnificative între grupuri și pentru parametrii respiratori, precum și pentru proporția subiecților care prezintă diaree, febră, tuse, dispnee, cefalee, astenie și mialgie. Mai mult, toți pacienții aveau semne clinice și radiologice compatibile cu pneumonia COVID-19 și aveau nevoie de asistență respiratorie în spital, dar nu de suport pentru resuscitare. Cele două grupuri de pacienți au fost omogene în raport cu proporția subiecților care au nevoie de suport neinvaziv de oxigen livrat prin masca Venturi în respirație spontană sau prin presiune continuă pozitivă a căilor respiratorii (CPAP).TABELUL 1

Tabelul 1 . Caracteristicile grupurilor de pacienți obținute pe baza administrării bacterioterapiei.

În special, la admitere, o proporție semnificativ mai mare de pacienți cu insuficiență respiratorie a fost prezentă în grupul tratat cu bacterioterapie orală în raport cu OB– (OB- 11/42, 26,2%; OB + 14/28, 50%; p = 0,042 ). Prin urmare, toți pacienții înscriși au fost clasificați în stadiul III (pneumonie severă – COVID sever-19) din clasificarea sindromică propusă de Societatea italiană de anestezie și resuscitare (SIAARTI) ( 12 ).

În ceea ce privește terapiile medicamentoase, ambele grupuri nu au diferit în ceea ce privește numărul, tipul și combinațiile de medicamente administrate în perioada de spitalizare ( Tabelul 2 ). Timpul mediu de la diagnostic la începutul administrării orale a bacterioterapiei a fost de 1 zi (min 0 – max 2) și durata tratamentului a fost de 14 zile pentru toți pacienții.MASA 2

Tabelul 2 . Terapii medicamentoase administrate grupurilor de subiecți, determinate de administrarea bacterioterapiei.

Administrarea bacteriană orală a fost asociată cu dispariția diareei la toți pacienții în decurs de 7 zile. Interesant este că o proporție mare de subiecți OB + (6/14, 42,9%) au rezolvat diareea în 24 de ore și aproape totalitatea (13/14, 92,9%) în 3 zileFigura 1A ). De asemenea, celelalte semne și simptome – febră, astenie, cefalee, mialgie și dispnee – considerate cumulativ, au prezentat o tendință similară, mai evidentă din a doua zi de bacterioterapieFigura 1B). În special, mai puțin de jumătate dintre pacienții care nu au fost tratați cu bacterioterapie au prezentat dispariția diareei sau a altor simptome în decurs de 7 zile. În ceea ce privește rezultatul respirator, prin aplicarea modelului mixt general liniar cu procedura GLIMMIX, am observat o diferență semnificativă în evoluția rezultatului respirator între grupul OB + și OB– ( p <0,001). După 7 zile de tratament, modelul calculat a arătat un risc de 8 ori semnificativ scăzut de a evolua o insuficiență respiratorie, cu necesitatea unui suport de resuscitare, adică, care necesită ventilație predispusă sau oxigenare a membranelor extracorporale (ECMO) pentru pacienții cărora li se administrează bacterioterapie OB– indiviziFigura 2 ).

vezi figurile in articol https://doi.org/10.3389/fmed.2020.00389

Figura 1 . Graficele cu bare colorate pe baza administrării probiotice care arată dispariția diareei (A) , precum și a altor simptome (B) în diferite momente de timp. Corecția FDR Benjamini Hochberg a fost utilizată pentru a explica testarea ipotezelor multiple. S-a raportat, de asemenea, semnificația statistică între grup la nivelul alfa 0,05.

Figura 2 . Analiza datelor longitudinale pentru variabila respirație în raport cu grupul „OB– vs. OB +” efectuată de GLIMMIX. Pentru fiecare punct de timp, au fost raportate probabilitatea, intervalul de încredere 95% și semnificația statistică.

Prelungirea intervalului QT, anomaliile hepatice și renale și imunosupresia au fost monitorizate cu atenție, de asemenea, pentru tendința creșterii intervalului QT la pacienții tratați cu azitromicină. Nu s-au înregistrat evenimente adverse. Pacienții tratați cu Tocilizumab au raportat un sentiment de astenie după administrarea medicamentului și o reducere a tensiunii arteriale, care nu a necesitat niciun tratament medical. Începând cu 4 aprilie 2020, deși nu este semnificativ din punct de vedere statistic, grupul OB- a arătat o prevalență mai mare a pacienților transferați la ATI pentru ventilație mecanică (OB– vs. OB +; 2/42, 4,8% vs. 0/28, 0,0% ) sau ajungând la un rezultat letal (OB– vs. OB +; 4/42, 9,5% vs. 0/28, 0,0%). Prevalența observată a pacienților cu rezultat letal în cadrul grupului de control a fost în concordanță cu aceasta (medie ± SD 9,4 ± 1,7%;) înregistrat în Italia în perioada 9 martie – 4 aprilie 2020 (13 ). De asemenea, toți pacienții tratați cu bacterioterapie au supraviețuit bolii COVID-19 și niciunul nu a necesitat ventilație mecanică invazivă și internare în ATI.

Discuţie

Acest raport vine de la medicii din „tranșee” în timpul războiului italian împotriva infecției COVID-19. Urgența pandemiei COVID-19 a schimbat echilibrul dintre așteptarea dovezilor înainte de a decide dacă se administrează terapia sau se creează dovezi în timpul îngrijirii de rutină a pacientului, în favoarea celei de-a doua alegeri. Administrația SUA pentru Alimente și Medicamente (FDA) a permis o autorizație de utilizare de urgență pentru a prescrie hidroxiclorochina ( 14 ). OMS, CDC și FDA nu au luat o poziție cu privire la utilizarea Tocilizumab în COVID-19, chiar dacă Comisia Națională de Sănătate a Chinei o recomandă pentru utilizare la pacienții cu COVID-19, dar numai dacă sunt prezente niveluri crescute de IL-6 ( 15). De asemenea, clinicienii italieni utilizează o varietate de abordări empirice pentru gestionarea COVID-19, într-o metodă „învață în timp ce faci” ( 16). Există o nevoie urgentă de a determina care intervenții împotriva COVID-19 sunt cele mai bune, dar în absența studiilor clinice care să ghideze managementul, nu colectarea datelor din utilizarea terapiilor off-label este o oportunitate ratată. Aici raportăm un „instantaneu” asupra a 70 de pacienți internați la Departamentul de Boli Infecțioase în perioada 9 martie – 4 aprilie 2020. Un grup de pacienți a fost tratat cu hidroxiclorochină, Tocilizumab și antibiotice singure sau în combinație, în timp ce un al doilea grup dintre subiecți au fost administrați cu bacterioterapie orală în plus față de terapia medicamentoasă standard. Rezultatele au evidențiat o supraviețuire mai proastă, precum și un risc mai mare de transfer la o resuscitare intensivă pentru pacientul care nu este suplimentat cu bacterioterapie în raport cu cel suplimentat. De asemenea,riscul estimat de a dezvolta insuficiență respiratorie în timpul cursului COVID-19 a fost de peste opt ori mai mic în grupul tratat cu bacterioterapie orală, în raport cu cel netratat. În ceea ce privește celelalte semne și simptome asociate cu COVID-19, adică diaree, febră, tuse, dispnee, astenie, mialgia, o îmbunătățire semnificativă este deja evidentă după 24-48 de ore de la începerea bacterioterapiei. Există potențiale comunicații anatomice și căi complexe care implică axa intestin-plămân (GLA) (mialgia, o îmbunătățire semnificativă este deja evidentă după 24-48 de ore de la începerea bacterioterapiei. Există potențiale comunicații anatomice și căi complexe care implică axa intestin-plămân (GLA) (mialgia, o îmbunătățire semnificativă este deja evidentă după 24-48 de ore de la începerea bacterioterapiei. Există potențiale comunicații anatomice și căi complexe care implică axa intestin-plămân (GLA) (5 ). Sistemul limfatic mezenteric este calea intre plamani si intestin, prin care bacteriile intacte, fragmente sau metaboliți ai acestora pot traversa bariera intestinală pentru a ajunge la circulația sistemică și poate influența răspunsul imun pulmonare ( de 17 – de 19 ). Metaboliții intestinali afectează în mod semnificativ nu numai imunitatea intestinală locală, ci și alte organe prin sistemul limfatic și circulator. De exemplu, acizii grași cu lanț scurt (SCFA) produși în principal prin fermentarea bacteriană a fibrelor alimentare, acționează în plămâni ca semnalizare pentru atenuarea răspunsurilor inflamatorii și alergice ( 20 , 21 ). Șoarecii cu deficit de receptor SCFA prezintă răspunsuri inflamatorii crescute în modele experimentale de astm (19 ). Celulele umane posedă sisteme de apărare antioxidantă pentru protecția lor împotriva speciilor reactive de oxigen (ROS) generate de viruși; cu toate acestea, infecțiile virale deseori inhibă un astfel de răspuns ( 22 ). Nu există niciun motiv să credem că acest lucru nu este valabil și pentru COVID-19 ( 23 ). Am emis ipoteza că la pacienții infectați cu COVID-19, o formulare bacteriană cu profilul biochimic și imunologic „adecvat” ar putea declanșa mai multe funcții biologice de protecție. Tulpinile bacteriene prezente în produsul pe care l-am administrat îmbunătățesc producția atât a factorului nuclear eritroid 2p45 legat de factorul 2 (Nrf2), cât și a țintei sale hemo oxigenază-1 (HO-1) ( 24). Aceste molecule exercită activitate antivirală printr-o reducere a stresului oxidativ. Nrf2 și HO-1 au activitate antivirală semnificativă împotriva unei largi varietăți de virusuri, inclusiv virusul imunodeficienței umane (HIV), virusul gripal, virusul sincițial respirator, virusul dengue și virusul Ebola, printre altele ( 25 – 29 ). În special, proprietățile benefice ale expresiei HO-1 au fost raportate pentru virușii care produc boli pulmonare. Șoarecii care supraexprimă HO-1 în plămâni prezintă mai puțină infiltrare de celule inflamatorii în plămâni și scăderea apoptozei celulelor epiteliale respiratorii, în comparație cu șoarecii de control. Prin urmare, expresia HO-1 previne un răspuns imun exacerbat în acest țesut și deteriorarea ulterioară ( 26). Colectarea datelor clinice, examinarea și îngrijirea pacienților cu COVID-19 este o provocare pentru riscul transmiterii virusului. COVID-19 este prezent în scaune, chiar și la pacienții externați, cu potențială recurență și transmitere a virusului ( 30 , 31). Inițiativa noastră a avut ca scop modularea axei intestin-plămân, facilitarea gestionării pacienților și, eventual, determinarea rezultatului infecției pulmonare. Bacterioterapia orală a arătat un impact semnificativ statistic asupra condițiilor clinice ale pacienților cu COVID-19. Având în vedere diferitele rezultate și neetic pentru a priva un procent de pacienți cu COVID-19 de șansa de a primi bacterioterapie orală, nu am inclus mai mulți pacienți sau am extins timpul de observare. În așteptarea rezultatelor studiilor clinice de confirmare, acest raport vizează furnizarea unei sugestii intermediare pentru îmbunătățirea managementului bolii COVID-19, ținând cont de faptul că diferite preparate bacteriene pot avea rezultate destul de diferite ( 32 ).

Declarație privind disponibilitatea datelor

Toate seturile de date prezentate în acest studiu sunt incluse în articol / material suplimentar.

Declarație de etică

Studiile care au implicat participanți umani au fost revizuite și aprobate de Comitetul de Etică al Policlinico Umberto I. Pacienții / participanții și-au acordat consimțământul informat în scris pentru a participa la acest studiu.

Contribuțiile autorului

Gd’E, GCe și MM au contribuit substanțial la concepția și proiectarea studiului și interpretării și au scris manuscrisul. GCa, CP, FA, FR, GR, LC, CS, CM, VT, GER și VM au contribuit substanțial la achiziția de date și la analiză. GA, FP și CMM au elaborat sau furnizat o revizuire critică a articolului și au oferit aprobarea finală a versiunii de publicat. GR a contribuit substanțial la interpretarea datelor.

Conflict de interese

Autorii declară că cercetarea a fost efectuată în absența oricărei relații comerciale sau financiare care ar putea fi interpretată ca un potențial conflict de interese.

Mulțumiri

Autorii doresc să-i mulțumească prof. Claudio De Simone pentru sugerarea raționamentului studiului și a dozelor de bacterioterapie orală administrată. Mulțumim tuturor celor din grupul de studiu pentru terapie intensivă COVID-19 și din grupul de studiu pentru bolile infecțioase COVID-19 de la Universitatea La Sapienza din Roma care au asistat la îngrijirea pacienților din acest program. Ne exprimăm solidaritatea față de cei care sunt sau au fost bolnavi cu COVID-19, lucrătorii din domeniul sănătății din primele linii ale acestei pandemii.

Abrevieri

ABX, antibiotice; ALT, alanina aminotransferază; ALT, aspartat aminotransferază; CI, interval de încredere; COVID-19, boala coronavIrus 19; CPAP, presiune continuă pozitivă a căilor respiratorii; ECMO, oxigenare cu membrană extracorporală; FDR, rata de descoperire falsă; GLA, axa plămânului intestinal; Hb, hemoglobină; HCQ, hidroxiclorochină; HIV, virusul imunodeficienței umane; HO-1, Hemoxigenază-1; ICU, Unitatea de terapie intensivă; IRQ, gama interquartile; Nrf2, factorul eritroid 2p45 legat de factorul nuclear 2; OB–, grup de bacterioterapie orală neadministrat; OB +, grup administrat de bacterioterapie orală; ROS, specii reactive de oxigen; SCFA, acizi grași cu lanț scurt; TCZ, Tocilizumab.

Referințe

1. Feng Z, Wang Y, Qi W. Intestinul subțire, un loc subestimat al infecției cu SARS-CoV-2: de la efectul de regină roșie la probiotice. Preimprimări. (2020). doi: 10.20944 / preprints202003.0161.v1

Text integral CrossRef | Google Scholar

2. Lilei Yu, Tong Y, Shen G, Fu A, Lai Y, Zhou X și colab. Imunodepletie cu hipoxemie: un subtip potențial cu risc crescut al bolii coronavirus 2019. medRxiv. (2020). doi: 10.1101 / 2020.03.03.20030650

Text integral CrossRef | Google Scholar

3. Chiu L, Bazin T, Truchetet ME, Schaeverbeke T, Delhaes L, Pradeu T. Microbiota de protecție: de la localizată la co-imunitate de lungă durată. Front Immunol. (2017) 8: 1678. doi: 10.3389 / fimmu.2017.01678

PubMed Abstract | Text integral CrossRef | Google Scholar

4. Leyer GJ, Li S, Mubasher ME, Reifer C, Ouwehand AC. Efecte probiotice asupra incidenței și duratei simptomelor asemănătoare gripei și a gripei la copii. Pediatrie august (2009) 124: e172-9. doi: 10.1542 / peds.2008-2666

PubMed Abstract | Text integral CrossRef | Google Scholar

5. Li N, Ma WT, Pang M, Fan QL, Hua JL. Microbiota comensală și infecția virală: o analiză cuprinzătoare. Front Immunol. (2019) 10: 1551. doi: 10.3389 / fimmu.2019.01551

PubMed Abstract | Text integral CrossRef | Google Scholar

6. Enaud R, Prevel R, Ciarlo E, Beaufils F, Wieërs G, Guery B, și colab. Axa intestin-plămân în sănătatea și bolile respiratorii: un loc pentru crosstalks inter-organ și inter-regat. Microbiolul infectează celula frontală. (2020) 10: 9. doi: 10.3389 / fcimb.2020.00009

PubMed Abstract | Text integral CrossRef | Google Scholar

7. Dumas A, Bernard L, Poquet Y, Lugo-Villarino G, Neyrolles O. Rolul microbiotei pulmonare și a axului intestin-plămân în bolile infecțioase respiratorii. Microbiol celular. (2018) 20: e12966. doi: 10.1111 / cmi.12966

PubMed Abstract | Text integral CrossRef | Google Scholar

8. Laviolette L, Laveneziana P. Dispnee: o abordare multidimensională și multidisciplinară. Eur Respir J. (2014) 43: 1750–62. doi: 10.1183 / 09031936.00092613

PubMed Abstract | Text integral CrossRef | Google Scholar

9. Barr W, Smith A. Diaree acută. Sunt medic Fam. (2014) 89: 180-9.

PubMed Abstract | Google Scholar

10. Ye Z, Zhang Y, Wang Y și colab. Manifestările CT toracice ale noii boli coronavirus 2019 (COVID-19): o revizuire picturală. Eur Radiol. (2020) 1-9. doi: 10.1007 / s00330-020-06801-0. [Epub înainte de tipărire].

PubMed Abstract | Text integral CrossRef | Google Scholar

11. Charlson ME, Pompei P, Ales KL, MacKenzie CR. O nouă metodă de clasificare a comorbidității prognostice în studii longitudinale: dezvoltare și validare. J Dis cronice. (1987) 40: 373-83. doi: 10.1016 / 0021-9681 (87) 90171-8

PubMed Abstract | Text integral CrossRef | Google Scholar

12. SIAARTI. Percorso assistenziale per il paziente affetto da COVID-19 Sezione 1 – Procedure area critica – versione 02 . (2020) Disponibil online la: http://www.siaarti.it/SiteAssets/News/COVID19%20-%20documenti%20SIAARTI/Percorso%20COVID-19%20-%20Sezione%201%20-%20Procedura%20Area% 20Critica% 20-% 20Rev% 202.0.pdf (accesat la 14 iunie 2020).

Google Scholar

13. Sursa: Departamentul italian de protecție civilă . Disponibil online la: http://opendatadpc.maps.arcgis.com/apps/opsdashboard/index.html#/b0c68bce2cce478eaac82fe38d4138b1 (accesat la 10 aprilie 2020).

Google Scholar

14. Wilson KC, Chotirmall SH, Bai C, Rello J. COVID-19: Orientări provizorii privind managementul în așteptarea dovezilor empirice . Disponibil online la: www.thoracic.org/professionals/clinicalresources/disease-related-resources/covid-19-guidance.pdf (accesat la 3 aprilie 2020).

Google Scholar

15. Alhazzani W, Moller MH, Arabi Y, Loeb M, Gong MN, Fan M, și colab. Campania de supraviețuire a sepsisului: linii directoare privind managementul adulților cu boală coronariană cu boală critică 2019 (COVID-19). Terapie intensivă Med . (2020) 28 1-34. doi: 10.1097 / CCM.0000000000004363

Text integral CrossRef | Google Scholar

16. Angus DC. Optimizarea schimbului dintre învățare și lucru într-o pandemie. JAMA. (2020) 323: 1895–6. doi: 10.1001 / jama.2020.4984

PubMed Abstract | Text integral CrossRef | Google Scholar

17. Bingula R, Filaire M, Radosevic-Robin N, Bey M, Berthon JY, Bernalier-Donadille A, și colab. Turbulența dorită? Axa intestin-plămân, imunitate și cancer pulmonar. J. Oncol. (2017) 2017: 5035371. doi: 10.1155 / 2017/5035371

PubMed Abstract | Text integral CrossRef | Google Scholar

18. McAleer JP, Kolls JK. Contribuțiile microbiomului intestinal în imunitatea pulmonară. Eur J Immunol . (2018) 48: 39–49. doi: 10.1002 / eji.201646721

PubMed Abstract | Text integral CrossRef | Google Scholar

19. Trompette A, Gollwitzer ES, Yadava K, Sichelstiel AK, Sprenger N, Ngom-Bru C, și colab. Metabolismul microbiotei intestinale a fibrelor alimentare influențează boala alergică a căilor respiratorii și hematopoieza. Nat Med. (2014) 20: 159-66. doi: 10.1038 / nm.3444

PubMed Abstract | Text integral CrossRef | Google Scholar

20. Cait A, Hughes MR, Antignano F, Cait J, Dimitriu PA, Maas KR, și colab. Inflamația pulmonară alergică determinată de microbiomi este ameliorată de acizii grași cu lanț scurt. Imunol mucosal. (2018) 11: 785-95. doi: 10.1038 / mi.2017.75

PubMed Abstract | Text integral CrossRef | Google Scholar

21. Anand S, Mande SS. Dieta, microbiota și conexiunea intestin-plămân. Microbiol frontal. (2018) 9: 2147. doi: 10.3389 / fmicb.2018.02147

PubMed Abstract | Text integral CrossRef | Google Scholar

22. Hosakote YM, Jantzi PD, Esham DL, Spratt H, Kurosky A, Casola A și colab. Inhibarea mediată de virali a enzimelor antioxidante contribuie la patogeneza bronșiolitei virale respiratorii sincitiale severe. Am J Respir Crit Care Med. (2011) 183: 1550–60. doi: 10.1164 / rccm.201010-1755OC

PubMed Abstract | Text integral CrossRef | Google Scholar

23. Zhang R, Wang X, Ni L, Di X, Ma B, Niu S și colab. COVID-19: Melatonina ca potențial tratament adjuvant. Life Science. (2020) 250: 117583. doi: 10.1016 / j.lfs.2020.117583

PubMed Abstract | Text integral CrossRef | Google Scholar

24. Castelli V, Angelo M, Lombardi F, Alfonsetti M, Antonosante A, și colab. Efectele formulării probiotice SLAB51 în modele in vitro și in vivo ale bolii Parkinson. Îmbătrânire (Albany NY). (2020) 12: 4641–59. doi: 10.18632 / aging.102927

PubMed Abstract | Text integral CrossRef | Google Scholar

25. Devadas K, Dhawan S. Activarea Hemin ameliorează infecția cu HIV-1 prin inducția hemogenigenazei-1. J Immunol. (2006) 176: 4252–7 doi: 10.4049 / jimmunol.176.7.4252

PubMed Abstract | Text integral CrossRef | Google Scholar

26. Hashiba T, Suzuki M, Nagashima Y, Suzuki S, Inoue S, Tsuburai T și colab. Transferul mediat de adenovirus de hemoxigenază-1 cADN atenuează leziunile pulmonare severe induse de virusul gripal la șoareci. Gene Ther. (2001) 8: 1499–507 doi: 10.1038 / sj.gt.3301540

PubMed Abstract | Text integral CrossRef | Google Scholar

27. Espinoza JA, León MA, Céspedes PF, Gómez RS, Canedo-Marroquín G, Riquelme SA și colab. Hemoxigenaza-1 modulează replicarea virusului respirator sincitial uman și patogeneza pulmonară în timpul infecției. J Immunol. (2017) 199: 212-23 doi: 10.4049 / jimmunol.1601414

PubMed Abstract | Text integral CrossRef | Google Scholar

28. Tseng CK, Lin CK, Wu YH, Chen YH, Chen WC, Young KC și colab. Hemoxigenaza umană 1 este un factor potențial al celulei gazdă împotriva replicării virusului dengue. Sci Rep. (2016) 6: 32176. doi: 10.1038 / srep32176

PubMed Abstract | Text integral CrossRef | Google Scholar

29. Hill-Batorski L, Halfmann P, Neumann G, Kawaoka Y. Enzima citoprotectoră hem oxigenază-1 suprimă replicarea virusului Ebola. J Virol. (2013) 87: 13795–802. doi: 10.1128 / JVI.02422-13

PubMed Abstract | Text integral CrossRef | Google Scholar

30. Leung WK, To KF, Chan PK, Chan HL, Wu AK, Lee N și colab. Implicarea enterică a infecției coronavirus asociate sindromului respirator acut sever. Gastroenterologie. (2003) 125: 1011-7. doi: 10.1016 / S0016-5085 (03) 01215-0

PubMed Abstract | Text integral CrossRef | Google Scholar

31. Infusino F, Marazzato M, Mancone M, Fedele F, Mastroianni CM, Severino P, și colab. Suplimentarea dietei, probiotice și nutraceutice în infecția cu SARS-CoV-2: o analiză a scopului. Nutrienți . (2020) 12: E1718. doi: 10.3390 / nu12061718

PubMed Abstract | Text integral CrossRef | Google Scholar

32. Freedman SB, Schnadower D, Tarr PI. Enigmul probiotic: confuzie de reglementare, studii conflictuale și probleme de siguranță. JAMA. (2020) 323: 823–4. doi: 10.1001 / jama.2019.22268

PubMed Abstract | Text integral CrossRef | Google Scholar

Cuvinte cheie: COVID-19, SARS-CoV-2, bacterioterapie, probiotic, lactobacil, ax intestin-plămân, intestin

Citat: d’Ettorre G, Ceccarelli G, Marazzato M, Campagna G, Pinacchio C, Alessandri F, Ruberto F, Rossi G, Celani L, Scagnolari C, Mastropietro C, Trinchieri V, Recchia GE, Mauro V, Antonelli G, Pugliese F și Mastroianni CM (2020) Provocări în gestionarea infecției cu SARS-CoV2: rolul bacterioterapiei orale ca strategie terapeutică complementară pentru a evita progresia COVID-19. Față. Med. 7: 389. doi: 10.3389 / fmed.2020.00389

Primit: 09 mai 2020; Acceptat: 22 iunie 2020;
Publicat: 07 iulie 2020.

Editat de:Alessandro Russo , Universitatea din Pisa, Italia

Revizuite de:Antonio Vena , Universitatea din Genova, Italia
Alice Picciarella , Policlinico Casilino, Italia

Copyright © 2020 d’Ettorre, Ceccarelli, Marazzato, Campagna, Pinacchio, Alessandri, Ruberto, Rossi, Celani, Scagnolari, Mastropietro, Trinchieri, Recchia, Mauro, Antonelli, Pugliese și Mastroianni. Acesta este un articol cu ​​acces liber distribuit în conformitate cu condițiile Creative Commons Attribution License (CC BY) . Utilizarea, distribuirea sau reproducerea în alte forumuri este permisă, cu condiția ca autorul (autorii) original (i) și deținătorul (autorii) drepturilor de autor să fie creditați și dacă publicația originală din această revistă este citată, în conformitate cu practica academică acceptată. Nu este permisă nicio utilizare, distribuție sau reproducere care nu respectă acești termeni.

* Corespondență: Giancarlo Ceccarelli, giancarlo.ceccarelli@uniroma1.it

https://www.nutraingredients.com/Article/2020/07/21/Probiotic-blend-may-act-to-halt-coronavirus-development

Int J Biol Sci . 2020; 16 (10): 1708-1717.Publicat online 2020 15 mar. Doi:  10.7150 / ijbs.45538PMCID: PMC7098036PMID: 32226288

Medicina tradițională chineză în tratamentul pacienților infectați(SARS-CoV-2) Covid19: o revizuire și o perspectivă

Yang Yang , Md Sahidul Islam , Jin Wang , Yuan Li și Xin Chen Informații despre autor Note despre articol Informații privind drepturile de autor și licență RenunțareAcest articol a fost citat de alte articole din PMC.

Date asociate

Materiale suplimentare

Abstract

În prezent, sindromul respirator acut sever Coronavirus 2 (SARS-CoV-2, cunoscut anterior sub numele de 2019-nCoV, agentul patogen cauzal al bolii Coronavirus 2019 (COVID-19)) s-a răspândit rapid în China și în întreaga lume, provocând un focar de pneumonie infecțioasă. Nu sunt disponibile medicamente antivirus sau vaccinuri specifice pentru tratamentul acestei boli bruște și letale. Singura opțiune în prezent este îngrijirea de susținere și tratamentul nespecific pentru ameliorarea simptomelor pacientului. În partea de TOP a acestor terapii convenționale, mai mult de 85% dintre pacienții infectați cu SARS-CoV-2 din China beneficiază de tratament pentru medicina tradițională chineză (TCM). În acest articol, literaturile relevante publicate sunt revizuite cu atenție și sunt analizate aplicațiile curente ale TCM în tratamentul pacienților cu COVID-19. Datorită omologiei în epidemiologie,genomică și patogenia SARS-CoV-2 și SARS-CoV și utilizarea pe scară largă a TCM în tratamentul SARS-CoV, sunt discutate dovezile clinice care arată efectul benefic al TCM în tratamentul pacienților cu infecții coronavirale SARS . Studiile experimentale actuale care oferă o perspectivă asupra mecanismului care stă la baza efectului terapeutic al TCM și acele studii au identificat noi compuși naturali cu activitate anti-coronavirală..

Cuvinte cheie: SARS-CoV-2, Medicină tradițională chineză (TCM), pneumonie coronavirus

Introducere

În decembrie 2019, a existat un focar de pneumonie inexplicabilă în orașul Wuhan, provincia Hubei, China 1 . Până la 7 ianuarie 2020, s-a confirmat că a apărut un nou tip de coronavirus numit SARS-CoV-2 (denumit anterior 2019-nCoV) 2 . Organizația Mondială a Sănătății (OMS) a numit pneumonia Wuhan drept boala Coronavirus-2019 (COVID-19) pe 11 februarie 2020 3 . Pacienții cu COVID-19 au prezentat simptome respiratorii tipice (cum ar fi tuse, febră și leziuni pulmonare) și alte simptome, cum ar fi oboseala, mialgia și diareea 4 , 5 . Începând cu 17 februarie 2020, în China și în alte 25 de țări au fost raportate un total de 73.332 cazuri de pneumonie infectată cu SARS-CoV-2, din care 72.528 cazuri au fost găsite în China 6. Datorită răspândirii rapide a SARS-CoV-2 prin transmiterea de la om la om, cazurile în prezent continuă să crească. SARS-CoV-2 extras de la pacienții cu pneumonie din Wuhan este un beta-coronavirus de tip ARN monocatenar învelit 7 . Secvențele genomice ale SARS-CoV-2 au împărțit 79,5% identitatea secvenței cu coronavirusurile asociate sindromului respirator acut sever (SARS-CoV) 8 , 9 . În plus, proteina spike (S) a SARS-CoV-2 și SARS-CoV intră în celulele epiteliale alveolare umane prin legarea receptorului 8 al enzimei de conversie a angiotensinei 2 (ACE2) 8 .

COVID-19 poate fi diagnosticat fie prin radiografie CT toracică, fie printr-un test de laborator. Din păcate, medicamentele antivirale specifice sau vaccinurile în prezent nu au fost disponibile pentru tratament10 , 11 . Conform ghidului clinic actual din China și experiențelor în tratamentul pacienților cu SARS sau cu sindrom respirator din Orientul Mijlociu (MERS), atât medicina convențională, cât și medicina tradițională chineză (TCM) sunt utilizate pentru tratamentul pacienților cu infecție cu SARS-CoV-. 2 în China , de 12 – pe 14 . Această revizuire se concentrează în principal pe discuția despre utilizarea TCM în tratamentul pacienților cu COVID-19, în contextul managementului convențional actual. Datorită omologiei în epidemiologie, genomică și patogenie a SRAS-CoV-2 și SARS-CoV8 , 9 și utilizarea pe scară largă a TCM în tratamentul pacienților infectați cu SARS-CoV în 2002-2003 15 , dovezile clinice care arată eficacitatea și siguranța TCM în tratamentul pacienților cu coronaviral emergent vor fi rezumate și analizate, inclusiv studiile de laborator care oferă o perspectivă asupra bazei moleculare a beneficiilor terapeutice.

Tratamentul convențional al SARS-CoV-2: există loc pentru medicina chineză?

Datorită absenței unei terapii antivirale specifice și a unui vaccin, strategia principală de tratament pentru COVID-19 este îngrijirea de susținere, care este completată de combinația de antibiotice cu spectru larg, antivirale, corticosteroizi și plasmă convalescentă 16 (Tabel(…)(Tabelul 1).1). Inhibitorii de protează HIV ritonavir și lopinavir au fost utilizați, de obicei în combinație cu antibiotice adecvate sau cu IFNα-2b, în ​​tratamentul pacienților infectați cu SARS-CoV-2 7 , 17 . Analogii nucleozidici, cum ar fi ribavirina 12, pot fi potențial benefici pentru tratamentul COVID-19, deoarece ribavirina a fost aprobată pentru tratarea infecției cu virusul sincițial respirator (RSV) 18 și utilizată pe scară largă în timpul focarului SARS și MERS 10 . Cu toate acestea, ribavirina a avut efecte secundare severe, cum ar fi anemia 18și dacă a avut suficientă activitate antivirală împotriva SARS-CoV-2 este neclar. Analogii nucleozidici favipiravir (T-705) pot inhiba în mod eficient activitatea ARN polimerazei virusurilor ARN, cum ar fi gripa 19 . Un studiu recent in vitro a constatat că avea activitatea anti-SARS-CoV-2 20 , dar efectul in vivo rămâne evaziv. Remdesivirul poate fi cel mai promițător medicament antiviral pentru tratamentul COVID-19. Are activitate antivirală in vitro și in vivo împotriva unei game largi de viruși ARN, inclusiv SARS și MERS 21 , și ar putea scădea încărcăturile virale și patologia plămânilor la modelele animale 22. Un studiu a arătat că remdesivirul a inhibat semnificativ infecția cu SARS-CoV-2 în celulele Vero E6 20 , iar majoritatea simptomelor primului pacient din SUA infectat cu SARS-CoV-2 s-au rezolvat rapid după administrarea intravenoasă cu remdesivir 23 . În prezent, se află în studiu clinic pentru a evalua siguranța și eficacitatea remdesivirului intravenos la pacienții cu infecție SARS-CoV-2 24 . Oseltamivirul oral a fost utilizat pentru tratamentul cazurilor cu SARS-CoV-2 7 , în timp ce eficacitatea sa rămâne în prezent incertă.

tabelul 1

Tratamentul convențional al pacienților cu infecție cu SARS-CoV-2

Tipul tratamentuluiAgent sau dispozitiv terapeuticReferinţă
Terapia cu oxigen
Canulă nazală
Ventilație mecanică neinvazivă Ventilație
mecanică invazivă
ECMO *
16
Combinație de antibioticeAmoxicilină
Azitromicină
Fluorochinolonele
16
Antivirale

Lopinavir / ritonavir16 , 17
Ribavirină16 , 18
Favipiravir (T-705)19 , 20
Remdesivir20 – 23
Oseltamivir7
Clorochina20 , 36
Interferon7 , 17
CorticosteroiziMetilprednisolon7
Plasma convalescentăPlasma convalescentă22

* ECMO, oxigenare cu membrană extracorporală.

Moleculele mici vizate de gazdă aprobate pentru alte boli umane pot modula interacțiunile virus-gazdă ale SARS-CoV-2. Clorochina, un potențial medicament antiviral cu spectru larg 25 , 26 , a fost demonstrat de un studiu recent cu activitate anti-SARS-CoV-2 20 . Eficacitatea sa clinică este în curs de studiu într-un studiu deschis (ChiCTR2000029609) 12 . Inhalarea de atomizare IFNα (5 milioane U) a fost recomandată ca terapie antivirală pentru tratarea SARS-CoV-2 16 . A fost inițiat un test de testare a combinației IFNα-2b a inhibitorilor anti-HCV aprobați 17 , cu toate acestea, nu este clar dacă ar putea acționa sinergic împotriva SARS-CoV-2.

Corticosteroizii au fost folosiți frecvent pentru a suprima nivelurile crescute de citokine la pacienții cu SARS-CoV 27 , 28 și MERS-CoV 29 , 30 . Cu toate acestea, nu există dovezi care să arate că mortalitatea pacienților cu SARS și MERS a fost redusă prin tratamentul cu corticosteroizi, în timp ce clearance-ul viral a fost întârziat cu un astfel de tratament 31 – 33 . În consecință, nu se recomandă utilizarea corticosteroizilor în mod sistemic la pacienții infectați cu SARS-CoV-2 34 , 35 .

Anterior, s-a demonstrat că, fie în gripa severă, fie în infecția cu SARS-CoV, tratamentul cu plasmă convalescentă ar putea scădea semnificativ încărcătura virală și reduce mortalitatea 31 , 36 . Plasma convalescentă a fost utilizată pentru infecția severă cu SARS-CoV-2 în China 22 , deși promițătoare, eficacitatea și siguranța trebuie să fie evaluate în continuare cu atenție.

În conformitate cu analiza anterioară, OMS a concluzionat, de asemenea, „până în prezent, nu există niciun medicament specific recomandat pentru prevenirea sau tratarea SARS-CoV-2” 37 . 

TCM a fost utilizat în combaterea bolilor infecțioase de mii de ani. Există loc pentru intervenția TCM ca terapie complementară pentru pacienții cu COVID-19. Se raportează că pacienții cu infecție SARS-CoV au beneficiat de tratament TCM 38 , inclusiv ameliorarea efectului secundar al terapiei convenționale 39 , 40 . Pe baza acestor factori, există o așteptare generală că TCM ar fi o armă valoroasă împotriva SARS-CoV-2.

Medicina tradițională chineză în tratamentul pacienților infectați cu SARS-CoV: dovezi clinice

Aplicarea TCM în tratamentul SARS-CoV-2 este în mare măsură inspirată de tratamentul SARS cauzat de focarul de coronavirus SARS (SARS-CoV) la sfârșitul anului 2002 în provincia Guangdong din China, care s-a răspândit rapid în 2003, cu numărul cumulat la nivel mondial de peste 8.000 41 – 43 . De la rapoarte de cazuri, serii de cazuri, studii observaționale controlate și studii clinice randomizate, au fost efectuate și raportate studii clinice care vizează examinarea efectului TCM asupra SARS. Există dovezi destul de convingătoare care susțin ideea că TCM are un efect benefic în tratamentul sau prevenirea SARS. De exemplu, rata de fatalitate în Hong Kong și Singapore a fost de aproximativ 18%, în timp ce rata de la Beijing a fost inițial mai mult de 52% până la 5 leadin mai și a scăzut treptat până la 4% -1% după 20 – lea mai in 2003. dramatica reducere de fatalitate de la sfârșitul lunii mai de la Beijing a fost considerata a fi asociata cu utilizarea TCM ca un supliment la terapia convențională 44 . Lau și colegii săi au raportat că, în timpul focarului SARS, 1063 de voluntari, inclusiv 926 de muncitori din spitale și 37 de tehnicieni de laborator care lucrează în laboratoare cu virusuri cu risc ridicat, au folosit un extract din plante TCM, și anume Sang Ju Yin plus Yu Ping Feng San . În comparație cu 0,4% din infecția din grupul de control, niciunul dintre utilizatorii TCM nu s-a infectat. Mai mult, au existat unele dovezi că Sang Ju Yin plus Yu Ping Feng Sanar putea modula celulele T într-o manieră pentru a spori capacitatea de apărare a gazdei 45 , 46 . Într-un studiu clinic controlat, tratamentul suplimentar cu TCM a dus la îmbunătățirea marcată a simptomelor și a scurtat evoluția bolii 47 . Efectul benefic clinic al TCM pare să fie susținut de studii de laborator. De exemplu, o cercetare de înaltă calitate publicată în Lancet a raportat că glicirizina, o rădăcină constitutivă activă majoră de lemn dulce, care este cea mai frecvent utilizată plantă chineză, a inhibat puternic replicarea izolatelor clinice ale virusului SARS 48. Un alt studiu independent a confirmat activitatea antivirus a glicirizinei prin teste de reducere a plăcii și acest studiu a constatat că un alt compus din plante chinezesc baicalin a avut, de asemenea, activitatea anti-SARS 49 . Mai mult, Wang și colab . găsit MOL376, un compus derivat din TCM, poate deveni un compus de plumb pentru terapia SARS prin inhibarea catepsinei L, o țintă pentru tratamentul SARS 50 .

Există o mulțime de literatură despre tratamentele TCM pentru SARS publicate după epidemia de SARS din China. O analiză critică a acestor publicații ar fi utilă pentru a confirma efectul benefic al TCM. Liu și colab. a analizat sistematic opt studii controlate randomizate și a concluzionat că, prin combinație cu medicina convențională, TCM a arătat efectele benefice, cum ar fi scăderea mortalității și ameliorarea simptomelor, precum și controlul infecțiilor fungice la pacienții cu SARS. Cu toate acestea, dovezile nu sunt suficiente, din cauza calității slabe a metodologiei utilizate în studii 13. Leung a analizat 90 de lucrări peer-review cu o calitate rezonabilă din 130 de publicații și a concluzionat că TCM utilizat împreună cu tratamentul convențional a avut unele efecte pozitive, inclusiv un control mai bun al febrei, eliminarea mai rapidă a infecției toracice și alte simptome. Cu toate acestea, un astfel de efect benefic al TCM nu este concludent și sunt necesare studii clinice de înaltă calitate 15 . Într-o altă analiză aprofundată a literaturii, Liu și colegii au ajuns la concluzia că nu există niciun beneficiu al tratamentului adjuvant cu TCM în ceea ce privește mortalitatea 39 . Datorită lipsei studiilor TCM de înaltă calitate și a prejudecăților care au influențat validitatea rezultatelor, Wu și colegii săi au sugerat să repete testele clinice ale TCM pentru tratamentul infecțiilor acute ale tractului respirator (ARTI) 51 .

Identificarea compusului anti-covid19 din medicina tradițională chineză

Produsele naturale utilizate în TCM rămân a fi o sursă bogată pentru identificarea unor agenți terapeutici noi pentru tratamentul bolilor umane 52 . În ultimul deceniu, oamenii de știință au depus un efort considerabil pentru a identifica formule pe bază de plante cu componente multiple în TCM cu activitate anti-SARS-CoV (Tabel(…)(Masa 2).2). S-a urmărit, de asemenea, identificarea ulterioară a entităților chimice conținute în plante TCM responsabile de efectul anti-SARS-CoV (Tabel(…)(Tabelul 3).3). Datorită omologiei SARS-CoV și SARS-CoV-2, aceste studii anterioare pot arunca lumina asupra compușilor naturali care au capacitatea de a inhiba SARS-CoV-2.

tabel 2

Formule de plante TCM utilizate pentru Tratamentul infecției cu SARS-CoV

Formula TCMCompoziţieEfect terapeuticReferinţă
Yin Qiao SanFructus Forsythiae, Flos Lonicerae, Radix Platycodonis, Herba Menthae, Herba Lophatheri, Radix Glycyrrhizae, Herba Schizonepetae, Soia fermentată , Fructus arctii și Rhizoma Phragmitis„Dispersează căldura vântului, curăță căldura și ameliorează toxicitatea”, conform teoriei TCM
Tratamentul infecției tractului respirator superior.
Îmbunătățirea funcției sistemului imunitar al mucoasei căilor respiratorii superioare
111 , 112
Yu Ping Feng SanAstragali radix, Astragalus membranaceus, Atractylodes macrocephala și Saposhnikoviae Radix„Tonifiant qi ” pentru a proteja împotriva agenților patogeni externi ”, conform teoriei TCM
Se pare că au efecte antivirale, antiinflamatorii și imunoreglatorii
113 – 115
Sang Ju Yin și Yu Ping Feng SanSang Ju Yin [făcut cu crizantemă, frunze de dud și alte 6 ierburi] și Yu Ping Feng SanSe pare că au efecte antivirale și imunoregulatoare46
Lian Hua Qing Wen CapsuleSuspensa forsythia , Ephedra sinica, Lonicera japonica, Isatis indigotica, Mentha haplocalyx, Dryopteris crassirhizoma, Rhodiola rosea, Gypsum Fibrosum , Pogostemon cablin, Rheum palmatum , Houttuynia cordata, Glycyrrhizae, uralensis, și armeniaca sibirica„Se curăță căldura și se detoxifică, îndepărtează căldura pulmonară”, conform teoriei TCM
Se pare că au efecte antivirale, antiinflamatorii și imunoregulatoare.
8283
Shuang Huang LianLonicera japonica, Scutellaria baicalensis, and Forsythia suspensa“Clear heat and detoxify, remove lung hotness”, according to TCM theory
Reportedly has anti-SARS-CoV-2 activity
Reportedly has immunosuppressive effects
7880116
Ma Xin Gan Shi TangEphedrae herba, Armeniacae semenamarum), Glycyrrhizae radix et rhizome, Gypsum fibrosum, and Da Yuan Yin [Arecae semen, Magnoliae officinalis cortex, Tsaoko fructus,Anemarrhenae rhizoma, Dioscoreae rhizoma, Scutellariae radix, and Glycyrrhizae raadix et rhizome]„Facilitează fluxul pulmonar„ qi ” și îndepărtează căldura”, conform teoriei TCM
Se pare că au activitate anti-SARS-CoV
117 , 118

Deschideți într-o fereastră separată

Tabelul 3

Extracte din plante TCM sau compuși derivați TCM cu activitate anti-HCoV

Compuși TCMModul de acțiuneReferinţă
Compuși fenolici derivați din plante și extract de rădăcină de Isatis indigoticaInhibați activitatea de scindare a enzimei SARS-3CLpro57
Extract apă din Houttuynia cordataInhibați activitatea SARS-3CLpro
virală Blocați activitatea virală a ARN-polimerazei dependente de ARN (RdRp)
Imunomodulare
54 , 55
Scutellarein și myricetinInhibați nsP13 afectând activitatea ATPazei61
Glicirizina din Glycyrrhizae radixInhibă adsorbția și penetrarea virală48 , 75
Herbacetină, quercetină, izobavascalconă, 3-β-D-glucozidă și helichrysetinăInhibă activitatea de scindare a enzimei MERS-3CLpro60
Tetrandrina, fangchinolina și cefarantinaInhibați expresia proteinei HCoV-OC43 și a proteinei nucleocapsidice.
Imunomodulare
106 , 119
Extractele de rubarbă chinezăInhibați activitatea SARS-3CLpro53
Flavonoide (de exemplu: extras din semințe de litchi, herbacetină, rhoifolin, pectolinarină, quercetină, epigalocatechină galat și galocatechină galat)Inhibați activitatea SARS-3CLpro56 , 58 , 59
Quercetin și TSL-1 de la Toona sinensis RoemInhibați intrarea celulară a SARS-CoV76
Emodin derivat din genul Rheum și PolygonumInhibați interacțiunea proteinei SARS-CoV Spike și ACE2
Inhibați canalul ionic 3a al coronavirusului SARS-CoV și HCoV-OC43
67 , 72
Derivați de kaempferolInhibați canalul ionic 3a al coronavirusului73
Baicalin din Scutellaria baicalensisInhibați enzima de conversie a angiotensinei (ECA)44 , 68
SaikosaponinsPreveniți stadiul incipient al infecției cu HCoV-22E9, inclusiv atașamentul și penetrarea virală74
Tetra- O -galloyl-β-D-glucoză și luteolina, de la Galla chinensis și Veronicalina riifolia respectivSe leagă avid de proteina vârf de suprafață a SARS-CoV71

Deschideți într-o fereastră separată

Proteaza asemănătoare chimotripsinei (3CLpro) este vitală pentru replicarea virusului și, prin urmare, reprezintă o țintă promițătoare a medicamentului pentru dezvoltarea agenților terapeutici pentru SARS-CoV, precum și pentru alte coronavirusuri umane, inclusiv SARS-CoV-2. Sa raportat că în urma TCM extracte din plante au capacitatea de a inhiba activitatea enzimatică a SARS 3CLpro: chineză rubarbă extracte (IC50: 13,76 ± 0,03 pg / ml) 53 , apă extract de Houttuynia cordata 54 , 55 , flavonoid extras din litchi semințe de 56 și beta-sitosterol (IC50: 1210µM) extras din extractul de rădăcină de Isatis indigotica 57. Mai mult, urmând compuși naturali obținuți din plante, inclusiv sinigrină (IC50: 217µM), indigo (IC50: 752µM), aloe-emodină (IC50: 366 µM), hesperetin (IC50: 8,3 µM) 57 , quercetin (IC50: 73µM), galatul de epigalocatechină (IC50: 73 uM), galatul de galocatechină (IC50: 47 uM) 58 , herbacetina, rhoifolina și pectolinarina 59 au fost capabili să inhibe activitatea SARS 3CLpro. Mai mult, flavonoidele și anume herbacetina, izobavascalcona, quercetina 3-β-D-glucozidă și helichrysetina au potențialul de a bloca activitatea enzimatică a proteazei MERS-CoV 3CL 60 .

Proteina helicază este, de asemenea, considerată ca o țintă potențială pentru dezvoltarea agenților anti-HCoV (coronavirus uman). Yu și colab. scutellareina și myricetina raportate au inhibat puternic nsP13 (proteina helicază SARS-CoV) in vitro prin afectarea activității ATPazei 61 . ARN-polimeraza dependentă de ARN (RdRp), o enzimă cheie responsabilă atât pentru sinteza ARN pozitivă cât și pentru cea negativă, reprezintă, de asemenea, o altă țintă potențială drogabilă. S-a arătat că extractele de Kang Du Bu Fei Tang (IC50: 471,3 µg / mL), Sinomenium acutum (IC50: 198,6 µg / mL), Coriolus versicolor (IC50: 108,4 µg / mL) și Ganoderma lucidum(IC50: 41,9 µg / ml) a inhibat SARS-CoV RdRp într-o manieră dependentă de doză 54 . Wu și colab. a efectuat screening la scară largă a medicamentelor existente, a produselor naturale și a compușilor sintetici (> 10000 de compuși) pentru a identifica agenți anti-SARS-CoV eficienți printr-un test pe bază de celule cu virusul SARS și celulele Vero E6 62 . Au descoperit că ginsenozida-Rb1 izolată din ginsengul Panax , aescina izolată din castanul de cal, reserpina conținută în genul Rauwolfia și extractele de eucalipt și Lonicera japonica au inhibat replicarea SARS-CoV la concentrații netoxice 62 .

La fel ca SARS-CoV și HCoV-NL63, SARS-CoV-2 folosește receptorul gazdă ACE2 pentru intrarea celulară 63 – 66 . Prin urmare, TCM cu capacitatea de a viza ACE2 deține promisiunea de a preveni infecția cu SARS-CoV-2. Emodin din genul Rheum și Polygonum 67 , baicalin din Scutellaria baicalensis 44 , 68 , nicotianamină din alimente (în special „inhibitor de soia ACE2 (ACE2iSB)”) 69 , scutellarin 70 , tetra- O -galoyl-β-D-glucoză (TGG) din Galla chinensis și luteolină din Veronicalina riifolia 71a inhibat semnificativ interacțiunea SARS-CoV S-protein și ACE2. Cu toate acestea, activitatea anti-SARS-CoV a acestor compuși rămâne de evaluat. În plus, inhibarea canalului de ioni 3a de către emodina 72 sau derivații de kaempferol – juglanina 73 ar putea preveni eliberarea virală din celulele infectate. Saikosaponinele 74 , glicirizina 48 , 75 , quercetina și TSL-1 extrase din Toona sinensis Roem 76 ar fi avut efecte puternice anti-SARS-CoV prin inhibarea intrării celulare virale, adsorbție și penetrare.

Răspunsurile inflamatorii copleșitoare sunt atribuite deceselor pacienților cu infecție cu SARS-CoV sau MERS-CoV sau COVID-19. Astfel, agenții antiinflamatori probabil ar putea reduce severitatea și mortalitatea 77 . Shuang Huang Lian, un produs pe bază de plante TCM preparat din Lonicerae japonicae Flos, Scutellariae radix și Fructus Forsythiae, ar fi avut activitatea de a inhiba SARS-CoV-2 78 . Interesant, am arătat că acest preparat pe bază de plante inhibă puternic sindromul de șoc toxic stafilococic producerea de citokine (IL-1β, IL-6, TNF-α, IFN-γ) și chemokine (MIP-1α) induse de toxina 1 (TSST-1) , MIP-1β și MCP-1) de celule mononucleare din sânge periferic (PBMC)79 . În conformitate cu rezultatele noastre, sa demonstrat că acest produs pe bază de plante reduce semnificativ nivelurile transcripționale și translaționale ale citokinelor inflamatorii TNF-α, IL-1β și IL-6 în macrofagele alveolare murine stimulate de lipopolizaharide 80 . Indirubina este un ingredient activ al unui preparat TCM Dang Gui Long Hui Pill, a avut efecte antivirale și imunomodulatoare puternice, după cum se arată într-un studiu bazat pe observarea macrofagelor umane infectate cu virusul H5N1 și a celulelor epiteliale alveolare de tip I 81 .S-a raportat că Lian Hua Qing Wen Capsule are in vitroactivitate în inhibarea propagării diferitelor virusuri gripale. Acest produs pe bază de plante TCM nu numai că a blocat stadiile incipiente ale infecției cu virusul gripal, dar a inhibat și expresia genică indusă de virus a IL-6, IL-8, TNF-a, IP-10 și MCP-1 82 . În plus, un studiu realizat de Dong și colab . a raportat că nivelurile de IL-8, TNF-α, IL-17 și IL-23 în spută și de IL-8 și IL-17 în sânge au fost semnificativ scăzute după tratamentul cu Lian Hua Qing Wen Capsule la pacienții cu acută exacerbarea bolii pulmonare obstructive cronice 83 . Un studiu de autocontrol realizat de Poon și colab. a arătat că administrarea formulelor pe bază de plante TCM ( Sang Ju Yin și Yu Ping Feng San) poate avea efecte imunomodulatoare benefice pentru prevenirea infecțiilor virale, inclusiv SARS-CoV 46 .

Mai mult, un număr de agenți anti-coronavirali au fost identificați din plante TCM, deși mecanismele de acțiune nu au fost încă elucidate. De exemplu, extracte din Lycoris radiata , Artemisia annua , Pyrrosia lingua și agregat Lindera posedau activitatea anti-SARS-CoV 84 , 3β-Friedelanol izolat din Euphorbia neriifolia 85 , Blancoxanthone izolat din rădăcinile Calophyllum blancoi 86 au prezentat anti-HCoV- 229E activitate.Mergi la:

Medicina tradițională chineză utilizată în tratamentul pacienților infectați cu SARS-CoV-2: situațiile actuale

TCM este foarte apreciat de guvernul Chinei în campania sa de conținere și eradicare a SRAS-CoV-2. De exemplu, Comisia de sănătate din 26 de provincii a declarat oficial că TCM ar trebui utilizat în combinație cu medicina convențională în tratamentul pacienților cu COVID-19. La 17 februarie, Comisia Națională de Sănătate (NHC) din Republica Populară Chineză a raportat că 60.107 pacienți confirmați cu COVID-19 (85,20% din totalul cazurilor confirmate) au fost tratați cu TCM 87. În ceea ce privește 1 martie 2020, în China au fost lansate un total de 303 de studii clinice aflate în desfășurare cu scopul de a evalua eficacitatea și siguranța tratamentelor pentru pacienții cu CoV-19. Dintre acestea, 50 de studii (16,5%) se referă la utilizarea TCM, inclusiv 14 cazuri (4,6%) pentru a examina efectul tratamentului combinat cu TCM și medicina occidentală. În 22 de studii TCM (7,3%), se examinează efectul preparatelor pe bază de plante auto-fabricate, cum ar fi Formula Xin Guan-1 , Formula Xin Guan-2 și Qing Yi-4 . În alte 14 studii TCM (4,6%), sunt studiate produsele TCM disponibile comercial, cum ar fi injecția Tan Re Qing și capsula Lian Hua Qing Wen ((Tabelul 44).

Tabelul 4

Încercări clinice TCM în curs pentru tratamentul infecției cu SARS-CoV-2


Număr de înregistrare
Tipul de proiectareTitluMedicină pe bază de plante TCMMarime de mostraFază
ChiCTR2000029432CCTUn studiu real pentru eficacitatea și siguranța dozei mari de injecție Tanreqing în tratamentul pacienților cu pneumonie coronavirusă nouă (COVID-19)Injecție Tan Re Qing724
ChiCTR2000029434RCTUn studiu randomizat, deschis, controlat în gol, pentru Lian-Hua Qing-Wen Capsule / Granule în tratamentul unei noi pneumonii cu coronavirus (COVID-19)Lian Hua Qing Wen Capsulă / Granulă4004
ChiCTR2000029487CCTStudiu clinic pentru Gu-Biao Jie-Du-Ling în prevenirea pneumoniei cu coronavirus (COVID-19) la copiiGu Biao Jie Du Ling2000
ChiCTR2000029589CCTUn studiu clinic deschis, prospectiv, multicentric pentru eficacitatea și siguranța injecției Reduning în tratamentul pneumoniei cu coronavirus ovel (COVID-19)Re Du Ning
Injection
600
ChiCTR2000029605RCTUn studiu randomizat, deschis, controlat în gol, multicentric, pentru soluția orală Shuang-Huang-Lian în tratamentul pneumoniei coronavirus noi (COVID-19)Shuang Huang Lian Lichid oral4004
ChiCTR2000029780RCTUn studiu multicentric, randomizat, deschis, controlat pentru eficacitatea și siguranța injecției Shen-Qi Fu-Zheng în tratamentul unei noi pneumonii cu coronavirus (COVID-19)Injecție Shen Qi Fu Zheng1604
ChiCTR2000029781RCTUn studiu multicentric, randomizat, deschis și controlat pentru eficacitatea și siguranța granulelor Kang-Bing-Du în tratamentul pneumoniei cu coronavirus noi (COVID-19)Kang Bing Du Granules1604
ChiCTR2000029822RCTUn studiu controlat randomizat pentru decoct de caprifoi în tratamentul pacienților cu infecție nouă cu coronavirus (COVID-19)Jin Yin Hua Tang1100
ChiCTR2000029991RCTA randomized, open-label, controlled trial for the safety and efficiency of Kesuting syrup and Keqing capsule in the treatment of mild and moderate novel coronavirus pneumonia (COVID-19)Ke Su Ting Syrup
/Ke Qing Capsule
724
ChiCTR2000030043RCTShen-Fu injection in the treatment of severe novel coronavirus pneumonia (COVID-19): a multicenter, randomized, open-label, controlled trialShen Fu Injection3004
ChiCTR2000030117RCTA multicenter, randomized, open, parallel controlled trial for the evaluation of the effectiveness and safety of Xiyanping injection in the treatment of common type novel coronavirus pneumonia (COVID-19)Xi Yan Ping Injection3484
ChiCTR2000030255RCTEfficacy and safety of Jing-Yin Granule in the treatment of novel coronavirus pneumonia (COVID-19) wind-heat syndromeJing Yin Granule3004
ChiCTR2000030388RCTEficacitatea și siguranța injecției Xue-Bi-Jing în tratamentul cazurilor severe de pneumonie coronavirusă nouă (COVID-19)Injecție Xue Bi Jing600
ChiCTR2000029813RCTStudiu clinic pentru capsulele Tanreqing în tratamentul pneumoniei cu coronavirus nou (COVID-19)Capsule Tan Re Qing720

Deschideți într-o fereastră separată

Note: RCT: studiu controlat randomizat; CCT: studiu clinic controlat.

Până în prezent, NHC a publicat 6 ediții Ghiduri de diagnostic și tratament pentru COVID-19 88 . Începând cu a patra versiune, diferite medicamente pe bază de plante utilizate în sistemul TCM au fost recomandate pentru tratamentul COVID-19, pe baza stadiului bolii și a diferențierii simptomelor 89 . Conform celei mai recente ediții a Ghidului 88 , după recomandarea produselor pe bază de plante din China cu mai multe componente pentru pacienții din perioada de observare medicală, probabil ca măsură preventivă: Huo Xiang Zheng Qi Shui , Lian Hua Qing Wen Capsule , S hu Feng Jie Du Capsule și Jin Hua Qing Gan Granule . În perioada de tratament clinic, Qing Fei Pai Du TangInjecția Xi Yan Ping , injecția Xue Bi Jing , injecția Re Du Ning, injecția Tan Re Qing , injecția Xing Nao Jing și alte formule de medicină chineză ar trebui selectate 90 . În plus, pentru pacienții aflați în stare critică, trebuie administrată injecția Shen Fu , injecția Sheng Mai , injecția Shen Mai , pilula Su He Xiang și pilula An Gong Niu Huang (Tabelul 5).

Tabelul 5

TCM recomandat de ediția a 6-a Ghiduri de diagnostic și tratament pentru COVID-19 88 .

Stadiul boliiSimptomMedicină chineză brevetată recomandată
Perioada de observare medicalăOboseală cu disconfort gastro-intestinalHuo Xiang Zheng Qi Shui
Oboseală cu febrăLian Hua Qing Wen Capsule, Shu Feng Jie Du Capsule, Jin Hua Qing Gan Capsule
Perioada de tratament clinic
(pacienți confirmați)
Cazuri ușoareQing Fei Pai Du Tang
Cazuri generaleQing Fei Pai Du Tang
Mai multe cazuriXi Yan Ping Injection, Xue Bi Jing Injection, Re Du Ning Injection, Tan Re Qing Injection, Xing Nao Jing Injection, Qing Fei Pai Du Tang
Cazuri criticeInjecție Xue Bi Jing, injecție Re Du Ning, injecție Tan Re Qing, injecție Shen Fu, injecție Sheng Mai, injecție Shen Mai, pilula Su He Xiang, o pastilă Gong Niu Huang

Prin analiza frecvenței TCM utilizată în 23 de provincii, Luo și colab. 37 au concluzionat că Astragalus membranaceus, Glycyrrhizae uralensis, Saposhnikoviae divaricata, Rhizoma Atractylodis Macrocephalae, Lonicerae Japonicae Flos, Fructus forsythia, Atractylodis Rhizoma, Radix platycodonis, Agastache rugosa și Cyrtomium fortune folosită în mod obișnuit în cele mai folosite obiecte din Cyrtomium pentru fortăreața J. SmID au fost 10 cele mai folosite pentru a fi folosite în Cyrtomium fortune J. Sm. -19. Xu și colab. 91 a raportat că Astragalus membranaceus și Yu Ping Feng au fost utilizate în cele 13 programe de prevenire (la Beijing, Tianjin și colab.) Pentru „consolidarea qi-ului vital ”, o terminologie utilizată în TCM care este similară cu creșterea capacității de apărare a gazdei.Ophiopogon japonicas și Scrophularia ningpoensis și sunt plante TCM care au fost utilizate cel mai frecvent pentru „hrănirea yinului ” în nordul Chinei, în timp ce Atractylodis Rhizoma, Agastache rugosa și alte plante medicinale chinezești cu proprietatea „dezumidificării aromatice” au fost utilizate în mod obișnuit în sudul Chinei (tabel(…)(Tabelul 66).

Tabelul 6

Ierburi TCM utilizate frecvent pentru prevenirea infecției COVID-19

Raportat deIerburi (nume latin)Ierburi (Pin chinezesc Yin)Regiuni aplicabile
Luo și colab . 37Astragalus membranaceusHuangqi23 de provincii acopereau nord-estul, nordul, centrul (inclusiv Wuhan), sudul, estul, nord-vestul și sud-vestul Chinei.
Glycyrrhizae uralensisGancao
Saposhnikoviae divaricataFangfeng
Rhizoma Atractylodis MacrocephalaeBaizhu
Lonicerae Japonicae FlosJinyinhua
Fructus ForsythiaeLianqiao
Atractylodis RhizomaCangzhu
Radix platycodonisJiegeng
Agastache rugosaHuoxiang
Cyrtomium fortune J. SmGuanzhong
Xu și colab. 91Astragalus membranaceusHuangqiBeijing, Tianjin, Shandong, Shaanxi, Gansu, Hebei, Shanxi, Henan, Hubei, Jiangxi, Hunan și Yunnan
Atractylodis RhizomaCangzhuCinci regiuni din sudul Chinei (Hubei, Jiangxi, Hunan, Yunnan și Wuhan)
Eupatorii HerbaPeilan
Agastache rugosaHuoxiang
Ophiopogon japonicasMaidongOpt regiuni din nordul Chinei (Beijing, Tianjin, Hebei, Henan, Shaanxi, Shanxi, Gansu și Shandong)
Scrophularia ningpoensisXuanshen
Rhizoma phragmitisLugen
Adeinophora stricta MiqShashen
Dendrobium nobile Lindl.Shihu

Deschideți într-o fereastră separată

Conform raportului Administrației Naționale de Medicină Tradițională Chineză, până la 5 februarie 2020, 214 pacienți cu COVID-19 au fost tratați cu Qing Fei Pai Du Tang în provinciile Shanxi, Hebei, Heilongjiang și Shaanxi, cu o rată efectivă globală ≥ 90%. Dintre aceștia, simptomele majorității pacienților (≥60%) au fost semnificativ îmbunătățite, în timp ce boala altora (30%) a fost stabilizată 92 .
După aceea, 701 de pacienți cu COVID-19 au fost tratați cu Qing Fei Pai Du Tangîn 10 provincii din China. Rezultatul a arătat că 130 de pacienți (18,5%) s-au vindecat complet după tratament. Tratamentul a dus, de asemenea, la dispariția simptomelor caracteristice ale COVID-19, cum ar fi febra și tusea, la 51 de pacienți (7,27%). În plus, îmbunătățirea sau stabilizarea simptomelor au fost observate la 268 pacienți (38,2%) și la 212 pacienți (30,2%), respectiv 87 .
Yao și colab . și Lu și colab. 93 , 94 au analizat retrospectiv eficacitatea clinică a capsulei Lian Hua Qing Wen în tratamentul pacienților cu COVID-19 confirmați și suspectați. Rezultatele au indicat faptul că acest produs pe bază de plante ar putea ameliora semnificativ simptomele majore, cum ar fi febra și tusea și avea capacitatea de a promova recuperarea.

Unii pacienți cu o boală ușoară în stadiul incipient ar putea evolua brusc către o boală severă și, în cele din urmă, au murit din cauza șocului septic cu sindrom de disfuncție a mai multor organe (MODS), care a fost asociat cu furtuna de citokine 95 . Există dovezi convingătoare că unele produse pe bază de plante TCM sau componentele sale au efecte imunosupresoare puternice, după cum arată studiile noastre 79 și 96 – 103 . De exemplu, Wang și colab . 104 au raportat că injecția Shen Fu ar putea inhiba inflamația pulmonară și ar putea scădea nivelurile de IL-1β, IL-6 și alte citokine. Chang și colab . 105 au raportat căInjecția Re Du Ning ar putea reduce semnificativ nivelurile de IL-1β, TNF-α, IL-8, IL-10 și alte câteva citokine ale modelului indus de LPS de leziuni pulmonare acute la șobolani. Am raportat recent că tetrandrina, un compus izolat dintr-o plantă antireumatică chineză, ar putea inhiba puternic răspunsurile proinflamatorii Th1, Th2 și Th17 la șoarecii cu LPS 106 . Prin urmare, TCM cu capacitatea de a inhiba furtuna de citokine și consecințele sale devastatoare pot fi valorificate în tratamentul pacienților cu COVID-19 severe.

În prezent, studiul de laborator asupra efectului TCM se pare că rămâne în urma aplicării clinice a TCM în tratamentul pacienților cu COVID-19. Cu toate acestea, unii oameni de știință au început să examineze efectul produselor TCM sau al componentelor sale asupra SARS-CoV-2 în laboratoarele lor. De exemplu, un studiu in vitro a arătat că S huang Huang Lian Oral Liquid a avut efect inhibitor asupra SARS-CoV-2 78 . Cu toate acestea, eficacitatea clinică și siguranța sa pentru tratamentul pacienților cu COVID-19 nu au fost evaluate. Am observat că acest produs TCM nu a fost recomandat de Ghidul 89 al HNC . La fel ca SARS-CoV, SARS-CoV-2 folosește receptorul ACE2 pentru intrarea celulară 8. Teoretic, blocarea ACE2 poate preveni infecția cu SARS-CoV-2. Chen și Du au efectuat astfel studiul de andocare moleculară și au descoperit că compușii derivați de TCM, inclusiv baicalina, scutellarina, hesperetina, glicirizina și nicotianamina ar putea interacționa cu ACE2 107 . Prin urmare, acești compuși, precum și ierburile care conțin aceste ingrediente, pot avea capacitatea de a inhiba infecția cu SARS-CoV-2. Anticipăm mai multe studii experimentale care arată activitatea anti-SARS-CoV-2 a TCM sau a componentelor sale vor fi publicate în viitorul apropiat.Mergi la:

Observații de încheiere

TCM a acumulat experiențe de mii de ani în tratamentul bolilor pandemice și endemice. Furnizarea de tratamente complementare și alternative este încă urgent necesară pentru gestionarea pacienților cu infecție cu SARS-CoV-2, experiențele în TCM merită cu siguranță să fie învățate. Lupta împotriva epidemiilor actuale oferă, de asemenea, o oportunitate de a testa adevărata valoare a TCM în tratarea bolilor contagioase emergente. Studiile randomizate, dublu-orb și controlate cu placebo sunt cel mai bun mod de a furniza cele mai fiabile dovezi pentru o terapie, inclusiv TCM. Este încurajator faptul că au fost efectuate și raportate studii clinice controlate pentru a evalua eficacitatea TCM în tratamentul SARS-CoV. In orice caz,cele mai multe dintre aceste studii s-au dovedit a fi slab concepute și rezultatele ar putea duce la posibile prejudecăți în evaluarea eficacității tratamentului TCM13 . Sperăm că studiul clinic actual pentru a evalua efectul TCM asupra COVID-19 va utiliza protocoale mai stricte, ascunderea alocării și dublu-orbire, pentru a asigura conformitatea standardelor internaționale acceptabile. Mai mult, produsele standardizate ale TCM, mai degrabă decât formulările auto-preparate, ar trebui utilizate în studiile clinice. Studiul experimental poate fi capabil să elucideze mecanismul care stă la baza efectului terapeutic al TCM în tratamentul COVID-19. Studiul suplimentar al TCM poate duce la identificarea de noi compuși anti-coronavirus umani care se pot dovedi în cele din urmă utile în tratamentul SARS-CoV-2 sau a altor boli virale fatale emergente ca agenți terapeutici convenționali.

Siguranța TCM în tratamentul bolilor emergente cu coronavirus nu a fost inclusă în observația la pacienții cu SARS 13 . S-a raportat că unele plante folosite în TCM conțin nefrotoxine și mutageni 108 , în timp ce caracteristicile toxicologice ale majorității medicamentelor pe bază de plante chineze rămân a fi pe deplin înțelese 109 . Mai mult, ierburile utilizate în TCM pot imita sau mări sau opune efectul medicamentelor convenționale 110 . Astfel, siguranța TCM utilizată în tratamentul infecțiilor emergente cu coronavirus ar trebui evaluată cu atenție. Este deosebit de important să se evite toxicitatea sau să se interfereze cu eficacitatea tratamentului convențional cauzat de interacțiunea medicament-plante.

Material suplimentar

Cifre și tabele suplimentare.Faceți clic aici pentru fișier de date suplimentare. (178K, pdf)Mergi la:

Mulțumiri

Acest proiect a fost finanțat din subvenția de cercetare 201/2017 / A3 și 0056/2019 / AFJ din grantul de cercetare Fondul de dezvoltare științifică și tehnologică din Macau (FDCT) MYRG2017-00120- ICMS și MYRG2019-00169-ICMS.Mergi la:

Referințe

1. Gralinski LE, Menachery VD. Revenirea Coronavirusului: 2019-nCoV. Viruși. 2020. 12. [ Articol gratuit PMC ] [ PubMed ]2. Burki TK. Coronavirus în China. Lancet Respir Med. 2020. [ Articol gratuit PMC ] [ PubMed ]3. Organizația Mondială a Sănătății. Observațiile directorului general al OMS în cadrul ședinței media pe 2019-nCoV din 11 februarie 2020. https://www.who.int/dg/speeches/detail/who-director-general-s-remarks-at-the-media- briefing-on-2019-ncov-on-11-februarie-2020. 2020.4. Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, Caracteristici clinice ale infecției cu coronavirus noi din 2019 în China. medRxiv. 2020. 2020. 02.06.20020974.5. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y. și colab. Caracteristici clinice ale pacienților infectați cu noul coronavirus din 2019 în Wuhan, China. Lancet. 2020; 395 (10223): 497-506. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]6. Organizația Mondială a Sănătății. Raport de situație-29. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200218-sitrep-29-covid-19.pdf?sfvrsn=6262de9e_2. 2020.7. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y. și colab. Caracteristicile epidemiologice și clinice ale 99 de cazuri de pneumonie coronavirusă nouă din 2019 în Wuhan, China: un studiu descriptiv. Lancet. 2020; 395 (10223): 507–513. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]8. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Un focar de pneumonie asociat cu un nou coronavirus de origine probabilă a liliecilor. Natură. 2020. [ Articol gratuit PMC ] [ PubMed ]9. Wu A, Peng Y, Huang B, Ding X, Wang X, Niu P, Genome Composition and Divergence of the Novel Coronavirus (2019-nCoV) Originare din China. Microbi gazdă celulară. 2020. [ Articol gratuit PMC ] [ PubMed ]10. Zumla A, Chan JF, Azhar EI, Hui DS, Yuen KY. Coronavirusuri – descoperirea medicamentelor și opțiuni terapeutice. Nat Rev Drug Discov. 2016; 15 : 327–47. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]11. Xie X, Zhong Z, Zhao W, Zheng C, Wang F, Liu J. Chest CT pentru pneumonia tipică 2019-nCoV: relația cu testarea negativă RT-PCR. Radiologie. 2020: 200343. [ Articol gratuit PMC ] [ PubMed ]12. Li G, Clercq ED. Opțiuni terapeutice pentru noul coronavirus din 2019 (2019-nCoV) Nat Rev Drug Discov. 2020. [ PubMed ]13. Liu J, Manheimer E, Shi Y, Gluud C. Medicina din plante chineze pentru sindromul respirator acut sever: o revizuire sistematică și meta-analiză. J Altern Complement Med. 2004; 10 : 1041–51. [ PubMed ] [ Google Scholar ]14. Li T, Peng T. Medicina tradițională din plante din China ca sursă de molecule cu activitate antivirală. Antivirale Res. 2013; 97 : 1-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]15. Leung PC. Eficacitatea medicinei chineze pentru SARS: o revizuire a publicațiilor chinezești după criză. Sunt J Chin Med. 2007; 35 : 575–81. [ PubMed ] [ Google Scholar ]16. Jin YH, Cai L, Cheng ZS, Cheng H, Deng T, Fan YP. și colab. Un ghid de sfaturi rapide pentru diagnosticul și tratamentul pneumoniei infectate cu coronavirusul nou (2019-nCoV) din 2019 (versiunea standard) Mil Med Res. 2020; 7 : 4. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]17. Habibzadeh P, Stoneman EK. The Novel Coronavirus: A Bird’s Eye View. Int J Occup Environ Med. 2020; 11 : 65–71. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]18. Jordan PC, Stevens SK, Deval J. Nucleozide pentru tratamentul infecțiilor cu virus ARN respirator. Antivir Chem Chemother. 2018; 26 : 2040206618764483. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]19. De Clercq E. Noi analogi nucleozidici pentru tratamentul infecțiilor cu virusul febrei hemoragice. Chem Asian J. 2019; 14 : 3962–8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]20. Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, Remdesivir și clorochina inhibă efectiv noul coronavirus recent apărut (2019-nCoV) in vitro. Rez. Celulare 2020. [ Articol gratuit PMC ] [ PubMed ]21. Sheahan TP, Sims AC, Graham RL, Menachery VD, Gralinski LE, Case JB, antiviral cu spectru larg GS-5734 inhibă atât coronavirusurile epidemice, cât și cele zoonotice. Sci Transl Med. 2017. 9. [ Articol gratuit PMC ] [ PubMed ]22. Zhang L, Liu Y. Intervenții potențiale pentru coronavirusul nou în China: o revizuire sistemică. J Med Virol. 2020. [ Articol gratuit PMC ] [ PubMed ]23. Holshue ML, DeBolt C, Lindquist S, Lofy KH, Wiesman J, Bruce H, Primul caz al romanului Coronavirus din 2019 în Statele Unite. N Engl J Med. 2020. [ Articol gratuit PMC ] [ PubMed ]24. Lai CC, Shih TP, Ko WC, Tang HJ, Hsueh PR. Sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) și boala virusului corona-2019 (COVID-19): epidemia și provocările. Int J Agenți antimicrobieni. 2020: 105924. [ Articol gratuit PMC ] [ PubMed ]25. Savarino A, Di Trani L, Donatelli I, Cauda R, Cassone A. Noi perspective asupra efectelor antivirale ale clorochinei. Lancet Infect Dis. 2006; 6 : 67-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]26. Yan Y, Zou Z, Sun Y, Li X, Xu KF, Wei Y. și colab. Medicamentul anti-malaric clorochină este extrem de eficient în tratarea infecției cu virusul gripei aviare A H5N1 la un model animal. Rez. Celulare 2013; 23 : 300–2. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]27. Wong CK, Lam CW, Wu AK, Ip WK, Lee NL, Chan IH. și colab. Citokine și chemokine inflamatorii plasmatice în sindromul respirator acut sever. Clin Exp Immuno. 2004; 136 : 95–103. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]28. He L, Ding Y, Zhang Q, Che X, He Y, Shen H. și colab. Exprimarea nivelurilor crescute de citokine pro-inflamatorii la celulele ACE2 + infectate cu SARS-CoV la pacienții cu SARS: relația cu leziunea pulmonară acută și patogeneza SARS. J Pathol. 2006; 210 : 288-97. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]29. Faure E, Poissy J, Goffard A, Fournier C, Kipnis E, Titecat M. și colab. Răspuns imunitar distinct la doi pacienți infectați cu MERS-CoV: putem merge de la bancă la pat? Plus unu. 2014; 9 : e88716. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]30. Falzarano D, de Wit E, Rasmussen AL, Feldmann F, Okumura A, Scott DP. și colab. Tratamentul cu interferon-alfa2b și ribavirină îmbunătățește rezultatul macacilor rhesus infectați cu MERS-CoV. Nat Med. 2013; 19 : 1313–7. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]31. Stockman LJ, Bellamy R, Garner P. SARS: revizuirea sistematică a efectelor tratamentului. PLoS Med. 2006; 3 : e343. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]32. Lansbury L, Rodrigo C, Leonardi-Bee J, Nguyen-Van-Tam J, Lim WS. Corticosteroizii ca terapie adjuvantă în tratamentul gripei. Cochrane Database Syst Rev. 2019; 2 : Cd010406. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]33. Arabi YM, Mandourah Y, Al-Hameed F, Sindi AA, Almekhlafi GA, Hussein MA. și colab. Terapia cu corticosteroizi pentru pacienții cu afecțiuni critice cu sindrom respirator din Orientul Mijlociu. Am J Respir Crit Care Med. 2018; 197 : 757-67. [ PubMed ] [ Google Scholar ]34. Russell CD, Millar JE, Baillie JK. Dovezile clinice nu susțin tratamentul cu corticosteroizi pentru leziunile pulmonare 2019-nCoV. Lancet. 2020. [ Articol gratuit PMC ] [ PubMed ]35. Organizația Mondială a Sănătății. https://www.who.int/internal-publications-detail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus-(ncov)-infection-is-suspected. 2020.36. Hung IFN, To KKW, Lee CK, Lee KL, Yan WW, Chan K. și colab. Tratamentul cu imunoglobulină hiperimună IV: un studiu controlat randomizat dublu-orb multicentric pentru pacienții cu infecție severă gripală A (H1N1) din 2009. Cufăr. 2013; 144 : 464–73. [ PubMed ] [ Google Scholar ]37. Luo H, Tang QL, Shang YX, Liang SB, Yang M, Robinson N, Poate fi utilizată medicina chineză pentru prevenirea bolii virusului Corona 2019 (COVID-19)? O revizuire a clasicilor istorici, a dovezilor de cercetare și a programelor actuale de prevenire. Chin J Integr Med. 2020. [ Articol gratuit PMC ] [ PubMed ]38. Tong X, Li A, Zhang Z, Duan J, Chen X, Hua C. și colab. Tratamentul TCM al pneumoniei atipice infecțioase – un raport de 16 cazuri. J Tradit Chin Med. 2004; 24 : 266-9. [ PubMed ] [ Google Scholar ]39. Liu X, Zhang M, He L, Li Y. Ierburi chinezești combinate cu medicina occidentală pentru sindromul respirator acut sever (SARS) Cochrane Database Syst Rev. 2012; 10 : Cd004882. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]40. Zhang MM, Liu XM, He L. Efectul medicinei tradiționale chineze și occidentale integrate asupra SARS: o revizuire a dovezilor clinice. World J Gastroenterol. 2004; 10 : 3500–5. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]41. Zhong N, mai RM, McLean AR, Pattison J, Weiss RA. Managementul și prevenirea SARS în China. Philos Trans R Soc Lond B Biol Sci. 2004; 359 : 1115–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]42. JSM P, DP, Yuen KY ea. Sindromul respirator acut sever. New Engl J Med. 2003; 249 : 2431–41. [ Google Scholar ]43. Jr TMF, Tsang KWT. Sindromul respirator acut sever. Nat Med. 2005; 4 : 95–106. [ Google Scholar ]44. Chen Z, Nakamura T. Dovezi statistice privind utilitatea medicinei chineze în tratamentul SARS. Cercetarea fitoterapiei: PTR. 2004; 18 : 592–4. [ PubMed ] [ Google Scholar ]45. TF Lau, Leung PC, Wong ELY, Fong C, Cheng KF, Zhang SC și colab. Folosirea medicamentelor pe bază de plante ca mijloc de prevenire în timpul crizei SARS. Sunt J Chin Med. 2005; 33 : 345–56. [ PubMed ] [ Google Scholar ]46. Poon PM, Wong CK, Fung KP, Fong CY, Wong EL, Lau JT. și colab. Efectele imunomodulatoare ale unei medicamente tradiționale chinezești cu activitate antivirală potențială: un studiu de autocontrol. Sunt J Chin Med. 2006; 34 : 13–21. [ PubMed ] [ Google Scholar ]47. Hsu CH, Hwang KC, Chao CL, Chang SG, Ho MS, Chou P. Medicina pe bază de plante poate ajuta împotriva gripei aviare? Învățând din experiența utilizării tratamentului suplimentar cu medicina chineză pe SARS sau boli infecțioase asemănătoare SARS în 2003. J Altern Complement Med. 2006; 12 : 505–6. [ PubMed ] [ Google Scholar ]48. Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. Glicirizina, o componentă activă a rădăcinilor de lemn dulce și replicarea coronavirusului asociat SARS. Lanceta. 2003; 361 : 2045–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Chen F, Chan KH, Jiang Y, Kao RY, Lu HT, Fan KW. și colab. Sensibilitatea in vitro a 10 izolate clinice ale coronavirusului SARS la compuși antivirali selectați. J Clin Virol. 2004; 31 : 69–75. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]50. Wang SQ, Du QS, Zhao K, Li AX, Wei DQ, Chou KC. Screening virtual pentru găsirea unui inhibitor natural împotriva catepsinei-L pentru terapia SARS. Aminoacizi. 2007; 33 : 129–35. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]51. Wu T, Yang X, Zeng X, Poole P. Medicina tradițională chineză în tratamentul infecțiilor acute ale tractului respirator. Resp Med. 2008; 102 : 1093-8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]52. Cragg GM, Newman DJ. Produse naturale: o sursă continuă de noi medicamente. Biochimica et biophysica acta. 2013; 1830 : 3670-95. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]53. Luo W, Su X, Gong S, Qin Y, Liu W, Li J, Anti-SARS coronavirus 3C-like protease effects of Rheum palmatum L. extracts. Tendințe BioScience. 2009. 3. [ PubMed ]54. Fung KP, Leung PC, Tsui KW, Wan CC, Wong KB, Waye MY. și colab. Activități imunomodulatoare ale formulei pe bază de plante Kwan Du Bu Fei Dang la subiecți sănătoși: un studiu randomizat, dublu-orb, controlat cu placebo. Hong Kong Med J. 2011; 17 (Supliment 2): 41-3. [ PubMed ] [ Google Scholar ]55. Lau KM, Lee KM, Koon CM, Cheung CS, Lau CP, Ho HM. și colab. Activități imunomodulatoare și anti-SARS ale Houttuynia cordata. J Etnofarmacol. 2008; 118 : 79-85. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]56. Gong SJ, Su XJ, Yu HP, Li J, Qin YJ, Xu Q. și colab. Un studiu asupra proteinei anti-SARS-CoV 3CL a flavonoidelor din nucleul son litchi chinensis. Buletin farmacologic chinez. 2008; 24 : 699–700. [ Google Scholar ]57. Lin CW, Tsai FJ, Tsai CH, Lai CC, Wan L, Ho TY. și colab. Efectele proteazei asemănătoare coronavirusului 3C ale rădăcinii de Isatis indigotică și ale compușilor fenolici derivați din plante. Antivirale Res. 2005; 68 : 36–42. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]58. Nguyen TTH, Woo HJ, Kang HK, Nguyen VD, Kim YM, Kim DW. și colab. Inhibarea mediată de flavonoizi a proteazei asemănătoare coronavirusului 3C SARS exprimată în Pichia pastoris. Biotechnol Lett. 2012; 34 : 831-8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]59. Jo S, Kim S, Shin DH, Kim MS. Inhibarea proteazei SARS-CoV 3CL de către flavonoizi. J Enzyme Inhib Med Chem. 2020; 35 : 145–51. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]60. Jo S, Kim H, Kim S, Shin DH, Kim MS. Caracteristicile flavonoidelor ca inhibitori puternici ai proteazei de tip MERS-CoV 3C. Chem Biol Drug Des. 2019. [ Articol gratuit PMC ] [ PubMed ]61. Yu MS, Lee J, Lee JM, Kim Y, Chin YW, Jee JG. și colab. Identificarea miricetinei și scutellareinei ca inhibitori chimici noi ai SARS coronavirus helicazei, nsP13. Bioorg Med Chem Lett. 2012; 22 : 4049–54. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]62. Wu CY, Jan JT, Ma SH, Kuo CJ, Juan HF, Cheng YSE. și colab. Molecule mici care vizează sindromul respirator acut sever coronavirus uman. Proc Natl Acad Sci US A. 2004; 101 : 10012–7. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]63. Kuhn JH, Radoshitzky SR, Li W, Wong SK, Choe H, Farzan M. SARS Coronavirus receptor ACE 2 O țintă potențială pentru terapia antivirală. În: Holzenburg A, Bogner E, editori. Noi concepte de terapie antivirală. Boston, MA: Springer SUA. 2006. p. 397-418.64. Letko M, Munster V. Evaluarea funcțională a intrării celulelor și a utilizării receptorilor pentru linia B β-coronavirusuri, inclusiv 2019-nCoV. bioRxiv. 2020. 2020. 01.22.915660. [ Articol gratuit PMC ] [ PubMed ]65. Lin HX, Feng Y, Wong G, Wang L, Li B, Zhao X. și colab. Identificarea reziduurilor din domeniul de legare la receptor (RBD) al proteinei spike ale coronavirusului uman NL63 care sunt critice pentru interacțiunea receptorului RBD-ACE2. J Gen Virol. 2008; 89 : 1015–24. [ PubMed ] [ Google Scholar ]66. Xu XT, Chen P, Wang JF, Feng JN, Zhou H, Li X, Evoluția noului coronavirus din focarul în curs de desfășurare de la Wuhan și modelarea proteinei sale de vârf pentru riscul transmiterii umane. Știință China Viață Știință. 2020. [ Articol gratuit PMC ] [ PubMed ]67. Ho T, Wu S, Chen J, Li C, Hsiang C. Emodin blochează interacțiunea SARS a coronavirusului și interacțiunea enzimei de conversie a angiotensinei 2. Antivirale Res. 2007; 74 : 92–101. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]68. Deng YF, Aluko RE, Jin Q, Zhang Y, Yuan LJ. Activități inhibitorii ale baicalinei împotriva reninei și a enzimei de conversie a angiotensinei. Pharm Biol. 2012; 50 : 401–6. [ PubMed ] [ Google Scholar ]69. Takahashi S, Yoshiya T, Yoshizawa-Kumagaye K, Sugiyama T. Nicotianamina este un nou inhibitor al enzimei 2 de conversie a angiotensinei din soia. Biomed Res. 2015; 36 : 219–24. [ PubMed ] [ Google Scholar ]70. Wang W, Ma X, Han J, Zhou M, Ren H, Pan Q. și colab. Efectul neuroprotector al scutellarinei asupra leziunilor cerebrale ischemice prin reglarea descendentă a expresiei enzimei de conversie a angiotensinei și a receptorului AT1. Plus unu. 2016; 11 : e0146197. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]71. Yi L, Li Z, Yuan K, Qu X, Chen J, Wang G. și colab. Molecule mici care blochează intrarea coronavirusului sindrom respirator acut sever în celulele gazdă J Virol. 2004; 78 : 11334-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Schwarz S, Wang K, Yu WJ, Sun B, Schwarz W. Emodin inhibă curentul prin proteina coronavirus 3a asociată cu SARS. Res antivirale. 2011; 90 : 64-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]73. Schwarz S, Sauter D, Wang K, Zhang R, Sun B, Karioti A. și colab. Derivați de Kaempferol ca medicamente antivirale împotriva proteinei de canal 3a a coronavirusului. Planta Medica. 2014; 80 : 177–82. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Cheng PW, Ng LT, Chiang LC, Lin CC. Efectele antivirale ale saikosaponinelor asupra coronavirusului uman 229E in vitro. Clin Exp Pharmacol Physiol. 2006; 33 : 612–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]75. Pilcher H. Licorice poate aborda SRAS. Natură. 2003.76. Chen CJ, Michaelis M, Hsu HK, Tsai CC, Yang KD, Wu YC. și colab. Extractul de frunze roșii Toona sinensis inhibă replicarea coronavirusului SARS. J Etnofarmacol. 2008; 120 : 108-11. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]77. Lu H. Opțiuni de tratament medicamentos pentru noul 2019 coronavirus (2019-nCoV) Biosci Trends. 2020. [ PubMed ]78. Știință CAo. Cercetătorii de la Shanghai Institute of Drugs și Wuhan Virus Institute au descoperit că medicamentul chinezesc brevetat lichid oral Shuanghuanglian poate inhiba noul coronavirus din 2019 .; 2020.79. Chen X, Howard OM, Yang X, Wang L, Oppenheim JJ, Krakauer T. Efectele Shuanghuanglian și Qingkailing, două componente multiple ale preparatelor medicinale tradiționale chinezești, asupra funcției leucocitelor umane. Life Science. 2002; 70 : 2897–913. [ PubMed ] [ Google Scholar ]80. Gao Y, Fang L, Cai R, Zong C, Chen X, Lu J. și colab. Shuang-Huang-Lian exercită activități antiinflamatorii și anti-oxidative în macrofagele alveolare murine stimulate de lipopolizaharide. Fitomedicina. 2014; 21 : 461-9. [ PubMed ] [ Google Scholar ]81. Chan MC, Chan RW, Mok CK, Mak NK, Wong RN. Indirubin-3′-oxima ca agent antiviral și imunomodulator în tratamentul infecției severe a virusului gripal uman. Hong Kong Med J. 2018; 24 (Supliment 6): 45-7. [ PubMed ] [ Google Scholar ]82. Ding Y, Zeng L, Li R, Chen Q, Zhou B, Chen Q. și colab. Capsula chineză lianhuaqingwen cu prescripție exercită activitate anti-gripală prin inhibarea propagării virale și afectează funcția imună. BMC Complement Altern Med. 2017; 17 : 130. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]83. Dong L, Xia JW, Gong Y, Chen Z, Yang HH, Zhang J. și colab. Efectul capsulelor Lianhuaqingwen asupra inflamației căilor respiratorii la pacienții cu exacerbare acută a bolii pulmonare obstructive cronice. Complement Evid Based Alternat Med. 2014; 2014 : 1-11. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]84. Li S, Chen C, Zhang H, Guo H, Wang H, Wang L. și colab. Identificarea compușilor naturali cu activități antivirale împotriva coronavirusului asociat SARS. Antivirale Res. 2005; 67 : 18–23. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]85. Chang FR, Yen CT, Ei-Shazly M, Lin WH, Yen MH, Lin KH. și colab. Triterpenoizi anti-Coronavirus (anti-HCoV) din frunzele Euphorbia Neriifolia. Nat Prod Commun. 2012; 7 : 1934578X1200701103. [ PubMed ] [ Google Scholar ]86. Shen YC, Wang LT, Khalil AT, Chiang LC, Cheng PW. Piranoxantoni bioactivi din rădăcinile Calophyllum blancoi. Chem Pharm Bull. 2005; 53 : 244-7. [ PubMed ] [ Google Scholar ]87. Comisia Națională de Sănătate din Republica Populară Chineză. Transcrierea conferinței de presă din 17 februarie 2020. http://www.nhc.gov.cn/xcs/s3574/202002/f12a62d10c2a48c6895cedf2faea6e1f. shtml. 2020.88. Comisia Națională de Sănătate din Republica Populară Chineză. Notificare privind punerea în aplicare a liniilor directoare de diagnostic și tratament pentru pneumonia infectată cu 2019-nCoV (versiunea 6) 6 ed; http://www.nhc.gov.cn/yzygj/s7653p/202002/8334a8326dd94d329df351d7da8aefc2.shtml?from=timeline. 2020.89. Han YY, Zhao MR, Shi B, Song ZH, Zhou SP, He Y. Aplicarea protocoalelor de medicină integrativă pentru tratamentul bolii coronavirus 2019. Chi Tradit Herbal Drugs. 1-5.90. Zhu YG, Deng ZW, Liu LH, Liu XH, Li XZ, Chen WH, Compilarea informațiilor despre medicamente pentru diagnosticul și tratamentul COVID-19 (versiunea 1) Central South Pharmacy. 1-14.91. Xu X, Zhang Y, Li X, Li XX. Analiza planului de prevenire a bolii virusului corona-19 (COVID-19) de către medicina tradițională chineză în diferite regiuni. Chin Herb Med. 2020. pp. 1-7.92. Zhao J, Tian SS, Yang J, Liu J, Zhang WD. Investigarea mecanismului Qing-Fei-Pai-Du-Tang pentru tratamentul pneumoniei cu coronavirus nou prin farmacologie de rețea. Chin Herb Med. 2020. pp. 1-7.93. Yao KT, Liu MY, Li X, Huang JH, Cai HB. Analiza clinică retrospectivă privind tratamentul pneumoniei noi infectate cu coronavirus cu medicina tradițională chineză Lianhua Qingwen. Chin J Exp Tradit Med Form. 2020. pp. 1-7.94. Lv RB, Wang WJ, Li X. Tratamentul suspectat de pneumonie cu coronavirus nou cu medicina chineză Lianhua Qingwen Observarea clinică a 63 de cazuri suspecte. J Tradit Chin Med. 2020. pp. 1–5.95. Zhang JW, Hu X, Jin PF. Furtuni de citokine cauzate de 2019-nCoV și terapia medicamentoasă. Jurnalul farmaceutic chinez. 2020. pp. 1-9. 96.96. Chen X, Yang D, Shen W, Dong HF, Wang JM, Oppenheim JJ. și colab. Caracterizarea acidului chenodeoxicolic ca antagonist endogen al receptorilor peptidici formilici cuplați la G. Inflamm Res. 2000; 49 : 744–55. [ PubMed ] [ Google Scholar ]97. Chen X, Mellon RD, Yang L, Dong H, Oppenheim JJ, Howard OM. Efectele de reglementare ale acidului deoxicolic, o componentă a medicinei tradiționale antiinflamatoare chineze Niuhuang, asupra răspunsului leucocitelor umane la chimiotratanți Biochem Pharmacol. 2002; 63 : 533–41. [ PubMed ] [ Google Scholar ]98. Chen X, Beutler JA, McCloud TG, Loehfelm A, Yang L, Dong HF. și colab. Acidul tanic este un inhibitor al CXCL12 (SDF-1alpha) / CXCR4 cu activitate antiangiogenă. Clin Cancer Res. 2003; 9 : 3115–23. [ PubMed ] [ Google Scholar ]99. Chen X, Yang L, Zhang N, Turpin JA, Buckheit RW, Osterling C. și colab. Shikonin, o componentă a medicinei de plante chinezești, inhibă funcția receptorilor de chemokine și suprimă virusul imunodeficienței umane de tip 1. Agenți antimicrobieni Chemother. 2003; 47 : 2810–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]100. Chen X, Oppenheim JJ, Howard OM. Chemokinele și receptorii chemokinelor ca ținte terapeutice noi în artrita reumatoidă (RA): efecte inhibitoare ale componentelor medicinale tradiționale chinezești. Cell Mol Immunol. 2004; 1 : 336–42. [ PubMed ] [ Google Scholar ]101. Chen X, Murakami T, Oppenheim JJ, Howard OM. Triptolida, un element constitutiv al medicinei chinezești imunosupresoare, este un puternic supresor al maturării și traficului celulelor dendritice. Sânge. 2005; 106 : 2409-16. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]102. He J, He ZD, Chen X. Efectele componentelor medicinale chinezești asupra receptorilor de chemokine: teorie, rezultate și metodologie. Metode de cercetare bazate pe dovezi pentru medicina chineză. 2016. pp. 187–97.103. Chen YB, Chen X. Componenta din plante antice poate fi un nou tratament terapeutic pentru artrita gută. J Leukoc Biol. 2019; 105 : 7-9. [ PubMed ] [ Google Scholar ]104. Wang J, Qiao LF, Li YS, Yang GT. Injecția Shen Fu activează macrofagul NF-kB alveolar al șobolanilor indus de LPS. Acta Medicinae Universitatis Scientiae și Technologiae Huazhong. 2009; 1 : 15–8. [ Google Scholar ]105. Chang XJ, Xiao W, Zhang S, Chang YP, Chen CM, Chen J. și colab. Mecanismul injecției Re Du Ning asupra leziunii pulmonare anti-acute la șobolani pe baza furtunii de citokine. Chin Herb Med. 2014; 46 : 236-9. [ Google Scholar ]

106. Zou HM, He TZ, Chen X. Tetrandrina inhibă diferențierea subgrupurilor proinflamatorii de celule T helper, dar schimbă diferențierea de novo a celulelor iTreg. Int Immunopharmacol. 2019; 69 : 307-12. [ PubMed ] [ Google Scholar ]

107. Chen H, Du Q. Compuși naturali potențiali pentru prevenirea infecției 2019-nCoV. Preimprimări. 2020.

108. Ng AWT, Poon SL, Huang MN, Lim JQ, Boot A, Yu W, acizii Aristolochic și derivații lor sunt implicați pe scară largă în cancerele de ficat din Taiwan și din toată Asia. Sci Trans Med. 2017. 9. [ PubMed ]

109. Zeng ZP, Jiang JG. Analiza reacțiilor adverse induse de medicamentele derivate din produse naturale. Br J Pharmacol. 2010; 159 : 1374–91. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

110. Fugh-Berman A. Interacțiuni dintre plante și medicamente. Lancet. 2000; 355 : 134–8. [ PubMed ] [ Google Scholar ]

111. Liu LS, Lei N, Lin Q, Wang WL, Yan HW, Duan XH. Efectele și mecanismul pulberii Yinqiao asupra infecției tractului respirator superior. Int J Biotechnol Wellness Ind. 2015; 4 : 57–60. [ Google Scholar ]

112. Fu YJ, Yan YQ, Qin HQ, Wu S, Shi SS, Zheng X. și colab. Efectele diferitelor principii ale tratamentului cu medicina tradițională chineză asupra căii de semnalizare TLR7 / NF-κB la șoarecii infectați cu virusul gripal. Chin Med. 2018; 13 : 42. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

113. Lau JT, Leung PC, Wong EL, Fong C, Cheng KF, Zhang SC. și colab. Utilizarea unei formule pe bază de plante de către lucrătorii din domeniul spitalului în timpul epidemiei de sindrom respirator acut sever din Hong Kong pentru a preveni transmiterea severă a sindromului respirator acut, ameliorarea simptomelor legate de gripă și îmbunătățirea calității vieții: un studiu prospectiv de cohortă. J Altern Complement Med. 2005; 11 : 49–55. [ PubMed ] [ Google Scholar ]

114. Du CY, Zheng KY, Bi CW, Dong TT, Lin H, Tsim KW. Yu Ping Feng San, un decoct din plante vechi din China, induce expresia genică a proteinelor antivirale și inhibă activitatea neuraminidazei. Phytother Res. 2015; 29 : 656-61. [ PubMed ] [ Google Scholar ]

115. Gao J, Li J, Shao X, Jin Y, Lu XW, Ge JF. și colab. Efectele antiinflamatorii și imunoreglatorii ale glucozidelor totale din pulberea de Yupingfeng. Chin Med J (Engl) 2009; 122 : 1636–41. [ PubMed ] [ Google Scholar ]

116. Zhang H, Chen Q, Zhou W, Gao S, Lin H, Ye S. și colab. Medicină chineză injecție shuanghuanglian pentru tratamentul infecției acute a tractului respirator superior: o revizuire sistematică a studiilor controlate randomizate. Complement Evid Based Alternat Med. 2013; 2013 : 987326. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

117. Xiao GL, Song K, Yuan CJ ea. Un raport literar despre tratamentul SARS pe etape cu medicina tradițională chineză. J Emerg Chin Med Hunan. 2005. pp. 53-5.

118. Bao L, J M. Progresul cercetării lui Da Yuan Yin privind tratamentul bolilor infecțioase. Emerg Tradit Chin Med. 2010; 2 : 263-87. [ Google Scholar ]

119. Kim DE, Min JS, Jang MS, Lee JY, Shin YS, Song JH. și colab. Alcaloizii Bis-Benzilizochinolinei naturali-Tetrandrina, Fangchinolina și Cefarantina, inhibă infecția cu Coronavirus uman OC43 Infecția cu celulele pulmonare umane MRC-5. Biomolecule. 2019; 9 : 696. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Științe Biologice sunt furnizate aici prin amabilitatea Ivyspring International Publisher

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7098036/

(Mana) Maicii Domnului ne scapa de covid19 mai rapid – studiu clinic

Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea noului coronavirus SARS-CoV-2 și accelerează negativarea PCR pacienților infectați Covid19

Descoperiri celulare volum 6 , Număr articol:  54 ( 2020 ) Citați acest articol

Draga editorule,

Pandemia bolii Coronavirus 2019 (COVID-19) este una dintre cele mai grave crize de sănătate publică la nivel mondial până în prezent. Începând cu 12 iulie 2020, peste 12,6 milioane de cazuri de infecție COVID-19 cu 0,56 milioane de decese au fost confirmate în întreaga lume 1 . Deoarece nu există terapii eficiente pentru tratarea sindromului respirator acut sever coronavirus 2 (SARS-CoV-2, virusul cauzal al infecției cu COVID-19) până acum, pandemia se răspândește rapid în întreaga lume. Este urgent să se dezvolte terapii eficiente, nu numai pentru a trata pacienții infectați, ci și pentru a controla pandemia.

Studiile noastre anterioare au demonstrat că un microARN al plantei, MIR2911, care este îmbogățit în decoct de caprifoi/Mana Maicii Domnului (HD), vizează în mod direct virusurile gripei A (IAV), inclusiv subtipurile H1N1, H5N1 și H7N9 prin legarea la ARNm și blocarea translației proteinelor. Administrarea orală de Mana Maicii Domnului HD poate preveni infecția IAV și reduce moartea de șoarece indusă de H5N1 2 . Studiile ulterioare au arătat că MIR2911 inhibă, de asemenea, direct replicarea diferiților viruși, în plus față de IAV-urile 3 , 4 . După absorbția dietetică, acești microARN se autoasamblează în exosomi și sunt apoi secretați în circulație și livrați în țesuturile țintă sau celule specifice, inclusiv ficatul, plămânul, splina, pancreasul și celulele T 5 , 6 , 7. Având în vedere compoziția unică de nucleotide îmbogățită cu GC a MIR2911 (GGCCGGGGGACGGACACGGGA) și după ce am analizat secvența genomului SARS-CoV-2, este cel mai probabil ca genomul virusului să conțină situri de legare MIR2911 și că MIR2911 poate inhiba SARS-CoV-2 replicare directă. În studiul de față, am evaluat efectul inhibitor al absorbției MIR2911 în HD asupra replicării SARS-CoV-2 și am efectuat un studiu clinic pentru a investiga eficacitatea HD la pacienții cu COVID-19.

Prin utilizarea analizei bioinformatice, am prezis că există 179 site-uri putoase de legare MIR2911 în genomul SARS-CoV-2. Douăzeci și opt de situri de legare (tabelul suplimentar S1 ) au fost confirmate prin testul clasic al luciferazei (fig. Suplimentară S1 ), care sunt distribuite pe scară largă în genomul virusului (fig. 1a ), indicând faptul că MIR2911 ar putea inhiba traducerea a aproape toate proteinele SARS-CoV-2.

figura 1
Fig. 1: MIR2911 absorbit în HD inhibă direct replicarea SARS-CoV-2.

Pentru a evalua efectul direct al MIR2911 absorbit asupra replicării SARS-CoV-2, exosomii celulari au fost colectați din mediul de cultură al celulelor HEK293T transfectate cu MIR2911 sintetic sau ARN necodificator de control (ncRNA), ca metodă similară raportului anterior 5 ( Fig. 1b ). Exosomii celulari izolați cu / fără MIR2911 au fost pre-incubați separat cu 5 × 10 4 celule Vero E6 (ATCC-1586) în 0,25 ml mediu celular timp de 8 ore. După schimbarea mediului de cultură, celulele au fost infectate cu SARS-CoV-2 (nCoV-2019BetaCoV / Wuhan / WIV04 / 2019 8) la o multiplicitate de infecție (MOI) de 0,01. Eficacitățile au fost evaluate prin cuantificarea numărului de copii virale în supernatantul celular prin RT-PCR cantitativă în timp real (qRT-PCR) la 24 ore după infecție (pi) (Fig. 1b ). Așa cum se arată în Fig. 1c , exosomul celular-MIR2911 la concentrația de 13,2 pM a inhibat replicarea virusului 93% (de la 4,09 × 10 9 la 2,87 × 10 8 copii / ml), indicând faptul că MIR2911 absorbit inhibă direct și suficient replicarea SARS-CoV-2 (Fig. 1c). Apoi, am evaluat efectul inhibitor al MIR2911 absorbit în HD asupra replicării SARS-CoV-2. Deoarece MIR2911 absorbit în HD este livrat în plămâni prin exosomi prin circulație, exosomii izolați din 62,5 μl de ser donator înainte și după ce au băut 200 ml HD (30 g caprifoi uscat) separat au fost pre-incubați cu 5 × 10 4 celule Vero E6, ca condiție similară cu cea a exosomului celular-MIR2911 (Fig. 1b ). Concentrația MIR2911 în 200 ml HD a fost de 52,5 pM (10,5 pmol / 200 ml / 30 g de caprifoi uscat). Nivelurile serice de MIR2911 în trei receptoare de sănătate după ce au băut timp de 2 ore au fost de 0,42, 0,45 și 1,13 pM (Fig. 1d), care erau nedetectabile înainte de băut). Exozomii (niveluri MIR2911: înainte de băut, nedetectabili; după băut, au fost 9,9, 14,4 și 19,4 amoli) au fost pre-incubați cu 5 × 10 4 celule (Fig. 1e , ~ 180 de copii ale MIR2911 / celulă). Așa cum se arată în Fig. 1e , exosomii care conțin MIR2911 au inhibat semnificativ replicarea virusului (Fig. 1e ). Nu există nicio diferență de viabilitate celulară între exosomi cu / fără MIR2911 colectate de la același donator înainte și după consumul HD (Fig. S2 suplimentar ). Aceste rezultate sugerează cu tărie că MIR2911 este suficient absorbit de consumatorii care consumă HD și că MIR2911 absorbit blochează semnificativ replicarea SARS-CoV-2.

Studiu clinic

Pentru a evalua efectul antiviral al MIR2911 în HD asupra pacienților cu COVID-19, am efectuat un studiu clinic. Șaptezeci și cinci de pacienți de tip moderat COVID-19 care au primit terapie antivirală de rutină (RT) la Spitalul II din Nanjing din ianuarie 2020 până în martie 2020 au fost înscriși în acest studiu. Pacienții au fost împărțiți în două grupuri pe baza tratamentului suplimentar cu MIR2911 în grupul Mana Maicii Domnului HD (MIR2911 + ) sau amestec de medicină tradițională chineză (TCM) (MIR2911  ) în plus față de terapia de rutina antivirala RT. Obiectivul principal a fost rata de conversie negativă în a 7-a zi de la primul tratament. Au fost 6 și 69 pacienți din MIR2911 + și MIR2911  grupuri, respectiv (Tabelele suplimentare S2 – S4). Rata de conversie negativă în a 7-a zi în grupul MIR2911 +  fost de 83,3%, care a fost îmbunătățită dramatic comparativ cu cea a pacienților tratați cu MIR2911  (26,1%, P  = 0,004) (Fig. 1g, f ).

Timpul necesar pentru a deveni SARS-CoV-2 PCR-negativ (TTN) a fost de asemenea, in favoarea pacienții tratați cu HD-MIR2911 (mediană 4.0 vs. 12,0 zile, HR 0,28, IC 95% 0,12-0,67, P  = 0,005) (Fig. 1g , f ).

TTN median al pacienților bărbați în MIR2911 + (1 caz) și MIR2911  (38 cazuri) este de 5,0 zile și 11,0 zile (HR 0,003, IC 95% 0,000018-0,52, P  = 0,027), respectiv.

TTN median al pacienților de sex feminin în MIR2911 +(5 cazuri) și grupurile MIR2911  (31 cazuri) sunt de 3,0 zile și 12,0 zile (HR 0,15, IC 95% 0,031-0,68, P  = 0,014), respectiv.

Mana Maicii Domnului/HD este folosita pentru a trata infecțiile virale de o mie de ani în China. Studiile anterioare au demonstrat că MIR2911 (0,06-0,18 pmol / zi) în 1-3 ml HD inhibă în mod semnificativ replicarea virusului gripal la 20 g șoarece 2 . În plus față de Farmacopeea din Republica Populară Chineză 9 , am ales 30 g de caprifoi uscat (nivel MIR 2911: 10,5 pmol) pe zi pentru utilizare. Rezultatele noastre demonstrează că 30 g de caprifoi uscat este sigur pentru utilizare (tabelul suplimentar S4 ) și are o funcție antivirală suficientă (Fig. 1d, e). Pe de altă parte, datele conform cărora MIR2911 (~ 60 fM) în exosomi inhibă semnificativ replicarea virusului nu numai că confirmă activitatea antivirală extra-ridicată a MIR2911 (comparativ cu cea a remdesivirului: 3,7 μM și a Clorochinei: 10 μM10, dar oferă și o strategie nouă conform căreia utilizarea exosomilor serici colectați de la un donator sănătos oferă cea mai similară condiție in vivo pentru a evalua eficacitatea potențialelor medicamente in vitro.

Pe scurt, rezultatele noastre sugerează că MIR2911 absorbit de plante caprifoi/Mana Maicii Domnului/ HD inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Tratamentul cu Mana Maicii Domnului HD ar putea ajuta la vindecarea pacienților infectați și la oprirea pandemiei COVID-19.

Referințe

  1. 1.OMS. Raport de situație a bolii coronavirus 2019 (COVID-19)-174. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200712-covid-19-sitrep-174 (2020).
  2. 2.Zhou, Z. și colab. MicroRNA2911 atipic codificat cu caprifoi vizează direct virusurile gripei A. Rez. Celulare 25 , 39–49 (2015).CAS Articol Google Scholar 
  3. 3.Huang, Y. și colab. MicroRNA2911 derivat din caprifoi inhibă direct replicarea virusului varicela-zoster prin direcționarea genei IE62. J. Neurovirol. 25 , 457–463 (2019).CAS Articol Google Scholar 
  4. 4.Li, X. și colab. MicroRNA2911 codificat cu caprifoi inhibă replicarea Enterovirus 71 prin direcționarea genei VP1. Antivir. Rez. 152 , 117–123 (2018).CAS Articol Google Scholar 
  5. 5.Zhang, L. și colab. Planta exogenă MIR168a vizează în mod specific LDLRAP1 la mamifere: dovezi ale reglării încrucișate prin microARN. Rez. Celulare 22 , 107–126 (2012).CAS Articol Google Scholar 
  6. 6.Zhao, C., Sun, X. și Li, L. Biogeneza și funcția miARN extracelulare. ExRNA 1 , 38 (2019).Articol Google Scholar 
  7. 7.Zhang, S. & Hong, Z. ARN-uri mobile – elful magic care călătorește între plantă și organismele asociate. ExRNA 1 , 8 (2019).Articol Google Scholar 
  8. 8.Zhou, P. și colab. Un focar de pneumonie asociat cu un nou coronavirus de origine probabilă a liliecilor. Natura 579 , 270-273 (2020).CAS Articol Google Scholar 
  9. 9.Comisia, Farmacopeea CP din Republica Populară Chineză , Vol. I 221 (Editura Medicală a Poporului, 2010).
  10. 10.Wang, M. și colab. Remdesivirul și clorochina inhibă în mod eficient noul coronavirus recent apărut (2019-nCoV) in vitroRez. Celulare 30 , 269-271 (2020).CAS Articol Google Scholar 

Descărcați referințele

Mulțumiri

Mulțumim lui Wei Ye, Yun Chi, Cong Cheng, Lanlan Ma, Guangchang Dai și Qian Shi, de la cel de-al doilea spital din Nanjing, pentru asistența lor în studiul clinic (numărul de registru al studiului clinic chinez, ChiCTR2000029822). În plus, îi mulțumim dr. Zhibin Hu (Universitatea de Medicină din Nanjing) pentru comentariile sale asupra lucrării. Această lucrare a fost susținută de subvenții din cadrul proiectului chinez de știință și tehnologie major al Chinei (2015ZX09102023-003), Programul național de cercetare de bază din China (Programul 973) (2014CB542300 și 2012CB517603), Fundația Națională de Științe Naturale din China (81250044, 81602697 și 31742075 ) și Fundația pentru Științe Naturale din provincia Jiangsu (BE2016737), Fondurile fundamentale de cercetare pentru universitățile centrale (020814380146) și Talentul pentru tineret medical din provincia Jiangsu (QNRC2016056).

Informatia autorului

Note de autor

  1. Acești autori au contribuit în mod egal: Li-Kun Zhou, Zhen Zhou, Xia-Ming Jiang, Yishan Zheng

Afilieri

  1. Nanjing Drum Tower Hospital Center of Molecular Diagnostic and Therapy, Laboratorul cheie de stat de biotehnologie farmaceutică, Jiangsu Engineering Research Center for MicroRNA Biology and Biotechnology, NJU Advanced Institute of Life Sciences (NAILS), NJU Institute of AI Biomedicine and Biotechnology, School of Life Sciences , Universitatea Nanjing, Nanjing, Jiangsu 210023, ChinaLi-Kun Zhou, Zhen Zhou, Xi Chen, Zheng Fu și Chen-Yu Zhang
  2. Tianjin Medical University Cancer Institute and Hospital, Centrul Național de Cercetare Clinică pentru Cancer, Centrul de Cercetare Clinică pentru Cancer din Tianjin, Laboratorul cheie de prevenire și terapie a cancerului, Tianjin, 300060, ChinaLi-Kun Zhou
  3. Laboratorul cheie de stat de virologie, Institutul de virologie Wuhan, Centrul pentru Mega-Științe în domeniul biosecurității, Academia Chineză de Științe, Wuhan, Hubei 430071, ChinaXia-Ming Jiang, Gengfu Xiao și Lei-Ke Zhang
  4. Departamentul de Medicină de îngrijire critică și Centrul de boli infecțioase din Nanjing, al doilea spital din Nanjing, Universitatea de Medicină Chineză din Nanjing, Nanjing, Jiangsu 210003, ChinaYishan Zheng și Yongxiang Yi

Contribuții

YY, L.-K.Zhang și C.-YZ au conceput și proiectat experimentele; L.-K.Zhou, ZZ, X.-MJ, YZ și ZF au participat la mai multe experimente; L.-K.Zhou, ZZ, GX, CZ, L.-K.Zhang și XC au analizat datele. L.-K.Zhou, ZZ, C.-YZ și L.-K.Zhang au scris lucrarea. C.-YZ, L.-K.Zhang și YY au furnizat aprobarea finală a lucrării.

Autori corespondenți

Corespondență cu Chen-Yu Zhang sau Lei-Ke Zhang sau Yongxiang Yi .

Declarații de etică

Conflict de interese

Autorii declară că nu au niciun conflict de interese.

Informatii suplimentare

Nota editorului Springer Nature rămâne neutră în ceea ce privește revendicările jurisdicționale din hărțile publicate și afilierile instituționale.

Informatie suplimentara

Informatie suplimentara

Acces liber Acest articol este licențiat sub o licență internațională Creative Commons Attribution 4.0, care permite utilizarea, partajarea, adaptarea, distribuirea și reproducerea în orice mediu sau format, atâta timp cât acordați creditul autorului (autorilor) original (e) și sursei, furnizați un link către licența Creative Commons și indicați dacă s-au făcut modificări. Imaginile sau alte materiale ale terților din acest articol sunt incluse în licența Creative Commons a articolului, cu excepția cazului în care se indică altfel într-o linie de credit pentru material. Dacă materialul nu este inclus în licența Creative Commons a articolului și utilizarea intenționată a dvs. nu este permisă de reglementările legale sau depășește utilizarea permisă, va trebui să obțineți permisiunea direct de la titularul drepturilor de autor. Pentru a vizualiza o copie a acestei licențe, vizitațihttp://creativecommons.org/licenses/by/4.0/ .

Reimprimări și permisiuni

Despre acest articol

Verificați moneda și autenticitatea prin CrossMark

Citați acest articol

Zhou, L., Zhou, Z., Jiang, X. și colab. Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Cell Discov 6, 54 (2020). https://doi.org/10.1038/s41421-020-00197-3

Descărcați citația

  • Primit07 iunie 2020
  • Admis12 iulie 2020
  • Publicat05 august 2020

https://www.nature.com/articles/s41421-020-00197-3

Tratamentul cu hidroxiclorochină, azitromicină și combinate la pacienții internați cu COVID-19

Samia Arshad, Paul Kilgore, Zohra S. Chaudhry, Gordon Jacobsen, Dee Dee Wang, Kylie Huitsing, Indira Brar, George J. Alangaden, Mayur S. Ramesh , John E. McKinnon, William O’Neill, Marcus Zervos , Varidhi Nauriyal, Asif Abdul Hamed, Owais Nadeem, Jennifer Swiderek, Amanda Godfrey, Jeffrey Jennings, Jayna Gardner-Grey, Adam M. Ackerman, Jonathan Lezotte, Joseph Ruhala, Raef Fadel, Amit Vahia, Smitha Gudipati, Tommy Parraga, Anita Shallal,  Gina Maki, Zain Tariq, Geehan Suleyman, Nicholas Yared, Erica Herc, Johnathan Williams, Odaliz Abreu Lanfranco, Pallavi Bhargava, Katherine ReyesPublicat: 1 august 2020 de  Elsevier BV în Jurnalul internațional de boli infecțioaseJurnalul internațional al bolilor infecțioase , volumul 97, pp. 396-403; doi: 10.1016 / j.ijid.2020.06.099
Site-ul editoruluiPMCText completGoogle ScholarAfișați / ascundeți abstractul

Abstract:

Statele Unite se află într-o fază de accelerare a pandemiei COVID-19. În prezent, nu se cunoaște o terapie eficientă sau un vaccin pentru tratamentul SARS-CoV-2, subliniind urgența în ceea ce privește identificarea terapiilor eficiente.

Design studiu Multicentru observațional retrospectiv.

Setare Henry Ford Health System (HFHS) în sud-estul Michiganului: sistem de sănătate integrat cu șase spitale mari; cel mai mare dintre spitale este un spital de învățământ cuaternar cu 802 de paturi din orașul Detroit, Michigan.

Participanți Pacienții consecutivi spitalizați cu o admitere legată de COVID19 în sistemul de sănătate din 10 martie 2020 până în 2 mai 2020 au fost incluși. Doar prima admitere a fost inclusă la pacienții cu admiteri multiple. Toți pacienții evaluați au avut vârsta de 18 ani și peste și au fost tratați ca pacienți internați timp de cel puțin 48 de ore, cu excepția cazului în care au expirat în 24 de ore.

Rezultate

Din 2.541 de pacienți, cu un timp mediu mediu de spitalizare de 6 zile (IQR: 4-10 zile), vârsta mediană a fost de 64 de ani (IQR: 53-76 ani), 51% bărbați, 56% afro-americani, cu timp mediu până la urmărire de 28,5 zile (IQR: 3-53).

Mortalitatea generală în spital a fost de 18,1% (IÎ 95%: 16,6% -19,7%);

per tratament:

hidroxiclorochină + azitromicină, 157/783 (20,1% [IÎ 95%: 17,3% –23,0%]),

hidroxiclorochină singură, 162/1202 (13,5% [IÎ 95%: 11,6% –15,5%]),

-azitromicină singură ,33/147 (22,4% [IÎ 95%: 16,0% –30,1%]) și

niciun medicament, 108/409 (26,4% [IÎ 95%: 22,2% –31,0%]).

Cauza principală a mortalității a fost insuficiența respiratorie (88%); niciun pacient nu a documentat torsada vârfurilor. Din modelarea de regresie Cox, predictorii mortalității au fost vârsta> 65 ani (HR: 2,6 [95% CI: 1,9-3,3]), rasa albă (HR: 1,7 [95% CI: 1,4-2,1]), CKD (HR: 1,7 [IC 95%: 1,4-2,1]), nivel redus de saturație a O2 la internare (HR: 1,5 [IC 95%: 1,1-2,1]) și utilizarea ventilatorului în timpul internării (HR: 2,2 [IC 95%: 1,4-3,3] ). Hidroxiclorochina a furnizat o reducere a raportului de pericol de 66%, iar hidroxiclorochina + azitromicina 71% în comparație cu niciunul dintre tratamente

Concluzii și relevanță

În această evaluare multi-spitalicească, la controlul factorilor de risc COVID-19,tratamentul cu hidroxiclorochină singură și în combinație cu azitromicină a fost asociat cu reducerea mortalității asociate COVID-19. Sunt necesare studii prospective pentru a examina acest impact

Google Traducere

https://www.scilit.net/article/d1166cb415a833a74555d43e9ceb6981