Arhive etichetă | cancer prostata

Efectele suplimentării genisteinei asupra metilării ADN la nivelul genomului și a expresiei genice la pacienții cu cancer de prostată localizat

Birdal Bilir , 1, 5 Nitya V. Sharma , Jeongseok Lee , Bato Hammarstrom , 2, 7 Aud Svindland , 3, 4 Omer Kucuk , 5, 6 și Carlos S. Moreno 1, 6

Genisteina [4 ‘, 5,7-trihidroxiizoflavonă sau 5,7-dihidroxi-3- (4-hidroxifenil) cromen-4-onă] este o formă de agliconă izoflavonoidă, derivată din plante, genistină (un glicozid) (Nayeem et. al., 2019 [ 16 ]; Sansai și colab., 2020 [ 20 ]). Genisteina se găsește în principal în plantele leguminoase, în special în soia împreună cu alte izoflavone importante, daidzeina și gliciteina (Kalaiselvan și colab., 2010 [ 12 ]). Alte surse de genisteină includ fasole, naut, legume, fructe, nuci, alimente pe bază de soia și suplimente de genisteină. De asemenea, s-a raportat că boabele de soia nefermentate conțin mai multă genisteină decât cele fermentate (Kuligowski și colab., 2017 [ 13 ]; Li și Zhang, 2017 [ 14]]). În plus, genisteina poate fi sintetizată prin introducerea genei IFS (gena izoflavonei sintază) în celulele de drojdie și liniile de orez, ceea ce duce la un conținut crescut de genisteină în orez (până la 30 de ori) (Spagnuolo și colab., 2015 [ 23 ]) .

1 Departamentul de patologie și medicină de laborator, Universitatea Emory, Atlanta, GA, SUA2 Departamentul de Urologie, Institutul de Cercetare a Cancerului, Spitalul Universitar Oslo3 Departamentul de Medicină Clinică, Universitatea din Oslo4 Departamentul de Patologie, Spitalul Universitar Oslo, Oslo, Norvegia5 Departamentul de hematologie și oncologie medicală6 Winship Cancer Institute, Emory University, Atlanta, GA, SUACorespondență cu: Dr. Carlos S. Moreno, Departamentul de patologie și medicină de laborator, Winship Cancer Institute, Emory University, Whitehead Research Building, camera 105J, 615 Michael Street, Atlanta, GA 30322, SUA, E-mail: ude.yrome@oneromcAdresa actuală: Departamentul de Medicină de Mediu și de Muncă, Spitalul Universitar Oslo, Oslo, NorvegiaAcest articol a fost citat de alte articole din PMC.Mergi la:

Abstract

Studiile epidemiologice au arătat că compușii dietetici au efecte semnificative asupra carcinogenezei prostatei. Dintre agenții dietetici, genisteina, izoflavona majoră din soia, prezintă un interes deosebit, deoarece consumul ridicat de produse din soia a fost asociat cu o incidență scăzută a cancerului de prostată, sugerând un rol preventiv al genisteinei în cancerul de prostată. În ciuda numeroaselor studii pentru a înțelege efectele genisteinei asupra cancerului de prostată, mecanismele de acțiune nu au fost pe deplin elucidate. Am investigat diferențele dintre nivelurile de metilare și expresie genică ale specimenelor de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie folosind Illumina HumanMethylation450 și Illumina HumanHT-12 v4 Expression BeadChip Microarrays Prezentul studiu a fost un studiu randomizat, controlat cu placebo,studiu clinic dublu-orb pe pacienți norvegieni care au primit zilnic 30 mg genisteină sau capsule placebo timp de 3-6 săptămâni înainte de prostatectomie. Modificările exprimării genei au fost validate prin PCR cantitativă (qPCR). Metilarea genomului întreg și profilarea expresiei au identificat site-uri metilate diferențial și au exprimat gene între grupurile placebo și genisteină. Genele reglementate diferențial au fost implicate în procesele de dezvoltare, markerii celulelor stem, proliferarea și reglarea transcripțională. Analiza îmbogățirii a sugerat reducerea generală a activității MYC și creșterea activității PTEN la pacienții tratați cu genisteină. Aceste descoperiri evidențiază efectele genisteinei asupra modificărilor globale în expresia genelor în cancerul de prostată și efectele sale asupra căilor moleculare implicate în tumorigeneză de prostată.Cuvinte cheie: genisteină, cancer de prostată, metilare ADN, expresie geneticăMergi la:

Introducere

Cancerul de prostată este cea mai frecvent diagnosticată afecțiune malignă și a doua cauză principală de deces prin cancer în rândul bărbaților din Statele Unite. Se estimează că aproximativ 180.890 de cazuri noi de cancer de prostată și 26.120 de decese cauzate de cancer de prostată au avut loc în SUA în 2016 ( 1 ). Factorii de risc comuni pentru cancerul de prostată sunt vârsta, rasa / etnia, geografia, istoricul familial și stilul de viață ( 2 ). În funcție de gravitatea bolii, opțiunile actuale de tratament pentru cancerul de prostată includ terapii unice sau o combinație de terapii, cum ar fi supravegherea activă, chirurgia, radioterapia, chimioterapia, terapia hormonală sau vaccinurile ( 3). Deși aceste intervenții au îmbunătățit semnificativ calitatea vieții pacienților și ratele globale de supraviețuire, tratamentul eficient al cancerului de prostată este încă limitat datorită provocărilor majore, cum ar fi eterogenitatea genetică, recurența tumorii (~ 30% din cazuri) și rezistența la medicamente chimioterapeutice convenționale ( 4 – 6 ). Prin urmare, este crucial să se dezvolte noi strategii preventive și terapeutice care au potențialul de a îmbunătăți rezultatele pentru pacienții cu cancer de prostată.

Studiile epidemiologice au arătat că există o diferență semnificativă în ratele de incidență și mortalitate ale cancerului de prostată între diferite țări, cu cele mai ridicate rate în SUA și țările europene și cele mai mici rate în țările asiatice, cum ar fi Japonia și China ( 7 , 8 ). Această variabilitate largă a ratelor de cancer de prostată între țări sugerează că mai mulți factori, inclusiv diferențele genetice, epigenetice și de mediu, joacă un rol cheie în etiologia bolii. În special, s-a demonstrat că imigranții asiatici din SUA au o incidență crescută a cancerului de prostată în comparație cu acei indivizi cu același background genetic care trăiesc în Asia, indicând faptul că factorii de mediu, în special dieta, sunt factorii determinanți majori ai incidenței cancerului de prostată (9 ). Una dintre diferențele dietetice remarcabile dintre țările asiatice și cele occidentale este cantitatea de consum de alimente pe bază de soia. Populațiile asiatice consumă cantități mari de alimente din soia, care sunt bogate în izoflavone (~ 2 g de izoflavone pe kg de soia proaspătă) ( 10 ). S-a demonstrat că concentrațiile plasmatice și de lichide prostatice ale izoflavonelor la bărbații asiatici sunt de 10 până la 100 de ori mai mari decât cele la bărbații occidentali, cu niveluri deosebit de ridicate ale genisteinei de izoflavonă ( 11 , 12 ). Un număr tot mai mare de studii bazate pe populație a demonstrat că aportul ridicat de izoflavone din soia este asociat cu un risc redus cu 25-30% de cancer de prostată ( 13 , 14 ).

Fiind principala izoflavonă biologic activă în dieta soia, genisteina a fost investigată pe larg pentru potențialul său chimiopreventiv în diferite tipuri de cancer, inclusiv în cancerul de prostată. Aportul zilnic mediu de genisteină la populațiile asiatice sa dovedit a fi de 20-80 mg, în timp ce este de 1-3 mg în SUA, susținând efectele protectoare ale genisteinei împotriva cancerului de prostată la bărbații asiatici ( 15 ). Genistein atinge concentrațiile plasmatice de 1-5 u , M 6-8 ore după ingestia de dieta bogata soia ( 11 , 16 ). Timpul de înjumătățire plasmatică al genisteinei a fost raportat la 7,9 ore la adulți. În plus, concentrațiile de izoflavone totale din soia din țesutul prostatei s-au arătat de ~ 6 ori mai mari decât nivelurile serice de izoflavone ( 17). Studiile de siguranță și farmacocinetice ale izoflavonelor din soia au demonstrat că s-a observat o toxicitate clinică minimă la subiecții sănătoși administrați cu izoflavone din soia purificate la doze care depășesc aporturile alimentare normale ( 18 ).

Datorită similarității sale structurale cu hormonul steroid 17β-estradiol, se leaga genisteina la receptorii de estrogen, ER-α și ER-β, cu o afinitate mai mare pentru ER-β, și acționează ca un modulator naturale selectiv al receptorului de estrogen ( 16 , 19 , 20 ). Genisteina își exercită efectele inhibitoare asupra celulelor canceroase de prostată prin reglarea în sus a expresiei ER-β, care are roluri anti-proliferative și pro-apoptotice în celulele prostatei ( 21 , 22 ). În plus față de activitățile sale estrogenice, genisteina reglează căile mediate de receptorul androgen (AR) în cancerul de prostată ( 23 , 24 ). De remarcat, s-a arătat că efectul inhibitor al genisteinei asupra expresiei AR este mediat și de ER-β (25 ). Mai multe alte mecanisme moleculare care stau la baza efectelor preventive ale genisteinei asupra cancerului de prostată includ inhibarea proliferării celulare prin inducerea opririi ciclului celular G1 și / sau G2 / M ( 26 – 28 ), angiogeneză ( 29 , 30 ) și metastază ( 31 – 33 ) și inducerea apoptozei ( 34 , 35 ). Genisteina își exercită efectele pleiotrope în contextul cancerului de prostată prin modularea mai multor căi de transducție a semnalului celular, cum ar fi IGF-1 ( 36 ), TGF-β ( 37 ), Wnt / β-catenină ( 36 ), NF-κB ( 38 ) , AKT și MAPK ( 39) semnalizare. Această modulare ar putea fi legată direct de receptorii nucleari sau modificarea stării de fosforilare a proteinelor de transducție a semnalului. În plus, genisteina inhibă activitățile tirozin kinazei ( 40 ) și prezintă proprietăți antioxidante ( 41 , 42 ) în celulele prostatei. Swami și colab. ( 43 ) au demonstrat că genisteina reduce progresia cancerului de prostată prin inhibarea sintezei și activității prostaglandinelor. De asemenea, sa raportat că genisteina are posibile efecte asupra deteriorării și reparării ADN-ului în celulele canceroase de prostată ( 42 ). Mai mult, genisteina inhibă metilarea ADN-ului ( 44 – 48 ) și modificările histonice ( 47 ,48 ) și reglează miARN ( 49 – 52 ) în cancerul de prostată. Este de interes că genisteina sa dovedit a spori eficacitatea radioterapiei și a chimioterapiei ( 53 , 54 ).

Deși au fost efectuate numeroase studii in vitro și in vivo pentru a înțelege efectele protectoare ale genisteinei împotriva cancerului de prostată, demonstrate prin studii epidemiologice, mecanismele moleculare care guvernează modul în care genisteina afectează patogeneza cancerului de prostată rămân în continuare evazive. Este de remarcat faptul că o provocare majoră este variabilitatea largă a efectelor genisteinei în funcție de doză, de forma de administrare sau de momentul și durata expunerii ( 55). În ciuda bogăției de studii efectuate pe linii celulare umane și modele animale, doar câteva studii clinice prospective randomizate au fost efectuate pentru a examina efectele moleculare ale genisteinei asupra cancerului de prostată. În studiul de față, după cunoștințele noastre pentru prima dată, am investigat efectele intervenției genisteinei asupra metilării globale și a modelelor de expresie genică la pacienții cu cancer de prostată localizat și am identificat ținte noi care sunt modulate diferențial prin suplimentarea cu genisteină, oferind alte perspective mecaniciste asupra efectelor genisteinei asupra carcinogenezei prostatei.Mergi la:

Materiale și metode

Subiecte

Probele de prostată dintr-un studiu clinic de suplimentare a genisteinei înainte de prostatectomie ( 56 ) au fost analizate pentru modificări globale în metilarea ADN și expresia genelor. Participanții au fost recrutați din ambulatoriul de la Departamentul de Urologie, Spitalul Universitar Oslo, Oslo, Norvegia în perioada aprilie 2007 – august 2008. Studiul a fost aprobat de Agenția Norvegiană pentru Medicamente, Comitetul Regional de Etică, Ombudsmanul pentru confidențialitate și Prostate Biobank la Spitalul Universitar Oslo, Aker.

Profilarea metilării la nivelul genomului

ADN-ul total a fost izolat din țesuturile de prostată înghețate folosind kitul DNeasy Blood and Tissue (Qiagen, Valencia, CA, SUA) conform instrucțiunilor producătorului. ADN-ul a fost supus nucleului de genomică integrată Emory pentru analiza metilării ADN-ului folosind Illumina HumanMethylation450 BeadChip Microarrays. Datele de metilare sunt disponibile pe GEO (numărul de acces GSE84749 ).

Profilarea expresiei la nivel de genom

ARN-ul total a fost extras din țesuturile de prostată înghețate folosind kitul de izolare miVNA mirVana (Life Technologies, Grand Island, NY, SUA), urmat de curățarea ARN folosind kitul RNeasy Mini (Qiagen). ARN-ul total a fost trimis la nucleul de genomică integrat Emory pentru analiza expresiei genice utilizând Illumina HumanHT-12 v4 Expression BeadChip Microarray. Datele despre microarray sunt disponibile pe GEO (numărul de acces GSE84748 ).

Analiza PCR cantitativă (qPCR)

ARN a fost transcris invers în ADNc folosind kitul de sinteză ADNc iScript (Bio-Rad Laboratories, Hercules, CA, SUA). Grundurile au fost proiectate folosind instrumentul Primer3. Secvențele primerilor sunt enumerate înTabelul I. qPCR a fost efectuat folosind iQ SYBR-Green Supermix (Bio-Rad Laboratories) pe un iCycler Bio-Rad conform protocoalelor producătorului. Gena β-actină umană, care s-a dovedit a fi o genă validă de referință pentru normalizarea qPCR în probe de țesut uman de cancer de prostată, a fost utilizată ca control intern în prezentul studiu ( 57 ). Ca calibrator s-a folosit o probă normală de țesut prostatic. Modificările relative ale datelor de exprimare a genei au fost analizate prin metoda 2 −ΔΔCT . S-au efectuat triplicate pentru fiecare probă. Datele sunt prezentate ca medie ± deviație standard.

Tabelul I

Secvențe ale primerilor utilizați în analiza PCR cantitativă.

Numele primarSecvență primară (5 ′ → 3 ′)
CKS2-FPTTAGTCTCCGGCGAGTTGTTG
CKS2-RPCATAACATGCCGGTACTCGT
JAG1-FPAGTCGTGCATGCTCCAATCG
JAG1-RPCCCCACACACACTTGGCTC
NOTCH3-FPGATGTGGACGAGTGTGCTGG
NOTCH3-RPCAGGCATGGGTTGGGGTC
MMP26-FPGGACTTTGTTGAGGGCTATTTCCA
MMP26-RPGGAGGTGTCGGACCCATCAG
HIF1A-FPCACCACAGGACAGTACAGGAT
HIF1A-RPCGTGCTGAATAATACCACTCACA
CDK6-FPGCTGACCAGCAGTACGAATG
CDK6-RPGCACACATCAAACAACCTGACC
CD24-FPCGCGGACTTTTCTTTTGGGG
CD24-RPACTGGAATAAATCTGCGTGGGT
AMACR-FPCCGTTCTGTGCTATGGTCCTG
AMACR-RPAGCCTTGGATTTTCCCGCTG
MYC-FPCCTACCCTCTCAACGACAGC
MYC-RPTTGTTCCTCCTCAGAGTCGC
SPP1-FPCAAACGCCGACCAAGGAAAA
SPP1-RPGGCCACAGCATCTGGGTATT
NEU1-FPCGCAGCTATGATGCCTGTGA
NEU1-RPGGTCAGGTTCACTCGGAACTC
ADCY4-FPCCTGGGACCAGGTGTCCTAT
ADCY4-RPCAAGATACAGCCCGAGGACC
β-actină-FPCACAGAGCCTCGCCTTTGCC
β-actină-RPTGACCCATGCCCACCATCAC

Analiza qPCR.

Analiza datelor

Analiza expresiei genice a fost efectuată utilizând modulul GenePattern ComparativeMarkerSelection ( 58 ) comparând tumorile tratate cu genisteină cu tumorile tratate cu placebo. Datele Illumina Microarray au fost filtrate pentru a include gene care au fost detectate (P <0,05) în cel puțin un grup experimental pentru a rezulta într-un set de date de 15918 gene pentru analiză. Modulul de selecție a markerului comparativ al GenePattern a fost utilizat pentru a calcula testele t-Student ale celor două fețe între grupuri cu 10.000 permutări pentru a calcula ratele de descoperire false. Sămânța aleatorie utilizată a fost 779948241. Clusterul ierarhic a fost realizat utilizând software-ul Cluster ( 59 ) și Java TreeView ( 60 ). Analiza microarray de metilare a fost efectuată în R utilizând modulul CpGassoc în Bioconductor ( 61). Datele de la sondele de 450K au fost filtrate la cele în care valoarea β maximă – minimă a fost> 0,2 pentru a rezulta sonde de 160K pentru analiza diferențială a metilării. CpGassoc a fost utilizat pentru a identifica 162 de sonde semnificative care au fost metilate diferențial. Trei sonde au fost metilate diferențial între probele tumorale tratate cu genisteină și probele tumorale tratate cu placebo, trei sonde au fost semnificative între probele tumorale tratate cu genisteină și probele normale și 156 au fost semnificativ diferite între probele tumorale tratate cu placebo și probele normale.

analize statistice

Testul U Mann-Whitney (cu două cozi) a fost utilizat pentru a determina diferențe semnificative între două grupuri de date. P <0,05 a fost considerat semnificativ statistic.Mergi la:

Rezultate

Caracteristici clinicopatologice

Am analizat probe de țesut prostatic dintr-un studiu anterior, care a fost un studiu clinic randomizat, controlat placebo, dublu-orb, de fază 2, pe pacienți norvegieni cu cancer de prostată localizat care au primit 30 mg genisteină sintetică sau capsule placebo zilnic timp de 3-6 săptămâni înainte de radical prostatectomie ( 56 ). Caracteristicile clinice și patologice ale cazurilor au fost descrise anterior ( 56 ). Disponibilitatea țesutului înghețat a limitat dimensiunea eșantionului în acest studiu și am investigat metilarea ADN și nivelurile de expresie genică a probelor de tumori de prostată de la 10 pacienți care au primit genisteină și 10 pacienți care au primit placebo. Au fost de asemenea analizate patru probe adiacente de țesut normal de prostată. Datele clinice pentru cei 20 de pacienți analizați aici sunt furnizate înTabelul II. Nu au existat diferențe semnificative statistic în ceea ce privește vârsta, nivelurile PSA serice și scorul Gleason între cele două grupuri de tratament.

Tabelul II

Date clinice pentru cei 20 de pacienți analizați în prezentul studiu.

TratamentID-ul pacientuluiGleasonSuma GleasonEtapăVârstăPSA
Genisteină (n = 10)13 + 4726812.0
73 + 4726810.9
83 + 362596.2
103 + 473a615.1
133 + 362587.6
144 + 373a648.5
174 + 482616.1
183 + 362576.0
193 + 362637.8
203 + 472687.9
Media (SD)6,7 (0,7)62,7 (4,2)7,8 (2,2)
Placebo (n = 10)243 + 362616.4
253 + 362574.2
263 + 473a689.9
274 + 482699.2
304 + 372555.1
333 + 362566.4
343 + 362637.6
353 + 473a605.7
383 + 472629.9
393 + 362667.0
Media (SD)6,6 (0,7)61,7 (4,9)7.1 (2.0)

Metilare diferențială în țesutul tratat cu genisteină în comparație cu țesutul tratat cu placebo

Profilurile de metilare a ADN-ului la nivelul genomului unui total de 24 de probe de prostată din țesuturi tumorale sau normale au fost generate folosind trusa Illumina HumanMethylation450 BeadChip. Starea de metilare a fiecărei probe a fost analizată pentru 485.577 de situri, acoperind 21.231 de gene. Am comparat profilurile de metilare ale probelor de tumori tratate cu genisteină cu cazurile tratate cu placebo. În general, modificările de metilare au fost modeste și nu a existat o genă metilată semnificativ diferențiat după corecție pentru testarea ipotezelor multiple. Cu toate acestea, valorile P necorectate au indicat faptul că RBM28 și CYTSBgenele au fost demetilate în probe tumorale tratate cu genisteină comparativ cu probele tratate cu placebo. Lipsa semnificației statistice s-a datorat probabil numărului mic de probe analizate în acest studiu. Am observat 156 de sonde cu metilare crescută semnificativ în țesuturile tumorale tratate cu placebo față de țesuturile normale care nu au fost semnificative între țesuturile tumorale tratate cu genisteină și țesuturile normale, sugerând că genisteina ar putea avea unele efecte de demetilare (disponibile la cerere). Aceste 156 de sonde corespundeau a cel puțin 92 de gene separate, inclusiv ADCY4 , ALOX12 , HAAO , LRRC4 , NEU1 , RAPGEFL1 și WNT7B (Tabelul III).

Tabelul III

Lista a 156 de sonde metilate diferențial (92 de gene).

ID țintăNumele geneiValoarea P (GT vs. PT)Valoarea P (GT vs. N)Valoarea P (PT vs. N)
cg00353923LRRC4; SND1nsns0,000214451
cg00420348EFCAB4Ansns0,000247793
cg00459232CD9nsns0,000270319
cg00494665nsns0,000274219
cg00506168PDXKnsns0,000515556
cg00578638RAPGEFL1nsns3.67E-05
cg01224366PDXKnsns0,000393857
cg01228355CORINnsns0,000881032
cg01233722NFATC4nsns1.51E-05
cg01398859nsns0,000942104
cg01561916HAAOnsns0,00015216
cg01684881FZD2nsns0,000472597
cg01856645DMGDH; BHMT2nsns0,000876054
cg02072400nsns3.73E-05
cg02131967ASnsns0,000468338
cg02215070AKR1B1nsns0,000607743
cg02493798ALOX12nsns0,000106934
cg02534363NBEAL2nsns0,000263128
cg02659920EPS8L2nsns0,000563556
cg02665650ANKS1Ansns0,000420543
cg02683114C2orf84nsns3.28E-05
cg02915422nsns0,000993538
cg03119308RBM280,000122845nsns
cg03404566ALOX12nsns9.44E-05
cg03407747ALOX12nsns0,000320776
cg03452174RAB34nsns0,000820466
cg03456213C9orf3nsns0,000620827
cg03760483ALOX12nsns0.000249903
cg03762994ALOX12nsns0,000338148
cg03782157nsns0.000566959
cg03787864CYBAnsns0.000360395
cg03955537TBCDnsns0.000449056
cg03957885nsns0.000500821
cg04034767GRASPnsns0.000526517
cg04178858RAPGEFL1nsns0.000378136
cg04194674SRCIN1nsns0.000665658
cg04332818FGF2nsns0.000648814
cg04555220SEMA5Ansns0.000994353
cg04621728nsns0.000680098
cg04797170nsns0.000729496
cg05209996nsns0.000724896
cg05897210DTHD1nsns0.000252462
cg05950572SPON1nsns0.000546993
cg06085985EFCAB4Ansns0.000230613
cg06590173TPM4nsns0.000778707
cg06607764CYTH1nsns0.000254746
cg06749789THAP4nsns0.000864909
cg06763054MTMR7nsns0.000353509
cg06795971TET2nsns0.000140266
cg06835156C14orf70ns0.000524942ns
cg06945399LRRC4; SND1nsns7.67E-05
cg07016556BAHCC1nsns0.000590044
cg07235805PARD6Gnsns0.000661791
cg07251099CD200nsns0.000689192
cg07522516ZAR1nsns0.000692555
cg07834955SFRP5nsns0.000372927
cg07871590LRRC4;SND1nsns0.000127567
cg07924363MGC16121; MIR424; MIR503ns0.000320255ns
cg08194377ANKS1Ansns0.000793165
cg08248285CFL2nsns0.000346449
cg08298946nsns0.000455024
cg08330950nsns0.000195062
cg08421126HAAOnsns0.000388422
cg08572315nsns0.000667361
cg08617833SMARCA1nsns0.000373883
cg09088834NINLnsns0.000442225
cg09246479C22orf45; UPB1nsns0.00010158
cg09456782TMCO3; DCUN1D2nsns0.000792785
cg09480054HAAOnsns0.000295903
cg09580336ATP1A1nsns0.000440859
cg09581551SOBPnsns0.000280079
cg09667289FMN1nsns0.000712725
cg09737314ALOX12nsns0.000673337
cg09920557ACEnsns0.000673976
cg09963123FLJ13197; KLF3nsns0.000654359
cg10445911nsns0.00061326
cg11417025SOSTDC1nsns0.000375888
cg11832404nsns0.000826709
cg11942956EYA4nsns0.00073108
cg12177793NFATC4nsns0.000965995
cg12262378ALOX12nsns0.000115607
cg12451530LOC100302652; GPR75nsns0.000188564
cg12828075INSCnsns0.000784835
cg13616314HS3ST3A1nsns2.38E-05
cg13801416AKR1B1nsns0.000474669
cg13857811SLC7A3nsns0.000228168
cg14032732ECHDC3nsns0.000256212
cg14243778CNTN1nsns0.00077315
cg14254720LRRC8Cnsns0.000920384
cg14287235ADCY4nsns0.000228476
cg14482902SRCIN1nsns0.000344968
cg14500300nsns8.80E-05
cg14603620RAPGEFL1nsns7.94E-05
cg14663984AGRNnsns0.000843468
cg14792081nsns0.000344126
cg15115171nsns0.000503109
cg15673034DLGAP1nsns0.000846318
cg15826437RAPGEFL1nsns0.00029995
cg15998779nsns0.000211956
cg16450577TBCDnsns0.000368573
cg16859884nsns0.000247308
cg16968985SEZ6nsns0.000382576
cg17011709CYP26C1nsns0.000901702
cg17131553TRPS1nsns0.000583708
cg17165580CRABP2nsns0.000197886
cg17479501TBCDnsns0.000197189
cg17496661ns0.0004364740.000459741
cg17624073BAHCC1nsns0.000526316
cg17729667NINLnsns0.000569462
cg18344652CNN3nsns0.000452391
cg19372602nsns0.000864447
cg19467964TBCDnsns0.000196505
cg19499884LZTS2nsns0.000537829
cg19929126TRILnsns0.000632594
cg20132775TRPC1nsns0.000197515
cg20145692COL9A2nsns0.000190537
cg20276377C3orf26; FILIP1L; MIR548Gnsns6.22E-05
cg20383155NEU1; SLC44A4nsns0.000632549
cg20801007EFCAB4Ansns0.000259905
cg20987431ZHX1nsns0.00053928
cg21079003RGMAnsns0.000411886
cg21116447NEU1; SLC44A4nsns0.000990119
cg21543859RUNX2nsns0.000760409
cg21849932LIME1nsns0.000537283
cg21944491LTBP4nsns0.000572287
cg22074576OSBPL5nsns0.00073274
cg22092811C3orf26; FILIP1L; MIR548Gnsns4.30E-05
cg22413388WNT7Bnsns0.000992683
cg22534145SSTR4nsns0.000156886
cg22675801TRILnsns0.000451146
cg22753340NEU1; SLC44A4nsns0.000874186
cg22773555EFCAB4Ansns0.00025263
cg22773661ZAR1nsns0.00033279
cg22871668EYA4nsns0.000392704
cg22878441nsns0.000393322
cg23083315FJX1nsns0.000288759
cg23142799SHISA2nsns0.000157373
cg23396786SFXN5nsns0.000434986
cg23425970HS6ST1nsns0.00016049
cg23563927C10orf93nsns0.000585909
cg23684878nsns0.000735566
cg23926436nsns0.00082097
cg24251193CRABP2nsns0.000141885
cg24331301CDH23nsns0.000549748
cg24878115SSBP4nsns0.000354342
cg24902339CASC2nsns0.000256574
cg25027125CFL2nsns0.000978881
cg25117523CYTH1nsns0.000297582
cg25387565NEU1nsns0.000708206
cg25563256FGF11nsns0.000933724
cg25813864RAPGEFL1nsns0.000174816
cg25834415IF1Ansns0.000894051
Kcg26009486NFATC4nsns0.000293111
cg26360792HAAOnsns0.000297095
cg26558799TBCDnsns0.000570916
cg26607748TPM2nsns0.000773141
cg26846076CYTSB0.000457469nsns
cg27191312nsns0.00012339
cg27299406HAAOnsns0.000380895
cg27347290NEU1; SLC44A4nsns0.000429935
cg27573591SND1; LRRC4nsns0.000183694
rs100331470.00000393nsns

Deschideți într-o fereastră separată

GT, tumoare tratată cu genisteină; PT, tumoare tratată cu placebo; N, normal; NS, nu semnificativ.

Profilul expresiei genei se modifică după tratamentul cu genisteină

Pentru a identifica efectele moleculare ale genisteinei asupra nivelurilor de ARNm în cancerul de prostată, am comparat profilurile de expresie genică ale tumorilor tratate cu genisteină cu probele tratate cu placebo. Din nou, nu au existat probe exprimate diferențial care să rămână semnificative statistic după corecție pentru testarea ipotezelor multiple. Cu toate acestea, au existat 628 de sonde care au atins valori P semnificative nominal (disponibile la cerere). Gruparea ierarhică a acestui set de date a arătat o segregare puternică a pacienților cu și fără tratament cu genisteină (Fig. 1). Genele cu valori P semnificative nominal au inclus gene NOTCH3 , JAG1 , CKS2 , HIF1A , CDK6 , MYC , CD24 , AMACR , MMP26 și SPP1 (Tabelul IV). NEU1 și ADCY4 nu au atins semnificație nominală , dar a avut o tendință spre semnificație, și integrarea datelor de metilare cu nivelurile de expresie expresia genelor pereche de profile de date indicate au scăzut stare de metilare și crescute de ADCY4 si NEU1 gene in cazurile tratate genisteina.figura 1

Profilarea expresiei întregului genom al probelor de tumori tratate cu placebo sau genisteină. Gruparea ierarhică a modificărilor în expresia genelor pentru acele gene cu un P <0,05 nominal între probele genistein-tumorale și probele placebo-tumorale.

Tabelul IV

Gene cu expresie diferențială a genelor analizate prin qPCR.

Simbol genicExpresia genelor se schimbă
MicroarrayqPCR
CKS2−2,02−2,50
NOTCH31,722.08
HIF1A−1,63−1,80
CDK6−2,87−1,57
JAG11,916.00
NEU1 a1,771,50
ADCY4 a1,671,60
C-UL MEU−1,57−2.30
CD24−2,02−2,64
AMACR−1,95−2.14
MMPP26−2,78−2,84
SPP1−2,36−3.09

Modificările de pliuri sunt genisteină-tumoră / placebo-tumorăo stare de metilare a ADN-ului este corelată cu expresia genelor în NEU1 și ADCY4. qPCR, PCR cantitativă.

Validarea datelor microarray

Am investigat nivelurile de expresie a 12 gene selectate (Tabelul IV) în toate cele 24 de eșantioane analizate prin microarrays folosind qPCR și au observat că datele microarray au fost corelate cu rezultatele qPCR (Fig. 2). Creșterea nivelurilor de expresie qPCR ale genelor NOTCH3 și JAG1 în tumorile tratate cu genisteină comparativ cu tumorile tratate cu placebo au fost semnificative statistic prin testul U Mann-Whitney.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este IJO-51-01-0223-g01.jpg

Deschideți într-o fereastră separatăFigura 2

Analiza qPCR a nivelurilor de expresie a 12 gene din grupurile placebo și genisteină. Modificările de expresie ale genelor selectate din datele microarray au fost validate folosind qPCR. Datele sunt prezentate ca modificări ale pliurilor în raport cu probele de control. qPCR, PCR cantitativă.

Analiza îmbogățirii

Am efectuat analize de îmbogățire a genei pe cele 628 de sonde semnificative nominal care au fost exprimate diferențial între probele de genisteină și placebo (Tabelul V) folosind Analiza căii de ingeniozitate ( 62 ) și baza de cunoștințe DAVID ( 63). Valoarea P indică distribuția hipergeometrică Valorile P ale suprapunerii pentru seturile de gene și categoriile funcționale. FDR indică o rată de descoperire falsă, corectate valorile P ale suprapunerii. Scorul z de activare este o indicație a consistenței membrilor în sus și în jos reglementați ai unui set de gene, cum ar fi o funcție biologică (tabelul de sus) sau țintele unui regulator în amonte (tabelul de mijloc). Scorurile de activare z> 2 sau <−2 sunt semnificative statistic pentru consistența activării sau inhibării. Moleculele indică numărul de molecule din setul de 628 de sonde analizate care se suprapun cu o anumită categorie. Rețeaua mecanistică indică numărul total de gene țintă ale unui regulator în amonte, iar numărul de gene suprapuse este indicat între paranteze. Am observat îmbogățirea termenilor asociați cu angiogeneza, apoptoza, tranziția epitelială la mezenchimală,progresia tumorii și legarea PDGF. Analiza potențialelor regulatoare din amonte prin analiza IPA a sugerat că PTEN și PDGF au fost activate, în timp ce MYC, β-estradiol, receptorul glucocorticoid NR3C1 și interferon-γ au fost reprimate ca răspuns la tratamentul cu genisteină.

Tabelul V

Analiza îmbogățirii a 628 de sonde semnificative nominal exprimate diferențial între grupurile de genisteină și placebo.

AnalizăValoarea PActivare scor zNumărul de moleculeFuncţie
IPA5.92E-080,77318Progresia tumorii
IPA4.88E-071,01355Neoplasm abdominal
IPA1.09E-061.92728Diferențierea liniilor celulare tumorale
IPA1.34E-06−1.01719Tranziția epitelial-mezenchimală
IPA7.46E-062.41222Tumora neuroendocrină
IPA7.98E-052.05428Necroza tumorii
AnalizăValoarea P a suprapuneriiActivare scor zRețea mecanicistăRegulator în amonte
IPA3.85E-08−0,692184 (16)NR3C1
IPA1.21E-071.681112 (9)PDGFB
IPA2.71E-07−1.385167 (15)β-estradiol
IPA2.15E-06−0,832144 (13)IFNG
IPA2.17E-061,608141 (16)PTEN
IPA4.59E-06−2.995133 (13)C-UL MEU
AnalizăFDRActivare scor zNumărul de moleculeTermen
DAVID7.90E-04N / A17GO: 0005840 ribozom
DAVID1.19E-02N / A34mitocondrie
DAVID2.00E-02N / A16GO: 0001568 dezvoltarea vaselor de sânge
DAVID1.77E-02N / A10GO: 0019838 legarea factorului de creștere
DAVID3.52E-02N / A7GO: 0008629 inducerea apoptozei prin semnale intracelulare
DAVID3.16E-02N / A4GO: 0048407 legarea factorului de creștere derivat din trombocite

Deschideți într-o fereastră separatăMergi la:

Discuţie

Din câte știm, prezentul studiu este primul care evidențiază efectele genisteinei asupra modificărilor globale ale metilării ADN și ale expresiei genice la pacienți dintr-un studiu clinic de genisteină în cancerul de prostată. Analiza integrativă a metilării genomului întreg și profilarea expresiei au identificat un număr de situri candidate metilate diferențial și au exprimat site-uri între grupurile placebo și genisteină. Cu toate acestea, diferențele dintre grupurile placebo și grupurile cu genisteină nu au fost semnificative statistic după corecție pentru testarea multiplelor ipoteze, posibil datorită numărului mic de cazuri din acest studiu. Deși modificările induse de genisteină nu sunt semnificative, aceste rezultate pot ajuta la elucidarea mecanismelor moleculare care stau la baza activităților genisteinei în cancerul de prostată.Matricile de metilare a ADN-ului la nivel de genom au arătat că un număr de gene, inclusivRBM28 și CYTSB , păreau a fi demetilate în probele tumorale tratate cu genisteină, comparativ cu probele din grupul placebo. Cu toate acestea, nu am observat modificări ale nivelurilor de expresie ale acestor gene. Printre genele exprimate diferențial identificate prin analiza microarray s-au numărat CKS2 , NOTCH3 , HIF1A , CDK6 , JAG1 , NEU1 , ADCY4 , MYC , CD24 , AMACR , MMP26 și SPP1. Datele microarray au fost confirmate prin analiza qPCR a acestor gene. Alte gene cu semnificație nominală prin microarray, dar care nu au fost testate de qPCR au inclus ZNF639 , CRIM1 , PGC și USP54 (disponibil la cerere).

Este interesant de remarcat faptul că statutul de metilare ADN – ul a fost corelat invers cu expresia genelor pentru NEU1 si ADCY4 gene, care a scazut de metilare și expresia crescută a ARNm în grupul genisteina comparativ cu grupul placebo. Descoperirea noastră care arată potențialul genisteinei pentru demetilarea ADN-ului este în concordanță cu datele raportate anterior care sugerează că genisteina acționează ca un inhibitor al DNMT, provocând astfel demetilarea insulelor CpG în promotorii genelor. De exemplu, s-a demonstrat că genisteina reactivează genele supresoare tumorale cu tăcere hipermetilată, inclusiv p16INK4a , receptorul de acid retinoic β ( RARβ ) și O 6-metilguanină metiltransferază ( MGMT), în celulele canceroase de prostată și esofag ( 46 ). Mai mult, genisteina a fost implicată în demetilarea promotorului WNT5a în celulele cancerului de colon ( 64 ). Una dintre genele care s-au dovedit a fi demetilate de genisteină în studiul de față este ADCY4, care este un membru al familiei adenilat ciclaselor, enzimele legate de membrană care catalizează formarea adenozinei monofosfat ciclic mesager secundar (AMPc) ( 65 ). În concordanță cu constatările noastre, s-a demonstrat recent că ADCY4 este un marker de metilare a ADN-ului care reprezintă evenimente epigenetice timpurii în tumorigeneză de prostată, susținând ipoteza noastră că genisteina poate inversa modelul metilării ADN-ului în ADCY4 în cancerul de prostată ( 66).). Cealaltă genă care a fost modulată prin intervenția genisteinei în prezentul studiu a fost NEU1, care este o sialidază lizozomală implicată în catabolismul glicoconjugatului și semnalizarea celulară, inclusiv răspunsurile imune și transducția semnalului mediată de receptorul elastinei ( 67 ). De fapt, NEU1 este esențial pentru desialilarea integrinei β4 și inhibarea FAK, ducând la suprimarea metastazelor hepatice în cancerul de colon ( 68 ). Kato și colab. ( 69 ) au raportat că supraexprimarea NEU1 a dus la suprimarea metastazelor pulmonare în melanom. În plus, suprimarea NEU1 de către miR-125b sa dovedit a promova migrația, invazia și metastaza în cancerele gastrice ( 70). Cu toate acestea, NEU1 poate avea, de asemenea, efecte pro-metastatice în cazurile de cancer pancreatic și ovarian ( 71 ) și, prin urmare, nu este pe deplin clar care ar putea fi impactul general al nivelurilor crescute de NEU1 în cancerul de prostată. Prin urmare, este important să se examineze modificările expresiei NEU1 la nivelul proteinelor și sunt necesare studii moleculare și celulare pentru a evalua consecințele funcționale ale modificărilor induse de reglarea ascendentă a NEU1 în celulele cancerului de prostată.

Dintre genele exprimate diferențial care au fost validate de qPCR, doar expresia mARN-urilor NOTCH3 și JAG1 au fost semnificativ mai mari în grupul cu genisteină comparativ cu grupul placebo de qPCR. Pe baza constatărilor noastre la nivel de ARNm, fără nici o confirmare la nivel proteic sau funcțional, ar fi speculativ să sugerăm că semnalizarea Notch poate juca un rol în mecanismul de acțiune al genisteinei asupra cancerului de prostată. NOTCH3 este important pentru EMT indus de TGFβ în cancerul de prostată ( 72 ) și este indus de hipoxie și contribuie la progresia cancerului de prostată ( 73 ). Ligandul Notch JAG1 este, de asemenea, asociat cu cancer de prostată mai agresiv ( 74 , 75 ), EMT și angiogeneză (76 ). Cu toate acestea, un rol de supresie tumorală a semnalizării Notch a fost raportat și în diferențierea neuroendocrină indusă de hipoxie a celulelor canceroase de prostată, precum și în alte tipuri de cancer, inclusiv cancerul vezicii urinare, tumorile maligne hematologice, gliomul, carcinomul tiroidian și cancerul pulmonar ( 77 – 82 ), indicând posibilitatea ca expresia crescută a NOTCH3 / JAG1 prin tratamentul cu genisteină să îmbunătățească rezultatele prin funcția sa de supresoare tumorală. Datele noastre sugerează că studii suplimentare pentru a delimita efectul genisteinei asupra căii de semnalizare Notch în cancerul de prostată pot fi justificate.

Analizele de îmbogățire a modificărilor ARNm induse de genisteină au indicat faptul că modificările subtile ale expresiei genice observate între probele de genisteină și placebo sunt în concordanță cu multe efecte raportate anterior ale genisteinei pe căile tumorale critice, inclusiv PTEN, PDGF, MYC, β-estradiol, receptor glucocorticoid și interferon- y ( 41 , 83 – 89 ). Genisteina pare să promoveze activitatea PTEN și inhibă activitatea MYC, în concordanță cu utilitatea sa potențială în îmbunătățirea rezultatelor în cancerul de prostată.

Pe scurt, rezultatele noastre indică faptul că intervenția genisteinei induce modularea mai multor gene, inclusiv NOTCH3 , JAG1 , ADCY4 și NEU1, sugerând că aceste gene pot avea potențialul de a fi ținte moleculare noi ale genisteinei în cancerul de prostată. Aceste gene sunt implicate în multe procese biologice critice, inclusiv ciclul celular, angiogeneza, răspunsul imun celular și transducția semnalului intracelular, oferind o perspectivă suplimentară asupra multiplelor căi moleculare implicate în tumorigeneză de prostată. Cu toate acestea, sunt necesare studii mecaniciste suplimentare pentru a investiga efectele genisteinei asupra reglării expresiei acestor gene la nivelul proteinelor și funcțiilor celulare. Aceste descoperiri pot contribui apoi la proiectarea de noi strategii pentru prevenirea și tratamentul cancerului de prostată. O avertisment al studiilor de profilare a expresiei genice este incapacitatea identificării mecanismelor de acțiune care sunt modulate la nivel post-transcripțional,sugerând posibilitatea ca genisteina să modifice procese celulare suplimentare. Un alt punct care trebuie făcut este momentul și durata expunerii la genisteină. Studiile de control al cazurilor au demonstrat că consumul ridicat de soia la începutul vieții (în timpul copilăriei și / sau adolescenței) este asociat cu o reducere de 25-60% a riscului de cancer mamar (90 , 91 ). În mod similar, aportul ridicat de soia la pubertate, perioada în care prostata suferă o creștere indusă de androgen, ar putea fi mai eficientă în prevenirea cancerului de prostată. O limitare a prezentului studiu este numărul mic de probe de pacienți. Alte studii clinice controlate randomizate de mari dimensiuni ar oferi rezultate mai definitive ale efectelor genisteinei asupra țesuturilor prostatei pacientului.Mergi la:

Mulțumiri

Prezentul studiu a fost susținut parțial de nucleul de genomică integrat Emory (EIGC), care este subvenționat de Grantul de asistență al Centrului de Cancer NCI P30CA138292 și de Școala de Medicină a Universității Emory și este una dintre facilitățile de bază integrate Emory. Acesta a fost susținut în continuare de un Premiu de Cercetare a Soia din cadrul Programului de Cercetare în Sănătate al Soia al United Soybean Board.Mergi la:

Referințe

1. Siegel RL, Miller KD, Jemal A. Statistici despre cancer, 2016. CA Cancer J Clin. 2016; 66 : 7–30. doi: 10.3322 / caac.21332. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Fapte și cifre despre cancerul de prostată 2016. American Cancer Society Inc; Atlanta, GA: 2016. [ Google Scholar ]3. Dunn MW, Kazer MW. Prezentare generală a cancerului de prostată. Semin Oncol Nurs. 2011; 27 : 241-250. doi: 10.1016 / j.soncn.2011.07.002. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Sartor AO. Progresia cancerului de prostată metastatic rezistent la castrate: impactul intervenției terapeutice în spațiul post-docetaxel. J Hematol Oncol. 2011; 4 : 18. doi: 10.1186 / 1756-8722-4-18. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Skolarus TA, Wolf AMD, Erb NL, Brooks DD, Rivers BM, Underwood W, III, Salner AL, Zelefsky MJ, Aragon-Ching JB, Slovin SF, și colab. American Cancer Society ghiduri de îngrijire pentru supraviețuirea cancerului de prostată. CA Cancer J Clin. 2014; 64 : 225–249. doi: 10.3322 / caac.21234. [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, Heguy A, Huberman K, Bernstein M, Assel M, și colab. Sarcina de modificare a numărului de copii prezice recăderea cancerului de prostată. Proc Natl Acad Sci SUA. 2014; 111 : 11139–11144. doi: 10.1073 / pnas.1411446111. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]7. Ferlay J, Bray F, Pisani P, Parkin DM. Globocan 2000: Incidența, mortalitatea și prevalența cancerului la nivel mondial. Presa IARC; Lyon: 2001. [ Google Scholar ]8. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Statistici globale privind cancerul. CA Cancer J Clin. 2011; 61 : 69–90. doi: 10.3322 / caac.20107. [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Kimura T. East întâlnește vestul: Diferențe etnice în epidemiologia cancerului de prostată între asiatici de est și caucazieni. Cancerul Chin J. 2012; 31 : 421-429. doi: 10.5732 / cjc.011.10324. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Reinli K, Block G. Conținutul de fitoestrogen din alimente – un compendiu al valorilor literaturii. Cancerul Nutr. 1996; 26 : 123–148. doi: 10.1080 / 01635589609514470. [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Adlercreutz H, Markkanen H, Watanabe S. Concentrații plasmatice de fitoestrogeni la bărbații japonezi. Lancet. 1993; 342 : 1209–1210. doi: 10.1016 / 0140-6736 (93) 92188-Y. [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Morton MS, Chan PS, Cheng C, Blacklock N, Matos-Ferreira A, Abranches-Monteiro L, Correia R, Lloyd S, Griffiths K. Lignans și izoflavonoizi în plasmă și lichid prostatic la bărbați: eșantioane din Portugalia, Hong Kong , și Regatul Unit. Prostata. 1997; 32 : 122–128. doi: 10.1002 / (SICI) 1097-0045 (19970701) 32: 2 <122 :: AID-PROS7> 3.0.CO; 2-O. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hwang YW, Kim SY, Jee SH, Kim YN, Nam CM. Consumul de alimente din soia și riscul de cancer de prostată: o meta-analiză a studiilor observaționale. Cancerul Nutr. 2009; 61 : 598-606. doi: 10.1080 / 01635580902825639. [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Van Poppel H, Tombal B. Chimioprevenția cancerului de prostată cu substanțe nutritive și suplimente. Cancer Manag Res. 2011; 3 : 91–100. doi: 10.2147 / CMAR.S18503. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Barnes S, Peterson TG, Coward L. Justificare pentru utilizarea matricelor de soia care conțin genisteină în studiile de chemoprevenție pentru cancerul de sân și de prostată. J Cell Biochem (Suppl) 1995; S22 : 181–187. doi: 10.1002 / jcb.240590823. [ PubMed ] [ CrossRef ] [ Google Scholar ]16. Takimoto CH, Glover K, Huang X, Hayes SA, Gallot L, Quinn M, Jovanovic BD, Shapiro A, Hernandez L, Goetz A, și colab. Analiza farmacocinetică și farmacodinamică de fază I a izoflavonelor de soia neconjugate administrate persoanelor cu cancer. Biomarkeri de epidemiol pentru cancer Prev. 2003; 12 : 1213–1221. [ PubMed ] [ Google Scholar ]17. CD Gardner, Oelrich B, Liu JP, Feldman D, Franke AA, Brooks JD. Concentrațiile de izoflavonă din soia prostatică depășesc nivelurile serice după suplimentarea dietei. Prostata. 2009; 69 : 719–726. doi: 10.1002 / pros.20922. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Bloedon LT, Jeffcoat AR, Lopaczynski W, Schell MJ, Black TM, Dix KJ, Thomas BF, Albright C, Busby MG, Crowell JA și colab. Siguranța și farmacocinetica izoflavonelor purificate din soia: Administrare cu doză unică la femeile aflate în postmenopauză. Sunt J Clin Nutr. 2002; 76 : 1126–1137. [ PubMed ] [ Google Scholar ]19. Yildiz F. Fitoestrogeni în alimente funcționale. CRC Press; Boca Raton, FL: 2005. https://doi.org/10.1201/9781420027594 . [ CrossRef ] [ Google Scholar ]20. Morito K, Hirose T, Kinjo J, Hirakawa T, Okawa M, Nohara T, Ogawa S, Inoue S, Muramatsu M, Masamune Y. Interacțiunea fitoestrogenilor cu receptorii de estrogen alfa și beta. Biol Pharm Bull. 2001; 24 : 351–356. doi: 10.1248 / bpb.24.351. [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Chang WY, Prins GS. Receptorul de estrogen-beta: Implicații pentru glanda prostatică. Prostata. 1999; 40 : 115–124. doi: 10.1002 / (SICI) 1097-0045 (19990701) 40: 2 <115 :: AID-PROS7> 3.0.CO; 2-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]22. Kumar R, Verma V, Jain A, Jain RK, Maikhuri JP, Gupta G. Mecanisme sinergice chimioprotectoare ale fitoestrogenilor dietetici într-o combinație selectă împotriva cancerului de prostată. J Nutr Biochem. 2011; 22 : 723–731. doi: 10.1016 / j.jnutbio.2010.06.003. [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Wang J, Eltoum IE, Lamartiniere CA. Chimioprevenția genisteinei a cancerului de prostată la șoarecii TRAMP. J Cancer. 2007; 6 : 3. doi: 10.1186 / 1477-3163-6-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Davis JN, Kucuk O, Sarkar FH. Expresia antigenului specific prostatei este reglată transcripțional de genisteină în celulele cancerului de prostată. Mol Carcinog. 2002; 34 : 91–101. doi: 10.1002 / mc.10053. [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H. Reglarea receptorilor de androgen prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgen este mediată de receptorul de estrogen beta. Eur Urol. 2004; 45 : 245–251. doi: 10.1016 / j.eururo.2003.09.001. discuție 251. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Shen JC, Klein RD, Wei Q, Guan Y, Contois JH, Wang TT, Chang S, Hursting SD. Doza mică de genisteină induce inhibitori de kinază dependenți de ciclină și oprirea ciclului celular G (1) în celulele cancerului de prostată uman. Mol Carcinog. 2000; 29 : 92–102. doi: 10.1002 / 1098-2744 (200010) 29: 2 <92 :: AID-MC6> 3.0.CO; 2-Q. [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Davis JN, Singh B, Bhuiyan M, Sarkar FH. Reglarea în sus a p21WAF1 indusă de genisteină, reglarea în jos a ciclinei B și inducerea apoptozei în celulele canceroase de prostată. Cancerul Nutr. 1998; 32 : 123–131. doi: 10.1080 / 01635589809514730. [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Raffoul JJ, Wang Y, Kucuk O, Forman JD, Sarkar FH, Hillman GG. Genisteina inhibă activarea NF-kappaB indusă de radiații în celulele canceroase de prostată, promovând apoptoza și oprirea ciclului celular G2 / M. Cancer BMC. 2006; 6 : 107. doi: 10.1186 / 1471-2407-6-107. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Li Y, Sarkar FH. Reglarea descendentă a invaziei și a genelor legate de angiogeneză identificate prin analiza microarray cDNA a celulelor canceroase de prostată PC3 tratate cu genisteină. Cancer Lett. 2002; 186 : 157–164. doi: 10.1016 / S0304-3835 (02) 00349-X. [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Guo Y, Wang S, Hoot DR, Clinton SK. Suprimarea interacțiunilor autocrine și paracrine mediate de VEGF între celulele cancerului de prostată și celulele endoteliale vasculare de către izoflavonele din soia. J Nutr Biochem. 2007; 18 : 408–417. doi: 10.1016 / j.jnutbio.2006.08.006. [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Li Y, Che M, Bhagat S, Ellis KL, Kucuk O, Doerge DR, Abrams J, Cher ML, Sarkar FH. Reglarea expresiei genelor și inhibarea metastazei osoase experimentale a cancerului de prostată de către genisteina dietetică. Neoplazie. 2004; 6 : 354–363. doi: 10.1593 / neo.03478. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zhang LL, Li L, Wu DP, Fan JH, Li X, Wu KJ, Wang XY, He DL. Un nou efect anticanceros al genisteinei: inversarea tranziției mezenchimale epiteliale în celulele canceroase de prostată. Acta Pharmacol Sin. 2008; 29 : 1060–1068. doi: 10.1111 / j.1745-7254.2008.00831.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Kumi-Diaka JK, Hassanhi M, Merchant K, Horman V. Influența genisteinei izoflavonei pe expresia matricei metaloproteinazei-2 în celulele cancerului de prostată. J Med Food. 2006; 9 : 491–497. doi: 10.1089 / jmf.2006.9.491. [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Kazi A, Daniel KG, Smith DM, Kumar NB, Dou QP. Inhibarea activității proteazomului, un mecanism nou asociat cu capacitatea genisteinei de inducere a apoptozei celulare tumorale. Biochem Pharmacol. 2003; 66 : 965–976. doi: 10.1016 / S0006-2952 (03) 00414-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]35. Kumi-Diaka J, Sanderson NA, Sala A. Rolul mediator al proteazei caspase-3 în mecanismul intracelular al apoptozei induse de genisteină în liniile celulare de carcinom prostatic uman, DU145 și LNCaP. Biol Cell. 2000; 92 : 595-604. doi: 10.1016 / S0248-4900 (00) 01109-6. [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Lee J, Ju J, Park S, Hong SJ, Yoon S. Inhibarea semnalizării IGF-1 de către genisteină: Modularea expresiei E-cadherinei și reglarea descendentă a semnalizării β-cateninei în celulele cu cancer de prostată PC-3 hormon refractare. Cancerul Nutr. 2012; 64 : 153–162. doi: 10.1080 / 01635581.2012.630161. [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Xu L, Bergan RC. Genisteina inhibă activarea matricei metaloproteinazei tip 2 și invazia celulelor cancerului de prostată prin blocarea factorului de creștere transformant activarea mediată de beta a căii proteinei kinazei 2-27-kDa proteinei șocului termic activat prin mitogen-activat kinază 2-27-kDa. Mol Pharmacol. 2006; 70 : 869–877. doi: 10.1124 / mol.106.023861. [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Davis JN, Kucuk O, Sarkar FH. Genisteina inhibă activarea NF-kappaB în celulele canceroase de prostată. Cancerul Nutr. 1999; 35 : 167–174. doi: 10.1207 / S15327914NC352_11. [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Li Y, Sarkar FH. Inhibarea activării factorului nuclear kappaB în celulele PC3 de către genisteină este mediată prin calea de semnalizare Akt. Clin Cancer Res. 2002; 8 : 2369–2377. [ PubMed ] [ Google Scholar ]40. Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M, Fukami Y. Genistein, un inhibitor specific al protein kinazelor specifice tirozinei. J Biol Chem. 1987; 262 : 5592–5595. [ PubMed ] [ Google Scholar ]41. Park CE, Yun H, Lee EB, Min BI, Bae H, Choe W, Kang I, Kim SS, Ha J. Efectele antioxidante ale genisteinei sunt asociate cu activarea proteinei kinazei activate de AMP și inducerea PTEN în celulele canceroase de prostată . J Med Food. 2010; 13 : 815–820. doi: 10.1089 / jmf.2009.1359. [ PubMed ] [ CrossRef ] [ Google Scholar ]42. Raschke M, Rowland IR, Magee PJ, Pool-Zobel BL. Genisteina protejează celulele prostatei împotriva deteriorării ADN-ului induse de peroxidul de hidrogen și induce expresia genelor implicate în apărarea împotriva stresului oxidativ. Carcinogeneză. 2006; 27 : 2322–2330. doi: 10.1093 / carcin / bgl082. [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Swami S, Krishnan AV, Moreno J, Bhattacharyya RS, Gardner C, Brooks JD, Peehl DM, Feldman D. Inhibarea sintezei și acțiunilor prostaglandinelor de către genisteină în celulele canceroase de prostată umane și de izoflavone din soia la pacienții cu cancer de prostată. Int J Rac. 2009; 124 : 2050–2059. doi: 10.1002 / ijc.24161. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]44. Adjakly M, Bosviel R, Rabiau N, Boiteux JP, Bignon YJ, Guy L, Bernard-Gallon D. Metilarea ADN și fitoestrogeni din soia: Studiu cantitativ în liniile celulare umane de cancer de prostată DU-145 și PC-3. Epigenomica. 2011; 3 : 795–803. doi: 10.2217 / epi.11.103. [ PubMed ] [ CrossRef ] [ Google Scholar ]45. Vardi A, Bosviel R, Rabiau N, Adjakly M, Satih S, Dechelotte P, Boiteux JP, Fontana L, Bignon YJ, Guy L și colab. Fitoestrogenii din soia modifică metilarea ADN a promotorului GSTP1, RASSF1A, EPH2 și BRCA1 în celulele cancerului de prostată. În Vivo. 2010; 24 : 393–400. [ PubMed ] [ Google Scholar ]46. Fang MZ, Chen D, Sun Y, Jin Z, Christman JK, Yang C. Inversarea hipermetilării și reactivării a 16 gene INK4a , RARbeta și MGMT de către genisteină și alte izoflavone din soia. Clin Cancer Res. 2005; 11 : 7033–7041. doi: 10.1158 / 1078-0432.CCR-05-0406. [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Majid S, Dar AA, Shahryari V, Hirata H, Ahmad A, Saini S, Tanaka Y, Dahiya AV, Dahiya R. cancer de prostată. Cancer. 2010; 116 : 66–76. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Kikuno N, Shiina H, Urakami S, Kawamoto K, Hirata H, Tanaka Y, Majid S, Igawa M, Dahiya R. Acetilarea histonei mediată de genisteină și demetilarea activează genele supresoare tumorale din celulele cancerului de prostată. Int J Rac. 2008; 123 : 552-560. doi: 10.1002 / ijc.23590. [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Li Y, Kong D, Ahmad A, Bao B, Dyson G, Sarkar FH. Dereglarea epigenetică a miR-29a și miR-1256 de către izoflavonă contribuie la inhibarea creșterii și invaziei celulelor canceroase de prostată. Epigenetica. 2012; 7 : 940–949. doi: 10.4161 / epi.21236. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Rabiau N, Trraf HK, Adjakly M, Bosviel R, Guy L, Fontana L, Bignon YJ, Bernard-Gallon DJ. miARN exprimate diferențial în liniile celulare de cancer de prostată după tratamentul cu soia. În Vivo. 2011; 25 : 917–921. [ PubMed ] [ Google Scholar ]51. Chen Y, Zaman MS, Deng G, Majid S, Saini S, Liu J, Tanaka Y, Dahiya R. MicroRNAs 221/222 și reglarea mediată de genisteină a genei supresoare tumorale ARHI în cancerul de prostată. Cancer Prev Res (Phila) 2011; 4 : 76–86. doi: 10.1158 / 1940-6207.CAPR-10-0167. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]52. Chiyomaru T, Yamamura S, Fukuhara S, Hidaka H, ​​Majid S, Saini S, Arora S, Deng G, Shahryari V, Chang I și colab. Genisteina reglează în sus microRNA-574-3p supresor tumoral în cancerul de prostată. Plus unu. 2013; 8 : e58929. doi: 10.1371 / journal.pone.0058929. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]53. Hillman GG, Forman JD, Kucuk O, Yudelev M, Maughan RL, Rubio J, Layer A, Tekyi-Mensah S, Abrams J, Sarkar FH. Genisteina potențează efectul radiației asupra celulelor carcinomului de prostată. Clin Cancer Res. 2001; 7 : 382–390. [ PubMed ] [ Google Scholar ]54. Li Y, Kucuk O, Hussain M, Abrams J, Cher ML, Sarkar FH. Activitățile antitumorale și antimetastatice ale docetaxelului sunt îmbunătățite de genisteină prin reglarea osteoprotegerinei / receptorului activator al factorului nuclear-kappaB (RANK) / ligand RANK / semnalizarea MMP-9 în cancerul de prostată. Cancer Res. 2006; 66 : 4816–4825. doi: 10.1158 / 0008-5472.CAN-05-3752. [ PubMed ] [ CrossRef ] [ Google Scholar ]55. Spagnuolo C, Russo GL, Orhan IE, Habtemariam S, Daglia M, Sureda A, Nabavi SF, Devi KP, Loizzo MR, Tundis R, și colab. Genisteina și cancerul: starea actuală, provocările și direcțiile viitoare. Adv Nutr. 2015; 6 : 408–419. doi: 10.3945 / an.114.008052. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]56. Katoh M. Rețea de WNT și alte cascade de semnalizare de reglementare în celule stem pluripotente și celule stem canceroase. Curr Pharm Biotechnol. 2011; 12 : 160–170. doi: 10.2174 / 138920111794295710. [ PubMed ] [ CrossRef ] [ Google Scholar ]57. Mori R, Wang Q, Danenberg KD, Pinski JK, Danenberg PV. Atât beta-actina, cât și GAPDH sunt gene de referință utile pentru normalizarea RT-PCR cantitativă în probe de țesut uman FFPE de cancer de prostată. Prostata. 2008; 68 : 1555–1560. doi: 10.1002 / pros.20815. [ PubMed ] [ CrossRef ] [ Google Scholar ]58. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006; 38 : 500-501. doi: 10.1038 / ng0506-500. [ PubMed ] [ CrossRef ] [ Google Scholar ]59. Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci SUA. 1998; 95 : 14863–14868. doi: 10.1073 / pnas.95.25.14863. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]60. Saldanha AJ. Java Treeview – vizualizare extensibilă a datelor micro-matrice. Bioinformatică. 2004; 20 : 3246–3248. doi: 10.1093 / bioinformatics / bth349. [ PubMed ] [ CrossRef ] [ Google Scholar ]61. Barfield RT, Kilaru V, Smith AK, Conneely KN. CpGassoc: O funcție R pentru analiza datelor despre microarray de metilare a ADN-ului. Bioinformatică. 2012; 28 : 1280–1281. doi: 10.1093 / bioinformatics / bts124. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]62. Qiagen’s Ingenuity Pathway Analysishttp://www.qiagen.com/ingenuity .63. Dennis G, Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Baza de date pentru adnotare, vizualizare și descoperire integrată. Genomul Biol. 2003; 4 : 3. doi: 10.1186 / gb-2003-4-5-p3. [ PubMed ] [ CrossRef ] [ Google Scholar ]64. Wang Z, Chen H. Genisteinul crește expresia genelor prin demetilarea promotorului WNT5a în linia celulară de cancer de colon SW1116. Anticancer Res. 2010; 30 : 4537–4545. [ PubMed ] [ Google Scholar ]65. Gao BN, Gilman AG. Clonarea și exprimarea unei adenilil ciclaze distribuite pe scară largă (tip IV). Proc Natl Acad Sci SUA. 1991; 88 : 10178-10182. doi: 10.1073 / pnas.88.22.10178. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]66. Brikun I, Nusskern D, Gillen D, Lynn A, Murtagh D, Feczko J, Nelson WG, Freije D. Un panou de markeri de metilare a ADN-ului dezvăluie metilare extinsă în nucleele biopsiei prostatei histologice benigne de la pacienții cu cancer. Biomark Res. 2014; 2 : 25. doi: 10.1186 / s40364-014-0025-9. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]67. Monti E, Bonten E, D’Azzo A, Bresciani R, Venerando B, Borsani G, Schauer R, Tettamanti G. Sialidases in vertebrates: O familie de enzime adaptate pentru mai multe funcții celulare. Adv Carbohydr Chem Biochem. 2010; 64 : 403–479. doi: 10.1016 / S0065-2318 (10) 64007-3. [ PubMed ] [ CrossRef ] [ Google Scholar ]68. Uemura T, Shiozaki K, Yamaguchi K, Miyazaki S, Satomi S, Kato K, Sakuraba H, Miyagi T. Contribuția sialidazei NEU1 la suprimarea metastazelor celulelor canceroase ale colonului uman prin desialilarea integrinei beta4. Oncogene. 2009; 28 : 1218–1229. doi: 10.1038 / onc.2008.471. [ PubMed ] [ CrossRef ] [ Google Scholar ]69. Kato T, Wang Y, Yamaguchi K, Milner CM, Shineha R, Satomi S, Miyagi T. Supraexprimarea sialidazei de tip lizozomal conduce la suprimarea metastazelor asociate cu reversia fenotipului malign în celulele melanomului B16 murin. Int J Rac. 2001; 92 : 797–804. doi: 10.1002 / ijc.1268. [ PubMed ] [ CrossRef ] [ Google Scholar ]70. Chang S, He S, Qiu G, Lu J, Wang J, Liu J, Fan L, Zhao W, Che X. MicroRNA-125b promovează invazia și metastaza cancerului gastric prin vizarea STARD13 și NEU1. Tumora Biol. 2016; 37 : 12141–12151. doi: 10.1007 / s13277-016-5094-y. [ PubMed ] [ CrossRef ] [ Google Scholar ]71. Haxho F, Neufeld RJ, Szewczuk MR. Neuraminidază-1: O țintă terapeutică nouă în tumorigeneză în mai multe etape. Oncotarget. 2016; 7 : 40860–40881. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Liu L, Chen X, Wang Y, Qu Z, Lu Q, Zhao J, Yan X, Zhang H, Zhou Y. Notch3 este important pentru tranziția epitelial-mezenchimală indusă de TGF-β în osul cancerului pulmonar cu celule mici. metastază prin reglarea ZEB-1. Cancer Gene Ther. 2014; 21 : 364–372. doi: 10.1038 / cgt.2014.39. [ PubMed ] [ CrossRef ] [ Google Scholar ]73. Danza G, Di Serio C, Ambrosio MR, Sturli N, Lonetto G, Rosati F, Rocca BJ, Ventimiglia G, del Vecchio MT, Prudovsky I, și colab. Notch3 este activat de hipoxia cronică și contribuie la progresia cancerului de prostată uman. Int J Rac. 2013; 133 : 2577–2586. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Terada N, Shiraishi T, Zeng Y, Aw-Yong KM, Mooney SM, Liu Z, Takahashi S, Luo J, Lupold SE, Kulkarni P, și colab. Corelarea Sprouty1 și Jagged1 cu celule agresive de cancer de prostată cu diferite sensibilități la privarea de androgen. J Cell Biochem. 2014; 115 : 1505-1515. doi: 10.1002 / jcb.24805. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]75. Pedrosa AR, Graça JL, Carvalho S, Peleteiro MC, Duarte A, Trindade A. Dinamica semnalizării crestăturii în prostata adultă sănătoasă și în dezvoltarea tumorilor de prostată. Prostata. 2016; 76 : 80–96. doi: 10.1002 / pros.23102. [ PubMed ] [ CrossRef ] [ Google Scholar ]76. Pedrosa AR, Trindade A, Carvalho C, Graça J, Carvalho S, Peleteiro MC, Adams RH, Duarte A. Endotelial Jagged1 promovează creșterea tumorilor solide atât prin funcții pro-angiogenice, cât și prin funcții angiocrine. Oncotarget. 2015; 6 : 24404–24423. doi: 10.18632 / oncotarget.4380. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]77. Danza G, Di Serio C, Rosati F, Lonetto G, Sturli N, Kacer D, Pennella A, Ventimiglia G, Barucci R, Piscazzi A, și colab. Semnalizarea prin crestături modulează diferențierea neuroendocrină indusă de hipoxie a celulelor cancerului de prostată uman. Mol Cancer Res. 2012; 10 : 230–238. doi: 10.1158 / 1541-7786.MCR-11-0296. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]78. Rampias T, Vgenopoulou P, Avgeris M, Polyzos A, Stravodimos K, Valavanis C, Scorilas A, Klinakis A. Un nou rol de supresor tumoral pentru calea Notch în cancerul de vezică urinară. Nat Med. 2014; 20 : 1199–1205. doi: 10.1038 / nm.3678. [ PubMed ] [ CrossRef ] [ Google Scholar ]79. Hernandez Tejada FN, Galvez Silva JR, Zweidler-McKay PA. Provocarea vizării crestăturii în tumorile maligne hematologice. Front Pediatr. 2014; 2 : 54. doi: 10.3389 / fped.2014.00054. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]80. Giachino C, Boulay JL, Ivanek R, Alvarado A, Tostado C, Lugert S, Tchorz J, Coban M, Mariani L, Bettler B, și colab. O funcție de supresie tumorală pentru semnalizarea Notch în subtipurile tumorale din creier anterior. Celula cancerului. 2015; 28 : 730–742. doi: 10.1016 / j.ccell.2015.10.008. [ PubMed ] [ CrossRef ] [ Google Scholar ]81. Jaskula-Sztul R, Eide J, Tesfazghi S, Dammalapati A, Harrison AD, Yu XM, Scheinebeck C, Winston-McPherson G, Kupcho KR, Robers MB și colab. Rolul supresorului tumorii al Notch3 în carcinomul tiroidian medular, dezvăluit prin inducție genetică și farmacologică. Mol Cancer Ther. 2015; 14 : 499–512. doi: 10.1158 / 1535-7163.MCT-14-0073. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]82. Sriuranpong V, Borges MW, Ravi RK, Arnold DR, Nelkin BD, Baylin SB, Ball DW. Semnalizarea prin crestături induce oprirea ciclului celular în celulele cu cancer pulmonar cu celule mici. Cancer Res. 2001; 61 : 3200–3205. [ PubMed ] [ Google Scholar ]83. Liu YL, Zhang GQ, Yang Y, Zhang CY, Fu RX, Yang YM. Genisteina induce arestarea G2 / M în celulele canceroase gastrice prin creșterea expresiei PTEN supresoare tumorale. Cancerul Nutr. 2013; 65 : 1034–1041. doi: 10.1080 / 01635581.2013.810290. [ PubMed ] [ CrossRef ] [ Google Scholar ]84. Su SJ, Yeh TM, Chuang WJ, Ho CL, Chang KL, Cheng HL, Liu HS, Cheng HL, Hsu PY, Chow NH. Romanul vizează anti-angiogeneza genisteinei pe celulele canceroase umane. Biochem Pharmacol. 2005; 69 : 307-318. doi: 10.1016 / j.bcp.2004.09.025. [ PubMed ] [ CrossRef ] [ Google Scholar ]85. Jagadeesh S, Kyo S, Banerjee PP. Genisteina reprimă activitatea telomerazei prin intermediul mecanismelor transcripționale și posttranslaționale în celulele canceroase de prostată umane. Cancer Res. 2006; 66 : 2107-2115. doi: 10.1158 / 0008-5472.CAN-05-2494. [ PubMed ] [ CrossRef ] [ Google Scholar ]86. Mahmoud AM, Al-Alem U, Ali MM, Bosland MC. Genisteina crește expresia beta a receptorilor de estrogen în cancerul de prostată prin reducerea metilării sale promotor. J Steroid Biochem Mol Biol. 2015; 152 : 62-75. doi: 10.1016 / j.jsbmb.2015.04.018. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]87. Whirledge S, Senbanjo LT, Cidlowski JA. Genisteina perturbă semnalizarea receptorilor glucocorticoizi în celulele Ishikawa endometriale uterine umane. Perspectiva sănătății Environ. 2015; 123 : 80-87. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]88. Bhamre S, Sahoo D, Tibshirani R, Dill DL, Brooks JD. Modificări ale expresiei genetice induse de genisteină în linia celulară de cancer de prostată LNCaP. Open Prostate Cancer J. 2010; 3 : 86–98. doi: 10.2174 / 1876822901003010086. [ CrossRef ] [ Google Scholar ]89. Ghaemi A, Soleimanjahi H, Razeghi S, Gorji A, Tabaraei A, Moradi A, Alizadeh A, Vakili MA. Genisteina induce un efect imunomodulator de protecție la un model de șoarece de cancer de col uterin. Iran J Immunol. 2012; 9 : 119–127. [ PubMed ] [ Google Scholar ]90. Korde LA, Wu AH, Fears T, Nomura AM, West DW, Kolonel LN, Pike MC, Hoover RN, Ziegler RG. Consumul de soia în copilărie și riscul de cancer mamar la femeile asiatice americane Biomarkeri de epidemiol pentru cancer Prev. 2009; 18 : 1050–1059. doi: 10.1158 / 1055-9965.EPI-08-0405. [ PubMed ] [ CrossRef ] [ Google Scholar ]91. Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W. Consumul de alimente din soia pentru adolescenți și adulți și riscul de cancer mamar: Rezultate din Studiul de sănătate al femeilor din Shanghai . Sunt J Clin Nutr. 2009; 89 : 1920–1926. doi: 10.3945 / ajcn.2008.27361. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Oncologie sunt furnizate aici prin amabilitatea Spandidos Publications

Honokiol intravenos în cancerul rezistent la medicamente: două rapoarte de caz

Context: Supraviețuirea pe termen lung a pacientului în cancer este afectată de rezistența la medicamente. Honokiol (HNK) este un polifenol cu ​​molecule mici izolat din coaja de coajă și semințe de Magnolia officinalis. S-a demonstrat că HNK sporește efectele chimioterapiei și inhibă rezistența la medicamente în modelele preclinice. HNK a fost bine tolerat în mai multe modele animale atunci când a fost administrat oral, intravenos (IV) și pe cale intraperitoneală. Cu toate acestea, există date umane limitate cu privire la utilizarea HNK în general și în mod specific prin IV (HNK-IV) în cancer.

Obiectiv: Ne propunem să evaluăm eficacitatea, siguranța și tolerabilitatea HNK-IV la pacienții cu tumori rezistente la medicamente.

Metode: Acesta este un studiu de caz a 2 pacienți cu cancer care au utilizat HNK-IV ca parte a regimului lor de tratament pentru cancer. Perfuzia inițială de HNK a fost de 10 mg / kg greutate corporală, iar tratamentele ulterioare au fost crescute până la 50 mg / kg în funcție de toleranța individuală, timp de 2 săptămâni.

Rezultate: Răspunsul clinic pozitiv a fost obținut la ambii pacienți, inclusiv simptome îmbunătățite și calitatea vieții. Nu au apărut efecte secundare adverse grave și nu au existat efecte adverse asupra parametrilor de laborator (hemoleucogramă completă, rinichi și funcție hepatică). S-au observat sedare tranzitorie și greață minoră și s-au rezolvat după infuzie.

Concluzii: Acesta este primul raport al HNK-IV la pacienții umani. Având în vedere rezultatele clinice pozitive, siguranța și tolerabilitatea, utilizarea HNK-IV justifică investigații suplimentare cu privire la formularea optimă și utilizarea acesteia ca terapie adjuvantă la pacienții cu cancer.

Introducere

Răspândirea metastatică a tumorilor solide este responsabilă direct sau indirect pentru majoritatea deceselor cauzate de cancer.1 Deși multe tumori sunt tratabile dacă sunt detectate timpuriu, rezistența la medicamente și recurența tumorii sunt obstacole comune pentru supraviețuirea pacientului pe termen lung. Potrivit Societății Americane a Cancerului (ACS), rata de supraviețuire relativă la 5 ani a cancerului de prostată metastatic este de 30%. , perspectiva unui individ depinde de mulți factori, inclusiv stadiul cancerului și gradul tumorii.4 Terapiile combinate, inclusiv agenții naturali care ar putea servi drept adjuvanți la tratamentele convenționale, pot juca un rol esențial în tratamentul cancerului. ; 3 ′, 5-di- (2-propenil) -1,1′-bifenil-2,2′-diol) este un polifenol bioactiv izolat din coaja de coajă și semințe de Magnolia spp, o plantă cu o lungă istorie de utilizare în medicina tradițională asiatică. Un număr mare de cercetări preclinice indică faptul că HNK modulează numeroase căi de semnalizare intracelulară implicate în cancer,inclusiv factorul nuclear-κB (NF-κB), traductoarele de semnal și activatorul transcripției 3 (STAT3), receptorul factorului de creștere epidermică (EGFR) și ținta de rapamină-mam (mTOR). De asemenea, s-a demonstrat că HNK blochează semnalizarea în tumorile cu funcție p53 defectă. .5-13 De exemplu, HNK este benefic cu etopozid la inducerea apoptozei în celulele cancerului de sân uman7; cisplatină in vivo în modele de xenogrefe de cancer ovarian și de colon8,9; docetaxel în celulele canceroase de prostată10; doxorubicina în celulele sarcomului uterin rezistente la doxorubicină11; și paclitaxel într-un model cancer uman rezistent la medicamente

Inhibarea NF-κB poate fi mecanismul dominant responsabil de aceste efecte.Honokiol a fost bine tolerat în mai multe modele animale atunci când a fost administrat oral, 14 intravenos (IV), 15 și pe cale intraperitoneală.8 Acest raport are ca scop evaluarea siguranței, tolerabilității. , și eficacitatea HNK-IV la 2 pacienți can-cer rezistenți la medicamente, după cum se determină prin observație clinică.

Pacienți și metode

Populație Acest raport de studiu de caz include 2 pacienți oncologici care sunt tratați adjuvant la clinica medicală și centrul de vindecare Amitabha (Amitabha Medical Clinic, Santa) Rosa, CA) de către medicul curant, Dr. Isaac Eliaz. Pacienții au avut cancer documentat, nu s-au cunoscut alergii la HNK, toleranță la o doză de testare orală și toleranță la alte tratamente intravenoase anterioare. Pacienții au semnat consimțământul informat în scris pentru tratamentul experimental cu HNK-IV și s-a obținut consimțământul pacientului sau reprezentantului pentru publicarea studiilor de caz. . 98% HNK a fost testat pentru puritate (ChromaDex, Irvine, CA). Formularea HNK-IV a inclus> 98% HNK la 50 mg / mL, alcool etilic (Letco Medical, Inc, Decatur, AL) la 100 mg / mL și polisorbat 80 (Letco Medical, Inc) la 80 mg / mL, în apă sterilă (sin-gle-utilizați flacon de 50 ml). Preparatul HNK-IV a fost amestecat în 250 ml soluție de dextroză 5% imediat înainte de administrarea IV. pacienții au primit o doză inițială de 500 până la 750 mg HNK egală cu 10 mg / kg greutate corporală, administrată intravenos timp de 45 până la 60 de minute cu monitorizare strânsă. După administrarea cu succes, doza a fost crescută individual pe o perioadă de 1-2 săptămâni, până la o doză maximă de 50 mg / kg

Siguranța, tolerabilitatea și eficacitatea

Siguranța a fost evaluată cu monitorizarea continuă a hemoleucogramelor complete și a panourilor metabolice complete. Răspunsul a fost evaluat prin evaluare clinică, teste labora-torioare care au inclus markeri tumorali serici, precum și imagistică periodică efectuată la intervale determinate de medicul oncolog tratant (care nu a administrat HNK-IV). Tolerabilitatea a fost evaluată prin evaluarea clinică continuă de către medicul curant și personalul care alăptează. Evaluarea a inclus efecte legate de tratament raportate în timpul și după tratament, între tratamente, precum și modificări ale morbidității și funcționalității.

Rezultate

Caz 1A bărbat în vârstă de 69 de ani diagnosticat în 2004 cu cancer de prostată, cu 1 an înainte de a fi văzut la Amitabha Medical Clinica. La momentul diagnosticului, pacientul avea un antigen specific prostatei (PSA) de 62,8 ng / ml; Scorul Gleason de 3 + 3; T4, tumoră N1 cu invazie perineurală; și limfade pelvine-nopatie extinse pe rezonanță magnetică. Pacientul a ales să nu urmeze terapii convenționale, adoptând în schimb o dietă macrobiotică. Această abordare a dus la o scădere a PSA la 38,5 ng / ml, urmată de o ascensiune lentă cu un zenit PSA la 3 ani postdiagnostic de 122 ng / ml, însoțită de metastaze osoase pelvine. În acest moment, în august 2005, a prezentat doctorului Isaac Eliaz la clinica medicală Amitabha. În plus față de terapiile integrative în curs de desfășurare la clinica medicală Amitabha, pacientul a început tratamentul cu deprivare de androgeni utilizând bicalutamidă urmat de leuprolidă, cu un răspuns bun și PSA ulterior scăzând la 0,2 ng / ml. În timp, pacientul a dezvoltat o boală rezistentă la castrat , iar metastazele scheletice au continuat să progreseze. În vara anului 2013, a început tratamentul de chimioterapie la Oncology Compassionate din Los Angeles. Sub îngrijirea lor, pacientul a primit docetaxel, carboplatină și estramustină, urmat de diferite terapii prescrise la Oncologie Compasivă. După cursul tratamentelor, pacientul a prezentat metastaze osoase stabile pe scanări cu PSA la 6,0 ng / ml. La acel moment, pacientul și-a continuat protocolul de terapie privativă de androgen care include o combinație de leuprolidă, enzalutamidă, met-formină cu eliberare prelungită și celecoxib. Pacientul a prezentat o criză în noiembrie 2014 și a fost diagnosticat cu astrocitom de gradul II, care nu sunt supuse rezecției. Pacientul a refuzat intervențiile chirurgicale și chimioterapeutice pentru astrocitomul său, precum și medicamentele antiseizive. Avea convulsii parțiale complexe în curs de desfășurare, cu simptome de grimasă din cauza gustului și mirosului urât. În 2015, PSA a început să urce de la un minim de 2,1 ng / mL în iulie 2014 la 10,99 ng / mL în martie 2015, la 16,45 ng / mL în iunie 2015 și la un maxim de 147,9 ng / mL în Noiembrie 2015. S-a observat o deteriorare clinică semnificativă cu dureri osoase crescute, slăbiciune și dificultăți de motilitate și mers. Pacientul a luat încă leu-prolid în tot acest timp și a continuat să o ia până cu puțin înainte de moartea sa. Starea sa a continuat să se deterioreze până în ianuarie 2016. În acel moment, pacientul era legat de casă și aproape legat de pat. După o vizită la domiciliu a doctorului Eliaz, terapia cu HNK-IV a început. Inițierea HNK-IV a avut loc pe 19 ianuarie 2016. O doză inițială de 10 mg / kg a fost crescută în decurs de 2 săptămâni până la 30 mg / kg, de 3 ori pe săptămână în mod continuu, când HNK-IV era disponibil. Pacientul a avut îmbunătățiri clinice, cu o reducere a durerii, mobilitate îmbunătățită, energie și pofta de mâncare și încetarea crizelor olfactive parțiale. Urmărirea PSA în februarie 2016 a scăzut la 68,5 ng / ml, arătând stabilizarea până în august 2016 la 79,5 ng / ml. Pacientul a oprit HNK-IV în vara anului 2016 din cauza lipsei de aprovizionare, având ca rezultat agravarea crizelor olfactive parțiale și a altor simptome. În cele din urmă, PSA a crescut progresiv la un nivel maxim de 184 ng / ml în ianuarie 2017. În acest moment, HNK-IV a fost repornit la o doză de 30 mg / kg, de 3 ori pe săptămână. PSA a scăzut la 66,8 ng / ml în iulie 2017, însoțit de îmbunătățirea simptomelor. Pacientul a putut să-și părăsească casa și să facă scurte plimbări. Datorită dificultăților în obținerea HNK-IV, doza a fost redusă la un singur IV pe săptămână începând din august 2017 și întreruptă în decembrie 2017 din cauza lipsei de disponibilitate. Răspunsul la tratament la HNK-IV a inclus un control eficient al simptome de convulsii, dureri osoase reduse și îmbunătățirea calității vieții timp de 22 de luni. HNK-IV a fost bine tolerat fără simptome adverse în timpul sau după tratamente. Pacientul s-a putut odihni confortabil în timpul perfuziilor, cu îmbunătățirea controlului durerii. Aceste beneficii au durat în perioadele intermediare dintre tratamente. După întreruperea terapiei cu HNK-IV, pacientul a continuat să se deterioreze și a decedat în aprilie 2018.

Femeia de caz 2A, în vârstă de 59 de ani, diagnosticată cu infiltrare ductală IIA (nodul T1a negativ, grad 3/3) carcinom de sân în mai 2013. Pacienta a primit che-motherapy la un birou local de oncologie în timp ce primea îngrijiri integrate de către dr. Eliaz la clinica medicală Amitabha, unde încă primește îngrijiri integrate. Între momentul diagnosticului și începerea terapiei neoadjuvante cu 10 săptămâni mai târziu, dimensiunea tumorii evaluate prin ultrasunete a arătat o creștere a dimensiunilor leziunii, de la 16 × 19 × 14 mm la 23 × 18 × 23 mm. Diapozitivele patologice ale pacientului au fost trimise pentru testarea inteligenței moleculare Caris (Caris Life Sciences, Irving, TX). Pacientul a primit chimioterapie neoadjuvantă la un centru local de oncologie din Santa Rosa, California. Ea a finalizat 4 cicluri de 5-fluo-rouracil / epirubicină / citoxan (FEC) cu răspuns parțial și tumoră reziduală prezentă atât în ​​examinarea fizică, cât și în imagistică. După FEC, pacientul a început tratamentul cu docetaxel. După 1 rundă, au existat dovezi clare ale progresului bolii la examenul fizic. Imagistică prin rezonanță magnetică a dezvăluit o masă bine circumscrisă (4,1 × 3,8 × 3,4 cm) care a crescut în dimensiune de la scanările inițiale înainte de începerea chimioterapiei neoadjuvante. Datele de laborator au relevat antigenul cancerului (CA) 15-3 niveluri de 28,6 U / mL, comparativ cu 7,6 U / mL la începutul che-motherapy, ambele în intervalul normal (0,0-35,0 interval de referință). În acel moment, datorită progresului sub docetaxel și a rezultatelor Caris Molecular Intelligence care au arătat sensibilitate la carboplatină și gemcitabină, chimioterapia neoadjuvantă a pacientului a fost schimbată prin tratarea oncologului său cu carboplatină și gemcitabină timp de 4 cicluri. La sfârșitul celui de-al treilea ciclu și înainte de administrarea celui de-al patrulea și ultimul ciclu, tumora era încă palpabilă clinic și estimată la 2 până la 3 cm, indicând doar un răspuns parțial. HNK-IV a fost inițiat cu cel de-al patrulea ciclu de chimioterapie, la o doză inițială de 10 mg / kg, crescută la 40 mg / kg 5 zile mai târziu și a continuat cu aceeași doză de 40 mg / kg, de 3 ori pe săptămână, timp de total de 7 tratamente pe parcursul a 3 săptămâni (tratamentul 1 în săptămâna 1, tratamentele 2, 3 și 4 în săptămâna 2 și tratamentele 5, 6 și 7 în săptămâna 3). În timpul tratamentului cu HNK-IV, tumoarea a devenit nepalpabilă, iar nivelurile CA 15-3 au scăzut la 14,5 U / mL. Chimioterapia parțială mastecomatică efectuată post neoadjuvant a relevat o tumoră reziduală de 0,3 cm, cu 2 ganglioni limfatici sentinela negativi. A fost administrată radioterapia postchirurgicală. Tomografia post-tratament cu emisie de pozitroni / tomografia computerizată (PET / CT) nu a evidențiat nici o activitate hipermetabolică sau indicații de boală neoplazică activă. Pacientul nu a mai avut recurență și continuă să fie lipsit de boli la 5 ani după finalizarea tratamentelor.

Efecte adverse

HNK-IV a fost bine tolerat în ambele cazuri, fără efecte adverse grave. Cel mai frecvent raportat efect secundar a fost sedarea tranzitorie, care a rezolvat tratamentul. Alte reacții adverse raportate au fost tuse uscată, dureri lombare temporare, amețeli ușoare și parestezii; toate efectele adverse s-au rezolvat rapid cu reducerea ratei în timpul administrării sau post-tratament. Greața a fost raportată rar și rezolvată în câteva ore. Niciunul dintre pacienți nu a întrerupt terapia din cauza impactului advers. Valorile hematologice au rămas stabile, fără evenimente adverse legate de tratament. Discuție Din câte știm, clinica medicală și centrul de vindecare Amitabha este primul și în prezent singurul centru medical care a oferit tratament HNK-IV. Acest raport al primei utilizări clinice a HNK-IV oferă dovezi ale unui posibil beneficiu la pacienții cu cancer. Cele 2 cazuri prezentate aici sugerează că HNK-IV prezintă activități antitumorale independente și poate spori eficacitatea tratamentelor standard, în concordanță cu rapoartele anterioare.5-12 HNK influențează un număr mare de căile de semnalizare care promovează apoptoza și inhibă angiogeneza, care ar putea explica capacitatea sa de a afecta mai multe tipuri de cancer.5,6 HNK-IV a fost sigur și bine tolerat și nu pare să interfereze cu alte terapii. odată cu introducerea HNK-IV, cu o reducere a durerii, mobilitate îmbunătățită, energie și apetit și încetarea crizelor olfactive parțiale. După oprirea HNK-IV timp de 6 luni, PSA-ul său a crescut de la 79,5 ng / ml în august 2016 la 184 ng / ml în ianuarie 2017. Odată ce tratamentul HNK-IV a fost recomandat, PSA a scăzut la 66,8 ng / ml în Iulie 2017, însoțită de îmbunătățirea simptomelor și a calității vieții. În cazul 2, terapia neoadjuvantă FEC a avut un răspuns parțial prin observare clinică. Tratamentul cu docetaxel a eșuat apoi pacientul, care a arătat o progresie a dimensiunii tumorii și o creștere a nivelurilor de CA 15-3 (dar încă în intervalul normal). După eșecul docetaxelului, pacientul a fost trecut la un regim de carboplatină-gemcitabină și a finalizat 4 cicluri din acest regim. Înainte de cel de-al patrulea ciclu, tumora era încă palpabilă și se estimează că avea o dimensiune de 2 până la 3 cm, pe baza examenului fizic. HNK-IV a fost inițiat cu cel de-al patrulea ciclu de tratament cu carboplatină-gemcitabină și a continuat pe tot parcursul celui de-al patrulea ciclu. Tumora a devenit nepalpabilă în timpul celui de-al patrulea ciclu, iar nivelurile CA 15-3 au scăzut. Micșorarea tumorii ar fi putut fi cauzată doar de tratamentul cu carbopla-staniu-gemcitabină, HNK-IV singur, combinația celor două, un răspuns antiinflamator inițiat de HNK-IV sau un potențial efect placebo. În timp ce pacientul este în viață și fără cancer timp de peste 5 ani după tratament, astfel de rezultate nu sunt neașteptate. 7 sarcoame, 11 și cancer de sân.12 Observațiile actuale la om pot fi în concordanță cu aceste studii preclinice. Cazul 1 a avut cancer de prostată care a prezentat rezistență la terapia hormonală. S-ar putea să fi existat, de asemenea, rezistență la docetaxel în cazul 2. HNK-IV a prezentat posibile beneficii anticanceroase la acești pacienți. Beneficii suplimentare în controlul simptomelor au fost observate în special pentru cazul 1, care a primit HNK-IV pe o perioadă îndelungată, cu reducerea eficientă a activității convulsive, precum și controlul durerii pentru metastazele osoase. După cum sa menționat anterior, se cunoaște că HNK traversează bariera hematoencefalică15 și se dovedește a avea beneficii în astrocitoame / glioblastoame.16 Acest lucru poate justifica o investigație clinică suplimentară pentru utilizarea potențială adjuvantă în tratamentul glioblastoamelor. necesitatea întreruperii tratamentului. HNK-IV a fost bine tolerat, ceea ce a permis o dozare mai mare în comparație cu administrarea orală. Acest studiu de caz este primul raport al utilizării adjuvante a HNK-IV la omul cu tumori solide. Cazurile individuale ale celor 2 pacienți au demonstrat că HNK-IV poate prezenta activitate anticancerigenă sau poate funcționa aditiv sau sinergic cu alte medicamente în tumorile rezistente la medicamente / rezistente la hormoni. Constatările preliminare sugerează că utilizarea HNK-IV ca terapie adjuvantă ar putea fi sigură și benefică. Este necesară o investigație suplimentară cu privire la formula optimă a HNK-IV și utilizarea acestuia ca terapie adjuvantă la pacienții cu cancer.

Mulțumiri Autorii ar dori să mulțumească și să recunoască sprijinul scris al manuscriselor de către Barry Wilk, John Trepanowski și Ruby Tischoff.

Interese Autorii nu au declarat potențiale conflicte de interese în ceea ce privește cercetarea, autorul și / sau publicarea acestui articol

https://www.researchgate.net/publication/341825305_Intravenous_Honokiol_in_Drug-Resistant_Cancer_Two_Case_Reports

Aportul de legume și fructe după diagnostic și riscul de progresie a cancerului de prostată

Erin L. Richman , ScD, 1, 2, 3 Peter R. Carroll , MD, 3, 4 și June M. Chan , ScD 3, 4, 5

Informații despre autor

 Informații despre drepturi de autor și licență Renunțare

Ultima versiune editată a editorului a acestui articol este disponibilă gratuit la Int J Cancer

Abstract

Legumele crucifere, sosul de roșii și leguminoasele au fost asociate cu riscul redus de apariție a cancerului de prostată avansat In vitro iar studiile la animale sugerează că aceste alimente pot inhiba evoluția cancerului de prostată, dar există date limitate la bărbați. Prin urmare, am examinat prospectiv dacă aportul de legume totale și în special legume crucifere, sos de roșii și leguminoase, după diagnostic, reduce riscul de progresie a cancerului de prostată în rândul a 1.560 de bărbați diagnosticați cu cancer de prostată non-metastatic și care participă la Strategic Urologic Cercetare Endeavour pt Cancerul prostatei , un registru al cancerului de prostată din Statele Unite. Ca analiză secundară, am examinat și alte subgrupuri de legume, fructe totale și subgrupuri de fructe. Participanții au fost diagnosticați în primul rând la clinici din comunitate și au urmat din 2004-2009. Am evaluat aportul de legume și fructe printr-un chestionar semicantitativ privind frecvența alimentelor,și a constatat rezultatele cancerului de prostată prin raportul urologului și dosarele medicale. Am observat 134 de evenimente de progresie (53 de recidive biochimice, 71 de tratamente secundare, probabil ca urmare a recurenței, șase metastaze osoase, patru decese de cancer de prostată) în timpul a 3.171 de persoane. Bărbații din a patra quartilă a aportului de legume crucifere post-diagnostice au prezentat un risc semnificativ statistic de 59% de risc de progresie a cancerului de prostată comparativ cu bărbații din cea mai mică quartilă (raport de risc (HR): 0,41; interval de încredere 95% (IC): 0,22, 0,76; tendința p: 0,003). Niciun alt grup de legume sau fructe nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată. În concluzie, aportul de legume crucifere după diagnostic poate reduce riscul de progresie a cancerului de prostată.Am observat 134 de evenimente de progresie (53 de recurențe biochimice, 71 de tratamente secundare probabil datorate recurenței, șase metastaze osoase, patru decese prin cancer de prostată) în timpul a 3.171 persoane-ani. Bărbații din al patrulea cvartal din aportul de legume crucifere post-diagnostice au avut un risc semnificativ statistic de 59% diminuat de progresie a cancerului de prostată în comparație cu bărbații din cel mai mic cuartil (raport de risc (HR): 0,41; 95% interval de încredere (CI): 0,22, 0,76; tendința p: 0,003). Niciun alt grup de legume sau fructe nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată. În concluzie, aportul de legume crucifere după diagnostic poate reduce riscul de progresie a cancerului de prostată.Am observat 134 de evenimente de progresie (53 de recidive biochimice, 71 de tratamente secundare, probabil ca urmare a recurenței, șase metastaze osoase, patru decese de cancer de prostată) în timpul a 3.171 de persoane. Bărbații din al patrulea cvartal din aportul de legume crucifere post-diagnostice au avut un risc semnificativ statistic de 59% diminuat de progresie a cancerului de prostată în comparație cu bărbații din cel mai mic cuartil (raport de risc (HR): 0,41; 95% interval de încredere (CI): 0,22, 0,76; tendința p: 0,003). Niciun alt grup de legume sau fructe nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată. În concluzie, aportul de legume crucifere după diagnostic poate reduce riscul de progresie a cancerului de prostată.Bărbații din cea de-a patra quartilă a aportului de legume crucifere post-diagnostice au avut un risc semnificativ statistic de 59% de risc scăzut de progresie a cancerului de prostată comparativ cu bărbații din cea mai mică quartilă (raport de risc (HR): 0,41; interval de încredere 95% (IC): 0,22, 0,76; p-trend: 0,003). Niciun alt grup de legume sau fructe nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată. În concluzie, aportul de legume crucifere după diagnostic poate reduce riscul de progresie a cancerului de prostată.Bărbații din cea de-a patra quartilă a aportului de legume crucifere post-diagnostice au avut un risc semnificativ statistic de 59% scăzut al progresiei cancerului de prostată comparativ cu bărbații din cea mai mică quartilă (raport de risc (HR): 0,41; interval de încredere 95% (IC): 0,22, 0,76; p-trend: 0,003). Niciun alt grup de legume sau fructe nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată.

INTRODUCERE

Peste 2,2 milioane de bărbați trăiesc în prezent cu cancer de prostată în Statele Unite (SUA). 1 Legumele crucifere, sosul de roșii și leguminoasele au fost legate de un risc mai scăzut de cancer de prostată incident și, în unele cazuri, de un risc redus de boală avansată sau agresivă la diagnostic. 2 – 6 Cu toate acestea, există date limitate despre efectele chimioterapeutice ale dietei după diagnosticul cancerului de prostată. Printre 1.202 de bărbați cu cancer de prostată nemetastatic în Studiul de urmărire a profesioniștilor din domeniul sănătății (HPFS), aportul post-diagnostic de sos de roșii și pește au fost asociate cu riscul redus de progresie a cancerului de prostată. 7 În cancerul prostatei Cercetare strategică de cercetare urologică (CaPSURE ™)), aporturile de păsări de curte cu piele și ouă după diagnostic au fost asociate cu un risc crescut de progresie a cancerului de prostată. 8 saturate aportul de grăsimi a fost , de asemenea , raportate pentru a creste riscul de progresie a cancerului de prostata, 9 , 10 si mici studii clinice efectuate la barbatii cu cancer de prostata si examinarea rezultatelor biomarker susțin un rol de dieta in progresia cancerului de prostata. 11 – pe 14

Astfel, am examinat prospectiv aportul post-diagnostic de legume și fructe în raport cu riscul de progresie a cancerului de prostată în rândul bărbaților cu cancer de prostată nemetastatic la diagnostic. Am emis ipoteza că totalul legumelor, în special legumele crucifere, sosul de roșii și leguminoasele, ar fi invers asociat cu riscul de progresie a cancerului de prostată.Mergi la:

MATERIAL SI METODE

Populația de studiu

CaPSURE este un studiu de registru al cancerului de prostată din SUA inițiat în 1995. 15 , 16 patruzeci de site-uri (34 de clinici comunitare, trei instituții academice, trei spitale ale Administrației Veteranilor) au înscris bărbați cu cancer de prostată verificat cu biopsie. Participanții la CAPSURE completează sondaje la momentul inițial și la fiecare 6 luni. ulterior, iar urologii furnizează date clinice la momentul inițial și la vizitele clinice ulterioare. Populația de bază pentru acest studiu a inclus 2.134 de participanți la CaPSURE care au completat un chestionar semicantitativ privind frecvența alimentelor (FFQ) în perioada 2004-2005. Consiliile de evaluare instituțională ale Universității din California, San Francisco și instituțiile colaboratoare au aprobat acest studiu.

Evaluare dietetică

Grupurile de legume și fructe sunt interesate pentru această analiză tabelul 1. Bărbații au fost întrebați cât de des au consumat în medie o anumită porție de 127 de alimente și băuturi în ultimul an, cu nouă opțiuni de frecvență variind de la <1 / lună. până la ≥6 / zi. De asemenea, am întrebat participanții dacă au mâncat mai mult, mai puțin sau aceeași cantitate din fiecare produs comparativ cu înainte de diagnosticul lor. FFQ-ul nostru s-a bazat pe un FFQ care a fost utilizat pentru a studia dieta și relațiile de boli cronice într-o varietate de populații. 17 , 18 Într-un studiu de validare, corelația mediană între două înregistrări dietetice de 1 săptămână și FFQ original pentru articolele din legume și fructe a fost de 0,58 (interval: 0,19 pentru usturoi până la 0,95 pentru banane). 19

tabelul 1

Grupuri de legume și fructe de interes.

Grupuri de legume
Morcovi / ignamiMorcovi crudi, morcovi fierți, ignami / cartofi dulci
Legume crucifereBrocoli; varză / coleslaw; Varză de Bruxelles; conopidă; verdeață de kale / muștar / chard
Legume cu frunze verziSpanac gătit; spanac crud; aisberg sau salată de cap; romaine / salată cu frunze; țelină
leguminoaseleTofu / soia; fasole verde; mazăre / fasole lima; fasole / linte
Suc de fructeDovlecei galbeni / de iarnă, vinete / dovlecel
Roșii (proaspete)Roșii, suc de roșii
Sos de rosiiSos de roșii, pizza
Total legumeToate cele de mai sus, plus sos de chili roșu, legume amestecate, sfeclă, varză de lucerna și usturoi
Grupuri de fructe
Mere / pereMere sau pere proaspete, suc de mere sau cidru
Fructe de padureCăpșuni, afine
CitricePortocale, suc de portocale, grapefruit, suc de grapefruit
Suc de fructeSuc de portocale, suc de grapefruit, suc de mere sau cidru, alt suc
Fructe totaleToate grupele de fructe plus stafide sau struguri, prune uscate, banane, melan, pepene verde, piersici / caise / prune
Fructe totale, fără sucMere sau pere proaspete, căpșuni, afine, portocale, grapefruit, stafide sau struguri, prune uscate, banane, melan, pepene verde, piersici / caise / prune

Deschideți într-o fereastră separată

Urmărire clinică

Am extras date despre tratament, biopsie Gleason suma, stadiu, antigen specific prostatei (PSA) și metastaze din registre medicale sau rapoarte urologi. Indicele național al deceselor și Biroul de statistici vitale au fost verificate pentru datele de mortalitate, iar certificatele de deces au fost utilizate pentru a verifica data și cauza decesului.

Progresia cancerului de prostată a fost definită ca: moartea cancerului de prostată, metastazele osoase din cancerul de prostată, recurența biochimică sau inițierea tratamentului secundar. Un deces a fost atribuit cancerului de prostată dacă cancerul de prostată a fost listat ca fiind cauza principală, secundară sau terțiară de deces și nici o altă malignitate nu a fost listată ca o cauză de ordin superior. Un rezultat al metastazelor osoase a fost definit ca raport urolog al: (1) progresia cancerului de prostată până la os, (2) scanare osoasă pozitivă, (3) radiații pentru metastaze la un loc osos sau (4) stadiul M1b. Recurența biochimică a fost definită ca două valori consecutive ale PSA ≥0,2ng / ml ≥8 săptămâni după prostatectomia radicală sau un PSA ≥2ng / ml peste limita post-radiație. 20 Tratamentul secundar a fost definit ca orice tratament inițiat ≥6 mii. după tratamentul primar. 2122 Data progresiei cancerului de prostată a fost prima dintre următoarele: decesul cancerului de prostată, diagnosticul metastazelor osoase, al doilea PSA ≥0.2ng / ml pentru pacienții cu prostatectomie radicală, primul PSA ≥2ng / ml peste nadir pentru pacienții cu radiații sau inițierea de tratament secundar.

Criterii de includere

Am exclus bărbații cu boală extraprostatică la diagnostic (stadiul T ≥T3b), bărbații lipsiți de informații despre tratament și bărbații care au raportat un aport de energie în afara 800-4200 kcal / zi (n = 241). Pentru a menține natura prospectivă a analizei noastre și a reduce potențialul de prejudecată a amintirii, am exclus bărbații al căror cancer de prostată a progresat înainte de FFQ (n = 333), rezultând 1.560 de bărbați pentru analiză.

Metode statistice

Am examinat asocierile dintre aportul de legume și fructe post-diagnostice și progresia cancerului de prostată folosind regresia proporțională a riscurilor Cox. Timpul persoană a fost calculat de la data FFQ până la evoluția cancerului de prostată, decesul cancerului de prostată, ultimul contact sau 21 august 2009, oricare a avut loc primul. Am modelat quartile de legume și fructe cu variabile indicator și am testat tendințele liniare folosind mediana fiecărui cvartal ca termen continuu.

Modelul 1 a fost ajustat pentru vârstă la diagnostic (continuă), aport de energie (continuu) și zile de la diagnostic până la FFQ (continuă). Modelul 2 a inclus variabilele din Modelul 1 plus riscul de prognostic la diagnostic (scăzut, intermediar, mare), tratament primar (prostatectomie radicală, radiații, supraveghere activă / activă, terapie privativă de androgeni), indice de masă corporală (IMC; <25, 25- 29,9, ≥30 kg / m 2 ) și sarcină echivalentă metabolică de mers pe jos (MET) -h / săptămână (rang quartile). 23 Am clasificat riscul de prognostic al participanților folosind definițiile D’Amico modificate după cum urmează: [Înalt: PSA> 20ng / ml sau suma Gleason = 8-10 sau T-Stage≥T3a; altceva Intermediar: PSA = 10.1–20ng / ml sau suma Gleason = 7 sau model secundar 4-5 sau T-Etapa = T2b / T2c (2002) sau T2b (1997); altfel Scăzut: PSA≤10ng / ml și suma Gleason = 2–6 și T-Etapa = ≤T2a].24 , 25 Modelul 3 a fost ajustat suplimentar pentru rangurile de ouă, păsări de curte cu piele, fructe și legume, altele decât expunerea de interes. Ajustarea pentru educație, venit, rasă, antecedente familiale de cancer de prostată, fumat și consumul de dulciuri, cereale sau lactate nu a modificat rezultatele; prin urmare, aceste variabile au fost omise din modelele finale.

Am examinat dacă suma biopsiei Gleason (<7 v. ≥7), vârsta la diagnostic (<60 v. ≥60 ani), fumatul (vreodată v. Niciodată), IMC (<25 v. ≥ 25 kg / m 2 ), sau mersul pe jos (<7,5 v. ≥7,5 MET-h / săptămână) a modificat oricare dintre relații folosind teste ale raportului de probabilitate. Punctele limitate pentru vârstă la diagnostic și mers au fost alese pe baza distribuției lor în populația studiată.

Am efectuat o analiză de sensibilitate, excluzând evenimentele definite prin tratamentul secundar, care nu aveau dovezi ale unei creșteri precedente a PSA. În plus, am fost îngrijorați că bărbații cu risc prognostic mai mare își pot crește consumul de roșii mai mult decât bărbații cu risc prognostic mai mic; prin urmare, am examinat dacă modificarea auto-raportată a tomatelor a fost asociată cu un risc prognostic la diagnostic, folosind teste chi-pătrate.

Toate testele statistice au fost bilaterale și considerate semnificative la p <0,05. Toate analizele au fost efectuate folosind SAS v. 9.1.3.Mergi la:

REZULTATE

Am observat 134 de evenimente de progresie (53 de recidive biochimice, 71 de tratamente secundare, șase metastaze osoase, patru decese de cancer de prostată) în rândul a 1.560 de bărbați în timpul a 3.171 de persoane. Anul mediu al diagnosticului a fost 2002 [intervalul intercuartil (IQR): 2000-2003]. Urmărirea mediană după FFQ a fost de 23 mii. (IQR: 10-32 mo.). Aproximativ 14% (n = 213) dintre bărbații care au completat FFQ nu au participat la urmărirea CaPSURE după FFQ; acești bărbați nu s-au diferit de ceilalți bărbați în ceea ce privește suma biopsiei Gleason, etapa clinică T, tratamentul primar sau aportul total de legume, legume crucifere, sos de roșii sau leguminoase. Cu toate acestea, au fost mai tineri (medie = 63y) comparativ cu bărbații rămași (medie = 65y) ( p- valoare = 0,001).

Bărbații care consumau mai multe legume erau mai educați, aveau venituri mai mari în gospodărie și cheltuiau mai multă energie pe jos decât bărbații care consumau cel mai puțin legume (tabel 2). Am observat o tendință inversă nesemnificativă pentru legumele totale și riscul de progresie (Tabelul 3), care părea a fi condusă de legume crucifere (de exemplu, broccoli; varză, salată de varză; conopidă; varză de Bruxelles; varză, muștar, verdeață de brustă). Bărbații din a patra quartilă a aportului post-diagnostic de legume crucifere au avut un risc redus cu 59% de progresie a cancerului de prostată comparativ cu bărbații din cea mai mică quartilă (raport de risc (HR): 0,41, interval de încredere 95% (IC): 0,22, 0,76 ; p- trend: 0,003). Restul grupelor de legume nu au fost asociate cu riscul de progresie a cancerului de prostată. Majoritatea articolelor crucifere individuale au fost invers legate de riscul de progresie a cancerului de prostată, dar niciunul nu a fost semnificativ din punct de vedere statistic, probabil din cauza consumului redus al acestor alimente (Tabelul 4).

tabel 2

Caracteristicile inițiale ale 1.560 de bărbați cu cancer de prostată după aportul total de legume după diagnostic.

Cvartila din aportul total de legume 1Q1Q2Q3T4
Porții mediane / d1.42.43.65.7
CaracteristicăN%N%N%N%valoarea p 2
Vârsta la diagnostic<60 y88231022610928117300,23
60–69,9 ani18447183471754515740
≥70 ani11730106271062711630
RasăAlte514182920,37
Afro-american7211382154
caucazian37697375963729636694
EducaţieȘcoala primară278236185195<0.01
Liceu17649143401383813236
Colegiu7320972787248824
Facultate842398271183312835
Sursa de venit<20.000 $3210175206247<0.01
$ 20-75,00021865210631965817953
≥ $ 75.000 de8626109321203613239
IMC (kg / m 2 )<2510226103269023126320,06
25-29.921756207532165618347
≥306717792083218121
FumatActual3182461542460.44
Fost20252206542135520754
Nu15239155401574115540
Mers (quartile median MET-hr / wk)Cvartila 1 (1)11733852373207521<.01
Cvartila 2 (4)88251103095268624
Cvartila 3 (10)922699271103010228
Quartile 4 (26)62177420912510228
PSA la diagnostic (ng / ml)≤10 ng / ml312833178432786323860,19
10,1–20 ng / ml501347134612349
> 20 ng / ml14412372185
Biopsie Gleason suma2-6266692737127671270700,99
79725892394249124
8-10215215195226
Etapa T clinicăT1194502195621154220560,61
T219149169431764516643
T3a41313141
Tratamentprostatectomie228592616724763230590,13
radiație106279424852210226
Alte369195349338
hormonii195174246256

Deschideți într-o fereastră separată

Abrevieri: IMC, indicele masei corporale; MET, sarcină echivalentă metabolică; PSA, antigen specific prostatei.1 Total legume incluse: tofu / soia, fasole, mazăre / fasole lima, fasole / linte, morcovi crudi, morcovi fierți, igname / cartofi dulci, broccoli, varză / salată de varză, conopidă, varză de Bruxelles, varză verde / muștar / verde, spanac fiert, spanac crud, iceberg sau salata de cap, salata romaine sau frunze, telina, dovlecei galbeni / de iarna, vinete / dovlecel, sos de rosii, pizza, rosii proaspete, suc de rosii, sos de chili rosu, legume amestecate, sfecla, varza de lucerna, și usturoi.2 valori P estimate folosind un test chi-pătrat Pearson.

Tabelul 3

Aportul de legume după diagnostic și riscul de progresie a cancerului de prostată la 1.560 de bărbați cu cancer de prostată nemetastatic la diagnostic.

Cvartila de aportp- trend
1234
Total legume 1
Aportul mediu 21,352,393.635,70
HR (IC 95%) 31.01,33 (0,84, 2,11)1,22 (0,76, 1,97)0,59 (0,33, 1,06)0,05
HR (IC 95%) 41.01,28 (0,78, 2,11)1,31 (0,79, 2,17)0,62 (0,33, 1,15)0.10
HR (IC 95%) 51.01,25 (0,76, 2,05)1,34 (0,80, 2,23)0,61 (0,33, 1,13)0,09
Morcovi / ignami
Aportul mediu 20,060,190,350,86
HR (IC 95%) 31.01,39 (0,88, 2,20)0,82 (0,51, 1,32)0,77 (0,47, 1,26)0,13
HR (IC 95%) 41.01,26 (0,77, 2,06)1,00 (0,61, 1,64)0,83 (0,48, 1,41)0,30
HR (IC 95%) 51.01,34 (0,82, 2,21)1,15 (0,68, 1,94)1,00 (0,56, 1,78)0,71
crucifere
Aportul mediu 20,060,210,430.92
HR (IC 95%) 31.00.90 (0.58, 1.39)0.78 (0.50, 1.23)0.45 (0.26, 0.77)0.003
HR (95% CI)41.00.96 (0.60, 1.53)0.82 (0.51, 1.33)0.46 (0.26, 0.81)0.005
HR (95% CI)51.00.95 (0.59, 1.52)0.77 (0.46, 1.27)0.41 (0.22, 0.76)0.003
Green/leafy
Median intake20.190.490.921.57
HR (95% CI)31.01.28 (0.80, 2.04)1.04 (0.63, 1.71)0.96 (0.58, 1.60)0.61
HR (95% CI)41.01.22 (0.75, 2.00)1.00 (0.60, 1.68)0.90 (0.53, 1.55)0.50
HR (95% CI)51.01.25 (0.76, 2.07)1.04 (0.60, 1.78)0.92 (0.51, 1.67)0.56
Legumes
Median intake20.130.270.490.93
HR (95% CI)31.00.64 (0.38, 1.10)0.76 (0.49, 1.17)0.77 (0.47, 1.25)0.47
HR (95% CI)41.00.72 (0.41, 1.27)0.91 (0.57, 1.45)0.86 (0.51, 1.46)0.81
HR (95% CI)51.00.76 (0.43, 1.36)1.00 (0.61, 1.61)0.97 (0.55, 1.68)0.86
Squash
Median intake20.00.060.130.29
HR (95% CI)31.01.27 (0.82, 1.96)1.25 (0.77, 2.01)0.80 (0.48, 1.32)0.35
HR (95% CI)41.01.26 (0.80, 1.98)1.11 (0.67, 1.85)0.75 (0.44, 1.28)0.25
HR (95% CI)51.01.26 (0.80, 1.99)1.17 (0.69, 2.00)0.79 (0.44, 1.40)0,39
Sos de rosii
Aportul mediu 20,060,130,210,49
HR (IC 95%) 31.00,89 (0,54, 1,46)1,04 (0,66, 1,63)0,95 (0,57, 1,58)0,93
HR (IC 95%) 41.00,91 (0,54, 1,52)0,96 (0,60, 1,56)1,10 (0,65, 1,87)0.62
HR (IC 95%) 51.00,91 (0,54, 1,54)1,02 (0,63, 1,66)1,20 (0,70, 2,05)0,42
Roșii (proaspete)
Aportul mediu 20,060,140,430,93
HR (IC 95%) 31.01,07 (0,63, 1,81)1,09 (0,67, 1,78)1,22 (0,74, 1,99)0.44
HR (IC 95%) 41.01,13 (0,65, 1,96)1,17 (0,69, 1,98)1,34 (0,79, 2,27)0,29
HR (IC 95%) 51.01,27 (0,72, 2,22)1,39 (0,80, 2,39)1,66 (0,95, 2,90)0,09

Deschideți într-o fereastră separată

Abrevieri: HR, raport de pericol; CI, interval de încredere; FFQ, chestionar de frecvență alimentară, IMC, indicele de masă corporală MET, sarcină echivalentă metabolică.Legumele totale includ toate legumele din următoarele subgrupuri: morcovi / ignami (morcovi cruzi, morcovi fierți, ignami / cartofi dulci), crucifere (broccoli, varză / salată de varză, conopidă, varză de Bruxelles, varză verde / muștar / verde), verde / cu frunze (spanac fiert, spanac crud, iceberg sau salată de cap, romaine sau salată cu frunze, țelină), leguminoase (tofu / soia, fasole, mazăre / fasole lima, fasole / linte), dovlecei ( dovlecei galbeni / de iarnă, vinete / dovlecei), sos de roșii ( sos de roșii, pizza), roșii (proaspete) (roșii proaspete, suc de roșii); și sos de chili rosu, legume mixte, sfecla, varza de lucerna, usturoi.2 Aporturi mediane raportate în porții / zi.3 Model ajustat pentru vârstă (ani), zile de la diagnostic până la FFQ și aportul energetic zilnic (kcal / d).4 Model ajustat pentru variabilele din modelul 1 plus IMC (<25, 25-29,9, ≥30 kg / m 2 ), risc prognostic (scăzut, intermediar, ridicat), tratament (prostatectomie radicală, radiații, supraveghere activă / altele, hormon) , și mersul pe jos (MET-h / wk; rangurile quartile). Bărbații care lipseau unul sau mai multe covariate au fost omisiți (n = 144, 9%).5 Model ajustat pentru variabilele din Modelul 2 plus rangurile de quartile de fructe, ouă, păsări de curte cu piele și legume, altele decât expunerea de interes. Bărbații care lipseau unul sau mai multe covariate au fost omisiți (n = 144, 9%).

Tabelul 4

Aportul de legume crucifere după diagnostic și riscul de evoluție a cancerului de prostată în rândul a 1.560 de bărbați cu cancer de prostată nemetastatic la diagnostic.

Cantitatea de aportp-trend
1234
Brocoli
Aportul mediu 10.00,060,140,43
HR (IC 95%) 21.01,13 (0,69, 1,84)1,30 (0,78, 2,17)0,66 (0,36, 1,21)0,06
HR (IC 95%) 31.01,18 (0,70, 2,02)1,51 (0,87, 2,61)0,80 (0,42, 1,51)0,22
HR (IC 95%) 41.01,24 (0,72, 2,12)1,64 (0,92, 2,93)0,93 (0,46, 1,88)0,42
Varza / coleslaw
Aportul mediu 10.00,060,14
HR (IC 95%) 21.01,01 (0,66, 1,55)0,66 (0,40, 1,09)0,06
HR (IC 95%) 31.00,96 (0,60, 1,52)0,63 (0,37, 1,08)0,06
HR (IC 95%) 41.00,97 (0,61, 1,55)0,65 (0,37, 1,12)0,09
Conopidă
Aportul mediu 10.00,060,14
HR (IC 95%) 21.01,00 (0,69, 1,47)0,65 (0,40, 1,04)0,08
HR (IC 95%) 31.01,02 (0,68, 1,52)0,64 (0,39, 1,07)0.10
HR (IC 95%) 41.01,03 (0,69, 1,54)0,68 (0,39, 1,16)0,18
varză de Bruxelles
Aportul mediu 10.00,06
HR (IC 95%) 21.00,74 (0,51, 1,10)0,13
HR (IC 95%) 31.00,75 (0,50, 1,12)0,16
HR (IC 95%) 41.00,80 (0,52, 1,21)0,29
nap
Aportul mediu 10.00,06
HR (IC 95%) 21.00,82 (0,51, 1,32)0.41
HR (IC 95%) 31.00,84 (0,51, 1,38)0,48
HR (IC 95%) 41.00,85 (0,51, 1,42)0.53

Deschideți într-o fereastră separată

Abrevieri: HR, raport de pericol; CI, interval de încredere; FFQ, chestionar de frecvență alimentară, IMC, indicele de masă corporală MET, sarcină echivalentă metabolică.1 Aportul mediu raportat în porții / zi.2 Model ajustat pentru vârstă (ani), zile de la diagnostic până la FFQ și energie (kcal / zi).3 Model ajustat pentru covariabile în modelul 1 plus IMC (<25, 25-29,9, ≥30 kg / m 2 ), risc clinic (scăzut, intermediar, ridicat), tratament (prostatectomie radicală, radiații, supraveghere activă / altele, privare de androgen terapie) și mersul pe jos (MET-h / wk; ranguri de quartile).4 Model ajustat pentru covariatele din Modelul 2 plus rândurile de cvile din fructe totale, ouă, păsări cu piele și alte aporturi de legume.

Grupurile totale de fructe și fructe, cu excepția boabelor, nu au fost asociate nici cu riscul de progresie a cancerului de prostată (Tabelul 5). Pentru fructe de pădure, a existat o asociere inversă în modelul adaptat la vârstă și calorii (HR, comparativ cu quartile extreme: 0,60; 95% CI: 0,37, 0,97), care a fost oarecum atenuată și nu a fost semnificativă statistic după ajustarea multivariate (HR comparativ cu quartile extreme : 0,68; IC 95%: 0,40, 1,15).

Tabelul 5

Aportul de fructe după diagnostic și riscul de progresie a cancerului de prostată la 1.560 de bărbați cu cancer de prostată nemetastatic la diagnostic.

Cvartila de aportp- trend
1234
Fruct total 1
Aportul mediu 20,751,752,704,40
HR (IC 95%) 31.01,13 (0,70, 1,80)0,71 (0,42, 1,19)0,85 (0,50, 1,44)0,32
HR (IC 95%) 41.01,37 (0,82, 2,27)0,97 (0,56, 1,66)0,90 (0,50, 1,60)0,42
HR (IC 95%) 51.01,41 (0,85, 2,34)1,04 (0,60, 1,81)1,01 (0,56, 1,81)0,73
Mere / pere 1
Aportul mediu 20,060,140,430,79
HR (IC 95%) 31.00,83 (0,49, 1,42)0,93 (0,59, 1,47)1,05 (0,67, 1,65)0.64
HR (IC 95%) 41.00,82 (0,47, 1,43)0,96 (0,59, 1,57)1,16 (0,73, 1,87)0.36
HR (IC 95%) 51.00,86 (0,49, 1,51)1,01 (0,62, 1,64)1,27 (0,79, 2,04)0,23
Boabe 1
Aportul mediu 20.00,060,130,49
HR (IC 95%) 31.00,68 (0,41, 1,12)0,75 (0,49, 1,17)0,60 (0,37, 0,97)0.10
HR (IC 95%) 41.00,71 (0,42, 1,22)0,82 (0,52, 1,29)0,65 (0,39, 1,09)0,18
HR (IC 95%) 51.00,70 (0,41, 1,19)0,84 (0,53, 1,33)0,68 (0,40, 1,15)0,27
Citrice 1
Aportul mediu 20,060,430,991.46
HR (IC 95%) 31.01,25 (0,76, 2,05)1,10 (0,66, 1,83)1,14 (0,68, 1,91)0,85
HR (IC 95%) 41.01,11 (0,66, 1,86)1,13 (0,66, 1,93)1,11 (0,65, 1,90)0,74
HR (IC 95%) 51.01,15 (0,68, 1,94)1,17 (0,68, 2,00)1,25 (0,72, 2,15)0,46
Suc de fructe 1
Aportul mediu 20.00,350,991.43
HR (IC 95%) 31.01,39 (0,84, 2,32)1,07 (0,64, 1,80)1,41 (0,85, 2,34)0,45
HR (IC 95%) 41.01,58 (0,93, 2,71)1,17 (0,67, 2,03)1,39 (0,81, 2,40)0,58
HR (IC 95%) 51.01,61 (0,94, 2,75)1,23 (0,71, 2,14)1,48 (0,86, 2,56)0.41
Fructe, cu excepția sucului
Aportul mediu 20,401.101,843.13
HR (IC 95%) 31.01,12 (0,70, 1,78)0,86 (0,53, 1,39)0,66 (0,39, 1,12)0,07
HR (IC 95%) 41.01,19 (0,72, 1,95)0,97 (0,58, 1,61)0,69 (0,39, 1,22)0,13
HR (IC 95%) 51.01,25 (0,76, 2,05)1,05 (0,63, 1,76)0,79 (0,44, 1,41)0,30

Deschideți într-o fereastră separată

Abrevieri: HR, raport de pericol; CI, interval de încredere; FFQ, chestionar de frecvență alimentară, IMC, indicele de masă corporală MET, sarcină echivalentă metabolică.Fructele totale au inclus toate fructele din următoarele subgrupuri: mere / pere (mere sau pere proaspete, suc de mere sau cidru), fructe de pădure (căpșuni, afine), citrice (portocale, suc de portocale, grapefruit, suc de grapefruit), suc de fructe (suc de portocale, suc de grapefruit, suc de mere sau cidru, alte sucuri) și stafide sau struguri, prune uscate, banane, melan, pepene verde, piersici / caise / prune.2 Aporturi mediane raportate în porții / zi.3 Model ajustat pentru vârstă (ani), zile de la diagnostic până la FFQ și energie (kcal / zi).4 Model ajustat pentru covariabile în modelul 1 plus IMC (<25, 25-29,9, ≥30 kg / m 2 ), categoria de risc clinic (scăzut, intermediar, ridicat), tratament (prostatectomie radicală, radiații, supraveghere activă / altele, androgen terapie privativă) și mersul pe jos (MET-h / wk; ranguri de quartile).5 Model ajustat pentru covariabile în modelul 2 plus ranguri de ouă, păsări de curte cu piele și legume totale.

Nu a existat nicio dovadă de modificare a efectului prin biopsie Suma Gleason, IMC, vârsta la diagnostic sau fumat. Cu toate acestea, a existat o interacțiune între mers și aportul total de legume ( p- interacțiune = 0,02). Printre cei 732 de bărbați care au mers ≥7,5 MET-h / săptămână după diagnostic (aproximativ 150 min / săptămână), aportul total de legume după diagnostic a fost asociat invers cu riscul de progresie a cancerului de prostată (HR comparativ cu quartile extreme: 0,35; IC 95%: 0,15 , 0,79). Nu a existat nicio asociere între cei 729 de bărbați care au mers <7,5 MET-h / săptămână (HR comparativ cu quartile extreme: 0,91; IC 95%: 0,36, 2,31).

Rezultatele noastre au rămas neschimbate la excluderea evenimentelor definite prin tratament secundar, fără dovezi ale creșterii anterioare a PSA. În plus, puțini bărbați au raportat orice modificare a aportului de tomate în comparație cu diagnosticul înainte (≤15%) și nu a existat nici o asociere între modificarea auto-raportată a vreunui produs de tomate și riscul prognostic la diagnostic (datele nu sunt arătate).Mergi la:

DISCUŢIE

În această nouă analiză a aportului de legume și fructe post-diagnostice și a rezultatelor clinice la bărbații cu cancer de prostată, am observat o asociere puternică inversă între aportul de legume crucifere după diagnostic și progresia cancerului de prostată. Niciun alt grup de legume sau fructe după diagnostic nu a fost asociat semnificativ statistic cu riscul de progresie a cancerului de prostată.

Acesta este primul studiu care examinează aportul de legume crucifere după diagnostic în raport cu rezultatele clinice la bărbații cu cancer de prostată. Cu toate acestea, două studii prospective recente au raportat asocieri inverse între legumele crucifere sau glucosinolatul, un metabolit al legumelor crucifere și riscul de cancer de prostată incident. Kirsh și colab. a raportat un risc redus cu 40% de cancer incident de prostată extraprostatic, comparând bărbații cu aport ridicat și scăzut de legume crucifere (HR: 0,60, IC 95%: 0,36, 0,98; tendința p: 0,02). 26 În cohorta EPIC-Heidelberg, consumul ridicat de glucozinolat a fost asociat cu o scădere cu 32% a riscului de cancer de prostată incident (HR Q4 versus Q1: 0,68; IC 95%: 0,48, 0,97; tendința p: 0,03). 27

Glucozinolații sunt hidrolizați pentru a forma izotiocianați și indoli, care au efecte anticancerigene in vitro și in vivo. 28 – 31 Izotiocianatul, sulforafanul, promovează apoptoza și stoparea ciclului celular în celulele canceroase de prostată. 32 – 34 Isotiocianatul de fenetil inhibă creșterea și migrația celulelor cancerului de prostată, reduce nivelul receptorilor de androgeni, afectează traducerea ARNm și promovează transcrierea p21. 35 – 38 În plus, indol-3-carbinolul promovează oprirea ciclului celular, inhibarea creșterii și apoptoza și s-a demonstrat că inhibă componentele căilor de semnalizare a celulelor oncogene. 39 – 41La om, consumul de varza de broccoli a inhibat histona deacetilază în sânge 42 și o dietă bogată în broccoli a modificat expresia globală a genelor la prostată. 43

Mai mult, Joseph și colab. a observat o relație inversă mai puternică între consumul de broccoli și riscul de cancer de prostată la bărbați cu glutation S-transferaza mu 1 (GSTM1) -genotip prezent în comparație cu bărbații cu deleții nule în această genă. 44 Enzimele glutationului S-transferază sunt induse de metaboliții legumelor crucifere și pot reduce riscul de progresie a cancerului de prostată prin detoxifiere a agenților cancerigeni și eliminarea speciilor oxidative reactive. 45

Am observat dovezi ale unei interacțiuni între aportul total de legume după diagnostic și mers pe jos, similar cu rezultatele din brațul de control al studiului privind alimentația sănătoasă și viața femeilor în rândul femeilor cu cancer de sân. 46 În acel studiu, femeile care au consumat ≥ 5 porții / zi de legume și fructe și s-au angajat în activitate fizică echivalentă cu mersul pe jos 30 min / zi 6 zile / săptămână au avut un risc redus de mortalitate cu 44% comparativ cu femeile care au consumat <5 porții / d de legume și fructe și implicate în <30 min / d 6 d / wk de activitate (HR: 0,56; IC 95%: 0,31, 0,98). Studiile viitoare ar trebui să ia în considerare posibila sinergie între dietele pe bază de plante și activitatea fizică în reducerea riscului de progresie a cancerului de prostată.

Asocierea nulă pentru sosul de roșii a fost contrară ipotezei noastre și asocierea inversă observată anterior. 7 Am luat în considerare dacă lipsa unei asocieri inverse pentru sosul de tomate s-a datorat cauzalității inverse (de exemplu, bărbații cu risc prognostic mai mare la diagnostic și-au mărit aportul de sos de roșii mai mult decât bărbații cu risc prognostic scăzut), dar nu a existat nici o asociere între schimbarea vreunei obiect de tomate și risc de prognostic la diagnostic. În general, rezultatele studiilor de intervenție privind sosul de roșii și / sau suplimentarea cu licopen după diagnosticarea cancerului de prostată în raport cu obiectivele intermediare au fost inconsistente, 11 , 47 și sunt necesare cercetări suplimentare cu privire la rolul roșiilor după diagnosticul cancerului de prostată.

Niciun alt studiu nu a examinat aportul post-diagnostic de leguminoase în raport cu rezultatele clinice la bărbații cu cancer de prostată. Cu toate acestea, observația noastră despre nicio asociere între aportul de leguminoase post-diagnostic și progresia cancerului de prostată este în concordanță cu multe studii prospective privind cancerul de prostată incident la populațiile occidentale, deși două asociații inverse au raportat. 6 , 48 – 50 În studiul cohortei multi-etnice, un consum mai mare de leguminoase a fost asociat cu reduceri mici până la moderate ale riscului de cancer de prostată incident total și agresiv (HR: 0,89, IC 95%: 0,89, 0,99 pentru total; HR: 0,74 , IC 95%: 0,61, 0,91 pentru agresiv). 48Cu toate acestea, această asociație a fost semnificativă doar în rândul latinilor, care au avut un consum mult mai mare de leguminoase decât orice alt grup etnic. O meta-analiză recentă a raportat variații similare între grupurile etnice, cu dovezi ale unei asociații protectoare la populațiile asiatice, dar nici o asociere la populațiile occidentale. 50 Asocierile dintre factorii dietetici și riscul de cancer de prostată incident comparativ cu aportul post-diagnostic și progresia cancerului de prostată diferă, și este nevoie de mai multe cercetări înainte de a trage concluzii ferme. Cu toate acestea, pe baza datelor disponibile, în cazul în care există un efect al leguminoaselor asupra evoluției cancerului de prostată, se pare că acesta este modest și variază probabil în rândul populațiilor, în funcție de nivelul lor de legume.

Limitările acestui studiu includ lipsa noastră de dietă pre-diagnosticată, pierderea de urmărire și câteva evenimente. Lipsa dietei pre-diagnostice ne împiedică să încheiem asocierea pe care am observat-o între aportul de legume crucifere post-diagnostic a fost independent de ceea ce au consumat bărbații înainte de diagnostic. În plus, 14% dintre participanți nu au participat la urmărirea CaPSURE după FFQ și, prin urmare, au fost considerați pierduți la urmărire imediat după finalizarea FFQ. Din fericire, acești bărbați nu s-au diferit de ceilalți bărbați în ceea ce privește aportul lor de legume sau factorii de prognostic clinic și, prin urmare, este puțin probabil ca pierderea acestor bărbați să influențeze rezultatele noastre. În cele din urmă,recunoaștem că acesta este un mic studiu, iar prudența este justificată în interpretarea relației inverse puternice pe care am observat-o între legumele crucifere post-diagnostice și riscul de progresie a cancerului de prostată. În timp ce este sugestiv, este necesar un studiu suplimentar al legumelor crucifere la bărbații cu cancer de prostată din studiile controlate randomizate, înainte de a transpune aceste rezultate în practica clinică.

În concluzie, consumul de legume crucifere după diagnostic a fost puternic asociat cu un risc redus de progresie a cancerului de prostată la bărbații diagnosticați inițial cu cancer de prostată nemetastatic. Aceste date consolidează rațiunea de a investiga fitochimicele legumelor crucifere la bărbații cu cancer de prostată și, dacă sunt confirmate, oferă orientări dietetice pentru bărbații cu cancer de prostată.Mergi la:

Recunoasteri

Mulțumim participanților și personalului de la CaPSURE pentru contribuțiile lor de neprețuit, și lui Asher Schranz pentru recenzia sa asupra literaturii despre izotiocianați și indoli.

CaPSURE este susținut de un cadou educațional nerestricționat de la Laboratoarele Abbott (Chicago, IL), de la Institutele Naționale de Sănătate / Institutul Național al Cancerului (5RC1CA146596) și de Agenția pentru Cercetări și Calitate în Sănătate (1U01CA88160). Richman a fost susținut de finanțarea National Training Institutes of Health (R25 CA098566). June Chan a fost susținută de Departamentul Apărării (W81XWH-04-1-0850) și Fundația pentru cancerul de prostată.Mergi la:

Note de subsol

Niciunul dintre autori nu are conflicte de interese.Mergi la:

Referințe

1. Rezultate SEaE. Fișe statistice SEER. Voi. 2011. Bethesda: Institutul Național al Cancerului; 2010. Prostata. [ Google Scholar ]2. Giovannucci E, Liu Y, Platz EA, Stampfer MJ, Willett WC. Factorii de risc pentru incidența și progresia cancerului de prostată în studiul de urmărire al profesioniștilor din domeniul sănătății. Int J Rac. 2007; 121 : 1571–8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]3. Dagnelie PC, Schuurman AG, Goldbohm RA, Van den Brandt PA. Dieta, măsurile antropometrice și riscul de cancer de prostată: o revizuire a studiilor prospective de cohortă și de intervenție. BJU Int. 2004; 93 : 1139–50. [ PubMed ] [ Google Scholar ]4. Chan JM, Gann PH, Giovannucci EL. Rolul dietei în dezvoltarea și progresia cancerului de prostată. J Clin Oncol. 2005; 23 : 8152–60. [ PubMed ] [ Google Scholar ]5. Platz E, Giovannucci E. Cancer de prostată. În: Schottenfeld D, JFF, editori. Epidemiologia și prevenirea cancerului. 3. New York: Oxford University Press; 2006. p. 1128-50. [ Google Scholar ]6. Alimentație, nutriție, activitate fizică și prevenirea cancerului: o perspectivă globală. Fondul Mondial de Cercetare a Cancerului și Institutul American pentru Cercetarea Cancerului; 2007. [ Google Scholar ]7. Chan JM, Holick CN, Leitzmann MF, Rimm EB, Willett WC, Stampfer MJ, Giovannucci EL. Dieta după diagnostic și riscul progresiei cancerului de prostată, reapariției și decesului (Statele Unite) Cancer Cause Control. 2006; 17 : 199–208. [ PubMed ] [ Google Scholar ]8. Richman EL, Stampfer MJ, Paciorek A, Broering JM, Carroll PR, Chan JM. Aporturile de carne, pește, păsări de curte și ouă și riscul de progresie a cancerului de prostată. Am J Clin Nutr. 2010; 91 : 712-21. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]9. Strom SS, Yamamura Y, Forman MR, Pettaway CA, Barrera SL, DiGiovanni J. Aportul de grăsimi saturate prezice eșecul biochimic după prostatectomie. Int J Rac. 2008; 122 : 2581–5. [ PubMed ] [ Google Scholar ]10. Meyer F, Bairati I, Shadmani R, Fradet Y, Moore L. Supraviețuirea în cancerul de prostată și grăsime din dietă. Controlul cauzelor cancerului. 1999; 10 : 245–51. [ PubMed ] [ Google Scholar ]11. Van Patten CL, de Boer JG, Tomlinson Guns ES. Studii de intervenție dietetică și suplimente alimentare pentru prevenirea recurenței cancerului de prostată: o revizuire a probelor randomizate controlate. J Urol. 2008; 180 : 2314-21. discuția 721–2. [ PubMed ] [ Google Scholar ]12. Schroder FH, Roobol MJ, Boeve ER, de Mutsert R, Zuijdgeest-van Leeuwen SD, Kersten I, Wildhagen MF, van Helvoort A. Studiu randomizat, dublu-orb, controlat placebo, la bărbați cu cancer de prostată și PSA în creștere : eficacitatea unui supliment alimentar. Eur Urol. 2005; 48 : 922–30. discuția 30-1. [ PubMed ] [ Google Scholar ]13. Ornish D, Magbanua MJ, Weidner G, Weinberg V, Kemp C, Green C, Mattie MD, Marlin R, Simko J, Shinohara K, Haqq CM, Carroll PR. Modificări ale expresiei genice a prostatei la bărbații supuși unei intervenții de nutriție intensă și a stilului de viață. Proc Natl Acad Sci SUA A. 2008; 105 : 8369–74. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]14. Chen L, Stacewicz-Sapuntzakis M, Duncan C, Sharifi R, Ghosh L, van Breemen R, Ashton D, Bowen PE. Deteriorarea ADN-ului oxidativ la pacienții cu cancer de prostată care consumă intrări pe bază de sos de roșii ca o intervenție alimentară integrală. J Natl Cancer Inst. 2001; 93 : 1872–9. [ PubMed ] [ Google Scholar ]15. Cooperberg MR, Broering JM, Litwin MS, Lubeck DP, Mehta SS, Henning JM, Carroll PR. Managementul contemporan al cancerului de prostată în Statele Unite: lecții din cancerul de cercetare strategică urologică a prostatei (CapSURE), un registru național al bolilor. J Urol. 2004; 171 : 1393–401. [ PubMed ] [ Google Scholar ]16. Lubeck DP, Litwin MS, Henning JM, Stier DM, Mazonson P, Fisk R, Carroll PR. Baza de date CaPSURE: o metodologie pentru practica clinică și cercetare în cancerul de prostată. Panoul de cercetare CaPSURE Cancerul prostatei Strategic Urologic Cercetare Cercetare. Urologie. 1996; 48 : 773-7. [ PubMed ] [ Google Scholar ]17. Longnecker MP, Lissner L, Holden JM, Flack VF, Taylor PR, Stampfer MJ, Willett WC. Reproductibilitatea și validitatea unui chestionar semicantitativ de auto-administrare a frecvenței alimentelor la subiecții din Dakota de Sud și Wyoming. Epidemiologie. 1993; 4 : 356-65. [ PubMed ] [ Google Scholar ]18. Subar AF, Thompson FE, Kipnis V, Midthune D, Hurwitz P, McNutt S, McIntosh A, Rosenfeld S. Validarea comparativă a chestionarelor de frecvență alimentară Block, Willett și Institutul Național al Cancerului: Studiul Eating at America’s Table. Am J Epidemiol. 2001; 154 : 1089–99. [ PubMed ] [ Google Scholar ]19. Feskanich D, Rimm EB, Giovannucci EL, Colditz GA, Stampfer MJ, Litin LB, Willett WC. Reproductibilitatea și validitatea măsurătorilor aportului alimentar dintr-un chestionar semicantitativ de frecvență alimentară. J Am Diet Conf. Univ. 1993; 93 : 790–6. [ PubMed ] [ Google Scholar ]20. Greene KL, Albertsen PC, Babaian RJ, Carter HB, Gann PH, Han M, Kuban DA, Sartor AO, Stanford JL, Zietman A, Carroll P. Declarație privind cele mai bune practici antigen specifice prostatei: actualizare 2009. J Urol. 2009; 182 : 2232–41. [ PubMed ] [ Google Scholar ]21. Grossfeld GD, Li YP, DP PL, Carroll PR. Modele de eșec după terapia locală primară pentru cancerul de prostată și motivarea terapiei secundare. Urologie. 2002; 60 : 57–62. discuție -3. [ PubMed ] [ Google Scholar ]22. Agarwal PK, Sadetsky N, Konety BR, Resnick MI, Carroll PR. Cancerul prostatei Cercetare urologică strategică E. Eșecul tratamentului după terapia primară și de recuperare pentru cancerul de prostată: probabilitate, modele de îngrijire și rezultate. Cancer. 2008; 112 : 307–14. [ PubMed ] [ Google Scholar ]23. Richman EL, Kenfield SA, Stampfer MJ, Paciorek A, Carroll PR, Chan JM. Activitatea fizică după diagnosticare și riscul de progresie a cancerului de prostată: date de la cercetarea privind cancerul de prostată. Cancer Res. 2011 [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]24. D’Amico AV, Whittington R, Malkowicz SB, Schultz D, Blank K, Broderick GA, Tomaszewski JE, Renshaw AA, Kaplan I, Beard CJ, Wein A. Rezultatul biochimic după prostatectomie radicală, radioterapie cu fascicul extern sau interstitial radioterapie pentru cancerul de prostată localizat clinic. JAMA. 1998; 280 : 969-74. [ PubMed ] [ Google Scholar ]25. Boorjian SA, Karnes RJ, Rangel LJ, Bergstralh EJ, Blute ML. Validarea Mayo Clinic a clasificării grupului de risc D’amico pentru prezicerea supraviețuirii în urma prostatectomiei radicale. J Urol. 2008; 179 : 1354–60. discuția 60-1. [ PubMed ] [ Google Scholar ]26. Kirsh VA, Peters U, Mayne ST, Subar AF, Chatterjee N, Johnson CC, Hayes RB. Studiul prospectiv al aportului de fructe și legume și al riscului de cancer de prostată. J Natl Cancer Inst. 2007; 99 : 1200-9. [ PubMed ] [ Google Scholar ]27. Steinbrecher A, Nimptsch K, Husing A, Rohrmann S, Linseisen J. Aportul alimentar de glucozinolat și riscul de cancer de prostată în studiul de cohortă EPIC-Heidelberg. Int J Rac. 2009; 125 : 2179–86. [ PubMed ] [ Google Scholar ]28. Hayes JD, Kelleher MO, Eggleston IM. Acțiunile chemopreventive ale cancerului ale fitochimicalelor derivate din glucozinolați. Eur J Nutr. 2008; 47 (Supliment 2): 73-88. [ PubMed ] [ Google Scholar ]29. Hecht SS. Chimioprevenție prin izotiocianați. J Cell Biochem Suppl. 1995; 22 : 195–209. [ PubMed ] [ Google Scholar ]30. Higdon JV, Delage B, Williams DE, Dashwood RH. Legume crucifere și risc de cancer uman: dovezi epidemiologice și bază mecanică. Farmacol Res. 2007; 55 : 224–36. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]31. Shertzer HG, Senft AP. Micronutrienții indol-3-carbinol: implicații pentru boală și chimioprevenție. Drogul Metabol Drogul interacționează. 2000; 17 : 159–88. [ PubMed ] [ Google Scholar ]32. Clarke JD, Dashwood RH, Ho E. Prevenirea multiplă a cancerului prin sulforafan. Rac Lett. 2008; 269 : 291–304. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]33. Singh AV, Xiao D, Lew KL, Dhir R, Singh SV. Sulforafanul induce apoptoza mediată de caspază în celulele de cancer de prostată umane PC-3 cultivate și întârzie creșterea xenogrefelor PC-3 in vivo. Carcinogeneza. 2004; 25 : 83–90. [ PubMed ] [ Google Scholar ]34. Singh SV, Herman-Antosiewicz A, Singh AV, Lew KL, Srivastava SK, Kamath R, Brown KD, Zhang L, Baskaran R. G2 / M indusă de sulfurafan G2 / M în ciclu de celulă arestează implică controlul kinazei 2-mediază fosfilailarea celulei ciclul de divizare 25C. J Biol Chem. 2004; 279 : 25813–22. [ PubMed ] [ Google Scholar ]35. Wang LG, Liu XM, Fang Y, Dai W, Chiao FB, Puccio GM, Feng J, Liu D, Chiao JW. Depresiunea promotorului p21 în celulele cancerului de prostată de către un izotiocianat prin inhibarea HDAC-urilor și a c-Myc. Int J Oncol. 2008; 33 : 375–80. [ PubMed ] [ Google Scholar ]36. Wang LG, Liu XM, Chiao JW. Represia receptorilor androgeni în celulele canceroase de prostată de către fenetil izotiocianat. Carcinogeneza. 2006; 27 : 2124–32. [ PubMed ] [ Google Scholar ]37. Xiao D, Singh SV. Isotiocianatul de fenetil inhibă angiogeneza in vitro și ex vivo. Cancer Res. 2007; 67 : 2239–46. [ PubMed ] [ Google Scholar ]38. Hu J, Straub J, Xiao D. Cancer Res. 2007; 67 : 3569–73. [ PubMed ] [ Google Scholar ]39. Sarkar FH, Li Y. Indol-3-carbinol și cancer de prostată. J Nutr. 2004; 134 : 3493S – 8S. [ PubMed ] [ Google Scholar ]40. Chinni SR, Sarkar FH. Inactivarea Akt este un eveniment cheie în apoptoza indusă de indol-3-carbinol în celulele PC-3. Clin Cancer Res. 2002; 8 : 1228–36. [ PubMed ] [ Google Scholar ]41. Chinni SR, Li Y, Upadhyay S, Koppolu PK, Sarkar FH. Indolul-3-carbinol (I3C) a indus inhibarea creșterii celulare, oprirea ciclului celular G1 și apoptoza în celulele canceroase de prostată. Oncogene. 2001; 20 : 2927–36. [ PubMed ] [ Google Scholar ]42. Myzak MC, Tong P, Dashwood WM, Dashwood RH, Ho E. Sulforafanul întârzie creșterea xenogrefelor PC-3 umane și inhibă activitatea HDAC la subiecții umani. Exp Biol Med (Maywood) 2007; 232 : 227–34. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]43. Traka M, Gasper AV, Melchini A, Bacon JR, Needs PW, Frost V, Chantry A, Jones AM, Ortori CA, Barrett DA, Ball RY, Mills RD și colab. Consumul de broccoli interacționează cu GSTM1 pentru a perturba căile de semnalizare oncogenice în prostată. Plus unu. 2008; 3 : e2568. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]44. Joseph MA, Moysich KB, Freudenheim JL, Shields PG, Bowman ED, Zhang Y, Marshall JR, Ambrosone CB. Legume crucifere, polimorfisme genetice în glutation S-transferaze M1 și T1 și risc de cancer de prostată. Nutr Cancer. 2004; 50 : 206-13. [ PubMed ] [ Google Scholar ]45. Herr I, Buchler MW. Componenți dietetici ai broccoli și a altor legume crucifere: implicații pentru prevenirea și terapia cancerului. Cancer Treat Rev. 2010 [ PubMed ] [ Google Scholar ]46. Pierce JP, Stefanick ML, Flatt SW, Natarajan L, Sternfeld B, Madlensky L, Al-Delaimy WK, Thomson CA, Kealey S, Hajek R, Parker BA, Newman VA, și colab. Supraviețuire mai mare după cancerul de sân la femeile active fizic, cu aport ridicat de legume-fructe, indiferent de obezitate. J Clin Oncol. 2007; 25 : 2345–51. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]47. Chan JM, Weinberg V, Magbanua MJ, Sosa E, Simko J, Shinohara K, Federman S, Mattie M, Hughes-Fulford M, Haqq C, Carroll PR. Suplimentele nutritive, expresia COX-2 și IGF-1 la bărbați în supraveghere activă pentru cancerul de prostată. Cancerul provoacă controlul. 2011; 22 : 141-50. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Park SY, Murphy SP, Wilkens LR, Henderson BE, Kolonel LN. Consumul de leguminoase și izoflavone și riscul de cancer de prostată: Studiul de cohortă multietnică. Int J Rac. 2008; 123 : 927–32. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Schuurman AG, Goldbohm RA, Dorant E, van den Brandt PA. Consumul de legume și fructe și riscul de cancer de prostată: un studiu de cohortă din Olanda. Biomarkeri de epidemiol pentru cancer Prev. 1998; 7 : 673-80. [ PubMed ] [ Google Scholar ]50. Yan L, Spitznagel EL. Consumul de soia și riscul de cancer de prostată la bărbați: o revizuire a unei metaanalize. Am J Clin Nutr. 2009; 89 : 1155–63. [ PubMed ] [ Google Scholar ]

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3310254/

Rolul vitaminelor, mineralelor și suplimentelor în prevenirea și gestionarea cancerului de prostată

 

Vincent M. Santillo; Franklin C. Lowe

Departamentul de Urologie, Spitalul St. Luke’s-Roosevelt și Departamentul de Urologie, Universitatea Columbia, Colegiul Medicilor și Chirurgilor, New York, NY, SUA

Adresa de corespondenta


ABSTRACT

Autorii revizuiesc literatura actuală privind medicamentele complementare și alternative utilizate cel mai frecvent de pacienții cu cancer de prostată și cei cu risc pentru boală. Produsele acoperite sunt vitamina E, vitamina A, seleniu, zinc, soia, licopen, suc de rodie, ceai verde și acizi grași omega-3. Nu există nicio dovadă definitivă că vreunul dintre suplimentele nutritive discutate poate afecta cursul cancerului de prostată sau dezvoltarea acestuia. Autorii sunt de părere că pur și simplu luarea unui multivitamin standard zilnic ar trebui să fie suficient pentru a se asigura că pacienții au nivelurile adecvate de vitamine și minerale, fără a risca utilizarea excesivă de vitamine, minerale și suplimente care pot duce la numeroase efecte secundare negative.

Cuvinte cheie: neoplasme prostatice; chemoprevention; Medicina complementară; suplimente de dieta; licopen; acizi grasi omega-3


INTRODUCERE

În ultimul deceniu a existat o creștere a conștientizării și utilizării medicamentelor complementare și alternative (CAM). Sondajele privind populația indică faptul că această creștere se datorează dorinței oamenilor de a fi proactivi în managementul sănătății lor, precum și a sentimentului că orice „natural” este în mod inerent sigur (1,2). În ceea ce privește cancerul de prostată, cea mai mare utilizare a CAM este printre cei care au fost deja diagnosticați și tratați pentru cancerul de prostată, iar pacienții cu cancer progresiv de prostată au mai multe șanse de a utiliza CAM decât cei cu boală stabilă (3). Cu toate acestea, datele care susțin această exuberanță a utilizării sunt contradictorii în cel mai bun caz. Acest articol va analiza datele disponibile curente ale produselor CAM cele mai frecvent utilizate.

VITAMINA E

Vitamina E (de fapt un grup de 4 tocoferoli și 4 tocotrienoli) este cel mai popular supliment folosit de bărbați. Se estimează că 15% până la 17% dintre bărbați iau acest supliment (4,5). Deoarece este o vitamină solubilă în grăsimi, sursele alimentare bune tind să fie alimente bogate în uleiuri derivate din plante: avocado, nuci, ouă, unt de arahide, soia și cereale pentru micul dejun gata de consumat. Uleiurile de gătit tind să fie cea mai mare sursă de vitamina E din dietă (6). Doza zilnică recomandată (RDA) este de 15 mg (22,5 UI). Nivelurile plasmatice de vitamina E sunt saturabile la aproximativ 800 UI.

În general, vitamina E este considerată sigură și nu a arătat proprietăți mutagene, în ciuda anilor de megadozare. Cu toate acestea, recent, sa dovedit că suplimentele de vitamina E cu o doză mare ( > 400 UI / zi) cresc un risc crescut de evenimente cardiovasculare (7). Alfa-tocoferolii (cea mai abundentă formă naturală de vitamina E) scad, de asemenea, agregarea plachetară și crește astfel riscul de sângerare. Pacienții trebuie sfătuiți să rețină aportul de vitamina E cu 10 până la 14 zile înainte de biopsia prostatei, prostatectomia radicală, semănarea radioactivă sau orice altă procedură chirurgicală (6).

Studii de laborator

Multe studii in vitro pe o varietate de linii celulare de cancer uman au arătat că vitamina E poate avea un impact benefic asupra carcinogenezei. Cea mai cunoscută funcție a vitaminei E este ca un antioxidant, detoxifierea radicalilor oxidanti care apar ca subproduse nedorite în timpul metabolismului normal. Acești radicali oxidanți pot interfera cu multe mecanisme celulare importante în creșterea și reglarea celulelor, inclusiv acele mecanisme implicate cu carcinogeneza prostatei (6). Alte roluri pentru vitamina E includ ca antiprostaglandină; se crede că prostaglandinele au un rol în carcinogeneza prostatei (9).

Studiile in vitro asupra liniilor de celule ale cancerului de prostată au arătat, de asemenea, că vitamina E induce oprirea ciclului celular în celulele canceroase de prostată la nivel fiziologic, precum și reglarea expresiei p27, un regulator al ciclului celular (9).

Studii clinice

Impactul potențial al consumului de vitamina E asupra dezvoltării cancerului de prostată a fost demonstrat pentru prima dată în rezultatele Studiului de prevenire a cancerului alfa-tocoferolului, beta-carotenului (studiu ATBC) (10). Acesta a fost un studiu randomizat, dublu-orb, pe 29.133 de fumători de sex masculin cărora li s-a administrat vitamina E (50 mg), beta-caroten (20 mg), ambele substanțe sau un placebo zilnic timp de 5 până la 8 ani pentru a evalua impactul acești 2 nutrienți pentru prevenirea cancerului pulmonar. Deși incidența cancerului pulmonar nu a fost diminuată, fumătorii de sex masculin care au luat vitamina E au avut o reducere dramatică de 32% a cancerului de prostată și o reducere de 41% a deceselor prin cancer de prostată la 7 ani (10). Faptul că studiul ATBC nu a fost conceput ca un studiu de prevenire a cancerului de prostată, lasă deschisă posibilitatea ca rezultatele să reprezinte o schemă statistică.

Răspunsul la întrebarea dacă rezultatul a fost sau nu o coincidență este acum testat în Studiul de prevenire a cancerului cu seleniu și vitamina E (SELECT). Studiul SELECT testează vitamina E (400 mg de acetat de alfa-tocoferil racemic) și seleniu (200 mcg de L-selenometionină) la 32 400 de bărbați americani. Randomizarea va fi distribuită în mod egal între 4 brațe de studiu (seleniu, vitamina E, seleniu și vitamina E și placebo). Studiul este conceput pentru a permite detectarea unei reduceri de 25% a incidenței cancerului de prostată din combinația de seleniu și vitamina E, comparativ cu nutrienții singuri. Efectul de combinație al seleniului și al vitaminei E ar putea fi sinergic, așa cum s-a demonstrat în experimentele in vitro în care cele două suplimente au obținut împreună o mai mare inhibare a creșterii celulare decât oricare singur (11). Procesul SELECT a ajuns la completul lor complet de bărbați în aprilie 2004. Datele inițiale sunt anticipate în 2006, cu rezultate finale în 2013 (12).

VITAMINA A

Vitamina A este o vitamină solubilă în grăsimi foarte versatilă, care are roluri în mai multe procese ale corpului. Alocația dietetică recomandată pentru bărbați este de 900 mcg și se estimează că aproximativ 3% dintre bărbați iau această vitamină ca supliment.

Conform cercetărilor epidemiologice și clinice, vitamina A nu este asociată cu riscul de cancer de prostată (13). Relația a fost ipotezată pe baza rolului pe care îl joacă retinoizii în reglarea diferențierii de creștere și a apoptozei celulelor normale și maligne. În studiul de eficiență a beta-carotenului și retinolului (CARET), un studiu de chemoprevenție controlat cu 7 ani, randomizat, dublu orb, controlat cu placebo, a testat combinația de beta-caroten (30 mg) și retinil palmitat (vitamina A) (25,000) UI) luate zilnic împotriva placebo la 12.025 de bărbați și 6.289 de femei cu risc ridicat de a dezvolta cancer pulmonar, nu a existat nicio diferență în incidența cancerului de prostată între acei bărbați care primesc vitamina A și un placebo (14). În timp ce obiectivul principal al studiului a fost reducerea incidenței cancerului pulmonar la o populație cu risc ridicat de boală, datele sunt convingătoare că vitamina A nu va fi probabil un agent chimiopreventiv pentru cancerul de prostată.

SELENIU

Seleniul este un oligoelement care apare atât în ​​forme organice, cât și în forme anorganice. Forma organică intră prin lanțul alimentar prin consumul de plante cultivate în sol care conțin forma anorganică. Se găsește în fructe de mare, carne și cereale, iar cantitatea variază în funcție de cantitatea prezentă în sol. Se estimează că 9% până la 10% dintre bărbați iau acest supliment (4,5). RDA este de 55 mcg și nivelul tolerabil de admisie superioară (UL) pentru adulți este de 400 mcg. Un exces de seleniu poate afecta activitatea celulelor ucigătoare naturale, poate afecta sinteza hormonilor tiroidieni și metabolismul hormonului de creștere și al factorului de creștere asemănător insulinei și are, de asemenea, efecte dermatologice, cum ar fi pierderea unghiilor și a părului și dermatita (15).

Proprietăți anticancerigene ale seleniului

Metoda exactă prin care seleniul afectează carcinogeneza este necunoscută, dar rolul său de antioxidant (atât singur, cât și încorporat ca cofactor în enzimele antioxidante) a fost un domeniu de cercetare. Alte efecte potențiale includ antiproliferarea, inducerea apoptozei, modularea nivelurilor de androgeni și efectele asupra funcției imunitare (16,17).

Studii clinice

În timp ce multe studii epidemiologice au arătat dovezi ale unei legături între nivelurile scăzute de seleniu și incidența crescută a cancerului, studiul Prevenției Nutriționale a Cancerului (NPC) a fost cel care a evidențiat relația sa cu cancerul de prostată. Studiul NPC de 1312 bărbați și femei a fost un studiu randomizat de 200 mcg de seleniu zilnic, conceput pentru a testa dacă o astfel de suplimentare poate reduce riscul de cancer de piele non-melanom recurent (18). Deși suplimentarea cu seleniu nu a avut efect asupra cancerului de piele, la sfârșitul studiului, o analiză a celor 457 de bărbați care au primit suplimente a arătat o incidență semnificativ mai mică a cancerului de prostată decât acei 470 de bărbați care au primit un placebo (cu o monitorizare medie de mai mult de 7 ani). Printre bărbații cu valori PSA de bază mai mici sau egale cu 4 ng / ml, rezultatele au arătat o reducere semnificativă de 65% a incidenței cancerului de prostată cu suplimentarea cu seleniu. Acei participanți cu valori PSA mai mari de 4 ng / ml nu au arătat nicio reducere a incidenței. Atunci când datele din testul NPC sunt evaluate pe baza nivelului de seleniu de la nivelul inițial, acei bărbați în tertilele cele mai mici și mijlocii ( < 123,2 ng / ml) au arătat reduceri semnificative ale incidenței de 86% și, respectiv, 61%. Cercetătorii au evaluat, de asemenea, o cohortă din Studiul de urmărire a profesioniștilor din domeniul sănătății, de 51.529 de bărbați de peste 8 ani, care a arătat că atunci când 181 de subiecți cu caz de cancer de prostată avansat au fost segregați în cinci grupuri bazate pe nivelurile inițiale de seleniu, acei bărbați aflați în studiu în cea mai mare quintilă a nivelului de seleniu a avut un risc cu 51% mai mic de cancer de prostată avansat decât bărbații cu cea mai mică chintilă a nivelului de seleniu (19). Până când rezultatele testului SELECT sunt disponibile, se pare că doar cei cu un nivel scăzut de seleniu (acest lucru ar trebui să fie testat mai întâi) sunt candidații adecvați pentru suplimentarea cu mineralul.

ZINC

Zincul este un mineral esențial care acționează ca cofactor pentru mai mult de șaptezeci de enzime. ADR pentru bărbați este de 11 mg pe zi și aproximativ 7% până la 8% dintre bărbați raportează că o iau (4,5). Zincul la niveluri ridicate poate fi toxic; aporturi de 150 până la 450 mg pe zi au fost asociate cu statut de cupru scăzut, funcție modificată a fierului, funcție imunitară redusă, niveluri reduse de lipoproteine ​​cu densitate ridicată și căderea părului (20). La rândul său, starea scăzută de cupru poate provoca o anemie sideroblastică, leucopenie și neutropenie (21). Mai important, utilizarea unei doze mai mari de 100 mg / zi pare să crească probabilitatea de cancer avansat de prostată (22).

O mare parte a interesului pentru zinc ca agent pentru tratamentul și prevenirea cancerului de prostată se datorează studiilor care au arătat o reducere marcată a nivelului de zinc în țesuturile prostatei în celulele canceroase de prostată față de celulele normale ale prostatei (23). În țesutul prostatic normal, zincul acționează ca un inhibitor al unei enzime (m-aconitaza), care face parte din ciclul Krebs. Odată cu inhibarea eliminată de nivelurile scăzute de zinc, celulele maligne sunt acum capabile să finalizeze ciclul Krebs și să treacă de la celule epiteliale secretoare ineficiente din punct de vedere energetic la celule eficiente din punct de vedere energetic (24).

Din păcate, înlocuirea acestui zinc prostatic intracelular nu este la fel de simplă ca și ingerarea acestuia: nivelurile excesive de zinc intestinal reglează absorbția zincului și, prin urmare, suplimentele orale de zinc nu au niciun efect asupra nivelului de zinc la nivelul prostatei (25). Zincul este transportat activ prin membrana celulelor prostatei și există dovezi că reglarea în jos a transportatorilor implicați este o cauză a absorbției reduse a zincului și această schimbare a expresiei genice poate fi un factor în dezvoltarea cancerului de prostată. Cercetările au arătat că hormonii de testosteron și prolactină pot crește absorbția de zinc în celulele prostatei, dar nu s-au efectuat studii umane despre acest efect (24).

Studii epidemiologice

Studiile asupra cancerului de zinc și de prostată au fost neconcludente (26). Unele studii au sugerat că un nivel ridicat de zinc intraprostatic poate proteja împotriva carcinogenezei prostatei, în timp ce alte studii arată că poate crește riscul, facilitând enzimele considerate a fi responsabile pentru proliferarea nelimitată a celulelor tumorale (22).

Într-o analiză de 14 ani de date privind o cohortă de 46,974 de bărbați din Studiul de urmărire a profesioniștilor în sănătate, s-a observat că aportul suplimentar de zinc în doze de până la 100 mg / zi nu a fost asociat cu un risc crescut de cancer de prostată (22 ). Cu toate acestea, bărbații care au consumat mai mult de 100 mg / zi au avut un risc relativ de cancer avansat de prostată cu 2,29 mai mare decât nonusers. Astfel, suplimentarea cu zinc ar putea promova dezvoltarea cancerului de prostată. Zincul obținut din surse alimentare nu a fost asociat cu riscul de cancer de prostată (22).

SOIA

Rolul soia și efectele benefice pe care fitoestrogenii (în special izoflavonoizii) pe care le conține asupra cancerului de prostată au fost un obiectiv al cercetărilor recente. Se estimează că doar 4% până la 8% dintre bărbați folosesc soia ca supliment (4,5). O mare parte din cercetare s-a concentrat pe două izoflavone în special, genisteina și daidzein.

Studii epidemiologice

Cercetarea urmărește să ofere înțelegere studiilor epidemiologice care au arătat o incidență mai mică a cancerului de prostată la populațiile cu diete bogate în produse de soia (27). S-a raportat că, în timp ce bărbații chinezi și japonezi au avut o incidență mai mică de cancer de prostată decât bărbații născuți în SUA, incidența în populația imigranților asiatici din Statele Unite este în conformitate cu ratele de incidență din SUA (28). Soia este de interes ca un posibil motiv, deoarece dieta medie asiatică include de zece ori mai mult decât cantitatea de produse de soia consumate în dieta tipică americană (27). Consumul de izoflavonă este de aproximativ 50 mg / zi în Asia față de 2 până la 3 mg / zi în Statele Unite (27). Un studiu privind obiceiurile alimentare a 12.395 de adventiști americani din ziua a șaptea, a demonstrat o reducere de 70% a riscului de cancer de prostată la acei bărbați care au consumat lapte de soia mai mult de o dată pe zi (29).

Studii de laborator

Genisteina, daidzein și metaboliții lor, cu activitatea lor estrogenică ușoară, s-a dovedit a inhiba creșterea benignă și malignă a celulelor epiteliale prostatice (30), a regla în jos genele receptorilor androgeni (31) și reduce creșterea tumorii la unele modele animale. În plus, genisteina inhibă creșterea atât a celulelor canceroase de prostată dependente de androgeni, cât și de androgeni, in vitro (12). Nu s-au raportat studii clinice la scară largă care folosesc soia sau produse de soia ca chimioprevenție sau terapie, deci opinia actuală trebuie să se bazeze pe studii epidemiologice, studii in vitro și studii in vivo pe modele animale.

Deși poate părea că o reducere a riscului ar putea fi obținută prin creșterea aportului de soia, un studiu recent a arătat că situația poate fi mai complicată (30). În acel studiu, echolul, un metabolit al daidzein, a demonstrat efecte inhibitoare. Nu toate persoanele care consumă daidzein produc echol. Este dieta obișnuită care determină tulpinile bacteriene din tractul gastro-intestinal, care la rândul său determină dacă individul transformă daidzein în echol. Acest studiu s-a concentrat doar pe un metabolit, dar demonstrează dificultatea aplicării rezultatelor la o populație la alta, deoarece flora intestinală locală, precum și dieta poate influența prezența metaboliților activi biologic.

Administrarea de soia poate să nu fie fără riscuri, după cum a demonstrat un studiu la animale atunci când a arătat o îmbunătățire a creșterii tumorii independente de androgeni in vivo, când șobolanii au fost hrăniți cu o dietă ridicată într-un izolat proteic de soia bogat în izoflavonă (32).

Studii clinice

Datele clinice colectate până în prezent au fost limitate și echivalente. Studiile au avut un număr mic de participanți sau au avut o durată limitată. Unii nu au arătat niciun impact asupra nivelului PSA sau vitezei PSA la bărbații sănătoși sau la pacienții cu cancer de prostată (33-35), în timp ce alții au demonstrat exact opusul la un grup de bărbați cu cancer de prostată (36,37). Din punct de vedere clinic, aceste studii sunt neconcludente, deoarece s-au concentrat asupra markerilor imperfecți ai cancerului de prostată și nu asupra bolii în sine. Nu s-au efectuat studii asupra suplimentării la soia la om și sunt necesare pentru a evalua impactul clinic (38).

LICOPEN

Similar cu seleniul și vitamina E, licopenul este un puternic antioxidant. Este un carotenoid care se găsește în principal în tomate și produse derivate din tomate. Nu există o cotă recomandată zilnic pentru licopen, deoarece nu este un nutrient esențial. Miller și colab. Recomandă consumul unei porții pe zi sau a cinci porții pe săptămână de produse de tomate ca parte a unei diete sănătoase (39).

Studii epidemiologice

Studiile epidemiologice au sugerat că produsele de tomate ar putea fi potențiali agenți de protecție împotriva cancerului de prostată (39-42). O analiză a datelor referitoare la dietă colectată dintr-o cohortă de 14.000 de bărbați adventiști din Ziua a șaptea a arătat o reducere cu 40% a riscului de cancer de prostată la cei care consumau roșii de mai mult de 5 ori pe săptămână în comparație cu cei care consumă mai puțin de o porție pe săptămână ( 39). Aceste observații au fost extinse de Giovannucci și colab. în studiul lor prospectiv din 1995 a unei cohorte de 47.894 de bărbați din cadrul Studiului de urmărire a profesioniștilor din sănătate (HPFS) (39,43). În această analiză, singurele articole de fructe și legume care au fost asociate cu un risc redus de cancer de prostată au fost tomatele crude, sosul de roșii, pizza și căpșunile. Atunci când grupurile de tomate sunt combinate, consumul care depășește zece porții pe săptămână, comparativ cu mai puțin de 1,5 porții pe săptămână a redus cu 35% riscul de cancer de prostată (39). O analiză mai recentă a 450 de cazuri de cancer de prostată incidente, comparativ cu 450 de controale din datele HPFS a sugerat că produsele de tomate pot avea un rol protector mai puternic în prevenirea cancerului de prostată sporadic, în loc de cancerul de prostată cu o componentă puternică familială / ereditară (44).

Studii de laborator

În timp ce licopenul poate fi luat ca supliment, un studiu recent efectuat la animale a arătat un efect protector împotriva pulberii de tomate, dar nu a licopenului pur, indicând faptul că compușii, pe lângă licopen, influențează carcinogeneza prostatei (45). Alte studii efectuate la animale și in vitro au demonstrat că administrarea de vitamina E (care este prezentă în tomate) împreună cu licopenul au dus la inhibarea sinergică a cancerului de prostată (46,47).

Ca și în cazul altor antioxidanți, licopenul poate avea un rol în limitarea daunelor oxidative ale macromoleculelor celulare. Studiile de laborator in vitro sugerează că licopenul este cel mai bun carotenoid natural pentru stingerea oxigenului reactiv singlet. Modurile reale în care licopenul lucrează cu alți antioxidanți și sisteme biologice care protejează împotriva deteriorarii oxidative este slab înțeles (39). De asemenea, licopenul a fost arătat in vitro pentru a influența semnalizarea factorului de creștere 1 (IGF-1) asemănător insulinei, evoluția ciclului celular și proliferarea celulară. Niveluri ridicate de IGF-1 au fost asociate cu un risc crescut de cancer de prostată (48).

Studii clinice

Un studiu din 2002 asupra a 26 de bărbați diagnosticați recent cu cancer de prostată, a demonstrat că suplimentarea cu un preparat de licopen (care a inclus 30 mg licopen, precum și un amestec de carotenoizi de tomate și alte fitochimice, inclusiv vitamina E) cu 3 săptămâni înainte de prostatectomia radicală a dus la scăderea Niveluri PSA plasmatice, precum și reducerea implicării difuze a glandei prostatei cu HGPIN, un precursor al cancerului de prostată (49). Până în prezent, nu a fost efectuat niciun studiu clinic controlat potențial al suplimentării licopenului.

SUC DE RODIE

Sucul de rodie este un puternic antioxidant care a primit recent o atenție sporită în cercetare. Este o sursă bogată de flavonoide polifenolice, despre care se crede că este motivul proprietăților sale puternice antioxidante și anti-aterosclerotice. Cel mai abundent dintre acești polifenoli este punicalagina și este responsabil pentru mai mult de 50% din activitatea antioxidantă puternică a sucului (50).

Studii epidemiologice

Studiile epidemiologice au arătat că consumul de fructe și legume cu conținut fenolic ridicat se corelează cu mortalitatea cancerului redusă. Sucul de rodie a fost comercializat ca fiind bogat în antioxidanți și cercetările de laborator s-au concentrat asupra potențialului său de a afecta cancerul de prostată. Interesant este că studiile au arătat că sucul comercial are un conținut ridicat de punicalagine, deoarece prelucrarea industrială extrage o parte din taninuri prezente în coaja de fructe (50). Astfel, orice beneficiu din rodie este posibil să provină din consumul de suc și nu de fructe – și mai exact din sucul care include o anumită prelucrare a șoriciului de fructe.

Studii de laborator

Studiile efectuate asupra cancerului de sân au demonstrat că sucul are un potențial semnificativ pentru reglarea în jos a angiogenezei. Se știe că anumite fracțiuni, în special uleiul din semințe, au activitate estrogenică. În plus, ca și în cazul vitaminei E, acidul punicic din uleiul de semințe de rodie inhibă formarea prostaglandinei (51). Studiile in vitro au arătat, de asemenea, o inhibare sinergică a invaziei celulelor canceroase de prostată din aplicarea unei combinații de extracte de rodie (52,53). Cercetările recente au arătat că efectele benefice ale diferitelor extracte din sucul de rodie sunt îmbunătățite atunci când sunt combinate cu celelalte polifenole găsite în suc (54).

Studii clinice

Un studiu clinic recent, de 2 ani, a fost finalizat pentru 48 de bărbați cu niveluri PSA în creștere după operație sau radioterapie (55). Pacienții au băut zilnic opt uncii de suc de rodie. Durata medie de dublare a PSA a crescut semnificativ odată cu suplimentarea sucului de rodie, de la 14 luni la 26 de luni. Aceste constatări sugerează că testarea suplimentară este justificată într-un studiu multi-centru, randomizat, controlat cu placebo (55).

CEAI VERDE

Lângă apă, ceaiul (preparat din frunzele Camellia sinensis) este cel mai consumat lichid din lume. Ceaiul verde, oolong și negru sunt toate făcute din frunzele aceleiași plante. Cu toate acestea, conținutul și aromele lor chimice sunt foarte diferite datorită proceselor lor de fermentare. Ceaiul verde conține mai mulți compuși polifenolici, incluzând polifenolul principal și cel care a primit cel mai mult accent de cercetare, epigalocatechinul galat (EGCG). În general, consumul este considerat sigur. Un studiu efectuat pe 49 de pacienți cu tumori solide a concluzionat că o doză echivalentă cu 3,5 până la 4 căni (28 – 32 fl. Oz) de ceai verde de 3 ori pe zi ar putea fi ușor tolerată și poate fi luată în siguranță timp de cel puțin 6 luni (56 ). Se estimează că ceaiul verde este utilizat de 6% la 8% dintre bărbați ca medicament complementar / alternativ (4,5).

Studii epidemiologice

Studiile epidemiologice au arătat că bărbații care consumă regulat ceai verde au o incidență mai mică a cancerului de prostată (57-59). Acest fapt poate contribui la observația că bărbații asiatici, cu consumul lor mult mai mare de ceai verde, au rate mai mici de cancer de prostată decât omologii lor occidentali (60).

Studii de laborator

Cercetările s-au concentrat pe rolul polifenolilor conținuți în ceaiul verde, dar mecanismul lor de acțiune nu a fost determinat. Efectele antineoplastice propuse observate includ: inhibarea enzimelor proteolitice pentru a preveni metastazele, modificările comunicării celulare și antiangiogeneza. Aceste mecanisme antitumorale necesită o expunere prelungită la ceaiul verde (61). EGCG a fost arătat atât în ​​studiile la animale cât și in vitro pentru a induce apoptoza și inhibarea creșterii celulare (62-64). La un șoarece TRAMP (care dezvoltă spontan cancerul de prostată metastatic), o fracție polifenolică izolată de ceaiul verde (polifenoli de ceai verde sau GTP) la echivalentul uman al șase căni de ceai verde pe zi, a provocat o inhibare semnificativă a cancerului de prostată și o supraviețuire crescută . GTP părea să inhibe complet metastazele sitului îndepărtat (65).

Studii clinice

Mai multe studii clinice nu au arătat niciun efect prin ceaiul verde asupra carcinomului independent de androgeni. Cu toate acestea, în aceste studii, cancerul populațiilor de pacienți ar fi putut fi prea avansat pentru a beneficia de această intervenție (61,66).

ULEI DE PEȘTE (acizi grași Omega-3)

Acizii grași Omega-3 pot fi găsiți în mod natural în uleiul de pește cu apă rece, cum ar fi macrou, somon, sardine, hamsii și ton, sau sub formă de uleiuri extrase din plante, precum semințele de in, canola sau soia. Acidul eicosapentaenoic (EPA) și acidul docosahexaenoic (DHA) se găsesc în principal în pești grași și sunt adesea denumiți acizi grași marini. Ambele pot fi sintetizate la om de la un precursor (acid alfa-linolenic). Cu toate acestea, conversia acidului alfa-linolenic în EPA sau DHA este ineficientă, consumul alimentar direct este o metodă mai eficientă de creștere a nivelului seric de acizi grași (67). Nivelurile de sânge sau țesut adipos de acizi grași omega-3 sunt corelate cu aportul de pește gras, mai degrabă decât cu aportul de acid alfa-linolenic (68). FDA recomandă ca consumul de uleiuri de pește să fie limitat la 3 grame sau mai puțin pe zi, deoarece doze mai mari pot crește riscul de sângerare (69).

Studii epidemiologice

Nu este clar că consumul de acizi grași marini poate reduce riscul de cancer de prostată (68). O analiză a dietei a 47,882 de bărbați înscriși în Studiul de urmărire a profesioniștilor din sănătate a arătat că consumul de pește de peste trei ori pe săptămână față de mai puțin de două ori pe lună s-a tradus într-un risc redus neglijabil de cancer de prostată (reducere de 7%), avansat. cancer de prostată (reducere de 17%) și un risc de cancer metastatic oarecum redus (44%) (70). Același studiu nu a găsit nicio asociere între riscul de cancer de prostată și consumul de suplimente de ulei de pește (70). În Lancet, Terry și colab. a analizat asocierea consumului de pește și riscul de cancer de prostată la 6.272 de bărbați suedezi de peste 30 de ani (71). Cei care nu au mâncat pește au avut o frecvență de două-trei ori mai mare de cancer de prostată decât cei care au mâncat fie cantități moderate, fie mari, așa cum este definit pe o scară de patru puncte, de pește gras. Într-un studiu de autopsie efectuat pe 27 de inuți (eskimosi), nu a fost găsit niciun carcinom latent de tip noninfiltrativ; doar una dintre prostatele inuite a prezentat cancer malign, iar acesta a fost la un copil de 73 de ani care avea o concentrație scăzută de acizi grași polinesaturați omega-3 (0,9% din acizii grași din țesutul adipos comparativ cu 1,79% pentru întregul grup de autopsie) . Absența carcinomului latent de tip noninfiltrativ a fost neașteptată în comparație cu incidențele de 25-35% care sunt de obicei raportate în alte populații comparabile, inclusiv asiatici. Autorii au sugerat că incidența scăzută a cancerului de prostată s-a datorat nivelurilor ridicate de seleniu și acizii grași omega-3 (72). Aceste rezultate sunt puternic contrazise de alte studii epidemiologice care nu arată nicio asociere între riscul de cancer de prostată și consumul total de pește și nici aportul de EPA sau DHA (73-75).

Studii de laborator

Spre deosebire de studiile epidemiologice, rezultatele in vitro au fost mai promițătoare. Acizii grași Omega-3 s-au dovedit a inhiba creșterea celulară și exprimarea proteinelor PSA (68). La animale, un studiu recent asupra cancerului de prostată umană la șoarecii xenografe a arătat un efect inhibitor al uleiului alimentar de pește (76).

S-a demonstrat că EPA și DHA inhibă activitatea biologică a eicosanoidelor și androgenilor, care sunt cunoscute ca având un efect stimulant asupra creșterii celulelor canceroase de prostată (70).

Studii clinice

Deși au fost făcute numeroase studii pentru prevenirea și gestionarea bolilor cardiace, nu sunt disponibile niciunul cu privire la cancerul de prostată (77).

CONCLUZIE

Pacienții cu cancer de prostată sau cei cu risc ridicat de a dezvolta boala se confruntă cu sfaturi voluminoase și adesea conflictuale despre suplimentarea nutrițională. Orice sfat pentru pacient trebuie temperat de faptul că nu există nicio dovadă definitivă că vreunul dintre suplimentele nutritive discutate poate afecta cursul cancerului de prostată sau dezvoltarea acestuia.

Grăsimea dietetică pare să aibă cel mai mare impact asupra cancerului de prostată (78). Este clar că pacienții trebuie să își mențină greutatea în 10% din indicele lor de masă corporală ideală (IMC). Se pare că există o corelație pozitivă între IMC și riscul de cancer de prostată (79,80). S-a demonstrat că consumul de carne roșie crește riscul de cancer de prostată (78). Urmând o dietă „sănătoasă pentru inimă” de proteine ​​din carne care nu sunt roșii (inclusiv peștele gras) ar putea beneficia de cei cu risc pentru dezvoltarea cancerului de prostată (81).

În ceea ce privește utilizarea suplimentului, datele nu sunt clare. Credința noastră este că pur și simplu luarea unui multivitamin standard zilnic ar trebui să fie suficient pentru a se asigura că pacienții au nivelurile adecvate de vitamine și minerale. În mod evident, suprautilizarea vitaminelor, mineralelor și suplimentelor poate duce la numeroase efecte secundare negative, precum riscul crescut de atac de cord și accident vascular cerebral (vitamina E), sângerare (vitamina E, vitamina A), scăderea acuității mintale (zinc, seleniu), anemie (zinc) și pierderea părului și a unghiilor (seleniu).

Suplimentarea este de asemenea avertizată atunci când analizăm istoricul PC-SPES (82). În 2002, aproximativ 10.000 de pacienți cu cancer de prostată foloseau acest supliment. Pacienții au utilizat produsul fără o supraveghere medicală atentă și, la acei pacienți, reacțiile adverse estrogenice (de exemplu, ginecomastie) au fost frecvente și au existat raportări de tromboză venală profundă. PC-SPES a fost găsit în mai multe teste ulterioare pentru a fi contaminat cu dietilstilbestrol (DES), etinilestradiol și warfarină, printre alți contaminanți. Contaminarea a variat în funcție de lotul examinat. Produsul a fost reamintit la începutul anului 2002, iar compania producătoare a încetat operațiunile mai târziu în acel an, dar nu după evenimentele adverse descrise (83).

Medicii trebuie să fie conștienți de ceea ce iau pacienții lor, deoarece aceste suplimente pot interfera cu absorbția și eficacitatea medicamentelor convenționale. Cu toate acestea, studiile au arătat că, de obicei, pacienții care utilizează CAM nu își informează medicul (3). Medicii trebuie să se intereseze proactiv despre utilizarea CAM. Pacienții trebuie educați cu privire la limitările și problemele de siguranță atunci când utilizează CAM. Mai multe date din studiile clinice riguroase sunt necesare pentru a răspunde la întrebarea eficacității tuturor acestor produse.

CONFLICTUL DE INTERES

Niciuna declarată.

REFERINȚE

1. Boon H, Brown JB, Gavin A, Westlake K: Bărbați cu cancer de prostată: luarea deciziilor cu privire la medicina complementară / alternativă. Luarea de decizii Med. 2003; 23: 471-9. Link-uri ]

2. Barqawi A, Gamito E, O’Donnell C, Crawford ED: consumul de suplimente pe bază de plante și vitamine la o populație de screening de cancer de prostată. Urologie. 2004; 63: 288-92. Link-uri ]

3. Wilkinson S, Gomella LG, Smith JA, Brawer MK, Dawson NA, Wajsman Z și colab .: Atitudini și utilizarea medicamentului complementar la bărbații cu cancer de prostată. J Urol. 2002; 168: 2505-9. Link-uri ]

4. Boon H, Westlake K, Stewart M, Gray R, Fleshner N, Gavin A și colab .: Utilizarea medicamentului complementar / alternativ de către bărbații diagnosticați cu cancer de prostată: prevalență și caracteristici. Urologie. 2003; 62: 849-53. Link-uri ]

5. Beebe-Dimmer JL, Wood DP, Gruber SB, Douglas JA, Bonner JD, Mohai C și colab .: Utilizarea medicamentului complementar și alternativ la bărbații cu antecedente familiale de cancer de prostată: un studiu pilot. Urologie. 2004; 63: 282-7. Link-uri ]

6. Fleshner NE: Vitamina E și cancer de prostată. Clinica Urol Nord Am. 2002; 29: 107-13. Link-uri ]

7. Miller ER 3rd, Pastor-Barriuso R, Dalal D, Riemersma RA, Appel LJ, Guallar E: Meta-analiză: suplimentarea cu doză mare de vitamina E poate crește mortalitatea pentru toate cauzele. Ann Intern Med. 2005; 142: 37-46. Link-uri ]

8. AF Badawi: Rolul sintezei prostaglandinei în cancerul de prostată. BJU Int. 2000; 85: 451-62. Link-uri ]

9. Venkateswaran V, Fleshner NE, Klotz LH: modularea proliferării celulare și a regulatorilor ciclului celular de vitamina E în liniile de celule ale carcinomului de prostată umană. J Urol. 2002; 168: 1578-82. Link-uri ]

10. Heinonen OP, Albanes D, Virtamo J, Taylor PR, Huttunen JK, Hartman AM și colab .: Cancerul de prostată și suplimentarea cu alfa-tocoferol și beta-caroten: incidență și mortalitate într-un studiu controlat. J Natl Cancer Inst. 1998; 90: 440-6. Link-uri ]

11. Zu K, Ip C: Sinergia dintre seleniu și vitamina E în inducerea apoptozei este asociată cu activarea caspazelor inițiator distinctive în celulele canceroase de prostată umane. Cancer Res. 2003; 63: 6988-95. Link-uri ]

12. Klein EA: Chimioprevenția cancerului de prostată. Crit Rev Oncol Hematol. 2005; 54: 1-10. Link-uri ]

13. Kristal AR: Vitamina A, retinoizi și carotenoizi ca agenți chimiopreventivi pentru cancerul de prostată. J Urol. 2004; 171: S54-8; discuție S58. Link-uri ]

14. Omenn GS, Goodman GE, Thornquist MD, Balmes J, Cullen MR, Glass A și colab .: Factori de risc pentru cancerul pulmonar și pentru efecte de intervenție în CARET, Beta-Caroten și Eficacitatea Retinolului. J Natl Cancer Inst. 1996; 88: 1550-9. Link-uri ]

15. Vinceti M, Wei ET, Malagoli C, Bergomi M, Vivoli G: Efecte adverse asupra sănătății seleniului la om. Rev Environ Health. 2001; 16: 233-51. Link-uri ]

16. Klein EA, Thompson IM: Actualizare privind chimioprevenția cancerului de prostată. Curr Opin Urol. 2004; 14: 143-9. Link-uri ]

17. Zhao H, Whitfield ML, Xu T, Botstein D, Brooks JD: Efecte diverse ale acidului metilseleninic asupra programului transcripțional al celulelor canceroase de prostată umane. Mol Biol Cell. 2004; 15: 506-19. Link-uri ]

18. Duffield-Lillico AJ, Dalkin BL, Reid ME, Turnbull BW, Slate EH, Jacobs ET, și alții: suplimentarea cu seleniu, starea inițială de seleniu în plasmă și incidența cancerului de prostată: o analiză a perioadei complete de tratament a prevenției nutriționale. de testare a cancerului. BJU Int. 2003; 91: 608-12. Link-uri ]

19. Yoshizawa K, Willett WC, Morris SJ, Stampfer MJ, Spiegelman D, Rimm EB și colab .: Studiul nivelului de seleniu prediagnostic la nivelul unghiilor de la picioare și al riscului de cancer avansat de prostată. J Natl Cancer Inst. 1998; 90: 1219-24. Link-uri ]

20. Fapte despre suplimentele alimentare – zinc. Serviciul de nutriție clinică. Maryland, Institutele Naționale de Sănătate. 2002; p. 1-11. Link-uri ]

21. Salzman MB, Smith EM, Koo C: Suplimentare excesivă de zinc oral. J Pediatr Hematol Oncol. 2002; 24: 582-4. Link-uri ]

22. Leitzmann MF, Stampfer MJ, Wu K, Colditz GA, Willett WC, Giovannucci EL: Utilizarea suplimentului de zinc și riscul de cancer de prostată. J Natl Cancer Inst. 2003; 95: 1004-7. Link-uri ]

23. Costello LC, Franklin RB: Rolul nou al zincului în reglarea metabolismului citratului de prostată și implicațiile acestuia în cancerul de prostată. Prostată. 1998; 35: 285-96. Link-uri ]

24. Costello LC, Feng P, Milon B, Tan M, Franklin RB: Rolul zincului în patogeneza și tratamentul cancerului de prostată: probleme critice de rezolvat. Cancerul de prostată Disostatica prostatică. 2004; 7: 111-7. Link-uri ]

25. Uzzo RG, Leavis P, Hatch W, Gabai VL, Dulin N, Zvartau N și colab .: Zincul inhibă activarea factorului nuclear-kappa B și sensibilizează celulele canceroase de prostată la agenții citotoxici. Clin Cancer Res. 2002; 8: 3579-83. Link-uri ]

26. Platz EA, Helzlsouer KJ: cancer de seleniu, zinc și prostată. Epidemiol Rev. 2001; 23: 93-101. Link-uri ]

27. EP EP Castle, Thrasher JB: Rolul fitoestrogenilor din soia în cancerul de prostată. Clinica Urol Nord Am. 2002; 29: 71-81. Link-uri ]

28. Lee MM, Gomez SL, Chang JS, Wey M, Wang RT, Hsing AW: Consumul de soia și izoflavonă în raport cu riscul de cancer de prostată în China. Biomarkeri de cancer Epidemiol Prev. 2003; 12: 665-8. Link-uri ]

29. Jacobsen BK, Knutsen SF, Fraser GE: Consumul mare de lapte de soia reduce incidența cancerului de prostată? Studiul de Sănătate Adventistă (Statele Unite) Cancerul provoacă controlul. 1998; 9: 553-7. Link-uri ]

30. Hedlund TE, Johannes WU, Miller GJ: Equolul isoflavonoidului de soia modulează creșterea in vitro a celulelor epiteliale benigne și maligne de prostată. Prostată. 2003; 54: 68-78. Link-uri ]

31. Bektic J, Berger AP, Pfeil K, Dobler G, Bartsch G, Klocker H: Reglarea receptorului androgenic prin concentrații fiziologice ale genisteinei izoflavonoide în celulele LNCaP dependente de androgeni este mediată de receptorul beta de estrogen. Eur Urol. 2004; 45: 245-51; discuție 251. [ Link-uri ]

32. Cohen LA, Zhao Z, Pittman B, Scimeca J: Efectul izolatului proteic de soia și al acidului linoleic conjugat asupra creșterii tumorilor de prostată la șobolan Dunning R-3327-AT-1. Prostată. 2003; 54: 169-80. Link-uri ]

33. Jenkins DJ, Kendall CW, D’Costa MA, Jackson CJ, Vidgen E, Singer W, și alții: Consumul de soia și fitoestrogeni: efect asupra antigenului specific de prostată serică atunci când lipidele din sânge și lipoproteina de densitate joasă oxidată sunt reduse în hiperlipidemie bărbați. J Urol. 2003; 169: 507-11. Link-uri ]

34. deVere White RW, Hackman RM, Soares SE, Beckett LA, Li Y, Sun B: Efectele unui extract bogat în genisteină asupra nivelurilor PSA la bărbații cu antecedente de cancer de prostată. Urologie. 2004; 63: 259-63. Link-uri ]

35. Adams KF, Chen C, Newton KM, Potter JD, Lampe JW: Izoflavonele de soia nu modulează concentrațiile de antigen specifice prostatei la bărbații în vârstă într-un studiu controlat aleatoriu. Biomarkeri de cancer Epidemiol Prev. 2004; 13: 644-8. Link-uri ]

36. Kumar NB, Cantor A, Allen K, Riccardi D, Besterman-Dahan K, Seigne J și colab .: Rolul specific al izoflavonelor în reducerea riscului de cancer de prostată. Prostată. 2004; 59: 141-7. Link-uri ]

37. Dalais FS, Meliala A, Wattanapenpaiboon N, Frydenberg M, Suter DA, Thomson WK și colab .: Efectele unei diete bogate în fitoestrogeni asupra antigenului specific prostatei și hormonilor sexuali la bărbații diagnosticați cu cancer de prostată. Urologie. 2004; 64: 510-5. Link-uri ]

38. Holzbeierlein JM, McIntosh J, Thrasher JB: Rolul fitoestrogenilor din soia în cancerul de prostată. Curr Opin Urol. 2005; 15: 17-22. Link-uri ]

39. Miller EC, Giovannucci E, Erdman JW Jr, Bahnson R, Schwartz SJ, Clinton SK: Produse de tomate, licopen și risc de cancer de prostată. Clinica Urol Nord Am. 2002; 29: 83-93. Link-uri ]

40. Giovannucci E: Produse de tomate, licopen și cancer de prostată: o revizuire a literaturii epidemiologice. J Nutr. 2005; 135: 2030S-1S. Link-uri ]

41. Etminan M, Takkouche B, Caamano-Isorna F: Rolul produselor de tomate și licopen în prevenirea cancerului de prostată: o meta-analiză a studiilor observaționale. Biomarkeri de cancer Epidemiol Prev. 2004; 13: 340-5. Link-uri ]

42. Gann PH, Ma J, Giovannucci E, Willett W, Sacks FM, Hennekens CH, ș.a .: Risc mai mic de cancer de prostată la bărbații cu niveluri plasmatice crescute de licopen: rezultatele unei analize prospective. Cancer Res. 1999; 59: 1225-30. Link-uri ]

43. Giovannucci E, Ascherio A, Rimm EB, Stampfer MJ, Colditz GA, Willett WC: Aportul de carotenoizi și retinol în raport cu riscul de cancer de prostată. J Natl Cancer Inst. 1995; 87: 1767-76. Link-uri ]

44. Wu K, Erdman JW Jr, Schwartz SJ, Platz EA, Leitzmann M, Clinton SK, și alții: plasmă și carotenoizi dietetici și riscul de cancer de prostată: un studiu de control al cazului cuibărit. Biomarkeri de cancer Epidemiol Prev. 2004; 13: 260-9. Link-uri ]

45. Boileau TW, Liao Z, Kim S, Lemeshow S, Erdman JW Jr, Clinton SK: Carcinogeneza de prostată în N-metil-N-nitrosourea (NMU) -sobolane tratate cu șobolani tratate cu tomate, licopen sau în diete cu restricții energetice . J Natl Cancer Inst. 2003; 95: 1578-86. Link-uri ]

46. ​​Pastori M, Pfander H, Boscoboinik D, Azzi A: Licopenul în asociere cu alfa-tocoferolul inhibă în concentrații fiziologice proliferarea celulelor carcinomului de prostată. Biochem Biophys Res Comun. 1998; 250: 582-5. Link-uri ]

47. Limpens J, van Weerden WM, Kramer K, Pallapies D, Obermuller-Jevic UC, Schroder FH: Re: Carcinogeneză de prostată în N-metil-N-nitrosourea (NMU) -sobișe tratate cu testosteron cu pulberi de tomate, licopen sau diete cu restricții energetice. J Natl Cancer Inst. 2004; 96: 554; răspunsul autorului 554-5. Link-uri ]

48. Chan JM, Stampfer MJ, Giovannucci E, Ma J, Pollak M: Factorul de creștere asemănător insulinei (IGF-I), proteina de legare la IGF-3 și riscul de cancer de prostată: studii epidemiologice. Hormă de creștere IGF Res. 2000; 10 (supliment A): S32-3. Link-uri ]

49. Kucuk O, Sarkar FH, Djuric Z, Sakr W, Pollak MN, Khachik F și colab .: Efectele suplimentării licopenului la pacienții cu cancer de prostată localizat. Exp Biol Med (Maywood). 2002; 227: 881-5. Link-uri ]

50. Gil MI, Tomas-Barberan FA, Hess-Pierce B, Holcroft DM, Kader AA: Activitatea antioxidantă a sucului de rodie și relația sa cu compoziția și prelucrarea fenolică. J Agric Food Chem. 2000; 48: 4581-9. Link-uri ]

51. Toi M, Bando H, Ramachandran C, Melnick SJ, Imai A, Fife RS și colab .: Studii preliminare asupra potențialului anti-angiogenic al fracțiilor de rodie in vitro și in vivo. Angiogenezei. 2003; 6: 121-8. Link-uri ]

52. EP Lansky, Jiang W, Mo H, Bravo L, Froom P, Yu W și colab .: Posibile reprimări sinergice ale cancerului de prostată prin fracțiuni de rodie discrete anatomic. Investiți noi medicamente. 2005; 23: 11-20. Link-uri ]

53. EP Lansky, Harrison G, Froom P, Jiang WG: Rodegate (Punica granatum) substanțe chimice pure arată o posibilă inhibare sinergică a invaziei umane de celule de cancer de prostată PC-3 în Matrigel. Investiți noi medicamente. 2005; 23: 121-2. Link-uri ]

54. Seeram NP, Adams LS, Henning SM, Niu Y, Zhang Y, Nair MG și colab .: Activități in vitro antiproliferative, apoptotice și antioxidante ale punicalaginului, acidului elagic și a unui extract total de tanin din rodie sunt îmbunătățite în combinație cu alte polifenole așa cum se găsește în sucul de rodie. J Nutr Biochem. 2005; 16: 360-7. Link-uri ]

55. Pantuck AJ, Leppert JT, Zomorodian N, Seeram N, Seiler D, Liker H: Studiul de faza II a sucului de rodie pentru bărbații cu PSA în creștere în urma intervenției chirurgicale sau a radiațiilor pentru cancer de prostată. J Urol. 2005; 173 (supliment 4): 225-6. Rezumat 831. [ Link-uri ]

56. Pisters KM, Newman RA, Coldman B, Shin DM, Khuri FR, Hong WK ​​și colab .: Procesul de fază I a extractului de ceai verde oral la pacienții adulți cu tumori solide. J Clin Oncol. 2001; 19: 1830-8. Link-uri ]

57. Heilbrun LK, Nomura A, Stemmermann GN: consum de ceai negru și risc de cancer: un studiu prospectiv. Br J Rac. 1986; 54: 677-83. Link-uri ]

58. Jian L, Xie LP, Lee AH, Binns CW: Efectul protector al ceaiului verde împotriva cancerului de prostată: un studiu de caz de control în sud-estul Chinei. Int J Rac. 2004; 108: 130-5. Link-uri ]

59. Jain MG, Hislop GT, Howe GR, Burch JD, Ghadirian P: consumul de alcool și alte băuturi și riscul de cancer de prostată în rândul bărbaților canadieni. Int J Rac. 1998; 78: 707-11. Link-uri ]

60. Gupta S, Mukhtar H: ceai verde și cancer de prostată. Clinica Urol Nord Am. 2002; 29: 49-57. Link-uri ]

61. Jatoi A, Ellison N, Burch PA, Sloan JA, Dakhil SR, Novotny P și colab .: Un studiu de faza II a ceaiului verde în tratamentul pacienților cu carcinom cu metastază independentă de metastază androgenă. Cancer. 2003; 97: 1442-6. Link-uri ]

62. Adhami VM, Ahmad N, Mukhtar H: ținte moleculare pentru ceaiul verde în prevenirea cancerului de prostată. J Nutr. 2003; 133 (supliment 7): 2417S-24S. Link-uri ]

63. Park OJ, Surh YJ: Potențialul chimiopreventiv al epatelor galate și genisteinei: dovezi din studii epidemiologice și de laborator. Toxicol Lett. 2004; 150: 43-56. Link-uri ]

64. Paschka AG, Butler R, Young CY: Inducerea apoptozei în liniile celulare de cancer de prostată de componenta ceaiului verde, (-) – epigalocatechin-3-galate. Cancer Lett. 1998; 130: 1-7. Link-uri ]

65. Gupta S, Hastak K, Ahmad N, Lewin JS, Mukhtar H: Inhibarea carcinogenezei prostatei la șoarecii TRAMP prin infuzie orală de polifenoli de ceai verde. Proc Natl Acad Sci SUA A. 2001; 98: 10350-5. Link-uri ]

66. Choan E, Segal R, Jonker D, Malone S, Reaume N, Eapen L și colab .: Un studiu clinic potențial de ceai verde pentru cancerul de prostată refractar hormonal: o evaluare a abordării terapeutice complementare / alternative. Urol Oncol. 2005; 23: 108-13. Link-uri ]

67. Terry PD, Terry JB, Rohan TE: aport de acizi grași cu lanț lung (n-3) și risc de cancere ale sânului și prostatei: studii epidemiologice recente, mecanisme biologice și indicații pentru cercetările viitoare. J Nutr. 2004; 134 (supliment 12): 3412S-20S. Link-uri ]

68. Astorg P: Acizi grași polinesaturați N-6 și N-3 dietetici și risc de cancer de prostată: o revizuire a dovezilor epidemiologice și experimentale. Cancerul provoacă controlul. 2004; 15: 367-86. Link-uri ]

69. Lewis CJ: Scrisoare privind cererea de sănătate a suplimentului alimentar pentru acizii grași omega-3 și bolile coronariene. FDA Nr. 91N-0103. 2000. Administrația SUA pentru Alimente și Droguri. [ Linkuri ]
http://vm.cfsan.fda.gov/~dms/ds-ltr11.html

70. Augustsson K, Michaud DS, Rimm EB, Leitzmann MF, Stampfer MJ, Willett WC și colab .: Un studiu prospectiv asupra aportului de pește și acizi grași marini și cancer de prostată. Biomarkeri de cancer Epidemiol Prev. 2003; 12: 64-7. Link-uri ]

71. Terry P, Lichtenstein P, Feychting M, Ahlbom A, Wolk A: consum de pește gras și risc de cancer de prostată. Lancet. 2001; 357: 1764-6. Link-uri ]

72. Dewailly E, Mulvad G, Sloth Pedersen H, Hansen JC, Behrendt N, Hart Hansen JP: Inuții sunt protejați împotriva cancerului de prostată. Biomarkeri de cancer Epidemiol Prev. 2003; 12: 926-7. Link-uri ]

73. Gann PH, Hennekens CH, Sacks FM, Grodstein F, Giovannucci EL, Stampfer MJ: Studiu prospectiv al acizilor grași din plasmă și al riscului de cancer de prostată. J Natl Cancer Inst. 1994; 86: 281-6. Erratum în: J Natl Cancer Inst 1994; 86: 728. [ Link-uri ]

74. Schuurman AG, van den Brandt PA, Dorant E, Brants HA, Goldbohm RA: Asocierea aportului de energie și grăsimi cu risc de carcinom de prostată: rezultate din Studiul de cohortă olandez. Cancer. 1999; 86: 1019-27. Link-uri ]

75. Schuurman AG, van den Brandt PA, Dorant E, Goldbohm RA: Produse de origine animală, risc de calciu și proteine ​​și cancer de prostată în Studiul de cohortă olandez. Br J Rac. 1999; 80: 1107-13. Link-uri ]

76. Kobayashi N, Leung P, Hong J, Barnard RJ, Freedland SJ, Elashoff D și colab .: Efectul inhibitor al uleiului alimentar de pește (acizi grași omega-3) asupra progresiei cancerului de prostată umană la șoarecii imunodeficienți combinați sever. J Urol. 2005; 173 (supliment 4): Rezumat 249, 68. [ Link-uri ]

77. Kris-Etherton PM, Harris WS, Appel LJ, Comitetul pentru nutriție: consum de pește, ulei de pește, acizi grași omega-3 și boli cardiovasculare. Arterioscler Tromb Vasc Biol. 2003; 23: e20-30. Erratum în: Arterioscler Tromb Vasc Biol. 2003; 23: e31. Link-uri ]

78. Stoeckli R, Keller U: grăsimi nutritive și riscul de diabet de tip 2 și cancer. Fiziol Behav. 2004; 83: 611-5. Link-uri ]

79. Andersson SO, Wolk A, Bergstrom R, Adami HO, Engholm G, Englund A și colab .: Mărimea corpului și cancerul de prostată: un studiu de urmărire de 20 de ani între 135006 lucrători din construcții suedeze. J Natl Cancer Inst. 1997; 89: 385-9. Link-uri ]

80. Bradbury BD, Wilk JB, Kaye JA: Obezitatea și riscul de cancer de prostată (Statele Unite). Cancerul provoacă controlul. 2005; 16: 637-41. Link-uri ]

81. Moyad MA: Reducerea grăsimilor dietetice pentru reducerea riscului de cancer de prostată: entuziasm controlat, învățarea unei lecții de la sân sau alte tipuri de cancer și imaginea de ansamblu. Urologie. 2002; 59 (supliment 1): 51-62. Link-uri ]

82. Kosty MP: PC-SPES: speranță sau hype? J Clin Oncol. 2004; 22: 3657-9. Link-uri ]

83. Marcaje LS, DiPaola RS, Nelson P, Chen S, Heber D, Belldegrun AS și colab .: PC-SPES: formulare pe bază de plante pentru cancer de prostată. Urologie. 2002; 60: 369-75; discuție 376-7. Link-uri ]

Adresa de corespondență:
Dr. Franklin C. Lowe
171 W 71st St.
New York, NY 10023, SUA
E-mail: fclowemd@aol.com

Acceptat:
12 septembrie 2005

Cancerul de prostată și suplimentarea cu alfa-tocoferol și beta-caroten: incidență și mortalitate într-un studiu controlat.

 1998 18 martie; 90 (6): 440-6.

1
Departamentul de Sănătate Publică, Universitatea din Helsinki, Finlanda.

Abstract

FUNDAL:

Studiile epidemiologice au sugerat că vitamina E și beta-caroten pot influența fiecare dezvoltarea cancerului de prostată. În Studiul de prevenire a cancerului beta-caroten, Alpha-Tocopherol, un studiu controlat, am studiat efectul alfa-tocoferolului (o formă de vitamina E) și a suplimentării de beta-caroten, separat sau împreună, asupra cancerului de prostată la fumătorii de sex masculin.

METODE:

Un total de 29133 fumători de sex masculin cu vârsta cuprinsă între 50 și 69 de ani din sud-vestul Finlandei au fost repartizați la întâmplare pentru a primi alfa-tocoferol (50 mg), beta-caroten (20 mg), ambii agenți sau placebo zilnic timp de 5-8 ani (median, 6,1 ani). Efectele suplimentării au fost estimate printr-un model de riscuri proporționale și s-au calculat valorile P față-verso.

REZULTATE:

Am găsit 246 de cazuri noi și 62 de decese cauzate de cancer de prostată în perioada de urmărire. O scădere de 32% (95% interval de încredere [CI] = -47% până la -12%) în incidența cancerului de prostată a fost observată la subiecții care au primit alfa-tocoferol (n = 14564) comparativ cu cei care nu au primit-o (n = 14569). Reducerea a fost evidentă în cancerul de prostată clinic, dar nu și în cel latent. Mortalitatea cauzată de cancerul de prostată a fost cu 41% mai mică (IC 95% = -65% la -1%) în rândul bărbaților care au primit alfa-tocoferol. Printre subiecții care au primit beta-caroten (n = 14560), incidența cancerului de prostată a fost cu 23% mai mare (IC 95% = -4% -59%), iar mortalitatea a fost cu 15% mai mare (IC 95% = -30% -89%). comparativ cu cei care nu o primesc (n = 14573). Niciun agent nu a avut niciun efect asupra intervalului de timp dintre diagnostic și moarte.

CONCLUZII:

Suplimentarea pe termen lung cu alfa-tocoferol a redus substanțial incidența cancerului de prostată și mortalitatea la fumătorii de sex masculin. Alte teste controlate sunt necesare pentru a confirma rezultatele.

PMID: 
9521168 
DOI: 
10.1093 / JNCI / 90.6.440

Studiu clinic faza 2 RODIE pe bărbați cu PSA in crestere in urma chirurgiei sau a radierii

CANCERUL DE PROSTATA Allan J Pantuck *, John T Leppert, Nazy
Zomorodian, Navindra Seeram, Daniel Seiler, Harley Liker, He-jing Wang,
Robert Elashoff, David Heber, Arie S Belldegrun, Los Angeles, CA

INTRODUCERE ȘI OBIECTIV: Fitochimice în plante comestibile pot
avea beneficii de prevenire a cancerului prin antioxidare și prin interacțiuni gene.

Sucul de rodie s-a dovedit a fi o sursă bogată de polifenolice – flavonoide. Datele pre-clinice au sugerat capacitatea sucului de rodie de a modula creșterea și evoluția cancerului de prostată. Pentru a masura efectele clinice ale  sucului de rodie la pacienții cu cancer de prostată, a fost efectuat un studiu clinic.
METODE: Un studiu de 2 ani, unic centru, faza II, un studiu clinic Simon cu două etape pentru bărbații cu PSA în creștere după operație sau radioterapie a fost proiectat pe baza a 20% rata de răspuns, o alfa de 5% și o putere de 90%. Pacienții eligibili aveau un detectabil PSA mai mare de 0,2 ng / ml și mai puțin de 5 ng / ml și un scor Gleason de 7 sau mai puțin.
Măsurătorile PSA în serie au determinat dublarea duratei de PSA. Pacienții au fost
tratati cu 8 uncii de suc de rodie pe zi pe gură (soi minunat, echivalentul a 1,5 mmol din totalul polifenolilor pe zi) până la progresia bolii.
Obiectivele clinice au inclus siguranța, efectul asupra PSA seric și explorator
studii de laborator. Pacienții au fost urmăriți la intervale de 3 luni pentru PSA seric și
sânge și urină au fost colectate pentru studii de laborator.
REZULTATE: Studiul a fost acumulat pe deplin la 48 de participanți în două etape după
ce criteriile de eficacitate au fost îndeplinite.

Nu au fost raportate evenimente adverse grave și tratamentul a fost bine tolerat.

Pe durata de  studiu nu s-a dezvoltat boală metastatică. 
Durata de dublare a PSA a crescut semnificativ cu tratamentul, de la 14 la 26 de luni(p <0,048). Panta medie PSA log a scăzut de la 0,08 la 0,04 mai departe
tratament (p <0,019). Analize in vitro folosind serul pacientului pre și post tratament pe
creșterea LNCaP a arătat o scădere a proliferării celulare și creșterea apoptozei
(P <0,07). Polifenolii de rodie au fost detectați în urina tuturor participanților de
LC-MS.
CONCLUZII: Raportăm primul studiu clinic al sucului de rodie pe
pacienți cu cancer de prostată recurent.

Beneficiul pozitiv și semnificativ efecte asupra parametrilor PSA obținuți, împreună cu efectele de laborator corespunzătoare pentru cancerul de prostată în vitro sustin acestea! recomandam testări ulterioare în in studiu randomizat, controlat cu placebo, în faza III.
Sursa finanțării: Roll International

Inversarea rezistenței clinice la analogul LHRH în cancerul de prostată metastatic de către hormonul pineal MELATONINA: eficacitatea analogului LHRH plus Melatonina la pacienții care progresează numai cu analogul LHRH.

 1997; 31 (2): 178-81.
1
Divizia de Oncologie Radiativă, Spitalul San Gerardo, Monza, Milano, Italia.

Abstract

OBIECTIV:

Studiile clinice experimentale și preliminare au sugerat că melatonina hormonală pineală (MLT) poate stimula exprimarea receptorului hormonal atât pe celulele normale, cât și pe celulele canceroase. Mai mult decât atât, MLT a părut să inhibe creșterea unor linii de celule canceroase, inclusiv cancerul de prostată, fie prin exercitarea unei acțiuni citostatice directe, fie prin scăderea producției endogene a unor factori de creștere a tumorii, cum ar fi prolactina (PRL) și creșterea asemănătoare insulinei. factorul 1 (IGF-1). Pe această bază, a fost efectuat un studiu pentru a evalua eficacitatea clinică a unei combinații de neuroendocrine constând în analogul LHRH triptorelin plus MLT în cancerul de prostată metastatic care progresează doar pe triptorelină.

MATERIAL SI METODE:

Studiul a cuprins 14 pacienți consecutivi cu cancer de prostată metastatic cu condiții clinice slabe (vârsta medie: 70,5 ani; PS mediană: 50%), refractar sau rezistent la o terapie anterioară cu analogul LHRH triptorelin singur. Triptorelin a fost injectat im la 3,75 mg la fiecare 28 de zile, iar MLT a fost administrat oral la 20 mg / zi seara în fiecare zi până la progresie, începând cu 7 zile înainte de triptorelină.

REZULTATE ȘI CONCLUZII:

O scădere a nivelurilor de ser PSA mai mari de 50% a fost obținută la 8/14 (57%) pacienți. Mai mult decât atât, concentrațiile medii ale PSA au scăzut semnificativ la terapia cu triptorelină și MLT. În plus, a fost obținută o normalizare a numărului de trombocite la 3/5 pacienți cu trombocitopenie persistentă înainte de studiu. Nivelurile serice medii ale PRL și IGF-1 au scăzut semnificativ la terapie. În cele din urmă, o supraviețuire mai mare de 1 an a fost obținută la 9/14 (64%) pacienți. Acest studiu preliminar ar sugera că administrarea concomitentă a hormonului pineal MLT poate depăși rezistența clinică la analogii LHRH și poate îmbunătăți condițiile clinice la pacienții cu cancer de prostată metastazici.

PMID: 
9076462 
DOI: 
10.1159 / 000474446
[Indexat pentru MEDLINE]

O estimare a mortalității premature de cancer în SUA din cauza dozelor inadecvate de radiații solare ultraviolete-B

 2002 15 martie; 94 (6): 1867-75.
Grant WB 1 .
1wbgrant@infi.net

Abstract

FUNDAL:

Există gradienți geografici mari ai ratelor de mortalitate pentru un număr de cancer în SUA (de exemplu, ratele sunt aproximativ de două ori mai mari în nord-est comparativ cu sud-vestul). Factorii de risc, cum ar fi dieta, nu explică această variație. Studii anterioare au demonstrat că distribuțiile geografice pentru cinci tipuri de cancer sunt legate invers de radiațiile solare. Scopul studiului actual a fost de a determina câte tipuri de cancer sunt afectate de radiațiile solare și câte decese premature cauzate de cancer se datorează radiațiilor ultraviolete (UV) insuficiente.

METODE:

Datele UV-B din iulie 1992 și ratele mortalității prin cancer în SUA pentru anii 1970-1994 au fost analizate într-un studiu ecologic.

REZULTATE:

Rezultatele studiului actual confirmă rezultatele anterioare că radiațiile solare UV-B sunt asociate cu un risc redus de cancer la sân, colon, ovar și prostată, precum și limfom non-Hodgkin. S-a constatat că alte malignități suplimentare prezintă o corelație inversă între ratele de mortalitate și radiațiile UV-B: vezică, esofagian, rinichi, plămâni, pancreatic, rectal, stomac și corpus uteri. Numărul anual de decese premature cauzate de cancer din cauza expunerilor mai mici la UV-B a fost de 21.700 (95% interval de încredere [95% CI], 20.400-23.400) pentru americanii albi, 1400 (95% CI, 1100-1600) pentru americanii de culoare, și 500 (IC 95%, 400-600) pentru americanii asiatici și alte minorități.

CONCLUZII:

Rezultatele studiului actual demonstrează că o mare parte din variația geografică a ratelor mortalității prin cancer în SUA poate fi atribuită variațiilor expunerii la radiații solare la radiații UV-B. Astfel, multe vieți ar putea fi prelungite printr-o expunere crescută atentă la radiațiile solare UV-B și mai în siguranță, suplimentarea cu vitamina D3, în special în lunile de non-vara.

PMID: 
11920550 
DOI: 
10.1002 / cncr.10427
[Indexat pentru MEDLINE] 

Text complet complet

Un studiu ecologic multicanal al factorilor de reducere a riscului pentru mortalitatea prin cancer de prostată

William B. Grant ∗, ‘Informații despre corespondență despre autor William B. GrantE-mail pe autor William B. Grantlink
12 Sir Francis Wyatt Place, Newport News, VA 23606-3660, SUA
Metrici PlumX
DOI: https://doi.org/10.1016/j.eururo.2003.08.018
Abstract

Abstract
Obiectiv: Scopul acestei cercetări este de a identifica și determina importanța relativă a riscurilor dietetice și  de mediu și a factorilor de reducere a riscului pentru mortalitatea prin cancer de prostată

Materiale și metode: O abordare ecologică multi-țară a fost utilizată în analizele de regresie multivariate cu rate de mortalitate prin cancer de prostată și factori dietetici și radiații solare ultraviolete B (UV-B). Ratele mortalității prin cancer de prostată pentru 32 de țări predominant caucaziene la sfârșitul anilor 1990 au fost obținute de la Organizația Mondială a Sănătății. Datele de aprovizionare dietetică au fost obținute de la Organizația pentru Alimentație și Agricultură. Datele anuale solare UV-B privind doza au fost obținute de la stațiile terestre europene și au fost utilizate pentru a estima valorile în altă parte. Au fost efectuate analize de regresie liniară și multiplă pentru toate cele 32 de țări, precum și pentru cele 20 de țări europene.

Rezultate: Cel mai puternic factor de risc pentru mortalitatea prin cancer de prostată au fost produsele de origine animală, porțiunea de lapte slab și alcool fiind ceva mai slabe; cei mai puternici factori de reducere a riscului au fost ceapa, alte produse vegetale de protecție (exclusiv alcoolul, uleiurile și îndulcitorii) și radiațiile solare UV-B(lumina solara ce induce vitamina D3). Datele dietetice pentru 1979–81 au dat cele mai mari corelații.

Concluzii: Aceste rezultate sunt în concordanță cu factorul I de creștere asemănător insulinei (IGF-I), fiind un factor de risc important pentru cancerul de prostată, alcoolul și calciul fiind factori de risc mai puțin importanți și legumele de familie alium(ceapa usturoi) și vitamina D fiind factori importanți de reducere a riscului. Aceste rezultate ar trebui să ofere îndrumări pentru studii suplimentare privind legăturile dietetice și de mediu cu cancerul de prostată.

 

Riscul de cancer de prostată și nivelurile serice prediagnostice de 25 de hidroxivitamină D (Finlanda)

 2000 Oct; 11 (9): 847-52.

1
Universitatea din Tampere, Școala Medicală, Finlanda.

Abstract

OBIECTIVE:

Scopul a fost evaluarea asocierii dintre nivelul seric de vitamina D (25-hidroxivitamina D) și riscul de cancer de prostată.

METODE:

Studiul de caz curat s-a bazat pe o monitorizare de 13 ani de aproximativ 19.000 de bărbați de vârstă mijlocie, care au participat la prima vizită de screening în cadrul Studiului de inimă din Helsinki și au fost lipsiți de cancer de prostată verificat clinic la început. Prin legătura record cu dosarele Registrului finlandez al cancerului, 149 de cazuri de cancer de prostată au fost identificate în cohortă. Au fost potriviți (1: 4) la controale de probă de densitate de probabilitate pentru vârstă, timp de prelevare de probe și reședință. Nivelurile serice de 25-hidroxivitamină D (25-VD) la intrare au fost măsurate pentru cazuri și controale. Riscurile relative ale cancerului de prostată au fost derivate folosind analiza regresivă logistică condiționată.

REZULTATE:

Riscul de cancer de prostată, analizat prin quartile nivelurilor de 25 VD, a fost invers legat de 25 VD. Bărbații cu concentrație de 25 VD sub mediană au avut un risc relativ ajustat (OR) de 1,7 în comparație cu bărbații cu un nivel de 25 VD peste median. Riscul de cancer de prostată a fost cel mai mare în rândul bărbaților mai tineri (<52 de ani) la intrare și a scăzut la 25-VD seric (OR 3.1 neadaptat și 3,5 ajustat). Dintre acei bărbați mai tineri (<52 de ani), scăderea 25 VD a implicat un risc mai mare de cancere non-localizate (SAU 6.3). Vârsta medie la diagnosticul pacienților cu concentrație de 25 VD peste mediană a fost de 1,8 ani mai mare decât cea a pacienților cu vitamina D sub mediană (63,1 față de 61,3 ani).

CONCLUZII:

Concluzionăm că nivelurile scăzute de 25 hidroxiVitamina D sunt asociate cu un risc crescut pentru expunerea anterioară ulterioară și dezvoltarea mai agresivă a cancerului de prostată, în special înainte de andropauză.

PMID: 
11075874 
DOI: 
10.1023 / a: 1008923802001
[Indexat pentru MEDLINE]