Arhive etichetă | covid19

Virgiliu Gheorghe: Ideea de obligativitate și certificat mi se pare a fi esența celei mai bine puse la punct dictaturi din toate timpurile. Simplul fapt al controlui total al persoanei prin codul QR este suficient pentru mine ca să nu accept vaccinarea

De vorbă cu dr. bioetician Virgiliu Gheorghe

Vaccinarea anti-COVID a generat cea mai mediatizată și polarizată controversă din istoria medicinei. De o parte sunt cei care promovează cu insistență vaccinarea ca fiind soluția ideală și unică pentru imunizare și revenirea la normal. De cealaltă parte îi aflăm pe cei care semnalează cu îngrijorare un număr considerabil de decese datorate vaccinului, precum și efecte secundare grave, fără precedent în istoria vaccinării. Din păcate, dezbaterile reale, obiective, bazate pe interpretarea datelor științifice și statistice, care să permită o informare adevărată a oamenilor, lipsesc din spațiul public.

L-am invitat pe domnul dr. bioetician Virgiliu Gheorghe să ne expună opiniile sale pe această temă, în speranța că ne va ajuta să aflăm dacă vaccinarea este, într-adevăr, calea ideală pentru imunizare în lupta cu coronavirusul. (M.C.)

– Domnule Virgiliu Gheorghe, cum vedeți măsurile de protecție împotriva contaminării cu noua tulpină Omicron a virusului COVID-19?

– Nu știu la ce măsuri vă referiți. În afara măștii – care și-a dovedit ineficiența –, altă măsură nu văd, decât stârnirea panicii prin mass-media și promovarea unicei soluții salvatoare, vaccinarea. Dacă însă vaccinarea ar fi fost soluția, nu ar mai fi existat virusul, căci s-ar fi stins epidemia în momentul în care ar fi fost atinsă o masă critică de persoane vaccinate. Din păcate, lucrurile stau cu tot altfel. Aud de peste tot că persoanele vaccinate, la nici două săptămâni de la vaccinare, încep să transmită virusul, iar acest lucru este valabil mai ales după cel de-al doilea rapel. Nu cu mult timp în urmă, am vorbit cu o prietenă din Anglia, care îmi spunea că în clasa copiilor ei de liceu au fost vaccinați mai toți elevii, în afara câtorva care proveneau din estul Europei. Ei bine, la o săptămână, zece din copiii vaccinați au făcut COVID și i-au contaminat și pe cei nevaccinați, care au dus virusul acasă, la părinți.

– Și, totuși, vaccinul nu poate asigura o anumită protecție, așa încât să se facă o formă mai ușoară a bolii?

– Din primele statistici așa reieșea, dar suntem nevoiți să punem la îndoială veridicitatea lor, atâta timp cât în Israel, de pildă, potrivit declarațiilor doctorului Koibi Haviv de pe Channel 13, 95% din cazurile severe de COVID sunt din rândul vaccinaților, iar 85%-95% dintre cei spitalizați sunt vaccinați1 – procente identice cu cele din Australia2. Contagiozitatea vaccinaților a fost demonstrată cu prisosință recent, într-un studiu publicat în The Lancet3. Unde este, așadar, eficiența vaccinului?

Aceeași situație se întâlnește și în Anglia, ca și în alte țări unde vaccinarea a atins rate ridicate. Și este normal, atâta timp cât pentru tulpina Delta s-a constatat un titru viral de 251 de ori mai mare la cei vaccinați decât la cei nevaccinați, care au trecut prin boală în anul 2020, contaminați cu primele tulpini virale4. Dar acum a apărut varianta Omicron, și contaminările vaccinaților sunt încă mai mari. Așadar, la ce a folosit vaccinul, dacă nu e valabil mai mult de un sezon? Oricum, același studiu arată că, pentru cei vaccinați, riscul de-a se infecta cu COVID este de 27 ori mai mare, iar cel de-a face o formă gravă de COVID, de 8 ori mai mare decât la cei care au dezvoltat o imunitate naturală după ce au trecut prin boală.

– Vorbiți de anticorpii anti-Covid?

– Nu este vorba numai de anticorpi, ci de imunitatea celulară care rămâne și după ce anticorpii dispar. Există o astfel de memorie a limfocitelor T, care poate fi regăsită și după unul sau doi ani, cel puțin așa arată studiile de până acum. Există o analiză specifică de sensibilizare limfocitară care poate pune în evidență această imunitate, dacă există sau nu. Eu personal nu am cunoscut persoane care să fi făcut boala, iar acum să fi trecut printr-o formă severă. Cea mai bună garanție a imunizării pe termen lung este, prin urmare, însăși trecerea prin boală. Pentru aceasta însă trebuie să existe în farmacii tratamente eficiente la dispoziția populației, iar medicii să fie pregătiți, ca să știe cum să trateze boala. Până acum, nimeni nu i-a informat privind protocolul terapeutic care trebuie folosit, de aceea se pot constata cele mai ciudate moduri de abordare.

– De ce credeți că nu s-au făcut astfel de sesiuni de pregătire a medicilor, în contextul în care ne confruntăm cu cea mai mare pandemie din istoria omenirii?

– Din păcate, nici la noi, nici în alte părți ale lumii nu s-a făcut mare lucru pentru informarea medicilor. Ba, mai mult, în unele țări chiar li s-a interzis să folosească antivirale eficiente precum Hidroxichloroquina și Ivermectina. Peste tot s-a recomandat Paracetamolul și să stea omul acasă, ca să vadă dacă se agravează boala sau nu. Ai sentimentul că oamenii au fost lăsați să facă forme grave parcă special pentru a ajunge la spital, a crește mortalitatea și a se justifica vaccinarea. Altfel cum s-ar putea explica? În afară de dezinfecția mâinilor și purtarea măștii, nu a existat nici o recomandare privind consumul de vitamine și minerale pentru a se preveni formele grave, deși studiile arătau eficiența acestora.

Efecte secundare grave ale vaccinurilor

– Există tot mai multe luări de poziție împotriva vaccinurilor, ca și studii care le contestă, din pricina mulțimii efectelor adverse. Care este cauza acestor efecte adverse?

– În primul rând, nu știm ce conțin aceste vaccinuri. Se ține secret acest lucru, de parcă nu ar trebui să ne privească și pe noi cu ce ne injectăm. În Japonia au descoperit în vaccinuri tot felul de substanțe, cu o diversitate de până la 10 tipuri diferite de vaccinuri. Unele erau pur și simplu placebo, ceea ce explică faptul că unii suferă efecte adverse grave, iar alții nu fac nici măcar anticorpi. Astfel că au refuzat loturi însumând un număr de 2.600.000 de vaccinuri!

Așadar, nici măcar nu știm dacă toate vaccinurile conțin aceeași substanță. Pe de altă parte, efectele adverse sunt, se pare, mai mari decât în cazul oricărui alt vaccin din istoria vaccinării. Voi menționa doar câteva.

Într-un studiu5 publicat în Statele Unite se arată că vaccinarea inițiază o cascadă proinflamatorie care poate duce la modificări neurologice și la agravarea cancerelor, în condițiile în care se știe că inflamația este cel mai bun mediu pentru proliferarea tumorală.

Dacă luăm în considerare datele oficiale de până în 17 septembrie 2021 ale VAERS de la CDC din Statele Unite, 726.963 de persoane au suferit efecte secundare grave, incluzând accidente vasculare cerebrale, insuficiență cardiacă, cheaguri de sânge, tulburări cerebrale, convulsii, crize, inflamații ale creierului și măduvei spinării, reacții alergice care pun în pericol viața, boli autoimune, artrită, avort spontan, infertilitate, miastenie (slăbiciune musculară) cu debut rapid, surditate, orbire, narcolepsie și cataplexie6.

În privința deceselor, Jane Doe, specialist în fraude medicale, a constatat în declarațiile VAERS7 o subevaluare a cazurilor reale de morți de cel puțin 5 ori! Așadar, dacă luăm în considerare numărul de morți înregistrați oficial la VAERS, vom ajunge la cifra de 76.000 de persoane decedate ca urmare a vaccinării până în data de 17 septembrie 2021.https://1c86411d09a334f8f01805364ff445ce.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

În același timp, se știe că decesele care survin până în ziua a 14-a după vaccinare nu sunt acceptate ca fiind legate de vaccin, ceea ce este o aberație. Adică, imediat după vaccinare i se face omului rău și moare în aceeași seară sau a doua zi, și asta este socotită… coincidență!

– De ce până în a 14-a zi după vaccinare nu se consideră efecte adverse?

– Singurul motiv pare a fi acela că în primele două săptămâni se înregistrează cea mai mare rată a mortalității. De exemplu, din baza de date a unui centru național de îngrijiri medicale din America (Centers for Medicare & Medicaid Service ‒ CMS), rezultă că, în urma vaccinării, au murit în primele 14 zile 19.400 persoane cu vârste de până în 81 de ani și 28.065 de persoane cu vârste de peste 81 de ani, adică 47.465 de persoane la un eșantion de 59 de milioane de persoane, câte erau înscrise în această bază de date, ceea ce reprezintă aproximativ 20% din populația Americii8. Dacă înmulțim cu cinci aceste cifre, aflăm numărul real al morților în primele 14 zile după vaccinare în Statele Unite, adică în jur de 237.325 de persoane. Dacă din aceștia scădem media mortalității pe ultimii ani, aflăm ușor numărul deceselor datorate vaccinării, adică în jurul a 119.025 de persoane. Repet, este vorba de decesele care au avut loc numai în primele 14 zile de la vaccinare, care nu sunt înregistrate în nici o statistică oficială a Statelor Unite.

Într-un alt studiu, publicat în revista Vaccines, cu autori provenind din mai multe țări, se arată că, potrivit statisticilor – în care efectele adverse sunt, oricum, mult subevaluate –, mor două persoane vaccinate pentru a se evita trei decese de COVID9. Raportul risc/beneficiu este doar în aparență bun, căci, în general, cei care mor de COVID-19 prezintă factori de risc sau sunt vârstnici, pe când, în urma vaccinării, mor și oameni tineri și fără factori de risc privind COVID-ul. Raportul semnat de David Johnsorensen și Dr. Vladimir Zelenko ajunge însă la concluzia că doar 1% din efectele adverse sunt declarate, ceea ce ne conduce la o cifră enormă a acestor cazuri10.

Cel mai mult m-a impresionat studiul realizat de Steve Kirsch care, după ce s-a vaccinat cu ambele doze, el și familia sa, a constatat că numărul de efecte adverse și decese în urma vaccinării este de 41 de ori mai mare decât cel declarat oficial în America ‒ adică între 150.000 și 300.000 de persoane ar fi murit după vaccinare11.https://1c86411d09a334f8f01805364ff445ce.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

Întărirea sistemului imunitar înnăscut

– Dar statistica lui nu poate fi suspectată de erori metodologice sau chiar de falsificarea datelor?

– Krisch este o somitate în domeniul prelucrării datelor. Deține șapte companii de high tech, este inventatorul mouse-ului optic și al unuia dintre primele motoare de căutare pe internet, Infoseek. Sincer fiind și constatând că în jurul său au murit mai multe persoane în urma vaccinurilor anti-COVID, a demarat o investigație personală, în care a investit milioane de dolari. Astfel, a ajuns la concluzii care, statistic, nu pot fi contrazise. Subevaluarea de 41 de ori a fost determinată pe opt căi diferite, așa că demonstrația este greu de combătut. A apărut și în fața celor mai importante instituții medicale din Statele Unite, Administrația Americană a Medicamentului (FDA) și Centrul pentru Prevenirea și Combaterea Bolilor (CDC), în contextul mai multor audieri. A prezentat în fața Comitetului Consultativ pentru Vaccinuri din cadrul FDA, în data de 26 octombrie 2021, un slideshow de 177 de pagini, cu titlul „Întrebări despre Vaccinul COVID”, la care nu a primit răspuns până astăzi. Afirmațiile pe care le-a făcut sunt prea grave ca să mai fi rămas în libertate, dacă ar fi recurs la falsuri și mistificări. De altfel, oricare dintre cei citați mai sus, dacă ar fi falsificat datele, ar fi fost închiși, căci miza este mult prea mare.

Kirch este însă și cel care demonstrează relația dintre vaccinare și declanșarea bolilor prionice12. Aceasta este o patologie rară până în prezent, care presupune o pliere anormală a proteinelor din creier, ceea ce duce la dezvoltarea rapidă a demenței, la dificultăți de mers, halucinații, confuzie, stare de epuizare și dificultăți de vorbire.

– Dacă nu ar exista aceste efecte adverse, v-ați vaccina?

– Nu, în primul rând pentru că am făcut boala în mai multe rânduri, ceea ce a condus la creșterea titrului de anticorpi anti-COVID. Și, mai înainte de toate, din punct de vedere medical, cred în sistemul meu imunitar înnăscut. Este o apărare uimitoare pe care Dumnezeu a pus-o în organismul omului și a fost antrenată continuu de-a lungul a mii de ani. A renunța la ea este ca și și cum ai renunța la propria armată în favoarea uneia străine, care are propriile interese și, la moment dat, s-ar putea să te părăsească sau chiar să se întoarcă împotriva ta. Mai frică mi-este de kilogramele în plus, de sedentarism sau de o alimentație defectuasă decât de virus, căci acestea îmi pot reprima sistemul imunitar.https://1c86411d09a334f8f01805364ff445ce.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

Așadar, trebuie să ne îngrijim în primul rând de condiția noastră fizică, psihologică și biologică, decât să stăm la televizor, pierzând un timp atât de prețios, și să ne mai și vaccinăm, lăsând să pătrundă în „casa” noastră un străin, care să ne anihileze propriul sistem imun.

– Ați pomenit și de efectele pe termen mediu și lung ale vaccinării. Care ar putea fi acestea?

– E greu de făcut un prognostic. E aproape imposibil de știut înainte de 5-10 ani. Dar câteva lucruri tot s-au constatat între timp. Pe termen mediu, putem vorbi de bolile cardiovasculare. De pildă, știu că, în cel puțin trei spitale de urgență din București, cardiologii sunt bulversați de mulțimea cazurilor de infarcturi miocardice, tromboembolisme pulmonare și alte patologii ale inimii, cum ar fi miocarditele și pericarditele, ca efecte adverse ale vaccinării. Vă dați seama că toți acești oameni riscă să moară în următorii ani de aceste patologii cardiovasculare declanșate de vaccin. Uitați-vă numai la sportivii vaccinați care au făcut stop cardiac pe teren, în jur de 283 la nivel mondial, dintre care 162 nu au supraviețuit13!

În același timp, s-au înmulțit la noi enorm morțile cauzate de infarct miocardic și accident vascular cerebral. Vorbim de persoane care au deja câteva luni de când au făcut vaccinul, iar cele mai multe dintre ele nu prezentau până la vaccinare probleme serioase cu inima. Cine nu crede, atunci să meargă la firul ierbii, întrebând preoții care fac înmormântările în sate și orașe. Pe toți acești morți nimeni nu-i socotește la „efecte adverse ale vaccinării”. În România, de altfel, declararea efectelor adverse este aproape nulă, nu numai în ceea ce privește vaccinarea anti-COVID, ci și oricare altă vaccinare sau procedură medicală. Funcționăm la fel ca în comunism: raportările sunt perfecte, dar lipsesc cu desăvârșire.

Cu fiecare vaccin este redus răspunsul imun”

– Despre efectele pe termen lung nu se poate spune încă nimic?

– Vaccinul supresează răspunsul imun, făcându-l sensibil la alte patologii, iar aceasta, proporțional cu numărul de rapeluri, prin dezvoltarea anormală a anticorpilor și limitarea răspunsului limfocitelor T și B. Sunt perfect de acord cu domnul Prof. Dr. Virgil Păunescu, care afirmă că fiecare vaccin ne reduce acest răspuns, iar în fața unui patogen nou sau a unei noi tulpini de COVID-19 va trebui să ne vaccinăm din nou pentru a supraviețui14. Așadar, putem vorbi despre o reducere a capacității generale de apărare în fața bolilor la persoanele vaccinate. Practic, orice boală poate îmbrăca forme mai grave.

De asemenea, mi se pare semnificativ faptul că ARN-ul mesager injectat – stând în corp în jur de 7 zile înainte de a fi distrus, și nu doar maxim 20 minute, cât stă un ARN mesager natural – poate ajunge să se insereze în genom15. Iar efectele prezenței proteinei spike în nucleu – generate de ARN-ul mesager artificial – sunt dezastruoase pentru sănătatea umană, pentru că blochează mecanismele de reparare ale ADN-ului, ceea ce va duce la înmulțirea cazurilor de cancer, boli autoimune, boli degenerative și, desigur, la o îmbătrânire prematură16. Pe forumurile internaționale ale bolnavilor de cancer se constată deja o explozie a cazurilor de cancer și a metastazelor în urma vaccinării, oricine poate verifica. Cred, așadar, că vaccinarea va conduce la o creștere abruptă a mortalității în următorii ani, iar aceasta va fi amplificată cu fiecare nou vaccin.

– Oamenii sunt însă presați să se vaccineze din cauza certificatului verde, dar și a angajatorilor. Cum ar trebui să reacționăm?

– Întreaga campanie de vaccinare cu forța la nivel mondial este ilegală. După Procesul de la Nüremberg, nici o procedură medicală nu mai poate fi administrată cu forța. Așa s-a hotărât acolo, pentru a nu se repeta în istorie abuzul pe care naziștii l-au făcut în lagărele lor, unde au experimentat tot felul de medicamente pe deținuți. De atunci, în toate convențiile internaționale semnate de mai toate statele lumii se reproduce această hotărâre. Vedeți Convenția Europeană de la Oviedo, din 4 aprilie 1997, pentru protecția drepturilor omului și a demnității ființei umane de aplicațiile biologiei și medicinei. Acolo se specifică clar că „o intervenție în domeniul sănătății nu se poate efectua decât după ce persoana vizată și-a dat consimțământul liber și în cunoștință de cauză”17. Această convenție este semnată și de statul român. Așadar, dacă vreo putere statală sau suprastatală ne obligă la vreun act medical, mai ales la vaccinare, nu se diferențiază cu nimic de dictatura nazistă sau de cea stalinistă, unde omul putea fi socotit material experimental, fără ca el să se poată opune în nici un fel.

Însăși ideea de obligativitate și de certificat verde, fără de care nu mai ai nici un drept social, mi se pare a fi esența dictaturii, cea mai bine pusă la punct dictatură din toate timpurile. Simplul fapt al acestui control total al persoanei umane prin codul QR este suficient pentru mine ca să nu accept vaccinarea. E o problemă de conștiință, și mai mult decât atât.

(va urma)Interviu realizat de Mihai Cristea

Articol publicat in Revista Familia Ortodoxa/Ianuarie 2022

Aceasta este Partea a III-e a unui interviu Familia Ortodoxă. Primele două părți aici:

Interviu cu Virgiliu Gheorghe despre Războiul Erei Covid: Că virusul Sars-CoV-2 este o armă biologică se știe de ceva vreme. Mass-media e a doua armă, care ce îți inoculează? Să-ți fie frică ‒ iar frica te conduce la vaccin

Interviu cu Virgiliu Gheorghe despre Războiul Erei Covid: Că virusul Sars-CoV-2 este o armă biologică se știe de ceva vreme. Mass-media e a doua armă, care ce îți inoculează? Să-ți fie frică ‒ iar frica te conduce la vaccin

NOTE

1 https://www.thegatewaypundit.com/2021/08/please-add-video-leading-israeli-health-official-vaccinated-account-95-severe-85-90-new-covid-hospitalizations-vaccine-effectiveness-really-fading-video/

2 https://www.activenews.ro/stiri/Israel-si-Australia-anunta-ca-85-99-dintre-persoanele-spitalizate-cu-Covid-sunt-complet-vaccinate-anti-Covid.-Dr.-Robert-Malone-Bine-de-stiut-168493.

3 https://www.thelancet.com/journals/lanepe/article/PIIS2666-7762(21)00258-1/fulltext?s=08#%20

4 https://nationalfile.com/israeli-study-fully-vaxxed-are-27-times-more-likely-to-get-covid-compared-to-people-with-natural-immunity/

5 https://www.cureus.com/articles/61880-new-onset-neurologic-symptoms-and-related-neuro-oncologic-lesions-discovered-after-covid-19-vaccination-two-neurosurgical-cases-and-review-of-post-vaccine-inflammatory-responses

6 https://www.activenews.ro/covid-dezvaluiri-covid/RAPORT-PRIVIND-DECESELE-CAUZATE-DE-VACCINURI.-De-DAVID-JOHN-SORENSEN-Dr.-VLADIMIR-ZELENKO-MD.-Traducere-in-limba-romana-Biblioteca-ActiveNews-PDF-170602

7 https://renzlaw.godaddysites.com/45k-whistleblower-suit

8 https://www.lifesitenews.com/news/nearly-50k-medicare-patients-died-soon-after-getting-covid-shot-whistleblower/

9 https://www.mdpi.com/2076-393X/9/7/693/htm

10 https://www.stopworldcontrol.com/downloads/en/vaccines/vaccinereport.pdf

11 https://trialsitenews.com/should-you-get-vaccinated/, https://web.archive.org/web/20210619014032/https://www.youtube.com/watch?v=Du2wm5nhTXY, https://articles.mercola.com/sites/articles/archive/2021/11/21/covid-vaccine-statistics.aspxhttps://www.activenews.ro/covid-dezvaluiri-covid/%E2%80%9EVaccinurile-anti-COVID-sunt-cele-mai-ucigase-din-istoria-medicinei-170869.

12 https://stevekirsch.substack.com/p/proof-covid-vaccines-cause-prion

13 http://goodsciencing.com/covid/71-athletes-suffer-cardiac-arrest-26-die-after-covid-shot/

14 https://www.national.ro/coronavirus/bomba-vaccinul-anti-covid-schimba-imunitatea-si-creeaza-dependenta-742121.html

15 https://www.imuno-medica.ro/noutati/Cercetatorii%C2%A0Harvard-spun-ca-vaccinurile-anti-COVID-19-ar-putea-altera-permanent-ADN-ul-genomic-uman-29

16 https://www.imuno-medica.ro/noutati/Proteina-Spike-suprima-mecanismele-de-reparare-a-ADN-ului-49; https://wmcresearch.org/sirt6-the-spike-proteins-master-target/

17 https://www.medlegtm.ro/CONVENTIE%20Oviedo.pdf

Canabidiolul inhibă replicarea SARS-CoV-2 prin inducerea stresului ER al gazdei și a răspunsurilor imune înnăscute

Abstract

Răspândirea SARS-CoV-2 și pandemia COVID-19 în curs de desfășurare subliniază necesitatea unor noi tratamente. Aici raportăm că canabidiolul (CBD) inhibă infecția cu SARS-CoV-2 în celule și șoareci. CBD și metabolitul său 7-OH-CBD, dar nu THC sau alți canabinoizi congeneri testați, blochează puternic replicarea SARS-CoV-2 în celulele epiteliale pulmonare. CBD acționează după intrarea virală, inhibând expresia genelor virale și inversând multe efecte ale SARS-CoV-2 asupra transcripției genei gazdă. CBD inhibă replicarea SARS-CoV-2 parțial prin reglarea în sus a răspunsului la stres al reticulului endoplasmatic (ER) IRE1α RNază gazdă și a căilor de semnalizare a interferonului.

În grupurile de pacienți umani din National COVID Cohort Collaborative, CBD (100 mg/ml soluție orală pe fișa medicală) a avut o asociere negativă semnificativă cu testele pozitive pentru SARS-CoV-2. Acest studiu evidențiază CBD ca un potențial agent preventiv pentru infecția cu SARS-CoV-2 în stadiu incipient și merită studii clinice viitoare. În prezent, vă avertizăm împotriva utilizării formulărilor non-medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.

INTRODUCERE

Sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) este responsabil pentru boala coronavirus 2019 (COVID-19), o pandemie care continuă să provoace morbiditate și mortalitate pe scară largă pe tot globul. SARS-CoV-2 este a șaptea specie de coronavirus cunoscută că infectează oamenii. Aceste coronavirusuri, care includ SARS-CoV, 229E, NL63, OC43, HKU1 și MERS-CoV, provoacă o serie de simptome de la răceala obișnuită până la patologii mai severe ( 1 ). În ciuda disponibilității recente a vaccinurilor, SARS-CoV-2 se răspândește în continuare rapid ( 2), subliniind necesitatea unor tratamente alternative, în special pentru populațiile cu înclinație sau acces limitat la vaccinuri. Până în prezent, au fost identificate puține terapii care blochează replicarea SARS-CoV-2 și producția virală.SARS-CoV-2 este un virus învelit cu ARN simplu (+ssRNA) cu sens pozitiv, compus dintr-un strat dublu lipidic și patru proteine ​​structurale care conduc la formarea particulelor virale. Spicul (S), membrana (M) și învelișul (E) sunt proteine ​​​​integrale ale membranei virale și promovează înmugurirea virionului în timp ce, de asemenea, recrutează proteina nucleocapside (N) și ARN-ul genomic viral în virionii în curs de dezvoltare. La fel ca ruda sa apropiată SARS-CoV, SARS-CoV-2 intră în principal în celulele umane prin legarea proteinei virale S de receptorul enzimei de conversie a angiotensinei 2 (ACE2) ( 3 – 5 ).), după care proteina S suferă proteoliza de către protează serină transmembranară 2 (TMPRSS2) sau alte proteaze în două peptide legate necovalent (S1, S2) care facilitează intrarea virală în celula gazdă. N – terminalul S1 leagă receptorul ACE2, iar C – terminalul S2 mediază fuziunea membranei celulare virale în urma clivajului proteolitic. În funcție de tipul de celulă, intrarea virală poate apărea și după legarea ACE2, independent de clivajul proteolitic ( 6 – 8 ). După intrarea în celule, genomul SARS-CoV-2 este tradus în două polipeptide mari care sunt scindate de două proteaze virale, Mpro și PLpro ( 9 , 10 ), pentru a produce 15 proteine, pe lângă sinteza ARN-urilor subgenomice care codifică alte 10 proteine ​​accesorii plus cele 4 proteine ​​structurale. Aceste proteine ​​permit replicarea virală, asamblarea și înmugurirea. Într-un efort de a suprima infecția cu SARS-CoV-2 beta-coronavirus, precum și cu alte viruși patogeni în evoluție, am testat potențialul antiviral al unui număr de molecule mici care vizează căile de răspuns la stres ale gazdei.Un potențial regulator al stresului gazdei și al răspunsurilor inflamatorii antivirale este canabidiolul (CBD), un membru al clasei canabinoide de produse naturale ( 11 ) produse de Cannabis sativa (Cannabaceae; marijuana/cânepă). Cânepa se referă la plantele de canabis sau la materialele derivate din acestea care conțin 0,3% sau mai puțin tetrahidrocannabinol psihotrop (THC) și au de obicei un conținut relativ ridicat de CBD. Prin contrast, marijuana se referă la materialele C. sativa cu mai mult de 0,3% THC în greutate uscată. THC acționează prin legarea de receptorul canabinoid, iar CBD potențează această interacțiune ( 11). În ciuda numeroaselor studii și a multor afirmații nefondate legate de produsele care conțin CBD, acțiunile biologice ale CBD în sine sunt neclare și țintele specifice sunt în mare parte necunoscute ( 12 ). Cu toate acestea, o soluție orală de CBD este un medicament aprobat de FDA, în mare parte pentru tratamentul epilepsiei ( 13 ). Astfel, CBD are statut de medicament, este viabil ca și terapeutic și nu poate fi comercializat ca supliment alimentar în Statele Unite ( 12 ). Deși limitate, unele studii au raportat că anumiți canabinoizi au efecte antivirale împotriva virusului hepatitei C (VHC) și a altor virusuri ( 14 ).

REZULTATE

CBD de înaltă puritate inhibă replicarea SARS-CoV-2 în celulele epiteliale pulmonare umane

Pentru a testa efectul CBD asupra replicării SARS-CoV-2, am pretratat celulele de carcinom pulmonar uman A549 care exprimă receptorul ACE-2 uman exogen (A549-ACE2) timp de 2 ore cu 0-10 μM CBD înainte de infectarea cu SARS-CoV- 2. După 48 de ore, am monitorizat celulele pentru exprimarea proteinei spike virale (S) și titrul viral. CBD a inhibat puternic replicarea virală în condiții netoxice cu o EC50 de ~ 1 μM ( Fig. 1A; smochin. S1A). CBD a inhibat replicarea SARS-CoV-2 în plămânul uman Calu3 și celulele epiteliale ale rinichilor de maimuță Vero E6 (fig. S1B) și nu a fost observată nicio toxicitate la dozele eficiente (fig. S1C,D). În cele din urmă, am testat trei variante de îngrijorare SARS-CoV-2 (α, β și γ) în plus față de tulpina originală SARS-CoV-2, iar capacitatea lor de a infecta celulele a fost inhibată în mod comparabil de CBD ( Fig. 1C ).

FIG. 1 . Canabidiolul (CBD) este un inhibitor puternic al infecției cu SARS-CoV-2 in vitro . ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de CBD de la patru furnizori diferiți, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. ( B ) Spectrele 1H qNMR ale materialului de referință CBD și probelor CBD de la patru furnizori diferiți. ( C) Celulele A549-ACE2 au fost tratate cu CBD de la furnizorul A urmată de infecție cu SARS-CoV-2 sau variante α,β sau γ la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50.

Când este izolat din planta sa sursă, CBD natural nesintetic este de obicei extras împreună cu alți canabinoizi, reprezentând complexitatea reziduală inevitabilă a produselor naturale ( 12 ). Pentru a verifica dacă CBD este într-adevăr responsabil pentru inhibarea virală, am analizat un standard de referință CBD, precum și CBD din patru surse diferite pentru puritate, folosind 100% RMN cantitativ (qNMR). Aceste surse au inclus doi furnizori de produse chimice (Furnizorii A și B) și doi vânzători comerciali (Furnizorii C și D). Congruența izbitoare dintre 1H RMN experimental și HiFSA mecanic cuantic recent stabilit ( 1Profilurile H Iterative Full Spin Analysis) observate pentru toate materialele au confirmat că 1) compușii utilizați au fost într-adevăr CBD cu purități de cel puțin 97% ( Fig. 1B ) și 2) canabinoizii congeneri nu erau prezenți la niveluri mai mari de 1,0%. Analiza acestor probe diferite de CBD în testul de infecție virală A549-ACE2 a arătat EC50 similare cu un interval de la 0,6-1,8 μM, reflectând probabil variabilitatea intrinsecă a testului biologic ( Fig. 1A ). Nu a fost observată nicio toxicitate pentru niciunul dintre preparatele CBD la dozele utilizate pentru a inhiba infecția virală (fig. S1 EG).

Metabolitul CBD 7-OH-CBD, dar nu un grup de congeneri CBD strâns înrudiți, prezintă activitate antivirală

CBD este adesea consumat ca parte a unui extract de C. sativa , în special în combinație cu THC psihoactiv îmbogățit în plante de marijuana. Prin urmare, am stabilit dacă canabinoizii congeneri, în special analogii cu structuri și polarități strâns înrudite produse de planta de cânepă, sunt, de asemenea, capabili să inhibe infecția cu SARS-CoV-2. În mod remarcabil, din acest grup, numai CBD a fost un agent puternic, în timp ce nu a fost prezentată activitate antivirală sau foarte limitată de acești congeneri strâns înrudiți din punct de vedere structural care împărtășesc căi de biosinteză și formează complexitatea reziduală determinată biogenetic a CBD purificat din C. sativa : THC, canabidiolic. acid (CBDA), canabidirina (CBDV), canabicromen (CBC) sau canabigerol (CBG) ( Fig. 2 A ,D ; vezi Metode). Niciunul dintre acești canabinoizi nu a fost toxic pentru celulele A549-ACE2 în intervalul de doză de interes (fig. S2). În special, combinarea CBD cu THC (1:1) a suprimat semnificativ eficacitatea CBD în concordanță cu inhibarea competitivă a THC.

FIG. 2 . Inhibarea limitată sau deloc a infecției cu SARS-CoV-2 de către canabinoizi, alții decât CBD. ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de diverși canabinoizi sau un amestec CBD/THC 1:1 urmat de infecția cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Toți canabinoizii testați au fost izolați dintr-un extract de cânepă așa cum este descris în Metode. ( B ) Structurile chimice ale canabinoizilor și 7-OH CBD. ( C) Celulele A549-ACE2 au fost tratate cu doze indicate de 7-OH CBD, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Datele reprezentative ale CBD din Figura 1C (furnizorul A) sunt utilizate pentru comparație. Sunt indicate valorile EC50.

CBD este metabolizat rapid în intestin și ficat în doi metaboliți principali, 7-carboxi-cannabidiol (7-COOH-CBD) și 7-hidroxi-cannabidiol (7-OH-CBD). Nivelul de 7-COOH-CBD este de 40 de ori mai mare, iar nivelul de 7-OH-CBD este de 38% din nivelul CBD din plasma umană ( 15 ). CBD și metabolitul său 7-OH-CBD sunt ingredientele active și echipotente pentru tratamentul epilepsiei ( 13 ). La fel ca CBD, 7-OH-CBD a inhibat eficient replicarea SARS-CoV-2 în celulele A549-ACE2 ( Fig. 2C ) și a fost netoxic pentru celule (fig. S2H, I). Analiza nivelurilor plasmatice din sânge la pacienții sănătoși care luau 1500 mg zilnic de soluție CBD aprobată de FDA (Epidiolex) a arătat o concentrație maximă (C max) la 7 zile pentru CBD și 7-OH-CBD de 1,7 μM și, respectiv, 0,56 μM; C max poate fi crescut în continuare de câteva ori prin administrarea concomitentă cu o masă bogată în grăsimi ( 15 ). Luate în ansamblu, aceste rezultate sugerează că concentrațiile plasmatice eficiente ale CBD și metabolitul său se află în intervalul terapeutic pentru a inhiba infecția cu SARS-CoV-2 la oameni.

CBD acționează într-un pas timpuriu după intrarea virală în celule

CBD ar putea acționa prin blocarea pătrunderii virale în celulele gazdă sau în etapele ulterioare după infecție. Deoarece s-a raportat că CBD scade expresia ACE2 în unele celule epiteliale, inclusiv A549 ( 16 ), am stabilit mai întâi dacă CBD a suprimat receptorul SARS-CoV-2 în celulele A549-ACE2, Calu-3 și Vero E6. Nu a fost observată nicio scădere a expresiei ACE2 ( Fig. 3A ; fig. S4A, B). Mai mult, analiza lentivirusurilor pseudotipizate fie cu proteina spike SARS-CoV-2, fie cu glicoproteina virusului stomatitei veziculoase (VSV) ( 17 ).) a arătat că 10 μM CBD a inhibat doar slab intrarea în celule de către virusul care exprimă vârful, sugerând că alte mecanisme sunt în mare măsură responsabile pentru efectele sale antivirale. Robustețea testului a fost confirmată prin utilizarea anticorpilor anti-spike care au blocat eficient infecția virală a lentivirusului pseudotipizat cu spike, dar nu VSVg ( Fig. 3B și fig. S3 A ​​și B). Spre deosebire de efectul neglijabil asupra intrării virale, CBD a fost foarte eficient (~95–99%) la inhibarea expresiei proteinei spike SARS-CoV-2 în celulele gazdă la 2 și 6 ore după infecție după intrare ( Fig. 3C ). Acest lucru a fost adevărat chiar și în prezența anticorpilor la proteina spike pentru a preveni reinfecția ( Fig. 3D) sugerând că CBD acționează la începutul ciclului de infecție, într-o etapă de după intrare. CBD a fost, de asemenea, parțial eficient (~60%) la inhibarea SARS-CoV-2 la 15 ore după infecție ( Fig. 3C ), sugerând un posibil efect secundar asupra adunării și eliberării virale. Pentru a evalua dacă CBD ar putea împiedica procesarea proteinelor virale de către proteazele virale Mpro sau PLpro, am testat activitatea acestora in vitro (fig. S4C, D). CBD nu a afectat activitatea niciunei proteaze, crescând posibilitatea ca CBD să țintească procesele celulei gazdă.

FIG. 3 . CBD inhibă replicarea virală după intrarea SARS-CoV-2 în celula gazdă. ( A ) Imunobloturi ale expresiei proteinei ACE2 din lizatele de celule A549-ACE2 fie netratate, fie tratate cu vehicul sau CBD la dozele indicate (n = 3). Petele au fost testate cu anticorpi împotriva ACE2 și tubulinei. Nivelurile de expresie a proteinei ACE2 au fost normalizate la semnalul tubulinei din fiecare probă. Nivelurile de expresie ACE2 au fost reprezentate grafic în raport cu probele netratate. ( B ) Celulele 293 T-ACE2 au fost infectate cu pseudovirusul spike sau VSV-G timp de 72 de ore cu dozele indicate de tratament cu CBD, iar procentul de celule infectate a fost reprezentat grafic. ( C) Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. S-a adăugat apoi DMSO sau 10 μM CBD la 2, 6 sau 15 ore după infectare. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. ( D) Panoul din stânga: celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. DMSO sau 10 μM CBD a fost apoi adăugat la 2 ore după infectarea cu anticorpul de neutralizare a vârfurilor pentru a preveni reinfectarea. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. Panoul din dreapta: Validarea eficacității anticorpilor neutralizanți. 400 pfu de virus SARS-CoV-2 au fost incubate cu sau fără 100 μM de anticorp neutralizant timp de 1 oră. Celulele A549-ACE2 au fost tratate cu amestecul timp de 16 ore și au fost cuantificate celulele Spike pozitive.

CBD inhibă expresia ARN viral și inversează modificările induse de virus în expresia genei gazdă

În conformitate cu această interpretare, analiza ARN-seq a celulelor A549-ACE2 infectate tratate cu CBD timp de 24 de ore arată o suprimare izbitoare a modificărilor induse de SARS-CoV-2 în expresia genelor. CBD a eradicat în mod eficient expresia ARN viral în celulele gazdă, inclusiv ARN-ul care codifică proteinele cu vârf, membrană, înveliș și nucleocapsid ( Figurile 4 A și B ). Atât SARS-CoV-2, cât și CBD au indus fiecare modificări semnificative în expresia genelor celulare (figurile S5 și S6). Analiza componentelor principale (PCA) a ARN-ului celulei gazdă arată inversarea aproape completă a modificărilor virale, dar, în loc să revină la o stare normală a celulei, celulele infectate cu virusul CBD + seamănă cu cele tratate numai cu CBD ( Fig. 4C).). Analiza grupării folosind Metascape dezvăluie câteva modele interesante și teme asociate ( Fig. 4D , figurile S7 și S8). De exemplu, inducerea virală a genelor asociate cu modificarea și transcripția cromatinei (Cluster 1) este inversată de CBD, deși CBD singur nu are niciun efect. În mod similar, inhibarea virală a genelor asociate cu ribozomi și neutrofile (Cluster 3) este în mare măsură inversată de CBD, dar medicamentul în sine nu are niciun efect. Acest lucru contrastează cu Clusterele 5 și 6 în care CBD singur induce activarea puternică a genelor asociate cu răspunsul la stres al gazdei. Împreună, aceste rezultate sugerează că CBD acționează pentru a preveni traducerea proteinelor virale și modificările celulare asociate.

FIG. 4 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBD la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Pentru fiecare genă sunt indicate modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBD (CBD_mock) și infectate cu SARS-CoV-2 plus tratate cu CBD (CBD_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

Pentru a obține o mai bună înțelegere a acțiunii antivirale specifice a CBD, am analizat ARNseq din lizate de celule neinfectate sau infectate cu SARS-CoV-2 tratate timp de 24 de ore cu omologul CBDV inactiv. Inducerea genelor virale pentru proteinele cu vârf, înveliș și nucleocapsid este redusă cu doar 60% cu CBDV, spre deosebire de ~99% cu CBD ( Fig. 5A,B ). Tratamentul CBDV provoacă mai puține modificări transcriptomice decât CBD în celulele A549-ACE2 și este în mare măsură ineficient în inversarea modificărilor transcripționale induse de SARS-CoV-2 ( Fig. 5C ). Analiza grupării folosind Metascape dezvăluie doar câteva grupuri care arată inversarea CBDV a modificărilor transcriptomice virale ( Fig. 5D). Acestea includ autofagia și metabolismul lipidic (Cluster 1) care sunt induse de CBDV, precum și traducerea proteinelor/ciclul celular/replicarea ADN-ului (Cluster 3) care sunt suprimate de CBDV.

FIG. 5 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBDV. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBDV la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD sunt indicate pentru fiecare genă. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBDV (CBDV_mock) și infectate cu SARS-CoV-2 plus tratate cu CBDV (CBDV_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

CBD induce răspunsul la stres ER și activitatea IRE1α ca un mecanism cheie pentru acțiunea sa antivirale

De interes deosebit sunt trei seturi de gene legate de răspunsul la stres reticulului endoplasmatic (ER), răspunsul proteic desfășurat (UPR) și inducerea interferonului care sunt reglate selectiv în sens pozitiv de CBD, dar nu de CBDV ( Fig. 6A ). Prin contrast, genele asociate cu răspunsul la stres oxidativ sunt induse de ambii canabinoizi. Celulele se confruntă cu stresul ER atunci când volumul de muncă al mașinilor de pliere a proteinei ER depășește capacitatea sa. Sub stresul ER, proteinele secretoare se acumulează în forme desfășurate în organele pentru a declanșa un set de căi de semnalizare intracelulare numite UPR, care face parte dintr-un răspuns la stres celular mai mare care menține proteostaza în întreaga celulă ( 18 ).). Calea UPR este controlată de trei proteine ​​transmembranare ER – IRE1α, PERK și ATF6 – care conțin un domeniu luminal ER capabil să detecteze direct sau indirect proteinele pliate greșit. Ca răspuns la stresul ER, fiecare dintre acești senzori pune în mișcare modificări transcripționale și translaționale care cresc capacitatea de pliere a proteinelor și încearcă să restabilească homeostazia. Cu toate acestea, dacă stresul asupra ER este iremediabil, UPR comută ieșirile și semnalează moartea celulei. Am validat inducerea CBD a expresiei genelor IRE1α, PERK și ATF6 prin qRT-PCR (fig. S9A), în concordanță cu rapoartele anterioare ( 19 ). Analiza ingeniozității a confirmat că CBD induce UPR semnificativ mai mult decât CBDV (fig. S9B, S10B, S11).

FIG. 6 . CBD promovează răspunsurile la stres ER ale celulei gazdă și splicing-ul IRE1α/XBP1, iar IRE1α contribuie la activitatea anti-virale CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament cu CBD sau CBDV la 10 μM (A,B) sau conform indicațiilor (C) timp de 24 de ore (A, B) sau conform indicațiilor (C). ). ( A ) Harta termică a activării căii prezise pe baza analizei Ingeniozității a scorurilor z de activare pentru fiecare cale și fiecare comparație. Roșu: calea este activată. Albastru: calea este inhibată. Alb: calea este neschimbată. Gri: nicio predicție din cauza lipsei de semnificație. ( B) Analiza îmbinării XBP1 de către RNază IRE1α. Au fost identificate și cuantificate citirile reprezentând XBP1 spliced ​​sau nespliced ​​pentru celulele care au fost tratate simulat, SARS-CoV-2 tratate sau tratate cu CBD sau CBDV fie singure, fie în prezența virusului (panoul din stânga). Au fost reprezentate grafice procentul de citiri îmbinate alternativ pentru probele de ARN-seq și au fost efectuate teste t nepereche comparând probele simulate ale fiecărui experiment cu alte probe (panoul din dreapta). ( C ) Celulele A549-ACE2 au fost tratate cu concentrațiile indicate de CBD timp de 3 și 6 ore. Relația dintre concentrația CBD și îmbinarea XBP1 a fost determinată prin qRT-PCR. ( D) Efectul IRE1α asupra răspunsului la doză pentru activitatea antivirală a CBD. Celulele A549-ACE2 sau A549-ACE2 lipsite de IRE1α (IRE1 KO) au fost tratate cu doze indicate de CBD, urmate de infectare cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. Testele t nepereche au fost efectuate la fiecare concentrație și au fost arătate valori p semnificative. Acesta este reprezentativ pentru trei experimente independente (Compozit EC50 1,7 v. 1,2, p < 0,05). ( E ) Schemă care ilustrează efectul CBD și SARS-CoV-2 asupra activității IRE1α RNază și îmbinării XBP1.

Numeroase studii raportează dovezi convingătoare că UPR este hiperactivat și necesar pentru replicarea altor membri ai familiei coronavirusului strâns înrudiți ( 20 , 21 ). În mod surprinzător, deși analiza de îmbogățire GSEA a datelor ARN-seq a arătat că calea IRE1α este puternic activată de CBD în prezența sau absența virusului, această cale nu a fost activată numai de SARS-CoV-2 ( Tabelul 1 ).; smochine. S12, S13, S14). PERK, prin contrast, a fost activat funcțional atât de SARS-CoV-2, cât și de CBD. IRE1α este o proteină transmembranară ER cu o singură trecere cu activități bifuncționale kinază/endoribonuclează (RNază). Ca răspuns la stresul ER, IRE1α suferă oligomerizare și autofosforilare, care își activează alosteric RNaza pentru a iniția îmbinarea productivă a ARNm XBP1. XBP1 îmbinat codifică un factor de transcripție care reglează în sus multe răspunsuri la stresul gazdei, inclusiv inducerea însoțitorului ER și componentele de degradare asociată ER (ERAD) ( 22 ) ( Fig. 6E ).

Comparaţiefiliala UPRGSEA NESARN-seq
schimbare de pliere
CBD vs mockPERK1.432.46
IRE11,382.29
ATF6ND*1.40
Virus vs batjocurăPERK1,921,85
IRE1Nu este îmbogățit2,67
ATF6ND*0,91
CBD + virus vs simulatPERK1.453.24
IRE11.442,76
ATF6ND*1.24

TABELUL 1 . Inducerea expresiei genelor PERK, IRE1 sau ATF6 și a funcției ca răspuns la virusul CBD și/sau SARS-CoV-2. Datele de expresie a genei ARN-seq sunt utilizate pentru GSEA pe trei termeni GO „UPR mediat de PERK”, „UPR mediat de IRE1” și „UPR mediat de ATF6” (numere Ontologie genică 36498, 36499, 36500). Scorul de îmbogățire normalizat este afișat în coloana „GSEA NES” (scor mai mare = mai multă îmbogățire). Schimbarea plierii pentru diferențele de expresie transcripțională între PERK, IRE1 și ATF6 este afișată pentru fiecare comparație în coloana „ARN-seq fold-change”. 

*ND = Nedeterminat din cauza lipsei de gene pentru a obține valori fiabile.CBD activează puternic activitatea IRE1α RNază așa cum se arată prin analiza splicing-ului XBP1 folosind atât datele ARNseq pentru a cuantifica XBP1 spliced, cât și confirmarea directă prin qRT-PCR ( Fig. 6B ; fig. S15). După cum sa prezis, CBD a indus îmbinarea XBP1 în prezența sau absența virusului, în timp ce CBDV nu a avut un efect semnificativ și este comparabil doar cu virusul. Curbele de timp și de răspuns la doză pentru inducerea CBD a splicing-ului XBP1 în absența virusului au fost în concordanță cu cursul în timp și răspunsurile la doză pentru inhibarea CBD a exprimării proteinei spike virale în celulele A549-ACE2 ( Fig. 6C).). În plus, în timp ce un knockout IRE1α nu a avut un efect semnificativ asupra infecției cu SARS-CoV-2, a schimbat răspunsul la doză și a redus semnificativ efectele antivirale ale CBD, ducând la o creștere de aproximativ 2 ori a EC50 împotriva SARS-CoV- 2 ( fig. 6D ; fig. S16). Împreună, aceste rezultate indică faptul că inducerea CBD a IRE1α este o componentă critică a acțiunii sale antivirale împotriva SARS-CoV-2.

CBD induce expresia interferonului ca parte a activității sale antivirale

Un alt mecanism prin care CBD ar putea suprima infecția virală și poate promova degradarea ARN viral este prin inducerea căii de semnalizare a interferonului. Interferonii sunt printre cele mai timpurii răspunsuri imune înnăscute ale gazdei la expunerea la patogen ( 23 ). După cum sa raportat ( 24 ), infecția cu SARS-CoV-2 suprimă calea de semnalizare a interferonului ( fig. 7A și fig. S17). Multe gene din cale, cum ar fi ISG15, IFIT1, IFIT3, SOCS1 și OAS1, o genă indusă de interferon care duce la activarea RNazelor L și a degradării ARN ( 25 ), au fost moderat up-reglate numai de CBD, dar puternic induse de CBD în prezența virusului ( Fig. 7Asi smochine. S18,19). Aceste din urmă rezultate sunt în concordanță cu posibilitatea ca CBD să reducă titrul viral efectiv suficient pentru a permite activarea normală a căii interferonului a gazdei. În același timp, CBD a inversat eficient inducerea virală a citokinelor care poate duce la furtuna mortală de citokine în stadiile ulterioare ale infecției ( Fig. 7B ). Prin contrast, omologul inactiv CBDV nu induce în mod semnificativ gene în cadrul căii interferonului și nici nu previne inducerea citokinelor ( Fig. 6A , 7A , 7C , figurile S20A, B și S21).

FIG. 7 . CBD promovează răspunsurile la interferonul celulei gazdă și inhibă inducerea virală a citokinelor. ( A ) Harta termică a schimbării de pliere (log2) a genelor din calea canonică de răspuns la interferon pentru toate probele tratate cu virus sau CBD în comparație cu probele tratate simulat. Coloanele 1-3 folosesc mostre din experimentul ARN-seq pe CBD și SARS-CoV-2. Coloanele 4-6 folosesc mostre din experimentul ARN-seq pe CBDV și SARS-COV-2. ( B ) Hartă termică a nivelurilor de expresie normalizate ale genelor GO Cytokine Activity care au fost reglate în sus de infecția virală, dar au fost reglate în jos prin tratamentul CBD pentru toate probele de ARN-seq din experimentul pe CBD și SARS-CoV-2. ( C) Hartă termică a nivelurilor de expresie normalizate ale acelorași gene pentru toate probele de ARN-seq din experimentul pe CBDV și SARS-CoV-2. ( D ) Celulele A549-ACE2 au fost tratate cu 2,5 μM de vehicul sau CBD cu sau fără anticorp uman IFN-γ și amestec uman de neutralizare a IFN de tip I cu 2 ore înainte de infectare. Celulele au fost apoi infectate cu 0,5 MOI SARS-CoV-2 și incubate timp de 24 de ore, iar virusul activ a fost măsurat utilizând un test pe placă. Rezultatele sunt reprezentative pentru trei experimente independente.

Pentru a testa direct posibilitatea ca interferonii să țină cont parțial de activitatea antivirală a CBD, am expus celulele ACE2-A549 la un amestec de anticorpi împotriva interferonilor de tip I (α,β,ο) și de tip II (γ) înainte de Tratament cu CBD de 2,5 μM și infecție virală. Rezultatele arată că anticorpii anti-interferon reduc efectele anti-virale ale CBD și salvează parțial infecția cu SARS-CoV-2 ( Fig. 7D ). Colectiv, aceste rezultate sugerează că CBD inhibă infecția cu SARS-CoV-2 parțial prin activarea IRE1α și a căilor interferonului, ceea ce duce la degradarea ARN viral și la modificări ulterioare induse de virus în expresia genei gazdă, inclusiv citokinele.

Tratamentul cu CBD inhibă semnificativ replicarea SARS-CoV-2 la șoareci

Deoarece mai mulți agenți, inclusiv medicamente amfipatice cationice, blochează replicarea SARS-CoV-2 în celulele cultivate, dar nu in vivo ( 26) , am determinat dacă CBD reduce titrul viral la șoarecii femele K18-hACE2 ( 27 ). Șoarecii au fost injectați intraperitoneal de două ori pe zi cu CBD (20 sau 80 mg/kg) timp de 7 zile înainte de provocarea intranazală cu SARS-CoV-2 (2×104 PFU ). După provocare, administrarea CBD a continuat de două ori pe zi timp de încă 4 zile ( Fig. 8A ). Tratamentul cu CBD a inhibat semnificativ replicarea virală în plămâni și cornetele nazale în ziua 5 după infecție într-o manieră dependentă de doză ( Figurile 8B-C). Doza mai mică de CBD a redus încărcătura virală de 4,8 ori în plămâni și de 3,7 ori în cortinele nazale, în timp ce doza mai mare a scăzut titrurile virale de 40 și, respectiv, de 4,8 ori în plămâni și, respectiv, în cortinele nazale. În această perioadă, șoarecii nu au prezentat semne de boală clinică, iar greutățile lor corporale nu au fost modificate semnificativ ( Fig. 8D ). Aceste rezultate stabilesc eficacitatea preclinica a CBD ca medicament antiviral pentru SARS-CoV-2 în stadiile incipiente ale infecției.

FIG. 8 . CBD inhibă replicarea SARS-CoV-2 la șoareci. ( A ) Cronologia experimentului cu șoarece. ( B ) Titrul viral în plămâni de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( C ) Titrul viral în cornetele nazale de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( D ) Măsurătorile de greutate ale șoarecilor din fiecare grup de tratament (n = 10) în timpul studiului. Greutatea corporală a fiecărui șoarece este normalizată la greutatea sa măsurată în ziua 0. Toate animalele au fost provocate cu SARS-CoV-2 prin instilare intranazală în ziua 7.

Utilizarea CBD este asociată negativ cu indicațiile de infecție cu SARS-CoV-2 la pacienți

Având în vedere că preparatele CBD de înaltă puritate sunt luate de un număr mare de persoane, am examinat dacă înregistrările de medicamente ale prescripțiilor sau utilizării CBD sunt asociate cu indicații ale infecției cu SARS-CoV-2 (adică, teste COVID-19 pozitive și/sau COVID-19). diagnostice proximale testelor COVID-19). O soluție orală de CBD 100 mg/mL (CBD100) este adesea utilizată pentru tratamentul convulsiilor (vezi suplimentul de analiză a pacientului). Analiza a 1.212 de pacienți din National COVID Cohort Collaborative (N3C) ( 28) cu un istoric de afecțiuni legate de convulsii și un dosar de medicație CBD100 a evidențiat 6,2% (75 de pacienți) cu o indicație de infecție cu SARS-CoV-2 proximă la datele primului lor test COVID-19 în datele lor N3C. Aceasta a fost o rată semnificativ mai mică decât ratele grupurilor de control potrivite de pacienți care nu au avut nicio înregistrare CBD100 (de exemplu, 6,2% pentru pacienții cu CBD100, comparativ cu 8,9% pentru pacienții non-CBD100, p = 0,014; raportul cotelor modelului logit multivariabil ( OR) de 0,65, p = 0,009, 95% CI [0,47, 0,90]). Datele demografice și istoricul medicației pacienților cu CBD100 au fost similare cu cele ale grupului de control potrivit. Istoricul stării medicale pentru acești pacienți a inclus afecțiuni legate de convulsii, lista CDC a afecțiunilor cu risc ( 29) și alți factori potențiali de confuzie, cum ar fi condițiile de mobilitate redusă, durerea cronică sau dizabilitățile de dezvoltare care pot limita interacțiunea publică și expunerea la COVID-19. Asocierea negativă a fost și mai semnificativă în analizele unui subgrup de 531 de pacienți cu CBD100 care probabil luau CBD100 la datele primelor lor teste COVID-19 (de exemplu, 4,9% dintre acești pacienți CBD100, comparativ cu 9,0% dintre 531 de martori potriviți, p. = 0,011; OR = 0,48, p = 0,006, 95% CI [0,29, 0,81]) ( Fig. 9 ; Tabelul S4 din Suplimentul de analiză a pacientului care descrie metodele și constatările de analiză a datelor pacientului în detaliu).

FIG. 9 . Înregistrările de medicamente CBD 100 mg/mL la pacienți sunt asociate în mod semnificativ cu o mai puțină pozitivitate pentru COVID-19. Schemă care arată derivarea eșantionului nostru principal de analiză și a grupurilor de pacienți cu canabidiol (CBD) obținute din National COVID Cohort Collaborative (N3C). Sunt ilustrate analize succesive ale subgrupurilor de pacienți. Panoul final arată asocieri între a avea o înregistrare a medicamentelor CBD de 100 mg/mL la data primului test COVID-19 și starea pozitivă pentru COVID-19 în rândul grupurilor de control potrivite de mărime în creștere (adică, 1-la-1, 2-la). -1 și 3 la 1 dintre controale față de pacienții cu CBD). O covariabilă nepotrivită are o diferență medie standardizată mai mare de 0,10 și o valoare p a testului exact Fisher pe două fețe mai mică de 0,05 atunci când se compară distribuția sa între pacienții cu CBD și martorii lor potriviți. AUC se referă la aria sub curba caracteristică de funcționare a receptorului.Informații detaliate cu privire la metodele și constatările de analiză a datelor pacientului se găsesc în Suplimentul de analiză a pacientului.

DISCUŢIE

Rezultatele noastre sugerează că CBD și metabolitul său 7-OH-CBD pot bloca infecția cu SARS-CoV-2 în stadiile incipiente și chiar ulterioare ale infecției. Mecanismul pare să fie mediat parțial de activarea căilor IRE1α RNază și interferon. În plus față de aceste descoperiri bazate pe celule, studiile preclinice arată că tratamentul cu CBD a redus titrurile virale în plămânii și turbinatele nazale ale șoarecilor infectați cu SARS-CoV-2. În cele din urmă, analiza unui eșantion național de pacienți cu înregistrări active de consum de 100 mg/ml CBD la momentul testării COVID a dezvăluit o asociere cu mult mai puține rezultate pozitive ale testelor SARS-CoV-2. Această asociere negativă a fost solidă pentru multe analize de sensibilitate, inclusiv modificări ale modelelor de potrivire și rezultate și merită cercetări suplimentare asupra potențialului CBD de a combate infecția cu SARS-CoV-2,cum ar fi validarea în alte seturi de date mari, cu mai multe site-uri, pentru dosarele de sănătate electronice sau proiecte experimentale prospective.Un mecanism care contribuie la activitatea antivirală a CBD este inducerea căii interferonului, atât direct, cât și indirect, după activarea răspunsului imun al gazdei la agentul patogen viral. De fapt, interferonii au fost testați clinic ca potențiale tratamente pentru COVID-19 ( 30 ). Când este hiperactivată de stres sever al ER, activitatea RNazei IRE1α duce la dezintegrarea endonucleolitică a multor ARNm localizați în ER (RIDD) și la activarea ulterioară a RIG-I și interferonilor ( 18 ).). Deși SARS-CoV-2 induce activitatea kinazei IRE1α, nu își activează activitatea RNază monitorizată prin splicing XBP1. Astfel, activitatea RNază a IRE1α indusă de CBD poate explica atât degradarea ARN viral, cât și inducerea interferonilor de către fragmentele de ARN. Vor fi necesare investigații suplimentare pentru a determina dacă ambele efecte antivirale ale CBD sunt legate de răspunsul la stres ER. Important, CBD suprimă, de asemenea, activarea citokinelor ca răspuns la infecția virală, reducând probabilitatea recrutării celulelor imune și a furtunilor ulterioare de citokine în plămâni și în alte țesuturi afectate. Aceste rezultate completează descoperirile anterioare care sugerează că CBD suprimă producția de citokine în celulele imune recrutate, cum ar fi macrofagele ( 31 ).). Astfel, CBD are potențialul nu numai de a acționa ca agent antiviral în stadiile incipiente ale infecției, ci și de a proteja gazda împotriva unui sistem imunitar hiperactiv în stadiile ulterioare.CBD are o serie de avantaje ca potențial agent preventiv împotriva SARS-CoV-2. CBD ca aditiv alimentar cu un conținut de THC mai mic de 0,3% este disponibil pe scară largă fără acces restricționat. Cu o formulare adecvată, control al calității și livrare, CBD ar putea fi utilizat profilactic, spre deosebire de medicamentele antivirale recente. Sunt posibile mai multe mijloace de ingerare a CBD, inclusiv potențialul de inhalare și livrare nazală. CBD blochează replicarea virală după intrarea în celule și, prin urmare, este probabil să fie eficient împotriva variantelor virale cu proteine ​​​​pic mutante. Spre deosebire de medicamente precum remdesivir sau anticorpii antivirali, administrarea CBD nu necesită injectare în spitale. În cele din urmă, CBD este asociat doar cu efecte secundare minore ( 32 ).Cu toate acestea, mai multe probleme necesită o examinare atentă înainte ca CBD să poată fi luat în considerare în continuare sau chiar explorat ca o pistă terapeutică pentru COVID-19 ( 12mai ales în lumina descoperirilor noastre care sugerează că alți canabinoizi, cum ar fi THC, ar putea acționa pentru a contracara eficacitatea antivirale CBD. Acest lucru elimină în esență fezabilitatea ca marijuana să servească drept sursă eficientă de CBD antiviral, în plus față de problemele legate de statutul său legal. În cele din urmă, alte mijloace de administrare a CBD, cum ar fi vapoarea și fumatul, ridică preocupări suplimentare cu privire la potențialele leziuni pulmonare.Vor fi necesare studii viitoare pentru a explora mijloacele optime de livrare a CBD către pacienți, împreună cu studii clinice, pentru a evalua în continuare promisiunea CBD ca medicament terapeutic pentru blocarea infecției cu SARS-CoV-2. Studiile noastre pe animale oferă suport preclinic pentru evaluarea CBD ca agent terapeutic anti-SARS-CoV-2 în studiile clinice. Susținem studii clinice controlate cu placebo concepute cu atenție, cu concentrații cunoscute și formulări foarte caracterizate, pentru a defini rolul CBD în prevenirea și tratarea infecției precoce cu SARS-CoV-2. Omul necesar in vivoconcentrația și calea optimă și formularea rămân de definit. Avertizăm cu tărie împotriva tentației de a lua CBD în formulările disponibile în prezent, inclusiv comestibile, inhalante sau topice ca terapie preventivă sau de tratament în acest moment, mai ales fără cunoștințele unui studiu clinic riguros randomizat cu acest produs natural ( 33 ).

MATERIALE SI METODE

Design de studiu

Am demonstrat utilizând celule knockout IRE1α și anticorpi anti-interferon care blochează că atât IRE1, cât și interferonii contribuie la activitatea anti-virală a CBD. În cele din urmă, utilizând înregistrările medicale pentru grupuri de pacienți umani din National COVID Cohort Collaborative în cadrul protocoalelor IRB adecvate, am analizat asocierea pacienților care iau CBD cu riscul lor de a fi testat pozitiv pentru SARS-CoV-2. Statisticile sunt furnizate în cifrele corespunzătoare și în metode.

Materiale, celule și viruși

CBD de înaltă puritate a fost achiziționat de la două companii chimice sau de la două surse comerciale online. 7-OH-CBD a fost achiziționat de la Cerilliant Corporation (Round Rock, TX). Toți compușii comerciali utilizați au fost validați prin RMN așa cum este descris mai jos. Uleiul de cânepă infuzat cu canabinoizi care conține peste 1.500 mg de canabinoizi a fost de la Bluebird Botanicals (Louisville, CO, SUA). Extractul de cânepă din biomasa C. sativa a fost de la Hopsteiner Ltd. (Yakima, Washington, SUA). Uleiul de cânepă cu conținut scăzut de CBD a fost obținut dintr-o sursă comercială online. Celulele A549-ACE2 au fost furnizate cu generozitate de tenOever și colegii ( 24). Celulele Vero E6 și celulele Calu3 au fost achiziționate de la ATCC. SARS-CoV-2 (nCoV/Washington/1/2020) a fost furnizat de Natalia Thornburg (Centre pentru Controlul Bolilor) prin Centrul Mondial de Referință pentru Viruși și Arbovirusuri Emergente (Galveston, Texas) și de la BEI Resources for the in vivostudii. Variantele SARS-CoV-2 au fost furnizate de resursele BEI. Varianta α este numărul BEI NR-54000, izolat hCoV-19/England/204820464/2020 provenit de la Public Health England. Varianta β este numărul BEI 54009, B.1.351(20H/501Y.V2) provenită de la Institutul de Cercetare în Sănătate din Africa. Varianta γ este numărul BEI 54982, izolat hCoV-19/Japan/TY7–503/2021 provenit de la Institutul Național de Boli Infecțioase din Japonia. Stocurile virale au fost realizate prin două treceri în celulele Vero E6 și titrurile stoc au fost determinate prin limitarea titrului plăcii de diluție pe celulele VeroE6 (descris mai jos).

Test de infecție cu SARS-CoV-2

Toate infecțiile cu SARS-CoV-2 au fost efectuate în condiții de nivel 3 de biosecuritate la Laboratorul Regional de Bioconteniment Howard T. Rickett, Universitatea din Chicago. In vivoinfecțiile au fost efectuate în condiții ABSL-3 la Centrul de Medicină Predictive pentru Bioapărare și Boli Infecțioase Emergente, Laboratorul Regional de Biocontainment al Universității din Louisville. Celulele din DMEM + 2% FBS au fost tratate cu CBD sau alți inhibitori sau 2 ore cu diluții de 2 ori începând cu 10 μM în triplicat pentru fiecare test. Celulele A549-ACE2 au fost infectate cu un MOI (multiplicitatea infecției) de 0,5 în medii care conțineau concentrația adecvată de medicamente. Celulele Vero E6 au fost infectate cu un MOI de 0,1 în medii care conțineau concentrația adecvată de medicamente. După 48 de ore, celulele au fost fixate cu formol 3,7%, blocate și testate cu anticorp anti-Spike de șoarece (GTX632604, GeneTex) diluat 1:1.000 timp de 4 ore, clătite și testate cu HRP anti-șoarece timp de 1 oră, spălat, apoi dezvoltat cu substrat DAB 10 minute. 40) au fost cuantificate prin microscopie cu lumină ca probe orbite. Titrurile virale au fost determinate prin analiza pe placă. Pe scurt, un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns. un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns.

Test de toxicitate Crystal Violet

Celulele au fost tratate cu concentrații diferite de compuși diferiți în 2% DMEM, începând cu 10 μM și coborând cu 1/2 pentru încă șase diluții. Celulele au fost incubate cu medicamentul timp de 48 de ore. Celulele au fost fixate cu soluție de formol 10% timp de 30 de minute. Apoi au fost colorați cu soluție Crystal Violet 1% timp de 30 de minute, după care plăcile au fost uscate și cantitatea de colorare Crystal Violet a fost evaluată prin măsurarea absorbanței la 595 nm pe un cititor de plăci TECAN M200. Citirile de absorbție au fost normalizate la cele ale godeurilor de control netratate cu medicament pentru a măsura diferențele de creștere a celulelor cu sau fără tratamentul medicamentos.

Test de neutralizare a proteinelor și a anticorpilor în vârf

Celulele A549-ACE2 au fost tratate cu 10 μM de CBD fie cu 2 ore înainte de infectare, fie cu 2, 6 sau 15 ore după infecție. Celulele au fost infectate cu MOI de 0,5 timp de 2 ore. Apoi, mediul de infecție a fost înlocuit cu mediu care conține CBD sau DMSO și probele au fost incubate la 37°C timp de 16 ore. Într-un experiment când CBD a fost adăugat la 2 ore după infecție, mediul de infecție a fost înlocuit cu CBD sau DMSO și μM de anticorp neutralizant (Active Motif 001414). După 16 ore, probele au fost fixate cu formol 10% și au fost supuse IHC pentru proteina spike. Eficiența anticorpului de neutralizare a fost testată prin incubarea a 400 pfu de virus cu sau fără 100 μM de anticorp la 37°C timp de 1 oră. Apoi celulele A549-ACE2 au fost infectate cu amestecul timp de 16 ore. Celulele Spike pozitive au fost cuantificate așa cum este descris mai sus.

Test de neutralizare a anticorpilor interferonului

Celulele A549-ACE2 au fost tratate cu 2,5 μM de CBD, 1 μg/ml anticorp IFN-γ uman (MAB285–100) și diluție 1:25 de amestec de Ab neutralizant IFN uman de tip I (PBL Assay Science 39000–1) cu 2 ore înainte infecţie. Celulele au fost apoi infectate cu 0,5 MOI și incubate timp de 24 de ore, după care supernatanții au fost colectați și virusul activ măsurat folosind testul pe placă descris mai sus.

Generarea de celule knockout IRE1α de către CRISPR-Cas9

Stocurile de lentivirus au fost prin utilizarea lentiCRISPR v2 (Addgene) cu ARN ghid unic (sgRNA) care vizează secvența IRE1 (CGGTCACTCACCCCGAGGCC). Celulele A549-ACE2 infectate au fost selectate policlonal și menținute folosind mediu suplimentat cu 4 μg/mL puromicină timp de 1 săptămână.

Descrierea canabinoizilor

CBD poate fi obținut prin izolarea acidului canabidiolic (CBDA) din materialul vegetal de Cannabis sativa și apoi inducerea decarboxilării chimice sau prin decarboxilarea canabinoizilor conținuti în materia primă de plante sau extract și izolarea ulterioară a CBD. Cannabidivarina (CBDV) este un omolog CBD natural care are un n -propil în locul lanțului lateral n – pentil al CBD . Cannabigerol (CBG), sub formă de acid cannabigerolic, este precursorul metabolic atât al acidului tetrahidrocannabidiolic, cât și al CBDA în C. sativa. Tetrahidrocannabinolul (THC) este un congener ciclizat al CBD care se obține după decarboxilarea acidului tetrahidrocannabinolic. THC este prezent în C. sativa atât în stereoizomerii Δ 9 – cis cât și Δ 9 – trans . Canabicromenul (CBC), sub formă de acid canabicromenic, reprezintă un al treilea metabolit posibil al acidului canbigerolic cu un inel de cromen în restul de geranil.

Achiziția, izolarea și caracterizarea canabinoizilor

În studiul de față, purificarea CBD din surse naturale a folosit (a) ulei de cânepă infuzat cu canabinoizi, care conține 1.500+ mg de canabinoizi în trigliceride cu lanț mediu pe uncie fluide, fabricat de Bluebird Botanicals (Louisville, CO, SUA) și (b) cânepă extract preparat prin extracție cu fluid supercritic (SFE) cu CO 2 din C. sativabiomasă care se califică drept cânepă, fabricată de Hopsteiner Ltd. (Yakima, Washington, SUA) cu un conținut total de 54,7% CBD, calculat ca CBD + CBDa*0,877. Puritățile tipice ale acestor preparate CBD sunt în intervalul 90-97%, inclusiv impuritățile străine (de exemplu, solvent rezidual) determinate de qHNMR. Detaliile metodologiilor de purificare și analiză a structurii sunt detaliate într-o publicație concomitentă, care este în prezent în presă (Journal of Natural Products). Pe scurt, metodologiile pot fi rezumate după cum urmează:

Procedura de purificare

CBD, CBC, CBG, Δ 9 – trans -THC, Δ 9 – cis -THC și CBDV au fost izolate din uleiul de cânepă, iar CBDA din extractul brut de cânepă SFE, utilizând cromatografia de partiție centrifugală (CPC), o tehnică de separare în contracurent. , și un sistem bifazic lichid-lichid.

Metodologia de elucidare a structurii

Identitățile CBD din sursă comercială și ale altor eșantioane de canabinoizi au fost verificate prin analiză 1D 1H RMN , efectuată ca măsurare qNMR, prin comparație cu un profil HiFSA autentic al CBD așa cum a fost publicat ( 12 ). Pe lângă o potrivire excelentă generală a profilurilor, semnalul de amprentă puternic cuplat al axului H-4” a servit ca un marker de identitate foarte specific. Structurile canabinoizilor care au fost obținute comercial sau purificate din surse naturale au fost stabilite printr-o combinație de analiză 1D/2D RMN și LC-HRMS, ținând cont de datele de referință din literatură.

Prepararea probelor RMN

Pentru probele comerciale furnizate ca soluție, solventul a fost îndepărtat cu grijă în vid și 450 μL de metanol deuterat (MeOH- 4) adăugat la reziduu folosind o seringă de precizie. Soluția a fost transferată într-un tub RMN de 5 mm cu o pipetă de sticlă, flaconul a fost clătit de trei ori cu 25 μL de solvent și soluția de clătire a fost transferată în același tub RMN, pentru un volum final de 525 μL. Probele comerciale și izolate disponibile ca solide au fost cântărite direct într-un tub RMN de 5 mm și au fost adăugate 500 μL de solvent cu o seringă de precizie. Pentru analiza preparatului comercial de ulei de cânepă, s-au adăugat direct 10 picături (0,25 ml echivalent cu 14-15 picături) într-un tub RMN de 5 mm. Greutatea netă a uleiului de cânepă în tubul RMN a fost de 198,50 mg, determinată pe o balanță de precizie de 0,01 mg și s-au adăugat 0,90 mg de acid dinitrobenzoic ca calibrant intern pentru IC-qHNMR; 325 μL de CDCl 3 și 10 μL de CD 3S-au adăugat OD, iar tubul a fost sigilat la flacără.

Achiziția și prelucrarea datelor RMN și evaluarea qNMR

Toate datele 1H RMN au fost achiziționate pe un Bruker 600 Avance III cu o sondă criogenică directă 13C cu două canale . Domeniul de timp (TD) a fost setat la 64 k, întârzierea de relaxare (D1) a fost de 60 de secunde, au fost utilizate impulsuri de excitație de 90 de grade pentru un total de 32 de scanări mediate de semnal. Câștigul receptorului (RG) a fost de 32 pentru toate probele, cu excepția unei probe cu masă limitată < 1 mg (RG = 101) și a probei de ulei de cânepă în cantitate mare (RG = 2; puls de excitație de 15 grade utilizat). Determinarea purității probei și a conținutului de CBD în uleiul de cânepă prin RMN cantitativ (qNMR) folosind abordarea 100% qNMR și foi de lucru publicate în mod deschis ( https://gfp.people.uic.edu/qnmr/content/qnmrcalculations/100p.html). Puritatea qNMR a tuturor probelor de CBD a fost > 97%, inclusiv impuritățile străine, și nu au putut fi detectați congeneri canabinoizi la niveluri de peste 1,0%. Folosind metoda absolută qHNMR cu calibrare internă (IC abs-qNMR), conținutul de CBD din uleiul de cânepă a fost determinat ca 0,30%.

Producția de lentivirus pseudotipizat

Celulele 293 T și 293 T-ACE2 au fost cultivate în DMEM (Corning 10017CV) cu piruvat de sodiu 1X (Gibco 11360070) și 10% FBS (HyClone SH30910). Particulele de lentivirus pseudotipizate cu proteina spike SARS-CoV-2 (Wuhan-Hu-1) sau VSV-G au fost generate așa cum este descris ( 19). Pe scurt, 293 de celule T au fost transfectate folosind TransIT-LT1 (Mirus) cu vectori de ambalare lentivirus de a treia generație (HDM-Hgpm2, HDM-tat1b, pRC-CMV-Rev1b), vector de transfer (pHAGE-CMV-ZsGreen-W) și fie SARS – Spike CoV-2 (HDM-IDTSpike-fixK) sau VSV-G (HDH-VSVG). Supernatanții colectați la 36 și 60 de ore după transfecție au fost reuniți, seringa filtrată și congelată în alicote de unică folosință la -80°C. Toate plasmidele utilizate pentru producerea de lentivirus au fost oferite cu amabilitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de legare a pseudovirusului

293 de celule T-ACE2 au fost însămânțate la 1,2 × 104 celule per 96 de godeuri în perete negru, plăci de fund clare. A doua zi, au fost preparate diluții de două ori de stoc CBD (10 mM) în DMSO, urmate de diluții 1:1000 fie în DMEM complet, fie în preparat pseudovirus. Pseudovirusul SARS-CoV-2 a fost utilizat nediluat, în timp ce pseudovirusul VSV-G a fost diluat 1:1.500 în DMEM complet. Celulele și pseudovirusul au fost pre-tratate cu diluții de CBD timp de 2 ore și, respectiv, 1 oră la 37°C. Celulele au fost infectate cu pseudovirus timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu un marker nuclear (Hoechst 33342, ThermoFisher H3570) și fotografiate. 293 de celule T-ACE2 au fost furnizate cu generozitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de neutralizare a pseudovirusului

Celulele 293 T sau 293 T-ACE2 au fost însămânțate la 1,2 × 104 celule pe 96 de godeuri în perete negru, plăci de fund clar. A doua zi, anticorpul de neutralizare a vârfului SARS-CoV-2 (Sino Biological 40592-R001) a fost diluat în DMEM complet la o concentrație finală inițială de 300 ng per 100 ul per 96 de godeuri, urmată de diluții ulterioare de 3 ori. Anticorpul de neutralizare a fost incubat cu pseudovirus timp de 1 oră. la 37°C. Celulele au fost infectate cu pseudovirus +/- anticorp neutralizant timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu marker nuclear Hoechst 33342 și fotografiate.

Test de inhibiție a proteazei

Testele au fost efectuate în duplicat, la temperatura camerei, în plăci negre cu 96 de godeuri la 25°C. Reacțiile care conțineau concentrații diferite de inhibitor (10 sau 50 μM) și enzima 3CLpro (0,4 μM) sau enzima PLpro (0,3 μM) în Tris-HCl pH 7,3, 1 mm EDTA au fost incubate timp de aproximativ cinci minute. Reacțiile 3CLpro au fost apoi inițiate cu substratul sondei TVLQ-AMC (40 μM), iar reacțiile PLpro au fost inițiate cu substratul sondei LKGG-AMC (40 μM). Placa de reacție a fost agitată liniar timp de 5 s și apoi măsurată pentru intensitatea emisiei de fluorescență (excitație λ: 364 nm; emisie λ: 440 nm) în timp (1 min-3 h) pe un Synergy Neo2 Hybrid). Fiecare test a conținut 2-3 godeuri de control pozitiv (DMSO) și 2 godeuri de control negativ (componentele testului fără protează). Datele au fost normalizate la godeurile de control pozitiv la 3 ore,căruia i s-a atribuit o valoare arbitrară de 100.

Imunoblotting

Celulele A549-ACE2 au fost tratate cu CBD, vehicul (DMSO) sau nu au fost tratate timp de 24 de ore. Celulele au fost mai întâi spălate cu PBS rece cu gheață. Extracția celulelor întregi a fost preparată prin lizarea directă a celulelor cu tampon de probă Laemmli (Bio-rad 1610747) suplimentat cu inhibitor de protează (Roche 4693159001), PMSF (Roche 10837091001) și inhibitor de fosfatază (GB-450) la 44°C. Probele de proteine ​​au fost în cele din urmă fierte la 98°C timp de 5 minute. Western blot a fost efectuat folosind anticorpi pentru ACE2 (Abcam 108252) și α-tubulină (Invitrogen MA1–19401) pentru control. Pentru validările knockout-ului IRE1α în A549-ACE2, au fost utilizate celule, anticorpi pentru IRE1α (Cell Signaling, 3294S) și GAPDH (Cell Signaling, 5174S). Petele au fost fotografiate și cuantificate folosind Licor Odyssey Fc.

secvențierea ARN

Celulele A549 alveolare pulmonare au fost supraexprimate stabil cu proteina enzimei de conversie a angiotensinei umane 2 (ACE2) și au fost însămânțate la 10.000 de celule per godeu într-o placă cu 96 de godeuri. Canabidiolul sau vehiculul au fost adăugate împreună la celule. Canabidiolul (Cayman Chemical, 90080) a fost dizolvat într-o soluție stoc 10 mM cu DMSO (Sigma-Aldrich, D2650-100 mL). Concentrația finală de CBD a fost de 10 μM. Stocul de virus a fost apoi îndepărtat și înlocuit cu mediu proaspăt 2% FBS DMEM cu medicament. Celulele au fost incubate încă 24 de ore înainte de extracția totală a ARN-ului cu trusa NucleoSpin 96 ARN (Takarabio, 740709). Au fost efectuate trei replici biologice independente per condiție experimentală, cu 12 probe totale de ARN. Verificarea calității probei de ARN, construcția bibliotecii,și secvențierea au fost efectuate de Universitatea din Chicago Genomics Facility urmând protocoale standard. Scorul mediu de integritate ARN a fost de 8,9. Toate cele 12 probe au fost secvențiate în două rulări de un secvențietor NovaSeq 6000 pentru a genera citiri de 100 bp la capătul pereche. Pentru fiecare probă, fișierele FASTQ brute din două celule de flux au fost combinate înainte de procesarea în aval. Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și s-au efectuat studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Datele ARN-seq pentru celulele tratate cu CBD și CBDV au fost analizate separat folosind o instanță locală Galaxy 20.05 pentru următorii pași ( 34 ). Calitatea și tăierea adaptorului au fost efectuate pe citirile de secvențiere brută folosind Trim Galore! 0,6,3 ( 35 ). Citirile au fost mapate atât la genomul uman (UCSC hg19 cu adnotare GENCODE), cât și la genomul SARS-COV-2 (NCBI Assembly ASM985889v3 cu adnotare Ensembl) folosind ARN STAR 2.7.5b ( 36 ). Citirile mapate rezultate din fiecare probă au fost numărate de featureCounts 1.6.4 ( 37) pentru a genera numere de citire pe genă. Numărările brute au fost analizate pentru expresia diferențială între condițiile experimentale folosind DESeq2 1.22.1 ( 38 ), care a generat, de asemenea, o matrice de expresie genică normalizată și o diagramă PCA a probelor.Numărul de citiri XBP1 îmbinate alternativ a fost numărat de Integrative Genomics Viewer 2.9.4 ( 39 ) folosind date de citire aliniate de la ARN STAR (vezi mai sus). Numărul total de citiri XBP1 a fost contorizat de featureCounts ca mai sus. Pentru fiecare probă, îmbinarea XBP1 relativă a fost determinată prin împărțirea citirilor care conțin locul de îmbinare alternativ la citirile totale XBP1.

qRT-PCR

ADNc a fost sintetizat din probe de ARN folosind kitul de transcripție inversă ADNc de mare capacitate (ThermoFisher, 4368813). Probele de ADNc au fost diluate în apă de calitate pentru biologie moleculară și au fost efectuate experimente qRT-PCR pe un instrument Roche LightCycler 96 folosind Applied Biosystems PowerUp SYBR Green Master Mix (ThermoFisher, A25776). Rezultatele au fost analizate de software-ul Roche LightCycler 96. RPL13A a fost folosit ca genă de referință. Au fost utilizate următoarele perechi de primeri (numele genei: primer primer, primer invers):ERN1: CCGAACGTGATCCGCTACTTCT, CGCAAAGTCCTTCTGCTCCACA.EIF2AK3: GTCCCAAGGCTTTGGAATCTGTC, CCTACCAAGACAGGAGTTCTGG.ATF6: CAGACAGTACCAACCGCTTATGCC, GCAGAACTCCAGGTGCTTGAAG.IFIT1: GCCTTGCTGAAGTGTGGAGGAA, ATCCAGGCGATAGGCAGAGATC.IFIT3: CCTGGAATGCTTACGGCAAGCT, GAGCATCTGAGAGTCTGCCCAA.ISG15: CTCTGAGCATCCTGGTGAGGAA, AAGGTCAGCCAGAACAGGTCGT.OAS1: AGGAAAGGTGCTTCCGAGGTAG, GGACTGAGGAAGACAACCAGGT.SOCS1: TTCGCCCTTAGCGTGAAGATGG, TAGTGCTCCAGCAGCTCGAAGA.Alt. XBP1 îmbinat: GCTGAGTCCCGCAGCAGGT, CTGGGTCCAAGTTGTCCAGAAT.Total XBP1: TGAAAACAGAGTAGCAGCTCAGA, CCCAAGCGCTGTCTTAACTC.RPL13A: CTCAAGGTGTTTGACGGCATCC, TACTTCCAGCCAACCTCGTGAG.

Clustering de gene variabile

Au fost selectate primele 5.000 de gene cele mai variabile, iar datele de expresie a genelor normalizate au fost analizate de software-ul Morpheus ( https://software.broadinstitute.org/morpheus ). Gruparea K-means cu 6 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBD și SARS-CoV-2, iar gruparea K-means cu 5 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBDV și SARS-CoV-2. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice.

Testul de îmbinare XBP1

qRT-PCR a fost utilizat pentru a cuantifica expresia relativă a versiunii spliced ​​a XBP1 (XBP1s) prin utilizarea perechilor specifice de primeri pentru XBP1 spliced ​​uman alternativ și XBP1 total (secvențele de primer sunt descrise mai sus) așa cum s-a descris anterior ( 40 ). Procentul relativ de îmbinare alternativă a XBP1 (%XBP1s) a fost indicat prin calcularea raportului de semnale dintre XBP1s și XBP1 total.

Analiza căii ingeniozității

Datele de exprimare (modificarea log 2 ) și starea de activare prezisă a genelor au fost suprapuse pe calea de semnalizare a interferonului și pe hărțile căii de stres al reticulului endoplasmatic utilizând Ingenuity Pathway Analysis. Cifrele au fost generate prin utilizarea IPA (QIAGEN Inc). Valorile normalizate ale expresiei genelor sau schimbarea pliului (log2) ale genelor au fost analizate de software-ul Morpheus. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice. Scorurile z de activare prezise de IPA ale căilor relevante din datele ARN-seq au fost, de asemenea, reprezentate grafic de software-ul Morpheus.

Analize de îmbogățire a setului de gene

Pentru a identifica temele din cele 6 clustere, au fost efectuate analize de îmbogățire a setului de gene funcționale pentru genele din fiecare cluster folosind Metascape ( 41).). Următoarele categorii au fost selectate pentru analizele de îmbogățire: Funcții moleculare GO, Seturi funcționale KEGG, Procese biologice GO, Căi canonice și Calea KEGG. Parametri suplimentari pentru Metascape: Min Overlap = 3, p-value Cutoff = 0,05, Min Enrichment = 1,5. Pentru a identifica seturile de gene care activitățile au fost inversate de CBD cu infecție virală, lista de gene de intrare include gene reglate în mod semnificativ în jos de virus (expresie diferențială comparând veh-infect vs veh-mock, limită pentru valoarea q 0,01), în timp ce, de asemenea, în creștere semnificativă. reglementat de CBD (expresie diferențială comparând CBD-infect vs veh-infect, limită pentru valoarea q 0,01). Analizele de îmbogățire a setului de gene au fost efectuate pe aceste două liste de gene folosind aceeași metodă Metascape. Aceleași analize au fost, de asemenea, efectuate asupra datelor de expresie diferențială din experimentele ARN-seq care implică CBDV și SARS-CoV-2 cu o valoare limită a q de 0,05. GSEA v4.1.0 a fost utilizat pentru a efectua analize specifice de îmbogățire a setului de gene pe termenii Ontologiei genetice Răspuns proteic nepliat mediat de PERK și Răspuns proteic nepliat mediat de IRE1 folosind datele de expresie diferențială din experimentul ARN-seq care implică CBD și SARS-CoV-2 ( 42 , 43 ).

Tratamentul CBD și provocarea SARS-CoV-2 la șoareci

Șoareci femele K18-hACE2 în vârstă de nouă până la unsprezece săptămâni ( 27) au fost achiziționate de la Jackson Laboratory (stock #034860). După aclimatizare, șoarecii au primit tratament cu CBD (20 sau 80 mg/kg) prin injecție intraperitoneală de două ori pe zi într-un volum de 0,1 ml. Soluția injectabilă a fost preparată imediat înainte de fiecare tratament. În primul rând, pulberea CBD de la furnizorul D a fost dizolvată în etanol 100%. Apoi soluția de CBD a fost amestecată cu Cremophor EL (Millipore Sigma 238470) urmată de soluție de PBS într-un raport de 1:1:18. Soluția de injecție vehicul a fost preparată prin amestecarea etanolului 100%, Cremophor EL și PBS la 1:1:18. Pentru fiecare injecție, cantitatea finală de CBD a fost fie de 20 mg, fie de 80 mg per kg de greutate corporală la șoarece, în funcție de grupul de tratament. Grupurile de control au fost tratate numai cu vehicul sau nu au primit niciun tratament. După șapte zile de tratament,

Titrarea virusului SARS-CoV-2 din țesuturile de șoarece prin testul TCID 50

Celulele Vero E6 (ATCC # CRL-1586) au fost însămânțate la o densitate de 20.000 celule/godeu în plăci de cultură de țesut cu fund plat cu 96 de godeuri (Nunc) și incubate peste noapte la 37°C cu 5% C02 și umiditate. Țesuturile omogenizate au fost centrifugate la 8.000 rpm timp de 10 minute la 4°C, iar supernatantul a fost colectat și diluat în serie de zece ori (până la 10 -7 ) în mediu de creștere virală (DMEM care conține 5% FBS și 1% soluție antibiotic/antimicotică) . După incubarea peste noapte, plăcile de celule au fost spălate de două ori cu PBS și diluțiile în serie adăugate în fiecare godeu în patru exemplare. Plăcile au fost incubate în continuare la 37°C într-un incubator umidificat cu 5% CO2. După 3 zile, celulele au fost colorate cu violet cristal 0,1% care conține 10% formol tamponat neutru și au fost marcate pentru dezvoltarea efectului citopatic (CPE). Doza TCID 50 a fost calculată conform metodei Reed și Muench ( 44 ) și corectată pentru greutatea pe gram a fiecărui omogenat pulmonar. Toate lucrările la animale au fost aprobate de Comitetul instituțional pentru îngrijirea și utilizarea animalelor de la Universitatea din Louisville. Toate lucrările cu SARS-CoV-2 viu au fost aprobate de Comitetul Instituțional de Biosecuritate al Universității și desfășurate în limita nivelului de biosecuritate trei.

Analiza datelor pacientului

Toate analizele datelor pacienților au fost aprobate de National COVID Cohort Collaborative și de comitetul de revizuire instituțional al Diviziei de Științe Biologice a Universității din Chicago (IRB21–0591), care a acordat o renunțare la consimțământ, deoarece identitățile participanților la studiu nu pot fi verificate cu ușurință de către anchetatori, anchetatorii nu contactează participanții, iar anchetatorii nu vor reidentifica participanții. O descriere detaliată a metodelor și constatărilor de analiză a datelor pacientului se găsește în Suplimentul de analiză a pacientului.

analize statistice

Datele sunt afișate ca medii ± SD. Pentru analiza expresiei diferențiale ARN-seq, a fost utilizată versiunea DESeq2 1.22.1 cu un prag de semnificație minim al valorii P corectate cu FDR (valoarea Q) de 0,01 pentru experimentul ARN-seq care implică CBD și SARS-CoV-2 și un prag de 0,05 pentru experimentul ARN-seq care implică CBDV și SARS-CoV-2. Pentru analiza îmbogățirii setului de gene, Metascape a fost utilizat cu un P minimpragul de semnificație a valorii de 0,05. Pentru calculele EC50 ale tratamentelor medicamentoase, software-ul GraphPad Prism a fost utilizat cu o potrivire a curbei neliniare cu patru parametri. Prism a fost, de asemenea, utilizat pentru teste t nepereche și ANOVA unidirecțional cu semnificație statistică definită ca p < 0,05. Pentru metodele de analiză statistică a datelor pacientului, vă rugăm să consultați secțiunea Analiză statistică din Suplimentul de analiză a pacientului.

Mulțumiri

Per total . Următorul reactiv a fost depus de către Centers for Disease Control and Prevention și obținut prin BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate USA-WA1/2020, NR-52281. Figura 8A a fost creată folosind BioRender.comSCR_019196) în special Sandhiya Arun și Pieter Faber, pentru asistența acordată cu secvențierea ARN. În cele din urmă, dorim să mulțumim viceprovostului pentru cercetare de la Universitatea din Chicago, Karen Kim, și decanului diviziei de științe biologice, Kenneth Polonsky, pentru sprijinul lor ferm.National COVID Cohort Collaborative (N3C) . Analizele datelor pacientului descrise în această publicație au fost efectuate cu date sau instrumente accesate prin intermediul Enclavei de date NCATS N3C covid.cd2h.org/enclave și susținute de NCATS U24 TR002306. Această cercetare a fost posibilă datorită pacienților ale căror informații sunt incluse în datele de la organizațiile participante ( covid.cd2h.org/dtas ) și organizațiile ( https://ncats.nih.gov/n3c/resources/data-contribution/data ). -semnatarii-acordului de transfer ) și oameni de știință care au contribuit la dezvoltarea continuă a acestei resurse comunitare ( 28). Proiectul descris a fost susținut de Institutul Național de Științe Medicale Generale, 5U54GM104942-04. Conținutul este responsabilitatea exclusivă a autorilor și nu reprezintă neapărat opiniile oficiale ale NIH. Analiza a folosit doar date de-identificate (adică, N3C Data Access Tier 2, descris la https://covid.cd2h.org/N3C_governance ). Mulțumim cu recunoștință contribuțiile următoarelor echipe principale N3C:• Investigatori principali : Melissa A. Haendel, Christopher G. Chute, Kenneth R. Gersing, Anita Walden• Lideri de lucru, subgrup și administrativi : Melissa A. Haendel, Tellen D. Bennett, Christopher G. Chute, David A. Eichmann, Justin Guinney, Warren A. Kibbe, Hongfang Liu, Philip RO Payne, Emily R. Pfaff, Peter N Robinson, Joel H. Saltz, Heidi Spratt, Justin Starren, Christine Suver, Adam B. Wilcox, Andrew E. Williams, Chunlei Wu• Legături cheie pe site-urile partenerilor de date• Personal de reglementare la site-urile partenere de date• Persoane de pe site-uri care sunt responsabile pentru crearea seturilor de date și transmiterea datelor către N3C• Echipa de asimilare și armonizare a datelor : Christopher G. Chute, Emily R. Pfaff, Davera Gabriel, Stephanie S. Hong, Kristin Kostka, Harold P. Lehmann, Richard A. Moffitt, Michele Morris, Matvey B. Palchuk, Xiaohan Tanner Zhang, Richard L. Zhu• Echipa Phenotype (Persoane care creează scripturile pe care site-urile le folosesc pentru a-și trimite datele, pe baza definițiilor COVID și Long COVID) : Emily R. Pfaff, Benjamin Amor, Mark M. Bissell, Marshall Clark, Andrew T. Girvin, Stephanie S. Hong, Kristin Kostka, Adam M. Lee, Robert T. Miller, Michele Morris, Matvey B. Palchuk, Kellie M. Walters• Echipa de management și operațiuni de proiect : Anita Walden, Yooree Chae, Connor Cook, Alexandra Dest, Racquel R. Dietz, Thomas Dillon, Patricia A. Francis, Rafael Fuentes, Alexis Graves, Julie A. McMurry, Andrew J. Neumann, Shawn T O’Neil, Usman Sheikh, Andréa M. Volz, Elizabeth Zampino• Parteneri de la NIH și alte agenții federale : Christopher P. Austin, Kenneth R. Gersing, Samuel Bozzette, Mariam Deacy, Nicole Garbarini, Michael G. Kurilla, Sam G. Michael, Joni L. Rutter, Meredith Temple-O’Connor• Echipa de analiză (persoane care construiesc infrastructura Enclave, ajută la crearea seturi de coduri, variabile și ajută echipele de domeniu și echipele de proiect cu seturile de date) : Benjamin Amor, Mark M. Bissell, Katie Rebecca Bradwell, Andrew T. Girvin, Amin Manna, Nabeel Qureshi• Echipa de management al Comitetului de Publicare: Mary Morrison Saltz, Christine Suver, Christopher G. Chute, Melissa A. Haendel, Julie A. McMurry, Andréa M. Volz, Anita Walden• Echipa de revizuire a Comitetului de publicație : Carolyn Bramante, Jeremy Richard Harper, Wenndy Hernandez, Farrukh M Koraishy, ​​Federico Mariona, Saidulu Mattapally, Amit Saha, Satyanarayana Vedula• Parteneri de date cu date publicate ( 50). Universitatea Stony Brook — U24TR002306 • Centrul de Științe ale Sănătății al Universității din Oklahoma — U54GM104938: Institutul de Științe Clinice și Translaționale din Oklahoma (OCTSI) • Universitatea Virginia de Vest — U54GM104942: Institutul de Științe Clinice și Translaționale din Virginia de Vest (WVCTSI) • Centrul Medical al Universității din Mississippi — U5454GM:1 Centrul Mississippi pentru Cercetare Clinică și Translațională (CCTR) • Centrul Medical al Universității din Nebraska — U54GM115458: Great Plains IDeA-Clinic & Translational Research • Maine Medical Center — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Wake Forest Universitatea de Științe ale Sănătății — UL1TR001420: Wake Forest Clinical and Translational Science Institute • Northwestern University din Chicago — UL1TR001422:• Parteneri suplimentari de date care au semnat DTA și eliberarea datelor în așteptare ( 35). Universitatea Rockefeller — UL1TR001866: Centrul pentru Științe Clinice și Translaționale • Institutul de Cercetare Scripps — UL1TR002550: Institutul de Cercetare Scripps Translațional • Centrul de Științe ale Sănătății al Universității din Texas din San Antonio — UL1TR002645: Institutul pentru Integrarea Medicină și Știință • Universitatea din Texas Centrul de Știință din Houston — UL1TR003167: Centrul pentru Științe Clinice și Translaționale (CCTS) • NorthShore University HealthSystem — UL1TR002389: Institutul pentru Medicină Translațională (ITM) • Spitalul Yale New Haven — UL1TR001863: Centrul Yale pentru Investigații Clinice • Universitatea Emory — UL1371TR00 Georgia Clinical and Translational Science Alliance • Weill Medical College of Cornell University — UL1TR002384:Centrul de Științe Clinice și Translaționale de Medicină Weill Cornell • Centrul Medical Montefiore — UL1TR002556: Institutul de Cercetare Clinică și Translațională de la Einstein și Montefiore • Colegiul Medical din Wisconsin — UL1TR001436: Institutul de Științe Clinice și Translaționale din Wisconsin de Sud-Est • Centrul de Științe ale Sănătății al Universității din New Mexico — UL1TR001449: Centrul de știință clinică și translațională de la Universitatea din New Mexico • Universitatea George Washington — UL1TR001876: Institutul de știință clinică și translațională de la Children’s National (CTSA-CN) • Universitatea Stanford — UL1TR003142: Spectrul: Centrul Stanford pentru cercetare și educație clinică și translațională • Institutul Regenstrief — UL1TR002529: Indiana Clinical and Translational Science Institute • Cincinnati Children’s Hospital Medical Center — UL1TR001425:Centrul pentru Știință și Formare Clinică și Translațională • Campusul Medical al Universității din Boston — UL1TR001430: Institutul de Științe Clinice și Translaționale al Universității din Boston • Universitatea de Stat din New York din Buffalo — UL1TR001412: Institutul de Științe Clinice și Translaționale • Aurora Health Care — UL1TR002373: Rețeaua Wisconsin pentru Cercetare în sănătate • Universitatea Brown — U54GM115677: Cercetare translațională clinică avansată (Advance-CTR) • Rutgers, Universitatea de Stat din New Jersey — UL1TR003017: Alianța din New Jersey pentru Științe Clinice și Translaționale • Universitatea Loyola din Chicago — UL1TR002389: Institutul pentru Medicină Translațională ( ITM) • #N/A — UL1TR001445: Institutul de Științe Clinice și Translaționale Langone Health • Spitalul de Copii din Philadelphia — UL1TR001878:Institutul pentru Medicină Translațională și Terapeutică • Centrul Medical al Universității din Kansas — UL1TR002366: Frontiere: Institutul de Științe Clinice și Translaționale de la Universitatea din Kansas • General Brigham din Massachusetts — UL1TR002541: Catalizator Harvard • Școala de Medicină Icahn din Muntele Sinai — UL1TR001433: Institutul ConduITS pentru Științe Translaționale • Ochsner Medical Center — U54GM104940: Centrul Louisiana Clinical and Translational Science (LA CaTS) • HonorHealth — Niciunul (voluntar) • Universitatea din California, Irvine — UL1TR001414: Institutul UC Irvine pentru Științe Clinice și Translaționale (ICTS) • Universitatea din California, San Diego — UL1TR001442: Altman Clinical and Translational Research Institute • Universitatea din California, Davis — UL1TR001860: UCDavis Health Clinical and Translational Science Center • Universitatea din California,San Francisco — UL1TR001872: UCSF Clinical and Translational Science Institute • Universitatea din California, Los Angeles — UL1TR001881: UCLA Clinical Translational Science Institute • University of Vermont — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Arkansas Children’s Hospital — UL1TR003107: Institutul de Cercetare Translațională UAMS• Confirmări suplimentare N3C . De asemenea, am dori să le mulțumim altora care nu sunt enumerate mai sus: Joy Alamgir (ARIScience), Seth Russell, MS (Universitatea din Colorado) și Hui Zhang, PhD MBA (Universitatea din Chicago), care au creat seturi de concepte N3C pe care le-am folosit pentru a defini unele a covariatelor indicatorului de stare medicală pentru analiza noastră statistică. De asemenea, am dori să mulțumim lui Steve Johnson, PhD (Universitatea din Minnesota) pentru că a scris un obiect de cunoștințe de calcul al IMC pe care l-am modificat pentru a calcula valorile IMC din datele de greutate și înălțime.Finanțarea:Această lucrare a fost susținută direct de: Grantul BIG Vision de la Universitatea din Chicago (MRR). National Institutes of Health grant R01 GM121735 (MRR). National Institutes of Health grant R01 CA184494 (MRR). Grantul National Institutes of Health R01 AI137514 (GR). Grantul Institutului Național de Sănătate R01 AI127518 (GR). Grantul Institutului Național de Sănătate R01 AI134980 (GR). National Institutes of Health grant R01 CA219815 (SAO). National Institutes of Health acordă R35 GM119840 (BCD). Grantul Institutului Național de Sănătate P30 CA014599 (grant de sprijin pentru Centrul de Cancer de la Universitatea din Chicago). Harry B. și Leona M. Helmsley Charitable Trust (KE P). Componenta de analiză a pacientului a acestei lucrări a fost susținută indirect de finanțarea enumerată în secțiunea N3C a secțiunii Mulțumiri.Contribuții ale autorului:Conceptualizare: MRR, LCN, DY, GR, SAO, GFP, DOM, ND, TJB. Metodologie: MRR, LCN, DY, GR, SAO, DOM, GFP, ND, BCD, TJB. Software: DY, TJB. Analiză formală: DY, TJB. Ancheta: LCN, DY, VN, TJB, TO, SN-C, JBF, ND, AM, CD, Diane Silva, HG, LS, LR-M, AV, ES, KAJ, S-AA. Resurse: GR, MRR, GFP, ST, BCD. Curatarea datelor: DOM, TJB, DY, National COVID Cohort Collaborative Consortium. Redactare – schiță originală: MRR. Scriere – revizuire și editare: LCN, DY, VN, TJB, SN-C, JBF, ND, AM, KAJ, Diane Silva, JMM, BCD, ST, SAO, GFP, DOM, GR, MRR. Vizualizare: LCN, DY, ND, AM, SN-C, BCD, JBF. Supraveghere: MRR. GR, DOM, GFP, SAO, ST, BCD. Administrare Proiect: MRR. Achiziție finanțare: MRR. Pentru experimentul pe animale: Investigație: Divyasha Saxena, CDA. Analiză formală: Divyasha Saxena, JDG. Metodologie: JDG, JKD, Divyasha Saxena, WES, KEP.Obținerea aprobărilor: WES, JDG. Achiziție finanțare: KEP.Interese concurente: SAO este cofondator și consultant la OptiKira., LLC (Cleveland, OH). Autorii nu declară alte interese concurente.Disponibilitatea datelor și a materialelor: Toate datele necesare pentru evaluarea concluziilor din lucrare sunt prezente în lucrare, Materialele suplimentare și/sau Datele suplimentare S1. Datele brute și procesate ARN-seq au fost depuse în baza de date GEO (GSE168797).

Materiale suplimentare

Acest fișier PDF include:

Figurile. S1 până la S24Supliment pentru analiza datelor pacientuluiTabelele de la S1 la S6DESCĂRCAȚI (9,91 MB)

Alte materiale suplimentare pentru acest manuscris includ următoarele:

Date S1DESCĂRCAȚI (9,91 MB)Vizualizați/solicitați un protocol pentru această lucrare de la Bio-protocol .

REFERINȚE ȘI NOTE

1SR Weiss, JL Leibowitz, Patogeneza coronavirusului. Adv. Virus Res. 81 , 85–164 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC2SE Galloway, P. Paul, DR MacCannell, MA Johansson, JT Brooks, AM Neil, RB Slayton, S. Tong, BJ Silk, GL Armstrong, M. Biggerstaff, VG Dugan, Apariția SARS-CoV-2 B.1.1. 7 descendență – Statele Unite, 29 decembrie 2020–12 ianuarie 2021. MMWR Morb Mortal Wkly Rep 70 , 95–99 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC3M. Hoffmann, H. Kleine-Weber, S. Schroeder, N. Krüger, T. Herrler, S. Erichsen, TS Schiergens, G. Herrler, N.-H. Wu, A. Nitsche, MA Müller, C. Drosten, S. Pöhlmann, intrarea în celulele SARS-CoV-2 depinde de ACE2 și TMPRSS2 și este blocată de un inhibitor de protează dovedit clinic. Celula 181 , 271–280.e8 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC4J. Jaimes, J. Millet, G. Whittaker, Clivajul proteolitic al proteinei spike SARS-CoV-2 și rolul site-ului roman S1/S2. iScience 23 , 101212 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC5S. Matsuyama, N. Nao, K. Shirato, M. Kawase, S. Saito, I. Takayama, N. Nagata, T. Sekizuka, H. Katoh, F. Kato, M. Sakata, M. Tahara, S. Kutsuna, N. Ohmagari, M. Kuroda, T. Suzuki, T. Kageyama, M. Takeda, Izolarea îmbunătățită a SARS-CoV-2 de către celulele care exprimă TMPRSS2. Proc. Natl. Acad. Sci. SUA 117 , 7001–7003 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC6R. Wang, CR Simoneau, J. Kulsuptrakul, M. Bouhaddou, KA Travisano, JM Hayashi, J. Carlson-Stevermer, JR Zengel, CM Richards, P. Fozouni, J. Oki, L. Rodriguez, B. Joehnk, K Walcott, K. Holden, A. Sil, JE Carette, NJ Krogan, M. Ott, Ecranele genetice identifică factorii gazdă pentru SARS-CoV-2 și coronavirusurile comune ale răcelii. Celula 184 , 106–119.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC7WM Schneider, JM Luna, H.-H. Hoffmann, FJ Sánchez-Rivera, AA Leal, AW Ashbrook, JL Pen, I. Ricardo-Lax, E. Michailidis, A. Peace, AF Stenzel, SW Lowe, MR MacDonald, CM Rice, JT Poirier, Genome-scale identification of Rețelele de factori gazdă SARS-CoV-2 și pan-coronavirus. Celula 184 , 120–132.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC8Z. Daniloski, TX Iordania, H.-H. Wessels, DA Hoagland, S. Kasela, M. Legut, S. Maniatis, EP Mimitou, L. Lu, E. Geller, O. Danziger, BR Rosenberg, H. Phatnani, P. Smibert, T. Lappalainen, BR tenOever, NE Sanjana, Identificarea factorilor gazdă necesari pentru infecția cu SARS-CoV-2 în celulele umane. Celula 184 , 92–105.e16 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC9DW Kneller, G. Phillips, HM O’Neill, R. Jedrzejczak, L. Stols, P. Langan, A. Joachimiak, L. Coates, A. Kovalevsky, Plasticitatea structurală a cavității site-ului activ SARS-CoV-2 3CL Mpro revelată prin cristalografie cu raze X la temperatura camerei. Nat. comun. 11 , 3202 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC10J. Osipiuk, SA Azizi, S. Dvorkin, M. Endres, R. Jedrzejczak, KA Jones, S. Kang, RS Kathayat, Y. Kim, VG Lisnyak, SL Maki, V. Nicolaescu, CA Taylor, C. Tesar, YA Zhang, Z. Zhou, G. Randall, K. Michalska, SA Snyder, BC Dickinson, A. Joachimiak, Structura proteazei asemănătoare papainei din SARS-CoV-2 și complexele sale cu inhibitori necovalenti. Nat. comun. 12 , 743 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC11F. Shahbazi, V. Grandi, A. Banerjee, JF Trant, Cannabinoids and cannabinoid receptors: The story so far. iScience 23 , 101301 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC12KM Nelson, J. Bisson, G. Singh, JG Graham, SN Chen, JB Friesen, JL Dahlin, M. Niemitz, MA Walters, GF Pauli, The essential medicinal chemistry of cannabidiol (CBD). J. Med. Chim. 63 , 12137–12155 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC13K. Sekar, A. Pack, Epidiolex ca terapie adjuvantă pentru tratamentul epilepsiei refractare: O revizuire cuprinzătoare, cu accent pe efectele adverse. F1000Res 8 , F1000 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC14HI Lowe, NJ Toyang, W. McLaughlin, Potentialul canabidiolului pentru tratamentul hepatitei virale. Farmacia. Res. 9 , 116–118 (2017).GOOGLE ACADEMIC15L. Taylor, B. Gidal, G. Blakey, B. Tayo, G. Morrison, A faza I, randomizat, dublu-orb, controlat cu placebo, doză crescătoare unică, doză multiplă și efect alimentar privind siguranța, tolerabilitatea și farmacocinetica canabidiolului înalt purificat la subiecții sănătoși. CNS Drugs 32 , 1053–1067 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC16SM Anil, N. Shalev, AC Vinayaka, S. Nadarajan, D. Namdar, E. Belausov, I. Shoval, KA Mani, G. Mechrez, H. Koltai, Compușii de canabis prezintă activitate antiinflamatoare in vitro în COVID-19 -inflamația asociată celulelor epiteliale pulmonare și activitatea proinflamatoare la macrofage. Sci. Rep. 11 , 1462 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC17KHD Crawford, R. Eguia, AS Dingens, AN Loes, KD Malone, CR Wolf, HY Chu, MA Tortorici, D. Veesler, M. Murphy, D. Pettie, NP King, AB Balazs, JD Bloom, Protocol și reactivi pentru pseudotiparea particulelor lentivirale cu proteina spike SARS-CoV-2 pentru teste de neutralizare. Virusuri 12 , 513 (2020).CROSSREFGOOGLE ACADEMIC18C. Hetz, E. Chevet, SA Oakes, Controlul proteostazei prin răspunsul proteic desfășurat. Nat. Cell Biol. 17 , 829–838 (2015).CROSSREFPUBMEDGOOGLE ACADEMIC19R. Dash, MC Ali, I. Jahan, YA Munni, S. Mitra, MA Hannan, B. Timalsina, DF Oktaviani, HJ Choi, IS Moon, Emerging potential of cannabidiol in reversing proteinopathies. Imbatranire Res. Rev. 65 , 101209 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC20J. Bechill, Z. Chen, JW Brewer, SC Baker, Infecția cu virusul hepatitei la șoarece activează calea Ire1/XBP1 a răspunsului proteic desfășurat. Adv. Exp. Med. Biol. 581 , 139–144 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC21TS Fung, DX Liu, senzorul de stres ER IRE1 și MAP kinaza ERK modulează inducerea autofagiei în celulele infectate cu virusul bronșitei infecțioase cu coronavirus. Virologie 533 , 34–44 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC22C. Hetz, K. Zhang, RJ Kaufman, Mecanisme, reglare și funcții ale răspunsului proteic desfășurat. Nat. Pr. Mol. Cell Biol. 21 , 421–438 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC23O. Haller, G. Kochs, F. Weber, The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344 , 119–130 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC24D. Blanco-Melo, BE Nilsson-Payant, W.-C. Liu, S. Uhl, D. Hoagland, R. Møller, TX Jordan, K. Oishi, M. Panis, D. Sachs, TT Wang, RE Schwartz, JK Lim, RA Albrecht, BR tenOever, Răspunsul dezechilibrat al gazdei la SARS- CoV-2 stimulează dezvoltarea COVID-19. Celula 181 , 1036–1045.e9 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC25H. Di, H. Elbahesh, MA Brinton, Caracteristicile proteinelor izoforme umane OAS1. Virusuri 12 , (2020).CROSSREFGOOGLE ACADEMIC26TA Tummino, VV Rezelj, B. Fischer, A. Fischer, MJ O’Meara, B. Monel, T. Vallet, Z. Zhang, A. Alon, HR O’Donnell, J. Lyu, H. Schadt, KM White , NJ Krogan, L. Urban, KM Shokat, AC Kruse, A. García-Sastre, O. Schwartz, F. Moretti, M. Vignuzzi, F. Pognan, BK Shoichet, Fosfolipidoza este un mecanism comun care stă la baza activității antivirale in vitro a multor medicamente reutilizate împotriva SARS-CoV-2. bioRxiv 10.1101 /2021.03.23.436648 (2021).GOOGLE ACADEMIC27PB McCray Jr., L. Pewe, C. Wohlford-Lenane, M. Hickey, L. Manzel, L. Shi, J. Netland, HP Jia, C. Halabi, CD Sigmund, DK Meyerholz, P. Kirby, DC Look , S. Perlman, Infecția letală a șoarecilor K18-hACE2 infectați cu coronavirus de sindrom respirator acut sever. J. Virol. 81 , 813–821 (2007).CROSSREFPUBMEDGOOGLE ACADEMIC28MA Haendel, CG Chute, TD Bennett, DA Eichmann, J. Guinney, WA Kibbe, PRO Payne, ER Pfaff, PN Robinson, JH Saltz, H. Spratt, C. Suver, J. Wilbanks, AB Wilcox, AE Williams, C Wu, C. Blacketer, RL Bradford, JJ Cimino, M. Clark, EW Colmenares, PA Francis, D. Gabriel, A. Graves, R. Hemadri, SS Hong, G. Hripscak, D. Jiao, JG Klann, K Kostka, AM Lee, HP Lehmann, L. Lingrey, RT Miller, M. Morris, SN Murphy, K. Natarajan, MB Palchuk, U. Sheikh, H. Solbrig, S. Visweswaran, A. Walden, KM Walters, GM Weber, XT Zhang, RL Zhu, B. Amor, AT Girvin, A. Manna, N. Qureshi, MG Kurilla, SG Michael, LM Portilla, JL Rutter, CP Austin, KR Gersing; Consorțiul N3C, Cohorta Națională COVID (N3C): justificare, proiectare, infrastructură,și desfășurare. J. Am. Med. Informa. conf. univ. 28 , 427–443 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC29Centre pentru Controlul și Prevenirea Bolilor, COVID-19, Persoane cu risc crescut, Persoane cu anumite afecțiuni medicale (2021).GOOGLE ACADEMIC30Q. Zhou, V. Chen, CP Shannon, XS Wei, X. Xiang, X. Wang, ZH Wang, SJ Tebbutt, TR Kollmann, EN Fish, Interferon-α2b Treatment for COVID-19. Față. Imunol. 11 , 1061 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC31T. Mutumalage, I. Rahman, Cannabidiolul reglează diferențial răspunsurile inflamatorii bazale și induse de LPS în macrofage, celule epiteliale pulmonare și fibroblaste. Toxicol. Aplic. Pharmacol. 382 , 114713 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC32Administrația pentru Alimente și Medicamente (FDA), numărul de cerere 210365Orig1s000,” Clinical Pharmacology and Biopharmaceutics Reviews (2017).GOOGLE ACADEMIC33BC Sorkin, AJ Kuszak, G. Bloss, NK Fukagawa, FA Hoffman, M. Jafari, B. Barrett, PN Brown, FD Bushman, SJ Casper, FH Chilton, CS Coffey, MG Ferruzzi, DC Hopp, M. Kiely, D Lakens, JB MacMillan, DO Meltzer, M. Pahor, J. Paul, K. Pritchett-Corning, SK Quinney, B. Rehermann, KDR Setchell, NS Sipes, JM Stephens, DL Taylor, H. Tiriac, MA Walters, D. Xi, G. Zappalá, GF Pauli, Îmbunătățirea traducerii cercetării produselor naturale: de la sursă la studiu clinic. FASEB J. 34 , 41–65 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC34E. Afgan, D. Baker, B. Batut, M. van den Beek, D. Bouvier, M. Čech, J. Chilton, D. Clements, N. Coraor, BA Grüning, A. Guerler, J. Hillman-Jackson , S. Hiltemann, V. Jalili, H. Rasche, N. Soranzo, J. Goecks, J. Taylor, A. Nekrutenko, D. Blankenberg, Platforma Galaxy pentru analize biomedicale accesibile, reproductibile și colaborative: actualizare 2018. Acizi nucleici Res. 46 , W537–W544 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC35F. Krueger, Trim Galore. Un instrument de împachetare în jurul Cutadapt și FastQC pentru a aplica în mod constant calitatea și tăierea adaptorului fișierelor FastQ. 517 (2015).GOOGLE ACADEMIC36A. Dobin, CA Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, TR Gingeras, STAR: Ultrafast universal ARN-seq aligner. Bioinformatica 29 , 15–21 (2013).CROSSREFPUBMEDGOOGLE ACADEMIC37Y. Liao, GK Smyth, W. Shi, featureCounts: Un program eficient de uz general pentru atribuirea de secvențe citirilor caracteristicilor genomice. Bioinformatica 30 , 923–930 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC38MI Love, W. Huber, S. Anders, Estimarea moderată a schimbării pliului și a dispersiei pentru datele ARN-seq cu DESeq2. Genom Biol. 15 , 550 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC39JT Robinson, H. Thorvaldsdóttir, W. Winckler, M. Guttman, ES Lander, G. Getz, JP Mesirov, Integrative genomics viewer. Nat. Biotehnologia. 29 , 24–26 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC40SB Yoon, YH Park, SA Choi, HJ Yang, PS Jeong, JJ Cha, S. Lee, SH Lee, JH Lee, BW Sim, BS Koo, SJ Park, Y. Lee, YH Kim, JJ Hong, JS Kim, YB Jin, JW Huh, SR Lee, BS Song, SU Kim, Cuantificarea PCR în timp real a proteinei de legare a casetei X spliced ​​1 (XBP1) folosind o metodă de primer universal. PLOS ONE 14 , e0219978 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC41Y. Zhou, B. Zhou, L. Pache, M. Chang, AH Khodabakhshi, O. Tanaseichuk, C. Benner, SK Chanda, Metascape oferă o resursă orientată către biologi pentru analiza seturilor de date la nivel de sisteme. Nat. comun. 10 , 1523 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC42A. Subramanian, P. Tamayo, VK Mootha, S. Mukherjee, BL Ebert, MA Gillette, A. Paulovich, SL Pomeroy, TR Golub, ES Lander, JP Mesirov, Analiza îmbogățirii setului de gene: O abordare bazată pe cunoștințe pentru interpretarea genomului -profiluri largi de expresie. Proc. Natl. Acad. Sci. SUA 102 , 15545–15550 (2005).CROSSREFPUBMEDGOOGLE ACADEMIC43C. Hetz, F. Martinon, D. Rodriguez, LH Glimcher, The unfolded protein response: Integrating stress signals through the stress sensor IRE1α. Physiol. Apoc. 91 , 1219–1243 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC44LJ Reed, H. Muench, O metodă simplă de estimare a punctelor finale de cincizeci la sută. A.m. J. Epidemiol. 27 , 493–497 (1938).CROSSREFGOOGLE ACADEMIC45Institutul OHDS, ATLAS. (2021).GOOGLE ACADEMIC46OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Standardized Derived Elements, Drug Era table (2021).GOOGLE ACADEMIC47Centers for Disease Control and Prevention, COVID-19: When to Carantine (CDC, 2021).GOOGLE ACADEMIC48Bibliotecă de servicii de procesare a textului, Operațiuni regulate de expresie (Servicii de procesare a textului, 2021).GOOGLE ACADEMIC49JJ Beltran-Montoya, T. Herrerias-Canedo, A. Arzola-Paniagua, F. Vadillo-Ortega, OF Dueñas-Garcia, H. Rico-Olvera, A randomized, clinical trial of ketorolac tromethamine vs ketorolac trometamine plus complex B vitamins for analgezie prin cezariană. Saudi J Anaesth 6 , 207–212 (2012).CROSSREFPUBMEDGOOGLE ACADEMIC50Centers for Disease Control and Prevention, COVID-19-spitalizare și deces în funcție de vârstă (CDC, 2021).GOOGLE ACADEMIC51OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Clinical Data Tables, Person table. (2021).GOOGLE ACADEMIC52L. Kompaniyets, AB Goodman, B. Belay, DS Freedman, MS Sucosky, SJ Lange, AV Gundlapalli, TK Boehmer, HM Blanck, Indicele de masă corporală și riscul de spitalizare asociată cu COVID-19, internarea la terapie intensivă, ventilația mecanică invazivă , și Death – Statele Unite, martie-decembrie 2020. MMWR Morb. Muritor. Wkly Rep. 70 , 355–361 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC53CB Weir, A. Jan, în StatPearls . (Insula comorilor (FL), 2021).GOOGLE ACADEMIC54F. a. D. Administrație, (2020).GOOGLE ACADEMIC55EC Leas, EM Hendrickson, AL Nobles, R. Todd, DM Smith, M. Dredze, JW Ayers, Cannabidiol auto-raportat (CBD) pentru afecțiuni cu terapii dovedite. JAMA Netw. Deschis 3 , e2020977 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC56M. Hepburn, N. Mullaguri, P. George, S. Hantus, V. Punia, A. Bhimraj, CR Newey, Convulsii simptomatice acute la pacientii critici cu COVID-19: Is there an association? Neurocrit. Care 34 , 139–143 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC57S. Corp., Manual de referință Tabulate Twoway (2021).GOOGLE ACADEMIC58D. Ho, K. Imai, G. King, E. Suart, A. Whitworth, N. Greifer, MatchIt: Nonparametric Preprocessing for Parametric Causal Inference (2021).GOOGLE ACADEMIC59PC Austin, Diagnosticarea echilibrului pentru compararea distribuției covariatelor inițiale între grupurile de tratament în eșantioanele potrivite cu scorul de tendință. Stat. Med. 28 , 3083–3107 (2009).CROSSREFPUBMEDGOOGLE ACADEMIC60D. Pregibon, Metode analitice de date pentru modele liniare generalizate, disertație, (1979).GOOGLE ACADEMIC61L. Blizzard, DW Hosmer, Parameter estimation and goodness-of-fit in log binomial regresion. Biom. J. 48 , 5–22 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC62Centrul JHCR, (2021).GOOGLE ACADEMIC63National COVID Cohort Collaborative, COVID-19 Pehnotyope 3.0 Additional Information (N3C, 2021).GOOGLE ACADEMIC

https://www.science.org/doi/10.1126/sciadv.abi6110

Efectul suplimentar al TCM medicinei chinezești pe bază de plante în tratamentul COVID-19 forme ușoare până la moderate: o revizuire sistematică și meta-analiză

Abstract

Introducere

Boala coronavirus 2019 (COVID-19) a apărut ca o pandemie globală de la izbucnirea ei în Wuhan, China. Este o sarcină urgentă prevenirea și tratarea eficientă a COVID-19 din timp. 

În experiența Chinei în combaterea pandemiei de COVID-19, medicina chineză pe bază de plante (CHM) a jucat un rol indispensabil. 

Un număr mare de investigații epidemiologice au arătat că COVID-19 ușoară până la moderată reprezintă cea mai mare proporție de cazuri. 

Este de mare importanță să se trateze astfel de cazuri de COVID-19, care pot ajuta la controlul progresiei epidemiei. 

Multe studii au arătat că CHM combinată cu terapia convențională în tratamentul COVID-19 ușor până la moderat a fost superioară terapiei convenționale în monoterapie.

 Această revizuire a fost concepută pentru a evalua efectul suplimentar al CHM în tratamentul COVID-19 ușor până la moderat.

Metode

Au fost opt ​​baze de date electronice, inclusiv PubMed, EMBASE, Cochrane Central Register of Controlled Trials, site-ul Clinical Trials.gov, China National Knowledge Infrastructure (CNKI), China Science and Technology Journal Database (VIP), Wanfang Database și China Biology Medicine (CBM). căutat din decembrie 2019 până în martie 2021 fără restricții de limbă. Doi recenzori au căutat și selectat studii și au extras datele în funcție de criteriile de includere și excludere în mod independent. Instrumentul Cochrane Risk of Bias (ROB) a fost utilizat pentru a evalua calitatea metodologică a RCT-urilor incluse. Pentru analiza statistică a fost folosit software-ul Review Manager 5.3.0.

Rezultate

Douăsprezece RCT eligibile, inclusiv 1393 de participanți, au fost incluse în această meta-analiză. Meta-analizele noastre au constatat că parametrii CT pulmonar [RR = 1,26, IC 95% (1,15, 1,38), P <0,00001] și rata de vindecare clinică [RR = 1,26, IC 95% (1,16, 1,38), P <0,00001] ale CHM combinate cu terapia convențională în tratamentul COVID-19 ușor până la moderat au fost mai bune decât cele ale terapiei convenționale. Rata de conversie la cazuri severe [RR = 0,48, IC 95% (0,32, 0,73), P = 0,0005], scorul simptomului TCM al febrei [MD = -0,62, IC 95% (-0,79, -0,45), P < 0,00001], cazuri de tuse [RR = 1,43, IC 95% (1,16, 1,75), P = 0,0006], scorul de simptom TCM al tusei [MD = -1,07, IC 95% (-1,29, -0,85), P<0,00001], scorul simptomelor TCM de oboseală [MD = -0,66, IC 95% (-1,05, -0,28), P= 0,0007], iar CRP [MD = -5,46, IC 95% (-8,19, -2,72), P <0,0001] a terapiei combinate a fost semnificativ mai mică decât cea a terapiei convenționale. Numărul leucocitelor a fost semnificativ mai mare decât cel al terapiei convenționale [DM = 0,38, IC 95% (0,31, 0,44), P <0,00001]. Rezultatele meta-analizei noastre au fost robuste prin analiza de sensibilitate.

Concluzie

Medicina pe bază de plante chineză combinată cu terapia convențională poate fi eficientă și sigură în tratamentul COVID-19 forma ușoara până la moderata. Sunt necesare mai multe RCT de înaltă calitate în viitor.

Plus unu. 2021; 16(8): e0256429.Publicat online 20 aug 2021. 

doi:  10.1371/journal.pone.0256429

PMCID: PMC8378756

PMID: 34415962

Xuqin Du , Curatarea datelor , Analiza formală , Achiziția de finanțare , Investigație , Metodologie , Software , Scriere – schiță originală , Scriere – revizuire și editare , 1 , 2 Lipeng Shi , Conceptualizare , Curare datelor , Investigație , Metodologie , Scriere – revizuire și editare , 1,2,* Wenfu Cao , Conceptualizare , Supraveghere , 1 , 2 , 3 , * Biao Zuo , Validare , Scriere – revizuire și editare , 1 , 2 și Aimin Zhou , Validare , Scriere – revizuire și editare 4Ahmed Negida, Editor

Informații despre autor

Note despre articol 

Informații privind drepturile de autor și licență 

Declinare a răspunderii

Acest articol a fost citat de alte articole din PMC.

Date asociate

Materiale suplimentare

Declarație de disponibilitate a datelor

Introducere

Boala coronavirus 2019 (COVID-19) cauzată de sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) a apărut ca o pandemie globală de la izbucnirea sa în Wuhan, China, în decembrie 2019 [ 1 ]. Până la 25 martie 2021, la nivel global au fost raportate peste 124,21 milioane de cazuri confirmate și peste 2,73 milioane de decese [ 2 ]. ]. Din păcate, cazurile confirmate continuă să crească din cauza răspândirii rapide. Prin urmare, este o sarcină urgentă prevenirea și tratarea eficientă a COVID-19 din timp.

Până în prezent, pandemia din China a fost controlată treptat datorită măsurilor guvernamentale puternice, depistare precoce, carantină timpurie și tratament timpuriu cu terapie convențională occidentală și medicina chineză pe bază de plante (CHM) [ 3 , 4 ]. CHM este un medicament special utilizat în prevenirea și tratamentul bolilor și este compus din medicina vegetală, medicina animală și medicina minerală [ 5 ]. În experiența Chinei de combatere a pandemiei de COVID-19, CHM a jucat un rol indispensabil, iar un program terapeutic CHM a fost inclus în ghidurile privind tratamentul COVID-19 [ 4 , 6 ]. Un număr mare de investigații epidemiologice au arătat că COVID-19 ușor până la moderat reprezintă cea mai mare proporție de cazuri [ 7 ]]. Este de mare importanță să se trateze astfel de cazuri de COVID-19, care pot ajuta la controlul progresiei epidemiei. Recomandările actuale de terapie convențională pentru COVID-19 ușor până la moderat sunt în principal tratament de sprijin antiviral și simptomatic [ 6 ]. Medicamentele antivirale recomandate sunt interferonul, ribavirina, lopinavir-ritonavirul și fosfatul de clorochină [ 6 ]. Cu toate acestea, majoritatea medicamentelor antivirale recomandate utilizate pentru tratarea COVID-19 uşoară până la moderată se bazează în prezent pe tratamente anterioare pentru sindromul respirator acut sever (SARS) şi gripa A, iar incertitudinile cu privire la eficacitatea şi efectele secundare ale acestor medicamente antivirale rămân problematice. 8]. Multe studii au arătat că CHM combinată cu terapia convențională în tratamentul COVID-19 ușor până la moderat a fost superioară terapiei convenționale singură în îmbunătățirea eficacității clinice, a simptomelor clinice și a efectelor antiinflamatorii, provocând în același timp mai puține evenimente adverse ale medicamentului [ 9 , 10 ] .

În prezent, nu există un raport de evaluare sistematică cu privire la eficacitatea CHM combinată cu terapia convențională în tratamentul COVID-19 ușor până la moderat. Prin urmare, am efectuat o revizuire sistematică și o meta-analiză a studiilor care au testat efectul suplimentar al CHM în tratamentul COVID-19 ușor până la moderat.Mergi la:

Metode

Protocolul pentru evaluarea noastră a fost înregistrat în Registrul Internațional Prospectiv al Evaluărilor Sistematice (PROSPERO) cu numărul de înregistrare CRD42020213528. Această revizuire a fost raportată conform articolelor de raportare preferate pentru revizuiri sistematice și meta-analize (PRISMA) [ 11 ].

Criterii de eligibilitate

Criterii de includere și excludere 

Criteriile de diagnosticare a COVID-19 uşoară până la moderată se referă la „Liniile directoare de diagnostic şi tratament pentru COVID-19 (procesul ediţia a 8-a)” [ 6 ]. Ușoară COVID-19 este definită ca simptome clinice ușoare (cum ar fi febră scăzută, oboseală ușoară, afectarea mirosului și a gustului etc.) fără dovezi radiografice de pneumonie [ 6 ]. COVID-19 moderat este definit ca având febră, simptome respiratorii și manifestări imagistice ale pneumoniei [ 6 ].

Criterii de includere: (1) Designul studiului: numai studii randomizate controlate (RCT). (2) Participanți: pacienți adulți (cu vârsta ≥18 ani) cu diagnostic stabilit de COVID-19 ușor până la moderat. (3) Intervenții: grupul de tratament a fost tratat cu o combinație de CHM și terapie convențională. Administrarea CHM a fost limitată la administrarea orală. Pacienții din grupul de control au fost tratați cu terapie convențională. (4) Rezultate: a. eficacitatea clinică (de exemplu, tomografia computerizată pulmonară (CT), rata de vindecare clinică, rata de conversie la cazuri severe, testarea acidului nucleic viral), b. simptome clinice (de exemplu, febră, tuse, oboseală), c. biomarkeri inflamatori (de exemplu, numărul de globule albe (WBC), numărul de limfocite (LYM), proteina C reactivă (CRP)), d. evenimente adverse medicamentoase (de exemplu greață și vărsături, diaree, afectare hepatică).

Criterii de excludere: (1) Pacienți cu diagnostic suspectat de COVID-19; (2) Studii retrospective, studii observaționale, studii de date repetate și studii încrucișate.

Strategia de căutare

Au fost opt ​​baze de date electronice, inclusiv PubMed, EMBASE, Cochrane Central Register of Controlled Trials, site-ul Clinical Trials.gov, China National Knowledge Infrastructure (CNKI), China Science and Technology Journal Database (VIP), Wanfang Database și China Biology Medicine (CBM). căutat din decembrie 2019 până în martie 2021 fără restricții de limbă. Termenii de căutare au inclus „boala coronavirus 2019”, „COVID-19”, „pneumonie cu coronavirus nou”, „SARS-CoV-2”, „2019-nCoV”, „medicina tradițională chineză”, „medicina chineză pe bază de plante”, „chineză”. plante medicinale”, „terapie cu plante medicinale chinezești”, „formule din plante chinezești”, „proces clinice”, „proces controlate randomizate”, „proces controlate randomizate” și „lin chuang yan jiu”. Potențialele studii eligibile au fost obținute prin căutarea în listele de referințe ale recenziilor și meta-analizelor.De asemenea, am contactat autorii studiului pentru mai multe informații.

Strategia de căutare PubMed este următoarea. Căutați: ((((((boala coronavirus 2019) SAU (COVID-19)) SAU (pneumonie cu coronavirus nou)) SAU (SARS-CoV-2)) SAU (2019-nCoV)) ȘI (((((chineză tradițională) medicament) SAU (medicament pe bază de plante chineză)) SAU (plantă chineză)) SAU (terapie cu plante chinezești)) SAU (formule chineze pe bază de plante))) ȘI ((((trial clinic) SAU (studiu controlat randomizat)) SAU (studiu controlat randomizat) )) SAU (lin chuang yan jiu)).

Selecția studiului și extragerea datelor

Doi recenzori (XQD și LPS) au citit titlul, rezumatul și textul integral și au selectat în mod independent studiile calificate conform criteriilor de eligibilitate. Pentru extragerea următoarelor informații a fost utilizată un formular de testare prestabilit în duplicat: caracteristici de bază (de exemplu, titlul, numele primului autori, data publicării), caracteristicile participanților (de exemplu, vârsta, sexul, dimensiunea eșantionului), detaliile intervenției (de exemplu, descrierea intervenții, descrierea controalelor, doza, calea de administrare orală, durata tratamentului) și măsurile de rezultat, precum și orice evenimente adverse. Evaluatorii (XQD și LPS) au verificat datele încrucișate. Orice diferențe de opinie între recenzenții primari au fost rezolvate de un al treilea evaluator (WFC). Toți recenzenții au fost imparțiali și nu au avut interese conflictuale.

Evaluarea calitatii metodologice

Doi recenzori (XQD și LPS) au evaluat calitatea metodologică utilizând instrumentul Cochrane Collaboration [ 12 ]. Șapte elemente de risc de părtinire (ROB) au fost evaluate după cum urmează: generarea aleatorie a secvenței, ascunderea alocării, orbirea (pacient, investigator și evaluator), datele incomplete ale rezultatelor abordate, fără raportare selectivă și alte părtiniri. Fiecare element al ROB a fost evaluat ca fiind ROB scăzut, ROB ridicat sau ROB neclar. În plus, orice neînțelegeri ale ROB au fost rezolvate prin consultare cu cel de-al treilea evaluator (WFC).

Meta-analize

Pentru analiza cantitativă a fost utilizat software-ul Review Manager 5.3.0 (Colaborarea Cochrane, Copenhaga, Danemarca). Riscul relativ (RR) a fost adoptat pentru variabilele dihotomice. Diferența medie (MD) sau diferența medie standard (SMD) au fost calculate pentru variabilele continue. Intervalele de încredere (IC) au fost stabilite la 95%, cu P < 0,05 considerată o diferență semnificativă statistic. Eterogeneitatea a fost evaluată cu testul χ2 și valoarea statistică I 2 . Când P ≥0,10 sau I2 ≤50 %, a fost adoptat un model cu efect fix. În caz contrar, a fost aplicat un model cu efect aleatoriu. Analizele de subgrup au fost efectuate în funcție de durata tratamentului. Analizele de sensibilitate au fost efectuate prin metoda leave-one-out [ 13]. Analiza funnel plot a fost efectuată pentru a evalua distorsiunea de raportare pentru măsurile de rezultat cu mai mult de 10 RCT-uri [ 14 ].Mergi la:

Rezultate

Studii eligibile

Diagrama de flux a selecției și identificării studiului este prezentată în (Fig 1). Un total de 526 de citate conexe au fost recuperate inițial. Douăsprezece RCT eligibile au fost incluse în meta-analiză conform criteriilor de includere și excludere [ 15 – 26 ]. Un RCT a fost publicat online în engleză [ 19 ], iar restul au fost raportate online în chineză.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g001.jpg

Fig 1Diagrama fluxului de selecție și identificare a studiilor.

Caracteristicile RCT incluse sunt enumerate în (tabelul 1). Douăsprezece RCT care au înrolat 1393 de participanți au fost incluse în această meta-analiză. Toate cele douăsprezece RCT au fost efectuate în China în 2020. În toate studiile incluse, pacienții din grupul de control au primit terapie convențională, în timp ce pacienții din grupul de tratament au primit terapie combinată de CHM și terapie convențională. Durata tratamentului a variat de la 5 la 15 zile. Dintre cele douăsprezece RCT [ 15 – 26 ], trei au fost studii multi-centrate [ 18 , 19 , 22 ], iar restul de nouă au fost studii unicecentrate.

tabelul 1

Caracteristicile RCT incluse.

Primul autorTipul de COVID-19Dimensiunea eșantionului (M/F)Varsta (ani)IntervenţieControlDuratăMăsuri finale
Duan C [ 15 ]blândT:82(39/43) C:41(23/18)T:51,99±13,88 C:50,29±13,17Granule Jinhua Qinggan și terapie convenționalăTerapie convențională5 zile⑤+⑦
Fu [ 16 ]uşoară/ moderatăT:32(17/15) C:33(19/14)T:43,26±7,15 C:43,68±6,45Granule Toujie Quwen și terapie convenționalăTerapie convențională10 zile①+②+③+⑤+⑥+⑦
Fu XX [ 17 ]moderatT:37(19/18) C:36(19/17)T:45,26±7,25 C:44,68±7,45Granule Toujie Quwen și terapie convenționalăTerapie convențională15 zile②+③+⑤+⑥+⑦
Hu F [ 18 ]moderatT:100(49/51) C:100(55/45)T:47,00±14,06 C:49,28±11,14Jinyinhua lichid oral și terapie convenționalăTerapie convențională10 zile①+③+④+⑦
Hu K [ 19 ]uşoară/ moderatăT:142(79/63) C:142(71/71)T:50,4±15,2 C:51,8±14,8Capsula Lianhua Qingwen și terapie convenționalăTerapie convențională14 zile①+②+③+④+⑤+⑦
Qiu M [ 20 ]moderatT:25(13/12) C:25(14/11)T:53,35±18,35 C:51,32±14,62Maxing Xuanfei Jiedu Decoctul și terapia convenționalăTerapie convențională10 zile①+③+⑤
Sun HM [ 21 ]uşoară/ moderatăT:32(17/15) C:25(11/14)T:45.4±14.10 C:42.0±11.70Lianhua Qingke granule si conventionala terapieConventionala terapie14 zile①+③+⑤
Yang MB [22]moderataT:26(16/10) C:23(9/14)T:50.35±13.37 C:47.17±16.57Reyanning mixtura si conventionala terapieConventionala terapie7 zile③+④+⑤+⑥+⑦
Yu P [23]usoara/ moderataT:147(82/65) C:148(89/59)T:48.27±9.56 C:47.25±8.67Lianhua Qingwen granule si conventionala terapieConventionala terapie7 zile①+②+③+⑤+⑥+⑦
Zhang CT [24]moderataT:22(9/13) C:23(10/13)T:53.7±3.5 C: 55.6±4.2Jiawei Dayuan Decoct si conventionala terapieConventional terapie7 zile①+⑤+⑥+⑦
Zhang YL [25]moderataT:80(50/30) C:40(23/17)T:53.4±13.70 C:52.0±14.10Jinyinhua oral lichid si conventionala terapieConventionala terapie10 zile③+⑤+⑦
Zhou WM [26]moderataT:52(32/20) C:52(28/24)T:52.47±10.99 C:51.11±9.87glicirizatul de diamoniu și terapia convenționalăTerapie convențională14 zile②+⑥+⑦

Deschide într-o fereastră separată

①: CT pulmonar; ②: rata de vindecare clinică; ③: Rata de conversie în cazuri severe; ④: testarea acidului nucleic al virusului; ⑤: Simptome clinice; ⑥: biomarkeri inflamatori; ⑦: Evenimente adverse.

Evaluarea calitatii metodologice

Rezultatele evaluării riscului de părtinire sunt prezentate în (Fig 2a) și (Fig 2b). În general, calitatea metodologiei incluse în această revizuire nu a fost ridicată. Majoritatea RCT-urilor nu au precizat în mod clar prejudecățile de detectare și toate nu au raportat în mod explicit ascunderea alocării, părtinirea performanței și părtinirea raportării.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g002.jpg

Fig 2Evaluarea calitatii metodologice.

(a) Graficul riscului de părtinire. (b) Rezumatul riscului de părtinire.

Descrierea CHM

Componentele CHM sunt enumerate în (masa 2). Nouă medicamente din plate CHM orale au fost utilizate în această revizuire, inclusiv granule Jinhua Qinggan [ 15 ], granule Toujie Quwen [ 16 , 17 ], lichid oral Jinyinhua [ 18 , 25 ], capsula Lianhua Qingwen (granule) [ 19 , 23 ], Maxing Xuanfei Jiedu Decoctul [ 20 ], granule Lianhua Qingke [ 21 ], amestec Reyanning [ 22 ], Decoctul Jiawei Dayuan [ 24 ], glicirrizinat de diamoniu [ 26 ].

tabel 2

Componentele CHM.

ReferințeCHMComponente
Duan C [ 15 ]Granule Jinhua QingganJinyinhua 10g, Shigao 10g, Mahuang (procesat cu miere) 10g, Kuxingren (prăjire) 10g, Huangqin 10g, Lianqiao 10g, Zhebeimu 10g, Zhimu 10g, Niubangzi 10g, Qingha 10g, Qinghao Gang110
Fu [ 16 ]Granule Toujie QuwenLianqiao 30g, Shancigu 20g, Jinyinhua 15g, Huangqin 10g, Daqingye 10g, Chaihu 5g, Qinghao 10g, Chantui 10g, Qianhu 5g, Chuanbeimu 10g, Zhebeimu 10g, Zhebeimu 10g, Fuqiimu 10g, 10g, 10g
Fu XX [ 17 ]Granule Toujie QuwenLianqiao 30g, Shancigu 20g, Jinyinhua 15g, Huangqin 10g, Daqingye 10g, Chaihu 5g, Qinghao 10g, Chantui 10g, Qianhu 5g, Chuanbeimu 10g, Zhebeimu 10g, Zhebeimu 10g, Fuqiimu 10g, 10g, 10g
Hu F [ 18 ]Jinyinhua lichid oralJinyinhua 5,4 g
Hu K [ 19 ]Capsula Lianhua QingwenLianqiao, Jinyinhua, Mahuang (prăjire), Kuxingren (prăjire), Shigao, Banlangen, Guanzhong, Yuxingcao, Huoxiang, Dahuang, Hongjingtian, Bohe, Gancao
Qiu M [ 20 ]Maxing Xuanfei Jiedu DecocMahuang 9g, Kuxingren 12g, Shigao 15~30g, Zhebeimu 12g, Chantui 10g, Jiangchan 15g, Jianghuang 12g, Jiegeng 12g, Zhiqiao 12g, Caoguo 9g, Caodoukou 12g
Sun HM [ 21 ]Granule Lianhua QingkeMahuang, Sangbaipi, Kuxingren (prăjire), Lianqiao, caprifoi de munte, Dahuang
Yang MB [ 22 ]Amestecul reyanningPugongying, Huzhang, Baijiang Herba cum Radice, Banzhilian
Yu P [ 23 ]Granule Lianhua QingwenLianqiao, Jinyinhua, Mahuang (prăjire), Kuxingren (prăjire), Shigao, Banlangen, Guanzhong, Yuxingcao, Huoxiang, Dahuang, Hongjingtian, Bohe, Gancao
Zhang CT [ 24 ]Decoctul Jiawei DayuanMahuang (prăjire) 10g, Xingren 15g, gips brut 20g, scoarță de trichosanthes 20g, Dahuang (prăjire cu vin galben de orez) 6g, Tinglizi 10g, Taoren 10g, Caoguo 6g, Bingglang 1010g
Zhang YL [ 25 ]Jinyinhua lichid oralJinyinhua 5,4 g
Zhou WM [ 26 ]diaminglicirizatdiaminglicirizat

Deschide într-o fereastră separată

Frecvența fiecărei plante chinezești din această meta-analiză a fost de asemenea rezumată manual. Primele 3 ierburi chinezești clasate au fost caprifoiul (58,33%) [ 15 – 19 , 23 , 25 ], forsythia (50,00%) [ 15 – 17 , 19 , 21 , 23 ] și efedra (50,00,%) [ 1 – 15 21 , 23 , 24 ].

Au fost incluse patru formulări de dozare de CHM oral, inclusiv granule [ 15 – 17 , 21 , 23 , 24 ], lichid oral [ 18 , 22 , 25 ], capsule [ 19 , 26 ] și decoct [ 20 ]. Cea mai frecvent utilizată formulare de dozare a fost granule (50,00%) [ 15 – 17 , 21 , 23 , 24 ].

Evaluarea eficacității și siguranței

Eficacitate clinică 

CT pulmonar . Criteriile de evaluare pentru un CT pulmonar se referă la Ghidurile COVID-19 pentru diagnosticul asistat de imagistică [ 27 ]. CT pulmonar poate evalua efectul curativ prin parametrii de bază absorbție, îmbunătățire, fără modificare și agravare. Dacă intervalul leziunii dispare ≥70%, aceasta indică o absorbție de bază. Dacă intervalul leziunii a dispărut ≥30%, aceasta indică o îmbunătățire. Dacă nu a existat nicio modificare în intervalul leziunii, aceasta indică nicio modificare. Dacă amploarea leziunii a crescut cu ≥30%, aceasta indică o agravare. Eficacitatea terapiei bazate pe CT pulmonar = (cazuri de absorbție de bază + cazuri de ameliorare)/total cazuri × 100%. Șapte studii care au înrolat 845 de pacienți au menționat CT pulmonar [ 16 , 19 – 24]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 8%, P = 0,37). Meta-analiză a arătat că terapia combinată ar putea îmbunătăți semnificativ CT pulmonar [RR = 1,26, IC 95% (1,15, 1,38), P <0,00001] (Fig 3a). Analiza subgrupurilor a arătat că a existat o diferență semnificativă între subgrupuri cu durata de tratament de 7 zile ( P = 0,03) și durata de tratament de 10 până la 14 zile ( P <0,00001) (Fig 3a).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g003.jpg

Fig 3

Graficul forestier al efectelor terapiei combinate pentru rezultatele (a) CT pulmonar, (b) rata de vindecare clinică, (c) rata de conversie la cazuri severe, (d) testarea acidului nucleic viral.

Rata de vindecare clinică . Standardele de vindecare clinică se referă la Ghid Principles for Clinical Research of New Chinese Materia Medica [ 28 ]. Efectele terapeutice sunt clasificate ca fiind eficiente, îmbunătățite și ineficiente. Dacă scorul simptomelor TCM este redus cu mai mult de 70%, aceasta sugerează eficacitate. Dacă scorul simptomelor TCM este redus cu mai mult de 30%, acesta reprezintă simptome îmbunătățite. Dacă scorul simptomelor TCM este redus cu mai puțin de 30%, acesta reprezintă un tratament ineficient. Rata de vindecare clinică = (cazuri eficiente + cazuri îmbunătățite)/total cazuri × 100%. Cinci studii care au înrolat 821 de participanți au raportat rata de vindecare clinică [ 16 , 17 , 19 , 22 , 26]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 0%, P = 0,77). Rezultatul a indicat rata de vindecare clinică în terapia combinată a fost mai mare decât terapia convențională [RR = 1,26, IC 95% (1,16, 1,38), P <0,00001] (Fig 3b).

Rata de conversie la cazuri severe . Nouă studii care au înrolat 1121 de pacienți au raportat rata de conversie la cazuri severe [ 16 – 23 , 25 ]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 0%, P = 0,83). Rezultatele au arătat că terapia combinată ar putea reduce semnificativ rata de conversie la cazuri severe [RR = 0,48, IC 95% (0,32, 0,73), P = 0,0005] (Fig 3c).

Testarea acidului nucleic viral . Rata negativă a testării acidului nucleic viral = (cazuri negative la sfârșitul studiului − cazuri negative înainte de proces)/total cazuri × 100%. Patru studii care au înrolat 581 de pacienți au raportat testarea acidului nucleic viral [ 18 – 19 , 22 , 25 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 57%, P = 0,08). Meta-analizele nu au evidențiat nicio diferență statistică în testarea acidului nucleic viral [RR = 1,09, IC 95% (0,98, 1,21), P = 0,13] (Fig 3d).

Simptome clinice 

Febra . Trei studii care au înrolat 205 pacienți au menționat cazuri de reducere a febrei [ 15 , 21 , 25 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 95%, P <0,00001). Meta-analiză a arătat că nu a existat nicio diferență statistică în cazurile de reducere a febrei [RR = 1,14, IC 95% (0,58, 2,25), P = 0,70] (Fig 4a). Patru studii au implicat 482 de participanți au raportat scorul simptomelor TCM de febră [ 16 , 17 , 22 , 23 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 79%, P = 0,009). Rezultatul cumulat a arătat că terapia combinată ar putea duce la o reducere semnificativă a scorului simptomatologiei TCM al febrei [MD = -0,62, IC 95% (-0,79, -0,45), P <0,00001] (Fig 4b).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g004.jpg

Fig 4

Graficul forestier al efectelor terapiei combinate pentru rezultatele (a) cazurilor de reducere a febrei, (b) scorul simptomelor TCM al febrei, (c) cazurilor de reducere a tusei, (d) scorul simptomelor TCM al tusei, (e) cazurilor de reducere a oboselii, (f) Scorul TCM simptom al oboselii.

Tusea . Trei studii care au înrolat 205 pacienți au menționat cazuri de reducere a tusei [ 15 , 21 , 25 ]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 0%, P = 0,89). Meta-analizele au arătat că terapia combinată ar putea reduce semnificativ cazurile de tuse [RR = 1,43, IC 95% (1,16, 1,75), P = 0,0006] (Fig 4c). Patru studii care au înrolat 482 de participanți au raportat scorul simptomelor TCM de febră [ 16 , 17 , 22 , 23 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 84%, P = 0,0003). Estimarea combinată a constatat că terapia combinată a scăzut scorul simptomelor TCM al tusei [MD = -1,07, IC 95% (-1,29, -0,85), P <0,00001] (Fig 4d).

Oboseala . Trei studii care au înrolat 205 pacienți au menționat cazuri de reducere a oboselii [ 15 , 21 , 25 ]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 28%, P = 0,25). Meta-analiză a arătat că terapia combinată ar putea reduce semnificativ cazurile de oboseală [RR = 1,23, IC 95% (1,03, 1,47), P = 0,02] (Fig 4e). Patru studii care au înrolat 482 de participanți au raportat scorul simptomelor TCM de febră [ 16 , 17 , 22 , 23 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 98%, P <0,00001). Rezultatul combinat a constatat că terapia combinată a scăzut scorul simptomelor TCM de oboseală [MD = -0,66, IC 95% (-1,05, -0,28), P = 0,0007] (Fig 4f).

Biomarkeri inflamatori 

Numărarea leucocitelor . Patru studii care au înrolat 478 de participanți au menționat numărul de leucocite [ 16 , 17 , 23 , 24 ]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 5%, P = 0,37). Meta-analiză a arătat că terapia combinată ar putea crește semnificativ numărul de leucocite [MD = 0,38, IC 95% (0,31, 0,44), P <0,00001] (Fig 5a). Analiza subgrupurilor a arătat că a existat o diferență semnificativă între subgrupuri cu durata de tratament de 7 zile ( P <0,00001) și durata de tratament de 10 până la 15 zile ( P <0,00001) (Fig 5a).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g005.jpg

Fig 5

Graficul forestier al efectelor terapiei combinate pentru rezultatele (a) numărului de leucocite, (b) numărului de LYM, (c) CRP.

LYM număr . Patru studii care au înrolat 482 de participanți au raportat numărul LYM [ 16 , 17 , 22 , 23 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 97%, P <0,00001). Estimarea combinată a constatat că terapia combinată a crescut numărul LYM [MD = 0,26, IC 95% (0,05, 0,47), P = 0,01] (Fig 5b). Analiza subgrupurilor a arătat că a existat o diferență semnificativă între subgrupuri cu durata de tratament de 7 zile ( P <0,00001) și durata de tratament de 10 până la 15 zile ( P = 0,0002) (Fig 5b).

CRP . Șase studii care au înrolat 631 de participanți au raportat CRP [ 16 , 17 , 22 – 24 , 26 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 96%, P <0,00001). Rezultatul cumulat a constatat că terapia combinată a scăzut CRP [MD = -5,46, IC 95% (-8,19, -2,72), P <0,0001] (Fig 5c). Analiza subgrupurilor a arătat că a existat o diferență semnificativă între subgrupuri cu durata de tratament de 7 zile ( P = 0,02) și durata de tratament de 10 până la 15 zile ( P = 0,04) (Fig 5c).

Evenimente adverse medicamentoase 

Numărul total de cazuri de evenimente adverse medicamentoase . Zece studii care au înrolat 1286 de participanți au raportat numărul total de cazuri de evenimente adverse ale medicamentelor [ 15 – 19 , 22 – 26 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 63%, P = 0,03). Meta-analizele nu au evidențiat nicio diferență statistică în numărul total de cazuri de evenimente adverse medicamentoase [RR = 1,13, IC 95% (0,45, 2,83), P = 0,79] (Fig 6a).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g006.jpg

Fig 6

Graficul forestier al siguranței terapiei combinate pentru rezultatele (a) numărului total de cazuri de evenimente adverse medicamentoase, (b) greață și vărsături, (c) diaree, (d) funcție hepatică anormală.

Greață și vărsături . Două studii care au înrolat 388 de participanți au raportat greață și vărsături [ 19 , 26 ]. A fost utilizat un model cu efecte fixe din cauza lipsei de eterogenitate semnificativă ( 2 = 0%, P = 0,74). Analiza subgrupurilor nu a sugerat nicio diferență statistică în ceea ce privește greața și vărsăturile [RR = 1,09, IC 95% (0,49, 2,41), P = 0,83] (Fig 6b).

Diareea . Cinci studii care au înrolat 759 de participanți au raportat numărul total de cazuri de evenimente adverse ale medicamentelor [ 15 , 18 , 19 , 25 , 26 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 70%, P = 0,009). Analiza subgrupurilor nu a arătat nicio diferență statistică în diaree [RR = 1,72, IC 95% (0,34, 8,67), P = 0,51] (Fig 6c).

Funcție hepatică anormală . Două studii care au înrolat 388 de participanți au raportat numărul total de cazuri de evenimente adverse ale medicamentelor [ 19 , 26 ]. A fost utilizat un model cu efecte aleatoare datorită eterogenității semnificative ( 2 = 78%, P = 0,03). Analiza subgrupurilor nu a evidențiat nicio diferență statistică în funcție de funcționarea anormală a ficatului [RR = 0,41, IC 95% (0,05, 3,69), P = 0,43] (Fig 6d).

Un studiu a raportat că au existat 8 cazuri de apetit scăzut, 1 caz de durere de cap și 8 cazuri de disfuncție renală în grupul de terapie combinată [ 19 ].

Analiza de sensibilitate

Analiza de sensibilitate a arătat că a existat o mică modificare a cantității de efect și o diferență semnificativă în CT pulmonar, rata de vindecare clinică, rata de conversie la cazuri severe, scorul simptomelor TCM de febră, cazurile de reducere a tusei, scorul simptomelor TCM de tuse, TCM scorul simptomelor de oboseală, numărul de leucocite și CRP, care au indicat că rezultatele meta-analizei de mai sus sunt robuste.

Prejudecata de publicare

În studiul nostru, zece studii au raportat evenimente adverse ale medicamentelor [ 15 – 19 , 22 – 26 ]. Printre acestea, cinci studii au raportat că nu au fost observate evenimente adverse ale medicamentului [ 16 , 17 , 22 – 24 ]. Graficul pâlnie a fost utilizat pentru a analiza studiile cu evenimente adverse raportate pentru a explora părtinirea (Fig 7). Graficul pâlnie este simetric, indicând nicio abatere evidentă.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este pone.0256429.g007.jpg

Fig 7Studii privind evenimentele adverse ale medicamentelor.Mergi la:

Discuţie

Clasificarea clinică a COVID-19 este ușoară, moderată, severă și critică [ 7 ]. COVID-19 sever este mai probabil să aibă complicații grave, cum ar fi șoc, sindromul de detresă respiratorie acută (ARDS), aritmie și leziune cardiacă acută [ 29 , 30 ], toate acestea crescând semnificativ dificultatea și costul tratamentului. Prin urmare, este de mare importanță prevenirea dezvoltării COVID-19 de la ușoară sau moderată la severă. În studiul nostru, s-a constatat că, în comparație cu terapia convențională în monoterapie, pacienții cu COVID-19 ușoare până la moderate tratați cu terapia combinată de CHM și terapia convențională au avut mai multe beneficii. Studii similare au arătat că CHM are efecte pozitive la pacienții cu COVID-19 [ 31 – 33]. În fața unei astfel de epidemii severe de COVID-19, țările occidentale ar trebui să acorde atenție efectului terapeutic al CHM pentru COVID-19.

Conform teoriei medicinei tradiționale chineze (MTC), boala epidemică se referă la o boală infecțioasă acută caracterizată prin debut brusc, transmitere rapidă, condiții periculoase și infecțiozitate puternică după ce a simțit pestilența rău [ 34 ]. COVID-19 este o „boală epidemică” a MTC în lumina modului său de incidență și a tendinței epidemice [ 7 ]. Patogenia COVID-19 uşoară până la moderată este umiditatea-căldură sau frig-umezeala care obstrucționează plămânul [ 7 ]. Prin urmare, CHM, cu efect de curățare a căldurii, de eliminare a umezelii, de rezolvare a flegmei și de dispersare a frigului, este utilizat pe scară largă [ 7 ].]. În studiile incluse, au fost utilizate nouă CHM orale diferite, inclusiv capsule și granule Lianhua Qingwen, granule Toujie Quwen, lichide orale Jinyinhua, glicirrizinat de diamoniu etc. Capsulele Lianhua Qingwen provin din formule clasice din plante chinezești și pot reduce virusul gripal A (H1N1) replicare, leziuni pulmonare și inflamație [ 35 ]. În plus, capsulele Lianhua Qingwen pot reduce leziunile pulmonare și pot ajuta la eliminarea infecției cu SARS-CoV-2 prin reglarea Akt1 [ 36 ]. Un studiu a arătat că granulele Toujie Quwen pot avea efecte terapeutice asupra COVID-19 prin reglementarea infecției cu SARS-CoV-2, a țintelor imune și legate de inflamație și a căilor [ 37 ].]. Glicirrizinatul de diamoniu este folosit ca protector hepatic și este componenta principală a extractelor de rădăcină de lemn dulce [ 38 ]. Glicirizinatul de diamoniu poate scădea nivelurile serice de ALT și AST, poate îmbunătăți leziunile histologice, poate regla în jos citokinele inflamatorii și poate inhiba apoptoza limfocitelor T din timus [ 38 ].

Dintre cele nouă CHM orale, cea mai frecvent utilizată plantă chineză a fost caprifoiul, urmată de forsythia și efedra. Caprifoiul și forsythia au funcția de a elimina toxicitatea termică și de a dispersa căldura vântului în teoria TCM [ 5 ]. Polizaharida de caprifoi este o componentă activă a caprifoiului care poate regla imunitatea nespecifică [ 39 ], poate inhiba expresia factorilor inflamatori TNF-α și IL-1β [ 40 ] și poate inhiba o varietate de virusuri [ 41 ]. Phillyrin este o componentă activă a forsythia care are activități antivirale și antiinflamatorii [ 42 , 43 ]. Efedra are funcția de a disipa frigul și de a difuza plămânul pentru a calma gâfâitul în teoria TCM [ 5 ]]. Efedrina este o componentă activă a efedrei care poate crește producția de citokină antiinflamatoare IL-10, poate reduce producția de citokine proinflamatorii TNF-α și IL-12 [ 44 ] și joacă un rol antiviral prin inhibarea replicării virale. 45 ].

Pacienții cu COVID-19 ușoare până la moderate tratați cu terapie combinată de CHM și terapie convențională au avut rezultate mai bune în parametrii, inclusiv eficacitatea clinică, simptomele clinice și răspunsul inflamator. Studiul nostru a constatat că, în comparație cu terapia convențională numai, terapia combinată ar putea îmbunătăți scorurile simptomelor precum febra, tusea și oboseala și ar putea reduce cazurile de tuse. Terapia combinată ar putea crește numărul de leucocite și poate scădea CRP. Acest lucru este legat de faptul că CHM poate îmbunătăți răspunsul imun al gazdei și poate regla în jos citokinele inflamatorii [ 35 , 38 , 46 ]. Modificările imunopatologice, inclusiv niveluri relativ mai scăzute de leucocite și LYM și niveluri semnificativ mai mari de CRP și citokine inflamatorii, sunt corelate cu severitatea COVID-19.47 , 48 ]. Suprimarea imună și leziunile inflamatorii sunt, de asemenea, factori importanți ai progresiei COVID-19 [ 49 ]. Furtuna de citokine este o hiperproducție de citokine inflamatorii, care poate duce la agravarea ARDS și leziuni tisulare larg răspândite, ducând la leziuni pulmonare acute, insuficiență multiorganică și moarte [ 50 , 51 ]. Direcționarea citokinelor în timpul managementului pacienților cu COVID-19 ar putea îmbunătăți ratele de supraviețuire [ 51 ]. În studiul nostru, am constatat, de asemenea, că terapia combinată a avut un efect mai bun asupra îmbunătățirii parametrilor CT pulmonar, promovând rata de vindecare clinică și reducând rata de conversie la cazurile severe.

Datorită formulărilor diferite și compozițiilor neclare, CHM are mulți factori necunoscuți de rezolvat. În studiul nostru, am constatat că formulările CHM utilizate în grupul de terapie combinată au fost diferite, iar calitatea intervenției pe bază de plante a fost neclară. CHM este probabil să necesite un tratament standard. În plus, calitatea formulelor pe bază de plante ar trebui monitorizată prin standardizare. În acest fel, cele mai bune dovezi pot fi rezumate sistematic pentru a oferi mai bine o bază bazată pe dovezi pentru luarea deciziilor TCM. Tratamentul CHM, care se bazează pe evaluare individualizată, poate fi afectat de diferite practici de dietă și vreme, ceea ce duce la dificultatea utilizării sale în țările occidentale. Prin urmare, considerăm că este necesar ca țările occidentale să angajeze experți în MTC pentru a participa la tratamentul COVID-19.Problemele de siguranță ar trebui să fie o preocupare atunci când CHM este utilizat pentru COVID-19. În studiul nostru, am constatat că majoritatea studiilor incluse au raportat evenimente adverse ale medicamentelor. Terapia combinată nu a crescut evenimentele adverse ale medicamentului. Graficul pâlnie al evenimentelor adverse ale medicamentelor nu a indicat nicio abatere evidentă.

Cu toate acestea, a fost o problemă comună faptul că cele mai multe dintre studiile incluse au avut un design metodologic slab și că analiza statistică de fuziune a unor rezultate a avut o eterogenitate inexplicabilă. Sunt necesare mai multe teste de înaltă calitate în viitor. În ciuda metodologiei slabe și a eterogenității inexplicabile, constatările noastre sunt foarte valoroase și oportune, având în vedere lipsa medicamentelor specifice aprobate pentru COVID-19.Mergi la:

Limitări

În ciuda utilității constatărilor noastre, această revizuire are, de asemenea, câteva limitări care ar putea fi îmbunătățite în studiile viitoare. În primul rând, cele mai multe dintre studiile incluse au avut deficiențe în proiectarea metodologiei, inclusiv alocarea ascunsă și raportarea inadecvată a metodelor oarbe. În al doilea rând, compoziția, doza și frecvența CHM au fost diferite în grupurile de tratament. În al treilea rând, studiile multicentrice au lipsit. În plus, durata studiilor incluse a variat între 5 și 15 zile. Prin urmare, este necesar să se proiecteze mai multe studii de înaltă calitate, cu un eșantion multicentric, cu o dimensiune mai mare a eșantionului și o urmărire mai lungă, pentru a observa mai bine eficacitatea și posibilele evenimente adverse ale CHM combinate cu terapia convențională în tratamentul COVID-19 ușor până la moderat. .Mergi la:

Concluzie

Medicina pe bază de plante chineză combinată cu terapia convențională ar putea fi eficientă și sigură în tratamentul COVID-19 ușor până la moderat. Terapia combinată poate îmbunătăți rata de vindecare clinică, principalele simptome clinice, indici imagistici și de laborator și poate reduce rata de conversie la cazuri severe. Cu toate acestea, deoarece COVID-19 este o boală bruscă, este dificil să se efectueze studii clinice dublu-orb, ceea ce duce la o metodologie insuficientă în studiile conexe existente. Prin urmare, sunt necesare mai multe studii de înaltă calitate pentru a evalua eficacitatea și siguranța medicinei pe bază de plante chinezești combinată cu terapia convențională în tratamentul adulților cu COVID-19 ușor până la moderat.Mergi la:

Informatii justificative

Lista de verificare S1

Lista de verificare PRISMA 2009.

(DOC)Faceți clic aici pentru un fișier de date suplimentar. (66K, document)Mergi la:

Declarație de finanțare

Această lucrare a fost susținută de Fundația Națională de Științe Naturale din China (Nr. 81573860), Fundația Postdoctorală a Universității Medicale Chongqing (Nr. R11004) și Fundația Specială Postdoctorală Chongqing (Oficiul Social Yuren [2020] Nr. 379). Finanțatorii nu au avut niciun rol în proiectarea studiului, colectarea și analiza datelor, decizia de publicare sau pregătirea manuscrisului.Mergi la:

Disponibilitatea datelor

Toate datele relevante se află în lucrare și în fișierele sale cu informații justificative.Mergi la:

Referințe

1. Sattler A, Angermair S, Stockmann H, et al.. Răspunsuri ale celulelor T specifice SARS-CoV-2 și corelații cu predispoziția pacientului COVID-19 [J]. J Clin Invest , 2020, 130 ( 12 ): 6477–6489. doi: 10.1172/JCI140965 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Organizația Mondială a Sănătății. Tabloul de bord OMS Coronavirus (COVID-19).2021 [EB/OL]. https://covid19.who.int/ (accesat 26 martie 2021).3. You C, Deng Y, Hu W, et al.. Estimarea numărului de reproducere variabilă în timp a focarului de COVID-19 în China [J]. Int J Hyg Environ Health , 2020, 228 :113555. doi: 10.1016/j.ijheh.2020.113555 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Ni L, Chen L, Huang X și colab.. Combaterea COVID-19 cu medicina tradițională chineză și occidentală integrată în China [J]. Acta Pharm Sin B , 2020, 10 ( 7 ):1149–1162. doi: 10.1016/j.apsb.2020.06.009 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Gao XM. Farmacia tradițională chineză (serie avansată de medicină tradițională chineză) [M]. Beijing: Editura People’s Health, 2000. [ Google Scholar ]6. Ghid de diagnostic și tratament pentru COVID-19 (Trial Ediția a 8-a) [J]. Chin J Viral Dis , 2020, 10 ( 05 ):321–328. [ Google Scholar ]7. Wu ZY, McGoogan JM. Caracteristicile și lecțiile importante din focarul bolii coronavirus 2019 (COVID-19) în China [J]. J Am Med Assoc , 2020, 323 ( 13 ): 1239–1242. [ PubMed ] [ Google Scholar ]8. Tian J, Yan S, Wang H și colab.. Formula Hanshiyi, un medicament pentru infecția cu Sars-CoV2 în China, a redus proporția de pacienți cu COVID-19 ușoare și moderate care trec la starea severă: un studiu de cohortă [J] . Pharmacol Res , 2020, 161 :105127. doi: 10.1016/j.phrs.2020.105127 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Zhang XY, Lv L, Zhou YL și colab.. Eficacitatea și siguranța injectării Xiyanping în tratamentul COVID-19: un studiu controlat multicentric, prospectiv, deschis și randomizat [J/OL]. Phytother Res : 7141[2021-05-12]. https://pubmed.ncbi.nlm.nih.gov/33979464/ articol gratuit PMC ] [ PubMed ] [ Google Scholar ]10. Xin S, Cheng X, Zhu B și colab.. Studiu clinic retrospectiv privind eficacitatea decoctului Qingfei Paidu combinat cu medicina occidentală pentru tratamentul COVID-19 [J]. Biomed Pharmacother , 2020, 129 :110500. doi: 10.1016/j.biopha.2020.110500 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Moher D, Liberati A, Tetzlaff J, et al.. Articole de raportare preferate pentru revizuiri sistematice și meta-analize: declarația PRISMA [J]. Ann Intern Med , 2009, 151 ( 4 ):264–W64. [ PubMed ] [ Google Scholar ]12. Higgins JPT, Green S. Cochrane Reviewers’ Handbook 5.3.0 [actualizat în martie 2014], Review Manager (RevMan) [Program de calculator]. Versiunea 5.3.0. www.cochrane-handbook.org13. Panahi Y, Hosseini MS, Khalili N și colab.. Efecte antioxidante și antiinflamatorii ale combinației curcuminoid-piperină la subiecții cu sindrom metabolic: un studiu controlat randomizat și o meta-analiză actualizată [J]. Clin Nutr , 2015, 34 ( 6 ):1101–1108. doi: 10.1016/j.clnu.2014.12.019 [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Liu M, Gao Y, Yuan Y și colab.. Eficacitatea și siguranța medicinei tradiționale chineze și occidentale integrate pentru boala cu virus corona 2019 (COVID-19): o revizuire sistematică și meta-analiză [J]. Pharmacol Res , 2020, 158 :104896. doi: 10.1016/j.phrs.2020.104896 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Duan C, Xia GW, Zheng CJ și colab.. Observație clinică asupra granulelor Jinhua Qinggan combinată cu terapia convențională de medicină occidentală în tratarea cazurilor ușoare de boală coronavirus 2019 [J]. J Tradit Chin Med , 2020, 61 ( 17 ):1473–1477. [ Google Scholar ]16. Fu XX, Lin LP, Tan XX. Observație clinică asupra efectului granulelor Toujie Quwen în tratamentul COVID-19 [J]. Chin J Exp Tradit Med Formul , 2020, 26 ( 12 ):44–48. [ Google Scholar ]17. Fu XX, Lin LP, Tan XX. Studiu clinic pe 37 de cazuri de COVID-19 tratate cu medicina tradițională chineză și occidentală integrată [J]. Tradit Chin Drug Res Clin Pharmacol , 2020, 31 ( 05 ): 600–604. [ Google Scholar ]18. Hu F, Guo AH, Huang L și colab.. Observarea clinică multicentrică a lichidului oral Jinyinhua combinat cu medicina occidentală în tratamentul COVID-19 moderat [J/OL]. J Tradit Chin Med :1–6[2020-11-4]. http://kns.cnki.net/kcms/detail/11.2166.R.20200819.0837.002.html . [ Google Scholar ]19. Hu K, Guan WJ, Bi Y, et al.. Eficacitatea și siguranța capsulelor Lianhuaqingwen, o plantă chineză reutilizată, la pacienții cu boală coronavirus 2019: Un studiu controlat multicentric, prospectiv, randomizat [J/OL]. Fitomedicina : 153242[2020-05-16]. https://pubmed.ncbi.nlm.nih.gov/32425361/ doi: 10.1016/j.phymed.2020.153242 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]20. Qiu M, Li QT, Zhu DP, et al.. Observarea eficacității decoctului Maxing Xuanfei Jiedu la pacienții cu COVID-19 moderat [J]. J Emerg Tradit Chin Med ,2020, 29 ( 07 ):1129–1130+1132. [ Google Scholar ]21. Sun HM, Xu F, Zhang L și colab.. Studiu privind eficacitatea clinică a granulelor Lianhua Qingke în tratamentul COVID-19 ușor și obișnuit [J]. Chin J Exp Tradit Med Formul ,2020, 26 ( 14 ):29–34. [ Google Scholar ]22. Yang MB, Dang SS, Haung S și colab.. Observarea clinică multicentrică a amestecului Reyanning în tratamentul COVID-19 [J]. Chin J Exp Tradit Med Formul ,2020, 26 ( 14 ):7–12. [ Google Scholar ]23. Yu P, Li YZ, Wan SB și colab.. Eficacitatea clinică a granulelor Lianhua Qingwen combinată cu abidol în tratarea bolii coronavirus 2019 [J]. Chin Pharm J ,2020, 55 ( 12 ):1042–1045. [ Google Scholar ]24. Zhang CT, Yang Y, You FM, et al.. Studiu clinic asupra COVID-19 din perspectiva teoriei „Yidujiashi” [J]. Pharmacol Clin Chin Materia Medica ,2020, 36 ( 02 ):43–45. [ Google Scholar ]25. Zhang YL, Lei L, Xu Y și colab.. Eficacitatea clinică a lichidului oral Jinyinhua în tratamentul a 80 de pacienți cu boala coronavirus 2019 [J]. Chin Pharm ,2020, 29 ( 09 ): 23–26. [ Google Scholar ]26. Zhou WM, Zhao FM, Li BL și colab.. Valoarea clinică a glicirrizinatului de diamoniu în tratamentul COVID-19 [J]. Chin J Virol ,2020, 36 ( 02 ):160–164. [ Google Scholar ]27. Comitetul profesional de radiologie a infecțiilor și inflamației al Asociației Spitalelor de Cercetare din China. Ghid pentru diagnosticarea asistată prin imagistică a COVID-19 [J]. Chin J Med Imaging Technol , 2020, 36 ( 3 ):1–11. [ Google Scholar ]28. Ministerul Sănătăţii al Republicii Populare Chineze. Principii directoare pentru cercetarea clinică a noii materie medicală chineză [M]. Beijing: China Medical Science and Technology Press, 2002: 186 . [ Google Scholar ]29. Chen N, Zhou M, Dong X și colab.. Caracteristicile epidemiologice și clinice ale a 99 de cazuri de pneumonie cu coronavirus nou din 2019 în Wuhan, China: un studiu descriptiv [J]. Lancet , 2020, 395 ( 10223 ):507–513. doi: 10.1016/S0140-6736(20)30211-7 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Wang DW, Hu B, Hu C și colab.. Caracteristicile clinice ale a 138 de pacienți spitalizați cu pneumonie nou infectată cu coronavirus din 2019 în Wuhan, China [J]. JAMA , 2020, 323 ( 11 ): 1061–1069. doi: 10.1001/jama.2020.1585 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Xiong X, Wang P, Su K și colab.. Medicina chineză pe bază de plante pentru boala coronavirus 2019: O revizuire sistematică și meta-analiză [J]. Pharmacol Res , 2020, 160 :105056. doi: 10.1016/j.phrs.2020.105056 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Zeng M, Li L, Wu Z. Medicina tradițională chineză Lianhua Qingwen tratarea bolii cu virus corona 2019 (COVID-19): Meta-analiză a studiilor controlate randomizate [J]. PLoS One , 2020, 15 ( 9 ): e0238828. doi: 10.1371/journal.pone.0238828 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Ang L, Song E, Lee HW și colab.. Medicina pe bază de plante pentru tratamentul bolii coronavirus 2019 (COVID-19): O revizuire sistematică și meta-analiză a studiilor controlate randomizate [J]. J Clin Med , 2020, 9 ( 5 ):1583. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]34. Yang J. Boli calde [M]. Beijing: Editura People’s Health, 2006. [ Google Scholar ]35. Gao D, Niu M, Wei SZ, et al.. Identificarea unui biomarker farmacologic pentru controlul calității bazat pe teste biologice al unei formule TCM cu treisprezece componente (Lianhua Qingwen) utilizată în tratarea infecției cu virusul gripal A (H1N1) [J ]. Front Pharmacol , 2020, 11 :746. doi: 10.3389/fphar.2020.00746 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Xia QD, Xun Y, Lu JL și colab.. Farmacologia de rețea și analizele de andocare moleculară pe capsula Lianhua Qingwen indică că Akt1 este o țintă potențială pentru tratarea și prevenirea COVID-19 [J]. Cell Prolif , 2020, 53 ( 12 ):e12949. doi: 10.1111/cpr.12949 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Ye M, Luo G, Ye D și colab.. Farmacologia de rețea, tehnologia de rezonanță plasmonică de suprafață integrată de andocare moleculară dezvăluie mecanismul Granulelor Toujie Quwen împotriva pneumoniei bolii coronavirus 2019 [J/OL]. Fitomedicina : 153401 [2020-10-28]. https://pubmed.ncbi.nlm.nih.gov/33191068/ doi: 10.1016/j.phymed.2020.153401 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Gao M, Li X, He L, și colab.. Glicirrizinatul de diamoniu atenuează leziunile hepatice prin inhibarea proliferării celulelor NKT și promovarea proliferării tregs [J]. Drug Des Devel Ther ,2019, 13 :3579–3589. doi: 10.2147/DDDT.S220030 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Zhou XN, Dong Q, Kan XZ, și colab.. Activitatea imunomodulatoare a unei noi polizaharide de la șoareci imunodeprimați Lonicera japonica indusă de ciclofosfamidă [J]. PloS one ,2018, 13 ( 10 ):1–15. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]40. Bai XY, Chai YW, Shi WL și colab.. Polizaharidele Lonicera japonica atenuează rinita alergică indusă de ovalbumină prin reglarea celulelor Th17 la șoarecii BALB/c [J]. J Functional Foods , 2020, 65 :103758. [ Google Scholar ]41. Wang J, Hou L, Chen YQ, et al.. Extracția și purificarea polizaharidei Lonicera japonica și activitatea sa antivirală in vitro [J]. Chin J Hosp Pharm , 2018, 38 ( 8 ): 810–812. [ Google Scholar ]42. Qu XY, Li QJ, Zhang HM, et al.. Efectele protectoare ale filirinei împotriva virusului gripal a in vivo [J]. Arch Pharm Res , 2016, 39 ( 7 ):998–1005.29. doi: 10.1007/s12272-016-0775-z [ PubMed ] [ CrossRef ] [ Google Scholar ]43. Jiang Q, Chen J, Long X, și colab. Phillyrin protejează șoarecii de leziuni cerebrale traumatice prin inhibarea inflamației microgliei prin calea de semnalizare PPARγ [J]. Int Immunopharmacol , 2020, 79 :106083. doi: 10.1016/j.intimp.2019.106083 [ PubMed ] [ CrossRef ] [ Google Scholar ]44. He W, Ma J, Chen Y, et al.. Clorhidratul de efedrina protejează șoarecii de peritonita indusă de stafilococul auriu [J]. Am J Transl Res , 2018, 10 ( 3 ): 670–683. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]45. Wei W, Du H, Shao C și colab.. Screeningul componentelor antivirale ale Ma Huang Tang și investigarea eficacității alcaloizilor efedra asupra virusului gripal de tip A [J]. Front Pharmacol , 2019, 10 :961. doi: 10.3389/fphar.2019.00961 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]46. Sun CY, Sun YL, Li XM. Rolul medicinei chineze în pneumonia COVID-19: o revizuire sistematică și meta-analiză [J]. Am J Emerg Med , 2020, 38 ( 10 ):2153–2159. doi: 10.1016/j.ajem.2020.06.069 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]47. Ganji A, Farahani I, Khansarinejad B, et al.. Expresie crescută a markerului CD8 pe celulele T la pacienții cu COVID-19 [J]. Blood Cells Mol Dis , 2020, 83 :102437. doi: 10.1016/j.bcmd.2020.102437 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]48. Chen G, Wu D, Guo W, și colab.. Caracteristici clinice și imunologice ale bolii coronavirus severe și moderate 2019 [J]. J Clin Invest , 2020, 130 ( 5 ): 2620–2629. doi: 10.1172/JCI137244 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]49. Yan W, Chen D, Bigambo FM, et al.. Diferențele de celule sanguine, subseturi de limfocite și citokine la pacienții cu COVID-19 cu diferite stadii clinice: o meta-analiză de rețea [J]. BMC Infect Dis , 2021, 21 ( 1 ):156. doi: 10.1186/s12879-021-05847-9 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]50. Fara A, Mitrev Z, Rosalia RA, et al.. Furtuna de citokine și COVID-19: o cronică a citokinelor proinflamatorii [J]. Open Biol ,2020, 10 ( 9 ): 200160. doi: 10.1098/rsob.200160 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]51. Ragab D, Salah Eldin H, Taeimah M, et al.. The COVID-19 cytokine storm; ceea ce știm până acum [J]. Front Immunol , 2020, 11 :1446. doi: 10.3389/fimmu.2020.01446 [ articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r001

Scrisoarea deciziei 0

Ahmed Negida , editor academicInformații privind drepturile de autor și licență

15 februarie 2021

PONE-D-20-38124

Medicina chineză pe bază de plante la adulți cu boală coronavirus ușoară până la moderată 2019 (COVID-19): o revizuire sistematică și meta-analiză

PLUS UNU

Dragă Dr. Shi,

Vă mulțumim că ați trimis manuscrisul la PLOS ONE. După o analiză atentă, considerăm că are merite, dar nu îndeplinește pe deplin criteriile de publicare ale PLOS ONE așa cum sunt în prezent. Prin urmare, vă invităm să trimiteți o versiune revizuită a manuscrisului care abordează punctele ridicate în timpul procesului de revizuire.

Vă rugăm să trimiteți manuscrisul revizuit până la 28 martie 2021, ora 23:59. Dacă veți avea nevoie de mai mult timp pentru a finaliza revizuirile, vă rugăm să răspundeți la acest mesaj sau să contactați biroul jurnalului la gro.solp@enosolp . Când sunteți gata să trimiteți revizuirea, conectați-vă la https://www.editorialmanager.com/pone/ și selectați folderul „Submissions Needing Revision” pentru a găsi fișierul manuscris.

Vă rugăm să includeți următoarele elemente atunci când trimiteți manuscrisul revizuit:

  • O scrisoare de respingere care răspunde la fiecare punct ridicat de editorul academic și recenzent(i). Ar trebui să încărcați această scrisoare ca fișier separat etichetat „Răspuns pentru examinatori”.
  • O copie marcată a manuscrisului dvs. care evidențiază modificările aduse versiunii originale. Ar trebui să încărcați acest fișier ca fișier separat etichetat „Manuscris revizuit cu urmărirea modificărilor”.
  • O versiune nemarcată a lucrării dvs. revizuite, fără modificări urmărite. Ar trebui să încărcați acest fișier ca fișier separat etichetat „Manuscris”.

Dacă doriți să faceți modificări în dezvăluirea dvs. financiară, includeți declarația dvs. actualizată în scrisoarea de intenție. Îndrumările pentru retrimiterea fișierelor cu figuri sunt disponibile sub comentariile recenzenților de la sfârșitul acestei scrisori.

Dacă este cazul, vă recomandăm să depuneți protocoalele de laborator în protocols.io pentru a îmbunătăți reproductibilitatea rezultatelor. Protocols.io atribuie protocolului dvs. propriul său identificator (DOI), astfel încât să poată fi citat independent în viitor. Pentru instrucțiuni, consultați:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Așteptăm cu nerăbdare să primim manuscrisul dumneavoastră revizuit.

Salutări calde,

Ahmed Negida, MD

Editor academic

PLUS UNU

Cerințe pentru jurnal:

Când trimiteți revizuirea, trebuie să răspundeți acestor cerințe suplimentare.

1. Vă rugăm să vă asigurați că manuscrisul dvs. îndeplinește cerințele de stil ale PLOS ONE, inclusiv cele pentru denumirea fișierelor. Șabloanele de stil PLOS ONE pot fi găsite la

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf și

2. Vă rugăm să includeți tabelele ca parte a manuscrisului principal și să eliminați fișierele individuale. Vă rugăm să rețineți că tabelele suplimentare ar trebui să rămână încărcate ca fișiere separate de „informații justificative”.

3. Remarcăm că ați indicat că datele din acest studiu sunt disponibile la cerere. PLOS permite ca datele să fie disponibile la cerere numai dacă există restricții legale sau etice privind partajarea datelor în mod public. Pentru informații despre restricțiile inacceptabile de acces la date, consultați http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions .

În scrisoarea de intenție revizuită, vă rugăm să adresați următoarele solicitări:

a) Dacă există restricții etice sau legale privind partajarea unui set de date de-identificate, explicați-le în detaliu (de exemplu, datele conțin informații potențial de identificare sau sensibile ale pacientului) și cine le-a impus (de exemplu, un comitet de etică). Vă rugăm să furnizați, de asemenea, informații de contact pentru un comitet de acces la date, un comitet de etică sau alt organism instituțional căruia i se pot trimite cererile de date.

b) Dacă nu există restricții, vă rugăm să încărcați setul minim de date anonimizate necesar pentru a replica rezultatele studiului dvs. fie ca fișiere de informații justificative, fie într-un depozit public stabil și să ne furnizați adresele URL relevante, DOI-urile sau numerele de acces. Vă rugăm să consultați http://www.bmj.com/content/340/bmj.c181.long pentru ghiduri privind modul de de-identificare și pregătire a datelor clinice pentru publicare. Pentru o listă a depozitelor acceptabile, consultați http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories .

Vom actualiza declarația de disponibilitate a datelor în numele dvs. pentru a reflecta informațiile pe care le furnizați.

[Notă: marcajul HTML este mai jos. Vă rugăm să nu editați.]

Comentariile recenzenților:

Răspunsurile recenzentului la întrebări

Comentarii către autor

1. Este manuscrisul solid din punct de vedere tehnic și datele susțin concluziile?

Manuscrisul trebuie să descrie o cercetare științifică solidă din punct de vedere tehnic, cu date care susțin concluziile. Experimentele trebuie să fi fost efectuate riguros, cu controale adecvate, replicare și dimensiuni ale eșantionului. Concluziile trebuie trase în mod corespunzător pe baza datelor prezentate.

Revizor #1: Da

Revizor #2: Parțial

Revizor #3: Parțial

Revizor #4: Da

*********

2. Analiza statistică a fost efectuată corespunzător și riguros?

Revizor #1: Da

Revizor #2: Nu știu

Revizor #3: Da

Revizor #4: Da

*********

3. Au făcut autorii disponibile toate datele care stau la baza constatărilor din manuscrisul lor?

Politica de date PLOS cere autorilor să pună la dispoziție toate datele care stau la baza constatărilor descrise în manuscrisul lor, fără restricții, cu excepții rare (vă rugăm să consultați Declarația privind disponibilitatea datelor din fișierul PDF manuscris). Datele ar trebui furnizate ca parte a manuscrisului sau a informațiilor de sprijin ale acestuia sau depozitate într-un depozit public. De exemplu, pe lângă statisticile rezumative, ar trebui să fie disponibile punctele de date din spatele mediilor, mediilor și măsurilor de varianță. Dacă există restricții privind partajarea publică a datelor – de exemplu, confidențialitatea participantului sau utilizarea datelor de la o terță parte – acestea trebuie specificate.

Revizor #1: Da

Revizor #2: Nu

Revizor #3: Da

Revizor #4: Da

*********

4. Manuscrisul este prezentat într-un mod inteligibil și scris în limba engleză standard?

PLOS ONE nu editează manuscrisele acceptate, așa că limbajul din articolele trimise trebuie să fie clar, corect și lipsit de ambiguitate. Orice greșeală tipografică sau gramaticală trebuie corectată la revizuire, așa că vă rugăm să notați orice erori specifice aici.

Revizor #1: Da

Revizor #2: Nu

Revizor #3: Nu

Revizor #4: Da

*********

5. Revizuiți comentariile către autor

Vă rugăm să folosiți spațiul oferit pentru a explica răspunsurile la întrebările de mai sus. De asemenea, puteți include comentarii suplimentare pentru autor, inclusiv preocupări legate de publicarea duală, etica cercetării sau etica publicării. (Vă rugăm să încărcați recenzia ca atașament dacă depășește 20.000 de caractere)

Revizor #1: vă rugăm să găsiți recenzia principală și comentariile în fișierul PDF atașat, în plus, vă rugăm să acordați atenție următoarelor puncte:

-Pretenția principală a lucrării este clară și semnificativă, mai ales într-o astfel de situație fără precedent.

-Analiza datelor susține însă afirmația lucrării; ar fi mai bine să conectăm acest studiu cu mai multe date și literaturi publicate anterioare într-un mod care să reducă dublarea și să susțină concluziile acestei lucrări.

-este nevoie de un protocol mai detaliat al analizei statistice în special, majoritatea datelor utilizate în analiză au fost preluate din lucrări în limba chineză.

-Tipul de probe din grupurile de tratament și de control nu exclude posibilitatea efectului de sinergie/combinație între CHM și medicina occidentală. ați avut studii care au folosit CHM doar pe grupuri separate ca tratament? A existat vreun grup de control care nu a primit niciun tratament? Există informații despre spitalizare sau primirea altor îngrijiri speciale (de ex. ventilator) pe lângă tratament?

adică: nu putem concluziona cu siguranță CHM ca un tratament separat, eficient și sigur pentru COVID-19 ușor până la moderat.

Revizor #2: au fost furnizate date valoroase în acest manuscris, care nu sunt ușor de evaluat pentru cititorii internaționali din afara Chinei. Prin urmare, trebuie să subliniez că acest manuscris prezintă date prețioase și valoroase care vor aduce beneficii literaturii și vor îmbunătăți înțelegerea rolului TCM în COVID-19. Cu toate acestea, în general, constat că există o lipsă de claritate în definirea multor lucruri, inclusiv a măsurilor de rezultat și a grupurilor de tratament. Important este că discuția a fost superficială. Trebuie să existe o corelație între ROB, calitatea studiului, eterogenitate și interpretarea rezultatelor. Vă rugăm să găsiți sugestia mea mai jos și așa cum se specifică în atașament:

1. Sugerați cu tărie pentru limbajul profesional / corectarea științifică pentru corectarea gramaticii, structurarea propozițiilor și selectarea cuvintelor care sunt preferate pentru a reprezenta o scriere științifică precisă pentru întregul manuscris. Vă rugăm să verificați utilizarea virgulei Oxford și utilizarea adecvată/excesivă a cuvintelor conjunctive pe tot parcursul. Autorilor în special le place să înceapă propoziții cu cuvântul „Și”. Spațierea dintre cuvinte și simboluri trebuie verificată și făcută consecventă.

2. Criteriile de eligibilitate pot fi rescrise în mod clar ca criterii de includere și excludere; sau rearanjați cu o diferențiere mai clară a subtemelor. Diferitele niveluri ale subtemelor din metode trebuie să fie clare. De exemplu (aici folosesc numere pentru a explica un exemplu despre cum trebuie clarificate diferitele niveluri. Este la discreția autorilor să prezinte acest lucru fără numere)

2.0 Metode

2.1 Criterii de eligibilitate

2.1.1 Tipul de studii

2.1.2 Caracteristicile participantului

2.2 Căutarea literaturii

2.2.1 Strategia de căutare

2.2.2 Selectarea studiului și extragerea datelor

2.3 Analiza datelor

2.3.1 Evaluarea metodologică a calității

2.3.2 Meta-analize

3. Specific metodelor

A. Vă rugăm să verificați cu lista de verificare PRISMA – Prezentați o strategie completă de căutare electronică pentru cel puțin o bază de date (vă rugăm să prezentați combinația de cuvinte cheie utilizate); Descrieți metoda de extragere a datelor din rapoarte (de exemplu, formulare pilotate, independent, în dublu exemplar) și orice procese de obținere și confirmare a datelor de la anchetatori (vă rugăm să menționați dacă s-au încercat să căutați date suplimentare)

b. Clarificați criteriile de includere – numai pe bază de plante medicinale chinezești orale

c. Măsurile de rezultat trebuie să fie bine definite, de exemplu care este rata de vindecare clinică, care este rata efectivă a CT pulmonar

4. Rezultate

A. aranjați nivelul subtiturilor în mod corespunzător, așa cum este sugerat pentru metode

b. definiția CHM și CWM trebuie să fie clară – denumirea grupurilor. Deși se menționează că grupul CHM a primit atât medicamente pe bază de plante, cât și medicamente occidentale în metode, CHM este încă abreviat ca medicament pe bază de plante chinezești. Rezultatele sunt scrise în mare parte ca „rezultatele sunt mai bune cu tratamentul cu CHM”, ceea ce poate fi confuz de interpretat și ușor de înțeles greșit, ca și cum numai CHM (fără medicina occidentală) ar fi benefic. Sugerați să descrieți clar ce înseamnă fiecare grup cu abrevieri distincte pentru grupuri. Poate că este și din cauza alegerii cuvântului „prin” care, atunci când este citit, este interpretat în acest fel, deci luați în considerare rescrierea secțiunii de rezultate cu o selecție mai precisă a cuvintelor.

5. Discuție

Deși este un subiect interesant cu date foarte valoroase (nu pot sublinia suficient acest lucru, sunt date foarte valoroase), discuția este superficială și lipsită de profunzime. câteva sugestii de subiecte de discutat includ

– eterogenitatea studiilor și impactul asupra constatărilor.

– impactul diferitelor formulări utilizate și cum au ajuns autorii să le interpreteze în mod colectiv în aceleași meta-analize (de asemenea, considerăm că diferite plante ar fi acționat diferit și, cu siguranță, ar trebui discutată interacțiunea plantă-plantă)

– riscul de părtinire și modul în care aceasta afectează interpretarea rezultatelor

– discutați despre evenimentele adverse, părtinirea raportării?

– calitatea intervenției pe bază de plante utilizate

– sugerează să se ia în considerare lista de verificare a consortului pentru tcm pentru a evalua calitatea raportării, ceea ce poate consolida și mai mult discuția

– cum se aplică aceste noi informații scenariului global și care sunt provocările aplicării TCM în acest scenariu

– diferența dintre abordarea MTC (care se bazează pe evaluare individualizată și poate fi chiar afectată de factori precum dieta, tipul de corp, mediul înconjurător, locația geografică, vremea) și abordarea medicinei occidentale

– este de asemenea important de subliniat că conceptul de selectare a tratamentului bazat pe filozofia MTC este foarte diferit. Experiența mea personală, consultând experți în MTC din China, pe care îl citez, tratamentul în China (Wuhan experimentând iarna în acea perioadă) poate să nu se potrivească țărilor cu climă și vreme diferită (de exemplu, o țară din Asia de Sud-Est cu climă caldă și umedă, cu diferite practici de dietă)

– de asemenea, considerăm că plantele medicinale, în formă brută, extrase sau în mediu de extracție diferit în contextul fitochimiei ar produce diferiți fitocompuși, iar unul dintre principalele decalaje aici este lipsa de consistență/documentare/cuantificare/interpretare a mecanismelor și bioactive. compus implicat

– provocări de reglementare

– contribuția factorilor de confuzie precum comorbiditățile, diferențele în medicina occidentală utilizată

6. Concluzie

Concluzia răspunde parțial obiectivului. Cu toate acestea, evaluarea critică (așa cum este menționat în secțiunea de discuții) ar ajuta la interpretarea mai bună a rezultatelor și le-ar face mai relevante pentru scenariul global. Limitările nu sunt doar în realizarea de studii de înaltă calitate (la care calitatea studiilor nu a fost de fapt evaluată și discutată în secțiunea de discuții), ci și aplicarea în lume și luarea în considerare a decalajului de cunoștințe.

7. Este într-adevăr identic tratamentul de braț al medicinei occidentale? Nu există date disponibile despre ceea ce este administrat ca medicină occidentală și este dificil de decis dacă sunt identice, similare sau dacă de fapt pot fi un factor de confuzie.

8. Ar fi bine să descriem cel puțin care sunt compozițiile diferite ale formulărilor comune de TCM utilizate.

Dar, în general, sunt foarte apreciat că aceste date vor fi puse la dispoziție și aștept cu nerăbdare versiunea modificată. Din nou, nu pot sublinia suficient cât de valoroase sunt aceste date.

Reviewer #3: Comentariile recenzentului

Medicina chineză pe bază de plante la adulți cu boală de coronavirus ușoară până la moderată 2019 (COVID-19): O revizuire sistematică și meta-analiză cu MS ID PONE-D-20-38124.

Comentarii majore

1. Studiile meta-analitice au fost efectuate în principal pe baza ref 10-20 și toate sunt publicate în reviste chineze, cu excepția doar ref 14, care indică părtinirea alegerii conținutului utilizat pentru realizarea studiului. Autorilor li se recomandă să trimită conținutul din alte surse, de asemenea, pentru a valida în continuare constatările.

2. Datele despre COVID-19 furnizate în secțiunea de introducere sunt în contradicție cu datele OMS. Se recomandă autorilor să verifice încrucișarea numărului de COVID-19 furnizat pe site-ul OMS.

3. Concluzia studiului nu este în conformitate cu rezultatele, prin urmare, trebuie modificată în consecință.

4. Manuscrisul trebuie în mod obligatoriu să fie tratat de experți lingvistici, deoarece există mai multe ambiguități în forma sa actuală.

Comentarii minore

1. Abrevierile lipsesc în manuscris.

2. Verificați formatul referințelor pentru a menține omogenitatea.

Reviewer #4: Aceasta este o recenzie foarte importantă de publicat în acest moment. Aceste constatări sunt foarte relevante și contribuie la cunoștințele esențiale despre o boală paralizantă la nivel global. Revizuirea a fost efectuată cu standarde riguroase și, prin urmare, rezultatele pot contribui semnificativ la prevenirea și tratamentul COVID-19. Vă mulțumim pentru munca dvs.

Comentariile complete ale recenziilor au fost încărcate ca atașament.

*********

6. Autorii PLOS au opțiunea de a publica istoricul evaluării de către colegi a articolului lor ( ce înseamnă asta? ). Dacă este publicat, acesta va include evaluarea dvs. completă și orice fișiere atașate.

Dacă alegeți „nu”, identitatea dvs. va rămâne anonimă, dar recenzia dvs. poate fi în continuare făcută publică.

Doriți ca identitatea dvs. să fie publică pentru această evaluare inter pares? Pentru informații despre această alegere, inclusiv retragerea consimțământului, vă rugăm să consultați Politica noastră de confidențialitate .

Revizor #1:  Da:  Muhammad G. Khodary Omar

Revizor #2:  Da:  Xin Yi, Lim

Revizor #3:  Da:  Dr. Vedpriya Arya

Reviewer #4:  Da:  Daniela RA Rambaldini

[NOTĂ: Dacă comentariile recenzenților au fost trimise ca fișier atașat, acestea vor fi atașate la acest e-mail și vor fi accesibile prin site-ul de trimitere. Vă rugăm să vă conectați la contul dvs., să găsiți înregistrarea manuscrisului și să verificați linkul de acțiune „Vizualizare atașamente”. Dacă acest link nu apare, nu există fișiere atașate.]

În timp ce revizuiți trimiterea, vă rugăm să încărcați fișierele cu cifre în instrumentul de diagnosticare digitală PACE (Preflight Analysis and Conversion Engine),  https://pacev2.apexcovantage.com/ . PACE ajută la asigurarea faptului că cifrele îndeplinesc cerințele PLOS. Pentru a utiliza PACE, trebuie mai întâi să vă înregistrați ca utilizator. Înregistrarea este gratuită. Apoi, autentificați-vă și navigați la fila ÎNCĂRCARE, unde veți găsi instrucțiuni detaliate despre cum să utilizați instrumentul. Dacă întâmpinați probleme sau aveți întrebări când utilizați PACE, vă rugăm să trimiteți un e-mail la PLOS la  gro.solp@serugif . Vă rugăm să rețineți că fișierele cu informații de suport nu au nevoie de acest pas.

Atașament

Nume fișier trimis: PONE-D-20-38124_reviewer(COVID-19 popular chinese medicine) reviewed.pdfFaceți clic aici pentru un fișier de date suplimentar. (3,9 M, pdf)

Atașament

Nume fișier trimis: PONE-D-20-38124_reviewer.pdfFaceți clic aici pentru un fișier de date suplimentar. (4,7 M, pdf)

Atașament

Nume fișier trimis: Comentarii ale recenzenților (1).docxFaceți clic aici pentru un fișier de date suplimentar. (13K, docx)

Atașament

Nume fișier trimis: PONE-D-20-38124_ Comentarii ale recenzenților – Copy.pdfFaceți clic aici pentru un fișier de date suplimentar. (2,1 M, pdf)

Atașament

Nume fișier trimis: PONE-D-20-38124_reviewer REVIEWED.pdfFaceți clic aici pentru un fișier de date suplimentar. (7,4 M, pdf)

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r002

Răspunsul autorului la scrisoarea de decizie 0

Informații privind drepturile de autor și licență

5 aprilie 2021

Revizor #1: vă rugăm să găsiți recenzia principală și comentariile în fișierul PDF atașat, în plus, vă rugăm să acordați atenție următoarelor puncte:

-Pretenția principală a lucrării este clară și semnificativă, mai ales într-o astfel de situație fără precedent.

-Analiza datelor susține însă afirmația lucrării; ar fi mai bine să conectăm acest studiu cu mai multe date și literaturi publicate anterioare într-un mod care să reducă dublarea și să susțină concluziile acestei lucrări.

Răspuns: în secțiunea de discuții, această revizuire a legat acest studiu cu mai multe date și literatură publicate anterior pentru analiză.

-este nevoie de un protocol mai detaliat al analizei statistice în special, majoritatea datelor utilizate în analiză au fost preluate din lucrări în limba chineză.

Răspuns: în revizuirea noastră, a fost elaborat un protocol detaliat al analizei statistice. În China continentală s-au desfășurat studii privind medicina chineză pe bază de plante pentru COVID-19 ușor până la moderat. Majoritatea studiilor au fost publicate online în limba chineză. Prin urmare, majoritatea datelor utilizate în analiză au fost preluate din lucrări în limba chineză.

-Tipul de probe din grupurile de tratament și de control nu exclude posibilitatea efectului de sinergie/combinație între CHM și medicina occidentală. ați avut studii care au folosit CHM doar pe grupuri separate ca tratament? A existat vreun grup de control care nu a primit niciun tratament? Există informații despre spitalizare sau primirea altor îngrijiri speciale (de ex. ventilator) pe lângă tratament?

Răspuns: studiile de medicină chineză pe bază de plante în tratamentul COVID-19 uşoară până la moderată au fost incluse în această revizuire. Grupul de tratament a fost tratat cu plante medicinale chinezești combinate cu terapia convențională. Nu există studii care au utilizat CHM doar pe grupuri separate ca tratament. Nu a existat niciun grup de control care să nu fi primit niciun tratament. Deoarece participanții au fost diagnosticați ca COVID-19 ușor până la moderat, pacienții nu au primit tratament cu ventilator. Informațiile specifice despre tratament sunt enumerate în Tabelul 1.

adică: nu putem concluziona cu siguranță CHM ca un tratament separat, eficient și sigur pentru COVID-19 ușor până la moderat.

Răspuns: concluzia acestei analize este că medicina pe bază de plante chineză combinată cu terapia convențională ar putea fi eficientă și sigură în tratamentul adulților cu COVID-19 ușor până la moderat.

Revizor #2: au fost furnizate date valoroase în acest manuscris, care nu sunt ușor de evaluat pentru cititorii internaționali din afara Chinei. Prin urmare, trebuie să subliniez că acest manuscris prezintă date prețioase și valoroase care vor aduce beneficii literaturii și vor îmbunătăți înțelegerea rolului TCM în COVID-19. Cu toate acestea, în general, constat că există o lipsă de claritate în definirea multor lucruri, inclusiv a măsurilor de rezultat și a grupurilor de tratament. Important este că discuția a fost superficială. Trebuie să existe o corelație între ROB, calitatea studiului, eterogenitate și interpretarea rezultatelor. Vă rugăm să găsiți sugestia mea mai jos și așa cum se specifică în atașament:

1. Sugerați cu tărie pentru limbajul profesional / corectarea științifică pentru corectarea gramaticii, structurarea propozițiilor și selectarea cuvintelor care sunt preferate pentru a reprezenta o scriere științifică precisă pentru întregul manuscris. Vă rugăm să verificați utilizarea virgulei Oxford și utilizarea adecvată/excesivă a cuvintelor conjunctive pe tot parcursul. Autorilor în special le place să înceapă propoziții cu cuvântul „Și”. Spațierea dintre cuvinte și simboluri trebuie verificată și făcută consecventă.

Răspuns: gramatica, structura propoziției, virgula și cuvintele conjunctive au fost corectate.

2. Criteriile de eligibilitate pot fi rescrise în mod clar ca criterii de includere și excludere; sau rearanjați cu o diferențiere mai clară a subtemelor. Diferitele niveluri ale subtemelor din metode trebuie să fie clare. De exemplu (aici folosesc numere pentru a explica un exemplu despre cum trebuie clarificate diferitele niveluri. Este la discreția autorilor să prezinte acest lucru fără numere)

Răspuns: criteriile de eligibilitate au fost rescrise ca criterii de includere și excludere.

3. Specific metodelor

A. Vă rugăm să verificați cu lista de verificare PRISMA – Prezentați o strategie completă de căutare electronică pentru cel puțin o bază de date (vă rugăm să prezentați combinația de cuvinte cheie utilizate); Descrieți metoda de extragere a datelor din rapoarte (de exemplu, formulare pilotate, independent, în dublu exemplar) și orice procese de obținere și confirmare a datelor de la anchetatori (vă rugăm să menționați dacă s-au încercat să căutați date suplimentare)

Răspuns: este listată strategia de căutare PubMed. Metoda de extragere a datelor din rapoarte și orice procese de obținere și confirmare a datelor de la anchetatori au fost descrise în această analiză.

b. Clarificați criteriile de includere – numai pe bază de plante medicinale chinezești orale

Răspuns: criteriile de includere au fost clarificate – numai pe bază de plante medicinale chinezești orale.

c. Măsurile de rezultat trebuie să fie bine definite, de exemplu care este rata de vindecare clinică, care este rata efectivă a CT pulmonar

Răspuns: Măsurile de rezultat (de exemplu rata de vindecare clinică, CT pulmonar) au fost bine definite.

4. Rezultate

A. aranjați nivelul subtiturilor în mod corespunzător, așa cum este sugerat pentru metode

Răspuns: nivelul subtitlurilor a fost aranjat în mod corespunzător, așa cum sa sugerat pentru metode.

b. definiția CHM și CWM trebuie să fie clară – denumirea grupurilor. Deși se menționează că grupul CHM a primit atât medicamente pe bază de plante, cât și medicamente occidentale în metode, CHM este încă abreviat ca medicament pe bază de plante chinezești. Rezultatele sunt scrise în mare parte ca „rezultatele sunt mai bune cu tratamentul cu CHM”, ceea ce poate fi confuz de interpretat și ușor de înțeles greșit, ca și cum numai CHM (fără medicina occidentală) ar fi benefic. Sugerați să descrieți clar ce înseamnă fiecare grup cu abrevieri distincte pentru grupuri. Poate că este și din cauza alegerii cuvântului „prin” care, atunci când este citit, este interpretat în acest fel, deci luați în considerare rescrierea secțiunii de rezultate cu o selecție mai precisă a cuvintelor.

Răspuns: denumirea grupurilor a fost rescrisă.

5. Discuție

Deși este un subiect interesant cu date foarte valoroase (nu pot sublinia suficient acest lucru, sunt date foarte valoroase), discuția este superficială și lipsită de profunzime. câteva sugestii de subiecte de discutat includ

– eterogenitatea studiilor și impactul asupra constatărilor.

– impactul diferitelor formulări utilizate și cum au ajuns autorii să le interpreteze în mod colectiv în aceleași meta-analize (de asemenea, considerăm că diferite plante ar fi acționat diferit și, cu siguranță, ar trebui discutată interacțiunea plantă-plantă)

– riscul de părtinire și modul în care aceasta afectează interpretarea rezultatelor

– discutați despre evenimentele adverse, părtinirea raportării?

– calitatea intervenției pe bază de plante utilizate

– sugerează să se ia în considerare lista de verificare a consortului pentru tcm pentru a evalua calitatea raportării, ceea ce poate consolida și mai mult discuția

– cum se aplică aceste noi informații scenariului global și care sunt provocările aplicării TCM în acest scenariu

– diferența dintre abordarea MTC (care se bazează pe evaluare individualizată și poate fi chiar afectată de factori precum dieta, tipul de corp, mediul înconjurător, locația geografică, vremea) și abordarea medicinei occidentale

– este de asemenea important de subliniat că conceptul de selectare a tratamentului bazat pe filozofia MTC este foarte diferit. Experiența mea personală, consultând experți în MTC din China, pe care îl citez, tratamentul în China (Wuhan experimentând iarna în acea perioadă) poate să nu se potrivească țărilor cu climă și vreme diferită (de exemplu, o țară din Asia de Sud-Est cu climă caldă și umedă, cu diferite practici de dietă)

– de asemenea, considerăm că plantele medicinale, în formă brută, extrase sau în mediu de extracție diferit în contextul fitochimiei ar produce diferiți fitocompuși, iar unul dintre principalele decalaje aici este lipsa de consistență/documentare/cuantificare/interpretare a mecanismelor și bioactive. compus implicat

– provocări de reglementare

– contribuția factorilor de confuzie precum comorbiditățile, diferențele în medicina occidentală utilizată

Răspuns: în recenzia noastră, sugestiile privind subiectele de mai sus au fost încorporate în discuție.

6. Concluzie

Concluzia răspunde parțial obiectivului. Cu toate acestea, evaluarea critică (așa cum este menționat în secțiunea de discuții) ar ajuta la interpretarea mai bună a rezultatelor și le-ar face mai relevante pentru scenariul global. Limitările nu sunt doar în realizarea de studii de înaltă calitate (la care calitatea studiilor nu a fost de fapt evaluată și discutată în secțiunea de discuții), ci și aplicarea în lume și luarea în considerare a decalajului de cunoștințe.

Răspuns: a fost făcută o evaluare critică.

7. Este într-adevăr identic tratamentul de braț al medicinei occidentale? Nu există date disponibile despre ceea ce este administrat ca medicină occidentală și este dificil de decis dacă sunt identice, similare sau dacă de fapt pot fi un factor de confuzie.

Răspuns: tratamentul de braț al medicinei occidentale nu este într-adevăr identic în diferite studii. Informațiile specifice despre tratament sunt enumerate în Tabelul 1.

8. Ar fi bine să descriem cel puțin care sunt compozițiile diferite ale formulărilor comune de TCM utilizate.

Răspuns: diferitele componente ale TCM au fost descrise în această revizuire.

Dar, în general, sunt foarte apreciat că aceste date vor fi puse la dispoziție și aștept cu nerăbdare versiunea modificată. Din nou, nu pot sublinia suficient cât de valoroase sunt aceste date.

Reviewer #3: Comentariile recenzentului

Medicina chineză pe bază de plante la adulți cu boală de coronavirus ușoară până la moderată 2019 (COVID-19): O revizuire sistematică și meta-analiză cu MS ID PONE-D-20-38124.

Comentarii majore

1. Studiile meta-analitice au fost efectuate în principal pe baza ref 10-20 și toate sunt publicate în reviste chineze, cu excepția doar ref 14, care indică părtinirea alegerii conținutului utilizat pentru realizarea studiului. Autorilor li se recomandă să trimită conținutul din alte surse, de asemenea, pentru a valida în continuare constatările.

Răspuns: studiile de medicină chineză pe bază de plante în tratamentul COVID-19 uşoară până la moderată au fost căutate cuprinzător în opt baze de date electronice. Datele potențial eligibile au fost obținute prin căutarea manuală în lista de referințe a recenziilor publicate anterior. Dacă este posibil, rezumatele conferinței au fost revizuite pentru a găsi studii nepublicate, iar datele au fost obținute prin contactarea autorului.

2. Datele despre COVID-19 furnizate în secțiunea de introducere sunt în contradicție cu datele OMS. Se recomandă autorilor să verifice încrucișarea numărului de COVID-19 furnizat pe site-ul OMS.

Răspuns: Datele COVID-19 au fost verificate încrucișat conform site-ului web al OMS.

3. Concluzia studiului nu este în conformitate cu rezultatele, prin urmare, trebuie modificată în consecință.

Răspuns: concluzia studiului nostru a fost modificată în conformitate cu rezultatele.

4. Manuscrisul trebuie în mod obligatoriu să fie tratat de experți lingvistici, deoarece există mai multe ambiguități în forma sa actuală.

Răspuns: manuscrisul nostru a fost manipulat de experți lingvistici.

Comentarii minore

1. Abrevierile lipsesc în manuscris.

Răspuns: abrevierile nume complete au fost enumerate în manuscris.

2. Verificați formatul referințelor pentru a menține omogenitatea.

Răspuns: formatul referințelor a fost verificat încrucișat.

Reviewer #4: Aceasta este o recenzie foarte importantă de publicat în acest moment. Aceste constatări sunt foarte relevante și contribuie la cunoștințele esențiale despre o boală paralizantă la nivel global. Revizuirea a fost efectuată cu standarde riguroase și, prin urmare, rezultatele pot contribui semnificativ la prevenirea și tratamentul COVID-19. Vă mulțumim pentru munca dvs.

Atașament

Nume fișier trimis: Răspuns la Reviewers.pdfFaceți clic aici pentru un fișier de date suplimentar. (93K, pdf)

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r003

Scrisoarea deciziei 1

Ahmed Negida , editor academicInformații privind drepturile de autor și licență

24 mai 2021

PONE-D-20-38124R1

Medicamentul chinezesc din plante la adulți cu COVID-19 ușor până la moderat: o revizuire sistematică și meta-analiză

PLUS UNU

Dragă Dr. Shi,

Vă mulțumim că ați trimis manuscrisul la PLOS ONE. După o analiză atentă, considerăm că are merite, dar nu îndeplinește pe deplin criteriile de publicare ale PLOS ONE așa cum sunt în prezent. Prin urmare, vă invităm să trimiteți o versiune revizuită a manuscrisului care abordează punctele ridicate în timpul procesului de revizuire.

Vă rugăm să trimiteți manuscrisul revizuit până la 08 iulie 2021, ora 23:59. Dacă veți avea nevoie de mai mult timp pentru a finaliza revizuirile, vă rugăm să răspundeți la acest mesaj sau să contactați biroul jurnalului la gro.solp@enosolp . Când sunteți gata să trimiteți revizuirea, conectați-vă la https://www.editorialmanager.com/pone/ și selectați folderul „Submissions Needing Revision” pentru a găsi fișierul manuscris.

Vă rugăm să includeți următoarele elemente atunci când trimiteți manuscrisul revizuit:

  • O scrisoare de respingere care răspunde la fiecare punct ridicat de editorul academic și recenzent(i). Ar trebui să încărcați această scrisoare ca fișier separat etichetat „Răspuns pentru examinatori”.
  • O copie marcată a manuscrisului dvs. care evidențiază modificările aduse versiunii originale. Ar trebui să încărcați acest fișier ca fișier separat etichetat „Manuscris revizuit cu urmărirea modificărilor”.
  • O versiune nemarcată a lucrării dvs. revizuite, fără modificări urmărite. Ar trebui să încărcați acest fișier ca fișier separat etichetat „Manuscris”.

Dacă doriți să faceți modificări în dezvăluirea dvs. financiară, includeți declarația dvs. actualizată în scrisoarea de intenție. Îndrumările pentru retrimiterea fișierelor cu figuri sunt disponibile sub comentariile recenzenților de la sfârșitul acestei scrisori.

Dacă este cazul, vă recomandăm să depuneți protocoalele de laborator în protocols.io pentru a îmbunătăți reproductibilitatea rezultatelor. Protocols.io atribuie protocolului dvs. propriul său identificator (DOI), astfel încât să poată fi citat independent în viitor. Pentru instrucțiuni, consultați:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . În plus, PLOS ONE oferă o opțiune pentru publicarea articolelor Lab Protocol revizuite de colegi, care descriu protocoalele găzduite pe protocols.io. Citiți mai multe informații despre partajarea protocoalelor la  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

Așteptăm cu nerăbdare să primim manuscrisul dumneavoastră revizuit.

Salutări calde,

Ahmed Negida, MD

Editor academic

PLUS UNU

Cerințe pentru jurnal:

Vă rugăm să examinați lista de referințe pentru a vă asigura că este completă și corectă. Dacă ați citat lucrări care au fost retractate, vă rugăm să includeți motivul pentru care ați făcut acest lucru în textul manuscrisului sau eliminați aceste referințe și înlocuiți-le cu referințe actuale relevante. Orice modificare a listei de referințe trebuie menționată în scrisoarea de respingere care însoțește manuscrisul revizuit. Dacă trebuie să citați un articol retras, indicați starea articolului retras în lista de referințe și includeți, de asemenea, o citare și o referință completă pentru notificarea de retragere.

[Notă: marcajul HTML este mai jos. Vă rugăm să nu editați.]

Comentariile recenzenților:

Răspunsurile recenzentului la întrebări

Comentarii către autor

1. Dacă autorii au abordat în mod adecvat comentariile dvs. ridicate într-o rundă anterioară de revizuire și considerați că acest manuscris este acum acceptabil pentru publicare, puteți indica că aici, pentru a ocoli secțiunea „Comentarii către autor”, introduceți conflictul de interese. declarație în secțiunea „Confidențial pentru editor” și trimiteți recomandarea dvs. „Accept”.

Reviewer #2: (Fără răspuns)

Revizor #4: Toate comentariile au fost abordate

*********

2. Este manuscrisul solid din punct de vedere tehnic și datele susțin concluziile?

Manuscrisul trebuie să descrie o cercetare științifică solidă din punct de vedere tehnic, cu date care susțin concluziile. Experimentele trebuie să fi fost efectuate riguros, cu controale adecvate, replicare și dimensiuni ale eșantionului. Concluziile trebuie trase în mod corespunzător pe baza datelor prezentate.

Revizor #2: Da

Revizor #4: Da

*********

3. Analiza statistică a fost efectuată corespunzător și riguros?

Revizor #2: Da

Revizor #4: Da

*********

4. Au făcut autorii disponibile toate datele care stau la baza constatărilor din manuscrisul lor?

Politica de date PLOS cere autorilor să pună la dispoziție toate datele care stau la baza constatărilor descrise în manuscrisul lor, fără restricții, cu excepții rare (vă rugăm să consultați Declarația privind disponibilitatea datelor din fișierul PDF manuscris). Datele ar trebui furnizate ca parte a manuscrisului sau a informațiilor de sprijin ale acestuia sau depozitate într-un depozit public. De exemplu, pe lângă statisticile rezumative, ar trebui să fie disponibile punctele de date din spatele mediilor, mediilor și măsurilor de varianță. Dacă există restricții privind partajarea publică a datelor – de exemplu, confidențialitatea participantului sau utilizarea datelor de la o terță parte – acestea trebuie specificate.

Revizor #2: Da

Revizor #4: Da

*********

5. Manuscrisul este prezentat într-un mod inteligibil și scris în limba engleză standard?

PLOS ONE nu editează manuscrisele acceptate, așa că limbajul din articolele trimise trebuie să fie clar, corect și lipsit de ambiguitate. Orice greșeală tipografică sau gramaticală trebuie corectată la revizuire, așa că vă rugăm să notați orice erori specifice aici.

Revizor #2: Nu

Revizor #4: Da

*********

6. Revizuiți comentariile către autor

Vă rugăm să folosiți spațiul oferit pentru a explica răspunsurile la întrebările de mai sus. De asemenea, puteți include comentarii suplimentare pentru autor, inclusiv preocupări legate de publicarea duală, etica cercetării sau etica publicării. (Vă rugăm să încărcați recenzia ca atașament dacă depășește 20.000 de caractere)

Revizorul #2: Vă mulțumim pentru revizuirea manuscrisului dvs. foarte valoros. A fost cu adevărat interesant și onoarea mea să am citit date atât de valoroase. Este cu adevărat prețios. Cu toate acestea, revizuiri majore, în special în interpretarea datelor, analiza critică și redactarea discuțiilor, precum și definirea rezultatelor, trebuie încă modificate.

1) Introducere – necesitatea de a justifica mai bine necesitatea acestei revizuiri sistematice (adică lipsa de cercetare care duce la obiectiv). Este prea scurt. De fapt, introducerea în rezumat a justificat mai bine scopul revizuirii decât introducerea în manuscris. Sugerați să modificați. De asemenea, foarte important, există o exagerare a constatărilor când se citează două studii privind beneficiile CHM în introducere, vă rugăm să revizuiți din nou așa cum este comentat în manuscris).

2) Metode și rezultate: Vă rugăm să definiți în profunzime rezultatele: CT pulmonar – care este definiția CT pulmonar îmbunătățit/bun etc, vă rugăm să detaliați. și cum se leagă asta cu evaluarea rezultatului. Același lucru se aplică definiției ratei de vindecare clinică și testării acidului nucleic viral. De asemenea, trebuie clarificată definiția termenului eficient, îmbunătățit, ineficient

3) Rezultate – tabelul 2 este trunchiat și nu am putut vizualiza întregul tabel. Rezoluția parcelelor forestiere a fost scăzută și multe nu sunt lizibile. Vă sugerez să redenumiți axa pentru a favoriza terapia singură și pentru a favoriza CHM + terapia convențională în loc de a favoriza controlul/favorizarea experimentală pentru a face mai ușor de citit la prima vedere.

4) Beneficiile asupra markerilor inflamatori – acest lucru este foarte important de clarificat. Nivelurile superioare sunt mai bune sau nivelurile inferioare sunt mai bune? Acest lucru va depinde de evoluția bolii. De exemplu, în stadiile inițiale, probabil că avem nevoie de niveluri mai ridicate de imunitate pentru a produce efecte antivirale. Cu toate acestea, dacă inflamația este evidentă și prelungită în etapele ulterioare, acest lucru poate împinge pacientul într-o furtună de citokine și, prin urmare, dăunătoare, adică momentul este important. Această componentă nu este discutată și ar trebui discutată, având în vedere că markerii inflamatori sunt unul dintre rezultatele evaluate și durata administrării variază.

5) Aș aprecia mai multe discuții despre terapia convențională CHM+, având în vedere că acest lucru joacă un rol major și în descoperirile dvs.

6) Engleza s-a îmbunătățit, dar trebuie să fie îmbunătățită în continuare. În special în selectarea cuvintelor corecte și adecvate din punct de vedere politic și a unui întreg paragraf subliniat în discuție. De asemenea, sunt recomandate modificări minore de formatare ale tabelelor.

7) Declarațiile privind disponibilitatea datelor ar trebui clarificate – aceasta contrazice cu ceea ce este deja furnizat.

Revizorul #4: Autorii par să fi abordat toate recomandările și punctele, inclusiv clarificarea metodelor, îmbunătățiri ale analizei statistice și testelor utilizate, actualizări ale rezultatelor, revizuiri ale discuției și modificări generale ale gramaticii și structurii propoziției. Adăugarea tabelelor 1 și 2 este foarte utilă.

*********

7. Autorii PLOS au opțiunea de a publica istoricul evaluării de către colegi a articolului lor ( ce înseamnă asta? ). Dacă este publicat, acesta va include evaluarea dvs. completă și orice fișiere atașate.

Dacă alegeți „nu”, identitatea dvs. va rămâne anonimă, dar recenzia dvs. poate fi în continuare făcută publică.

Doriți ca identitatea dvs. să fie publică pentru această evaluare inter pares? Pentru informații despre această alegere, inclusiv retragerea consimțământului, vă rugăm să consultați Politica noastră de confidențialitate .

Revizor #2: Nu

Reviewer #4:  Da:  Daniela RA Rambaldini

[NOTĂ: Dacă comentariile recenzenților au fost trimise ca fișier atașat, acestea vor fi atașate la acest e-mail și vor fi accesibile prin site-ul de trimitere. Vă rugăm să vă conectați la contul dvs., să găsiți înregistrarea manuscrisului și să verificați linkul de acțiune „Vizualizare atașamente”. Dacă acest link nu apare, nu există fișiere atașate.]

În timp ce revizuiți trimiterea, vă rugăm să încărcați fișierele cu cifre în instrumentul de diagnosticare digitală PACE (Preflight Analysis and Conversion Engine),  https://pacev2.apexcovantage.com/ . PACE ajută la asigurarea faptului că cifrele îndeplinesc cerințele PLOS. Pentru a utiliza PACE, trebuie mai întâi să vă înregistrați ca utilizator. Înregistrarea este gratuită. Apoi, autentificați-vă și navigați la fila ÎNCĂRCARE, unde veți găsi instrucțiuni detaliate despre cum să utilizați instrumentul. Dacă întâmpinați probleme sau aveți întrebări când utilizați PACE, vă rugăm să trimiteți un e-mail la PLOS la  gro.solp@serugif . Vă rugăm să rețineți că fișierele cu informații de suport nu au nevoie de acest pas.

Atașament

Nume fișier trimis: PONE-D-20-38124_R1_reviewer – Copy – Copy.pdfFaceți clic aici pentru un fișier de date suplimentar. (3,2 M, pdf)

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r004

Răspunsul autorului la scrisoarea de decizie 1

Informații privind drepturile de autor și licență

8 iulie 2021

Revizorul #2: Vă mulțumim pentru revizuirea manuscrisului dvs. foarte valoros. A fost cu adevărat interesant și onoarea mea să am citit date atât de valoroase. Este cu adevărat prețios. Cu toate acestea, revizuiri majore, în special în interpretarea datelor, analiza critică și redactarea discuțiilor, precum și definirea rezultatelor, trebuie încă modificate.

1) Introducere – necesitatea de a justifica mai bine necesitatea acestei revizuiri sistematice (adică lipsa de cercetare care duce la obiectiv). Este prea scurt. De fapt, introducerea în rezumat a justificat mai bine scopul revizuirii decât introducerea în manuscris. Sugerați să modificați. De asemenea, foarte important, există o exagerare a constatărilor când se citează două studii privind beneficiile CHM în introducere, vă rugăm să revizuiți din nou așa cum este comentat în manuscris).

Răspuns: necesitatea acestei revizuiri sistematice a fost ilustrată în continuare. În introducere, autorii au afirmat beneficiile specifice ale CHM combinată cu terapia convențională în tratamentul COVID-19 ușor până la moderat.

2) Metode și rezultate: Vă rugăm să definiți în profunzime rezultatele: CT pulmonar – care este definiția CT pulmonar îmbunătățit/bun etc, vă rugăm să detaliați. și cum se leagă asta cu evaluarea rezultatului. Același lucru se aplică definiției ratei de vindecare clinică și testării acidului nucleic viral. De asemenea, trebuie clarificată definiția termenului eficient, îmbunătățit, ineficient

Răspuns: autorii au definit în profunzime rezultatele CT pulmonar, rata de vindecare clinică și testarea acidului nucleic viral.

3) Rezultate – tabelul 2 este trunchiat și nu am putut vizualiza întregul tabel. Rezoluția parcelelor forestiere a fost scăzută și multe nu sunt lizibile. Vă sugerez să redenumiți axa pentru a favoriza terapia singură și pentru a favoriza CHM + terapia convențională în loc de a favoriza controlul/favorizarea experimentală pentru a face mai ușor de citit la prima vedere.

Răspuns: autorii au modificat tabelul 2 și rezoluția parcelelor forestiere. Autorii au redenumit axa pentru a favoriza terapia convențională și pentru a favoriza terapia combinată în loc de a favoriza controlul/favoarea experimentală pentru a face mai ușor de citit la prima vedere.

4) Beneficiile asupra markerilor inflamatori – acest lucru este foarte important de clarificat. Nivelurile superioare sunt mai bune sau nivelurile inferioare sunt mai bune? Acest lucru va depinde de evoluția bolii. De exemplu, în stadiile inițiale, probabil că avem nevoie de niveluri mai ridicate de imunitate pentru a produce efecte antivirale. Cu toate acestea, dacă inflamația este evidentă și prelungită în etapele ulterioare, acest lucru poate împinge pacientul într-o furtună de citokine și, prin urmare, dăunătoare, adică momentul este important. Această componentă nu este discutată și ar trebui discutată, având în vedere că markerii inflamatori sunt unul dintre rezultatele evaluate și durata administrării variază.

Răspuns: beneficiile asupra markerilor inflamatori au fost clarificate. Analizele de subgrup ale rezultatelor markerilor inflamatori au fost efectuate în funcție de durata tratamentului.

5) Aș aprecia mai multe discuții despre terapia convențională CHM+, având în vedere că acest lucru joacă un rol major și în descoperirile dvs.

Răspuns: această revizuire a discutat despre terapia combinată de CHM și terapia convențională.

6) Engleza s-a îmbunătățit, dar trebuie să fie îmbunătățită în continuare. În special în selectarea cuvintelor corecte și adecvate din punct de vedere politic și a unui întreg paragraf subliniat în discuție. De asemenea, sunt recomandate modificări minore de formatare ale tabelelor.

Răspuns: autorii au primit asistență lingvistică oferită de AJE ( https://secure.aje.com/cn/researcher/ ) în timpul pregătirii acestui manuscris. Formatul tabelelor a fost modificat.

7) Declarațiile privind disponibilitatea datelor ar trebui clarificate – aceasta contrazice cu ceea ce este deja furnizat.

Răspuns: autorii au clarificat declarațiile privind disponibilitatea datelor.

Atașament

Nume fișier trimis: Răspuns la Reviewers.pdfFaceți clic aici pentru un fișier de date suplimentar. (103K, pdf)

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r005

Scrisoarea deciziei 2

Ahmed Negida , editor academicInformații privind drepturile de autor și licență

9 august 2021

Efectul suplimentar al medicinei chinezești pe bază de plante în tratamentul COVID-19 ușor până la moderat: o revizuire sistematică și meta-analiză

PONE-D-20-38124R2

Dragă Dr. Shi,

Suntem încântați să vă informăm că manuscrisul dumneavoastră a fost considerat adecvat din punct de vedere științific pentru publicare și va fi acceptat oficial pentru publicare odată ce va îndeplini toate cerințele tehnice restante.

În termen de o săptămână, veți primi un e-mail care detaliază modificările necesare. Când acestea au fost abordate, veți primi o scrisoare formală de acceptare și manuscrisul dumneavoastră va fi programat pentru publicare.

La scurt timp după acceptarea formală va urma o factură de plată. Pentru a asigura un proces eficient, vă rugăm să vă conectați la Editorial Manager la http://www.editorialmanager.com/pone/ , faceți clic pe linkul „Actualizați informațiile mele” din partea de sus a paginii și verificați din nou dacă informațiile dvs. de utilizator sunt actualizate. la zi. Dacă aveți întrebări legate de facturare, vă rugăm să contactați departamentul nostru de facturare cu autor direct la gro.solp@gnillibrohtua .

Dacă instituția sau instituțiile dvs. au un birou de presă, vă rugăm să le informați despre lucrarea viitoare pentru a ajuta la maximizarea impactului acestuia. Dacă vor pregăti materiale de presă, vă rugăm să informați echipa noastră de presă cât mai curând posibil – nu mai târziu de 48 de ore de la primirea acceptării oficiale. Manuscrisul dvs. va rămâne sub embargo de presă strict până la ora 14:00, ora de Est, la data publicării. Pentru mai multe informații, vă rugăm să contactați gro.solp@sserpeno .

Salutări calde,

Ahmed Negida, MD

Editor academic

PLUS UNU

Comentarii suplimentare ale editorului (opțional):

Comentariile recenzenților:

2021; 16 (8) : e0256429.Publicat online 20 aug 2021. doi:  10.1371/journal.pone.0256429.r006

Scrisoare de acceptare

Ahmed Negida , editor academicInformații privind drepturile de autor și licență

13 august 2021

PONE-D-20-38124R2

Efectul suplimentar al medicinei chinezești pe bază de plante în tratamentul COVID-19 ușor până la moderat: o revizuire sistematică și meta-analiză

Stimate Dr. Shi:

Sunt încântat să vă informez că manuscrisul dumneavoastră a fost considerat adecvat pentru publicare în PLOS ONE. Felicitări! Manuscrisul dvs. este acum la departamentul nostru de producție.

Dacă instituția sau instituțiile dvs. au un birou de presă, vă rugăm să le informați acum despre lucrarea dvs. viitoare pentru a ajuta la maximizarea impactului acestuia. Dacă vor pregăti materiale de presă, vă rugăm să informați echipa noastră de presă în următoarele 48 de ore. Manuscrisul dvs. va rămâne sub embargo de presă strict până la ora 14:00, ora de Est, la data publicării. Pentru mai multe informații vă rugăm să contactați gro.solp@sserpeno .

Dacă vă putem ajuta cu altceva, vă rugăm să ne trimiteți un e-mail la gro.solp@enosolp .

Vă mulțumim pentru că ați trimis munca la PLOS ONE și pentru că susțineți accesul deschis.

Salutări calde,

Personalul Redacției PLOS ONE

în numele

Dr. Ahmed Negida

Editor academic

PLUS UNU

Dezvăluiri uimitoare: PROTOCOLUL LUI ARAFAT cu Remdesivir și Kaletra A OMORÂT SUTE DE OAMENI. Și confirm eu, că sunt în sistem. Vaccinul provoacă sterilitate și omoară. ÎNREGISTRARE extraordinară cu o asistentă din Bihor. Spitalul reacționează

ÎNREGISTRAREA DESPRE CRIMELE DIN SPITALELE ȘI CENTRELE DE VACCINARE DIN BIHOR https://rumble.com/embed/vo0tn7/?pub=awbt2O asistentă de la Spitalul din Aleșd a fost înregistrată în timpul unei convorbiri telefonice, purtată înainte de valul IV pandemic, iar miercurea trecută aceasta a apărut în spațiul public. Asistenta acuză că protocolul lui Arafat a produs crime masive și că din experiența ei proprie a constatat cum vaccinul a omorât oameni. Dezvălurile ne aduc aminte de cazurile similare de la Spitalele din Galați, unde au avut loc și deshumnări, Arad și Sibiu, unde, de altfel, Parchetul a deschis o anchetă pentru ucidere din culpă.  Colegii de presă de la Bihor Online – BIHON.RO – au publicat întreaga afacere uimitoare. Cu mulțumiri adresate redacției bihorene preluăm mai sus înregistrarea extraordinară și dezvăluirile asistentei cu trimitere către comunicatul Spitalului.
 Înregistrarea a fost publicată miercuri, 08 decembrie, pe un cont fictiv de Facebook, cu aproape 18.000 de urmăritori.

„Dezvăluiri din interiorul sistemului. Protocolul criminal. Înregistrarea unei convorbiri cu o asistentă medicală din Aleșd, făcută înainte de «valul al 4-lea»”, este descrierea care însoțește înregistrarea audio a unei convorbiri telefonice între Maria T.P, o asistentă de la Spitalul din Aleșd și un bărbat.

Potrivit femeii, înregistrarea a fost făcută fără acordul acesteia, neștiindu-se exact ce s-a discutat înainte ca bărbatul să pornească înregistrarea

Înregistrarea este făcută sub forma unui interviu, iar bărbatul a cărui identitate nu o cunoaștem îi adresează pe parcursul dialogului mai multe întrebări asistentei.

„Remdesivir și Kaletra au omorât sute de oameni”, spune femeia la începutul înregistrării, care susține apoi că Dexametazona trebuia administrată într-o singură fiolă, iar la pacienți li se dădeau 6 de fapt.

ADVERTISEMENT

„Este un antiinflamator, se dă la reumatism, la poliartrite, la pacienți care au dureri foarte mari. Este un inflamator foarte puternic. Antibioticul în doze decente induce o infecție, în doze mari e letal. Dacă dau la cineva până în două grame de Cefort e ok, la o infecție urinară sau cutanată. Dacă îi dau patru grame îl omor.”, spune asistenta în înregistrare.

In acelasi timp afirmațiile privind transferul acesteia pe sectia de chirurgie pe considerentul atitudinii sale anti-vaccinare sunt totalmente nefondate , deoarece singurul considerent privind transferul a fost prin prisma deficitului de personal inregistrat la nivel de sectie.

„Deci zici că așa au reușit să îi pună în pită` pe mulți (pacienți -n.r.). Cu supradoză, nu?”, spune bărbatul.ADVERTISEMENT

La acuzația extrem de gravă lansată de bărbat, aceea de malpraxis medical, femeia răspunde cu lejeritate: „Da, bineînțeles”.

„Am avut colegă care a fost repartizată la Oradea, la Gavril Curteanu, pe COVID. A zis clar: «Maria, aruncam Dexametazona în coș, aruncam Kaletra». Mă duceam cu ea la bolnavi și făceau aștia ochii mari și ziceau «nu, nu vreau asta. Băgam doza în buzunar, mă duceam la baie și o aruncam în veceu. Tu știi câtă Kaletra am aruncat eu în veceu doar să nu-i am pe conștiință”, mai spune asistenta în înregistrare, care apoi critică modul de administrare a oxigenului pentru pacienți.

„Tu bagi în bolnavi 12L de oxigen continuu, când după 2 ore la 6 litri organismul intră în acidoză și procesele chimice se dau peste cap în organism. Încarci un edem pulmonar acut, o insuficiență respiratorie. Maxim două ore la 6 litri de oxigen la o persoană. Dacă îl ții 24/24 la 12 litri face acidoză și-ți crapă, îți moare (n.r.- pacientul)”, mai spune asistenta.

Bărbatul încearcă apoi să ducă discuția într-un alt sens, făcând referire la cele spuse mai sus de femeie și zicând: Și asta se făcea conform protocoalelor lu` ăsta, lu` Arafat”, după care femeia îi răspunde «Da,da,da. Asta a făcut Raed Arafat. Și confirm eu, că sunt în sistem și știu»”, mai spune Maria.T.https://20d56a7fe8e054dacafaa5887033455d.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

Apoi, femeia spune că asistentele scădeau nivelul de oxigen la 6 litri, iar șefa de secție urla: „V-am spus să lăsați la 12 Litri”, pentru că din spusele ei, „avea niște planuri acolo făcute”.

Discuția continuă în aceeași manieră, asistenta spunând că după ce s-au simțit vinovați, mai mulți medici au ieșit public și au spus că au omorât oameni.

Asistenta Maria T.P, a lucrat o perioadă la Centrul de vaccinare din Aleșd, iar apoi a fost mutată la spital, în secția de Chirurgie din cauza deficitului de personal.

Întrebată apoi de bărbat dacă se mai respectă protocoalele medicale, femeia spune că cei care le-au făcut au fost „atinși”.

„Stai să vedem dacă mai vine un val ce protocoale mai scot. Au fost atinși și mulți s-au revoltat, deci nu cred că le mai aplică. Dar atunci în plin doliu, în toiul nebuniei, astea s-au aplicat. Sforile se trag la un nivel mult mai mare, la care noi aștia mici nici măcar nu putem să ne gândim. Venea de la București, de la Arafat ăsta e protocolul, un protocol sanitar care trebuie respectat”, mai spune femeia în înregistrare.

Ea a susținut în înregistrare că directiva a venit de la OMS.

„Ăia trebuie să ne rărească. Suntem prea mulți. Trebuie rărită lumea. OMS-ul a dat directiva. Orice sistem medical se ghidează după OMS”, spune femeia pe înregistrare, care apoi face o remarcă rasistă la adresa șefului OMS, Tedros Adhanom: «Unde îl avem pe negrotelul ală, pe Tedros ală sau cum îi zice. Azi zice una, mâine zice nu am zis asta, ați înțeles greșit. Asta denotă câtă încredere poți să ai în el».

Femeia a lucrat ca asistent medical generalist la spitalul „Santa Giulia”, din Milano timp de 14 ani, iar din 21 ianuarie 2021 a fost angajată la Spitalul din Aleșd.

„Vaccinul produce sterilitate”

„Vaccinul produce sterilitate. Atacă organele genitale. Organele de reproducere, nenorocitul ăsta de vaccin. Eu din ianuarie până când m-am accidentat am lucrat pe vaccinări. Am fost la centrul de vaccinare (din Aleșd – n.r.). Vaccinam lumea în prostie”, mai spune femeia pe înregistrare.

„Venea lumea și îmi spunea: «abia aștept să mă imunizez». La fiecare cum venea le spuneam păi, nu vă imunizați. Știți ce înseamnă imun? Dacă ești imun boala nu te poate atinge, iar acest vaccin, impropriu spus, nu vă protejează. Dumneavoastră nu faceți vaccin, faceți terapie genetică. Sunteți cobai până în 2023. Eu cu seringa în mână le spuneam chestia asta”, mai spune asistenta pe înregistrare.

Atâta timp cât are un ARN mesager acolo, nu e un vaccin. Singurul vaccin este AstraZeneca, că are tulpină atenuată de virus în el. Ală e singurul vaccin, restul sunt terapii genetice.

„Cine îmi garantează că acest ARN mesager se duce doar până la nivel de mitocondrii și acolo se dezintegrează, se autodistruge. Dacă cumva se joacă cu ADN-ul ală. Ce se întâmplă după, modifică genomul uman. Ce devenim după 20-30 de ani? monștri, mutanți. Din cauză că tu, nu poți să te joci de-a Dumnezeu să umbli cu ARN-ul și cu ADN-ul, să te joci cu ele fără să ai consecințe. Asta fac mințile bolnave. Bogații ăștia, lumea aia nevăzută, care ne conduce pe noi și nu e teoria conspirației și nu e nebun cine crede așa ceva, pentru că înainte să le scot pe gură am citit și m-am documentat cu persoane, zic eu importante care știu despre ce vorbesc. Sunt date care atestă așa ceva. Bogătașii ăștia nu mai știu ce să facă. Se joacă de-a Dumnezeu”, mai spune asistenta Maria, care apoi face comparația oamenilor, cu a puilor de găină pe care îi poți omorî în diverse feluri pentru a face experimente pe ei.

„Veneau cupluri la vaccinare și la rapel doar el sau ea”

Asistenta îi povestește apoi bărbatului că pe perioada cât a lucrat la centrul de vaccinare din Aleșd, au venit 6 cupluri la vaccinare, iar la rapel, doar unul dintre ei, spunând că celălalt partener a murit de la vaccin.

„Să nu spun cazuri în care veneau cuplurile, fericiți că se vaccinează. Și veneau la rapel doar el sau ea. Păi unde-i doamna, a murit, 6 cazuri am avut. Trei anafilaxii foarte puternice. Reacție la 15 minute post-vaccinare, i-am trimis la Oradea”, mai spune Asistenta.

Conform protocolului de vaccinare, fiecare pacient trebuie să stea sub observație timp de 15 minute, pentru a vedea dacă are reacții adverse în urma vaccinării.

„La 3 zile de la vaccinare l-au îngropat”

„Săream pe ei și prindeam linia venoasă și repede perfuzie și du-te cu adrenalina. Le ziceam hai că a intrat în șoc anafilactic. Era nebunie. Și veneau măi, vrem vaccin și vrem vaccin”, mai spune femeia, care apoi povestește cazul unui bătran care a mers să se vaccineze și a murit la 3 zile după imunizare.

„Avenit un domn și l-am întrebat de ce vreți să vă vaccinați. Păi cum adică îmi spuneți așa ceva, eu sunt cardiac și trebuie să mă vaccinez că mi-a zis medicul de familie că chiar e indicată vaccinarea în cazul meu, pentru că doamne păzește, dacă mă îmbolnăvesc, o să fac o formă ușoară. I-am spus nu luați în calcul că poate vă păzește Dumnezeu de boală și fără vaccinul ăsta? Și șansele sunt mai mici să faceți complicații. S-a supărat pe mine, la trei zile l-au îngropat. A treia zi de la vaccin era în groapă.”, mai spune femeia.

„Am vaccinat peste 3.000 persoane”

Asistenta îi mai spune bărbatului că cele spuse nu sunt povești, sunt experiențe personale trăite.

„Eu cu mâna mea am vaccinat 3.000 și ceva de oameni. Prima dată am zis nu accept, după am zis că nu e o chestie pe care o fac împotriva voinței omului. Singurul lucru pe care pot să-l fac e să-i explic ce face”, mai spune Maria.T, care apoi aduce vorba unui transfer, de la centrul de vaccinare, la secția de Chirurgie a Spitalului Aleșd, care s-a făcut conform conducerii spitalului din cauza deficitului de personal de pe secția respectivă.

Asistenta spune că Centrul de vaccinare din Aleșd vaccina în jur de 200 de persoane pe zi, iar din cauza faptului că ea „informa” persoanele care doreau să se imunizeze, la un moment dat nu au mai mers oameni să se vaccineze.

„Afirmațiile privind transferul acesteia pe secția de chirurgie pe considerentul atitudinii sale anti-vaccinare sunt totalmente nefondate , deoarece singurul considerent privind transferul a fost prin prisma deficitului de personal inregistrat la nivel de secție.

Din sursele noastre, asistenta Maria.T este fina managerului spitalului, Florin Creț.

În baza înregistrării apărute în spațiul public, Spitalul din Aleșd a transmis un comunicat oficial, semnat de managerul executiv Florin Creț, directorul medical Florin Creț și directorul financiar Săteanu Elvira, pe care îl puteți citi integral la sursă: BIHON.RO

Riscul de mortalitate cauzat de COVID-19 se corelează invers cu starea vitaminei D3, iar o rată a mortalității apropiată de ZERO ar putea fi teoretic atinsă la 50 ng/ml 25(OH)D3: Rezultatele unei revizuiri sistematice și ale unei meta-analize

Abstract

Context Multe cercetări arată că nivelurile sanguine de calcidiol (25(OH)D3) se corelează puternic cu severitatea infecției cu SARS-CoV-2. Există o discuție deschisă cu privire la dacă D3 scăzut este cauzat de infecție sau dacă deficiența afectează negativ apărarea imunitară. Scopul acestui studiu a fost de a colecta dovezi suplimentare pe acest subiect.

Metode Căutarea sistematică a literaturii a fost efectuată pentru a identifica cohorta retrospectivă, precum și studii clinice privind ratele mortalității COVID-19 față de nivelurile sanguine D3. Ratele de mortalitate din studiile clinice au fost corectate pentru vârstă, sex și diabet. Datele au fost analizate folosind corelația și regresia liniară.

Rezultate Au fost identificate un studiu populațional și șapte studii clinice, care au raportat nivelurile sanguine D3 înainte de infecție sau în ziua internării în spital. Ele au arătat în mod independent o corelație Pearson negativă a nivelurilor D3 și a riscului de mortalitate (r(17)=-.4154, p=.0770/r(13)=-.4886, p=.0646). Pentru datele combinate, nivelurile mediane (IQR) D3 au fost de 23,2 ng/ml (17,4 – 26,8) și a fost observată o corelație Pearson semnificativă (r(32)=-.3989, p=.0194). Regresia a sugerat un punct teoretic de mortalitate zero la aproximativ 50 ng/ml D3.

Concluzii Cele două seturi de date oferă dovezi puternice că D3 scăzut este mai degrabă un predictor decât un efect secundar al infecției. În ciuda vaccinărilor în desfășurare, recomandăm creșterea nivelului seric de 25(OH)D la peste 50 ng/ml pentru a preveni sau atenua noile focare datorate mutațiilor de evadare sau scăderii activității anticorpilor.

Înregistrare de probă Nu se aplică.

Declarație de interes concurent

Autorii nu au declarat niciun interes concurent.

Declarație de finanțare

Nu se aplică.

Declarații de autor

Confirm că toate orientările etice relevante au fost respectate și au fost obținute toate aprobările necesare IRB și/sau comitetului de etică.

da

Detaliile IRB/organismului de supraveghere care a acordat aprobarea sau scutirea pentru cercetarea descrisă sunt prezentate mai jos:

Nu se aplică.

A fost obținut tot consimțământul necesar pacientului/participantului și au fost arhivate formularele instituționale corespunzătoare.

da

Înțeleg că toate studiile clinice și orice alte studii intervenționale prospective trebuie să fie înregistrate într-un registru aprobat de ICMJE, cum ar fi ClinicalTrials.gov. Confirm că orice astfel de studiu raportat în manuscris a fost înregistrat și că este furnizat ID-ul de înregistrare a studiului (notă: dacă postați un studiu prospectiv înregistrat retroactiv, vă rugăm să furnizați o declarație în câmpul ID-ul studiului, care să explice de ce studiul nu a fost înregistrat în prealabil) .

da

Am urmat toate liniile directoare adecvate de raportare a cercetării și am încărcat listele de verificare relevante pentru raportarea cercetării din Rețeaua EQUATOR și alte materiale pertinente ca fișiere suplimentare, dacă este cazul.

da

Hârtie în colecție de preprinturi COVID-19 SARS-CoV-2 de la medRxiv și bioRxiv

 Vizualizați profilul ORCIDLorenz Borsche ,

 Vizualizați profilul ORCIDBernd Glauner ,

 Vizualizați profilul ORCIDJulian von Mendel

doi:https://doi.org/10.1101/2021.09.22.21263977

https://www.medrxiv.org/content/10.1101/2021.09.22.21263977v1

Studiu publicat în Jurnalul European de Epidemiologie: Vaccinarea nu diminuează infectarea, ba chiar dimpotrivă. Autorii sunt cercetători la Harvard iar redactorul șef al revistei este președintele Departamentului de Epidemiologie al Universității


Un studiu
 al unui profesor de Sănătatea Populației de la Universitatea Harvard realizat împreună cu un stagiar la Centrul de Analiză Geografică al Universității Harvard și publicat de Jurnalul European de Epidemiologie demonstrează că vaccinarea nu diminuează numărul infectărilor cu coronavirus, ceea ce răstoarnă rău de tot carul de vacciniști cu tot cu discursul lor oficial, care acum se poate rezuma probabil doar la textul că vaccinatul decedat a avut o moarte mai ușoară. Statisticile prezentate de cei doi cercetători de la Harvard arată că în țările sau regiunile cele mai vaccinate ale lumii nu numai că nu a scăzut numărul celor infectați dar în multe cazuri acestea au devenit și puternice focare de infecție – realitate expusă, adeseori, și de ActiveNews. Nu mai departe de zilele trecute am arătat că și la nivelul României, cele mai infectate orașe sau/și județe sunt și cele mai vaccinate, în cap cu Bucureștii.
 Autorii studiului de la Harvard au analizat 68 de țări și 2.947 de comitate/județe ale SUA. Din păcate, România lipsește din studiu dar în schimb sunt prezente vecinele noastre „nevacciniste” Bulgaria, cu 17% injectați și Ucraina, cu doar 9% înțepați, ignorată din narațiunile oficiale pe tema vaccinării deși este aici, peste gard de noi. Dar are și Ivermectină și Arbidol, la farmacii.

Studiul a fost publicat online de Jurnalul European de Epidemiologie la data de 30 septembrie 2021. AICI poate fi vizualizat în format PDF. După ce cunoscutul profesor Didier Raoult l-a răspândit pe contul său Twitter generând un val de reacții, AFP Franța s-a gândit că poate să-l conteste.„Jurnalul European de Epidemiologie, al cărui editor sunt și eu, este cea mai bine cotată publicație de specialitate din lume în domeniul epidemiologiei. Aici, publicația demonstrează lipsa de corelație între politica de vaccinare și numărul de cazuri.”, a scris Didier pe Twitter pe 8 octombrie 2021. Într-o încercare tâmpă de a discredita studiul, un cearșaf întreg semnat de tot „AFP Franța”-ul concluzionează pe 14 octombrie că e „un studiu limitat și greșit interpretat”. Cercetând și noi cine e „AFP Franța”-ul – dincolo de trecutul istoric care prezintă agenția cam penetrată adânc de spionajul sovietic – am găsit o echipă de factcecări de vreo 12 capete, dintre care 6-7 născute între 1989 și 1996. Nici unul nu este însă de formație medic sau sociolog ci majoritatea a terminat jurnalismul, unul dreptul, altul istoria sau limbile străine. Mai lipsea un profesor de fizică. Cu toate acestea echipa semnatară anonim AFP Franța s-a gândit să-l chestioneze pe redactorul-șef al revistei, Dr. Albert Hofman, care este chiar președintele Departamentului de Epidemiologie al micuței Universități Harvard, cea mai veche instituție de învățământ superior din Statele Unite (1636) și una dintre cele mai prestigioase din lume. Dr. Hofman i-a trimis la plimbare pe „controlorii” AFP-iști explicându-le omenește căeste vorba de un articol științific care a fost evaluat de colectivul de specialiști al revistei, adicălea e „peer-reviewed”, ceea ce înseamnă pe românește că este de nivel academic. Desigur, probabil nu la nivelul laricsului autohton dar, cum se zice pe la noi, fiecare cu laboratorul lui și eprubeta din care provine.https://4f9e267203ca48436ef86e7981b29a60.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html De altfel, chiar producătorul celui mai bine mediatizat ser experimental, Pfizer/Comirnaty, recunoaște în prospectul său oficial publicat de Agenția Europeană a Medicamentului că „Impactul vaccinării cu Comirnaty asupra răspândirii virusului SARS-CoV-2 în comunitate nu este încă cunoscut.” De asemenea, „Nu se știe încă cât de mult oamenii vaccinați pot să poarte și să răspândească virusul”. În plus, „În prezent nu se știe cât durează protecția dată de Comirnaty. Persoanele vaccinate în studiul clinic vor continua să fie urmărite timp de 2 ani pentru a aduna mai multe informații despre durata protecției.”
 Dar hei, cine să mai citească prospectul când avem atâția actori care să-l interpreteze la TV sau în scenetele ieftine plătite cu bani negri unor vedete prostituate și oricum deja bine injectate, ba chiar ciuruite? O să ne mai vedem noi după 2 ani, vorba producătorului dar și a lui Gigi Becali.
 Studiul cercetătorilor de la Harvard are în prezent (19 octombrie 2021, ora 9.00, ora României) 935.000 de accesări, ceea ce înseamnă că a fost citit de câteva milioane bune de oameni din întreaga lume. Studiul a fost semnalat în premieră în România (tot) de ActiveNews, pe 8 octombrie 2021, printr-o preluare de la publicația The Defender / Apărătorul, a organizației internaționale conduse de Robert F. Kennedy Jr, Children’s Health Defense. Având în vedere importanța lui, mai ales în noul context propagandistic dement din România, ActiveNews revine asupra lui pentru a prezenta (probabil tot singular) în limba română, fragmentele cele mai relevante ale Studiului:

Creșterea numărului cazurilor de COVID-19 nu are legătură cu nivelul de vaccinare în 68 de țări și 2947 de comitate ale Statele Unite

Vaccinurile constituie, în prezent, principala strategie pentru combaterea Covid-19 în întreaga lume. De exemplu, se argumentează că relatările despre creșterea continuă a numărului de cazuri noi în Statele Unite (SUA) sunt rezultatul ratelor scăzute de vaccinare din anumite zone. O narațiune similară a fost observată și în țări precum Germania și Regatul Unit. În același timp, Israelul, care a fost lăudat pentru ratele sale rapide și ridicate de vaccinare, a înregistrat, totodată, o revenire în forță a cazurilor de COVID-19. Investigăm relația dintre procentul populației complet vaccinate și noile cazuri de COVID-19 în 68 de țări și în 2.947 de comitate ale SUA. […]https://4f9e267203ca48436ef86e7981b29a60.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html
Constatări
La nivel de țări, nu pare să existe o relație sesizabilă între procentul de populație complet vaccinată și noile cazuri de COVID-19 din ultimele 7 zile (Fig. 1). De fapt, linia de tendință sugerează o asociere marginal pozitivă, astfel încât țările cu un procent mai mare de populație complet vaccinată au un număr mai mare de cazuri COVID-19 la 1 milion de persoane. De remarcat că Israelul, cu peste 60% din populație complet vaccinată, a înregistrat cele mai multe cazuri de COVID-19 la 1 milion de persoane în ultimele 7 zile. Lipsa unei asocieri semnificative între procentul populației complet vaccinate și noile cazuri COVID-19 este exemplificată și mai mult, de exemplu, prin compararea Islandei și a Portugaliei. Ambele țări au peste 75% din populație complet vaccinată și au mai multe cazuri COVID-19 la 1 milion de persoane decât țări precum Vietnam și Africa de Sud, care au aproximativ 10% din populație complet vaccinată.

De asemenea, la nivelul comitatelor din SUA, mediana cazurilor noi de COVID-19 la 100.000 de persoane în ultimele 7 zile este în mare măsură foarte asemănătoare la toate categoriile de procente de populație complet vaccinată (Fig. 2). Se observă, de asemenea, o variație substanțială la nivel de comitat în ceea ce privește numărul de cazuri noi de COVID-19 din cadrul categoriilor de procentaj al populației complet vaccinate. De asemenea, nu pare să existe o sesizare semnificativă a scăderii numărului de cazuri COVID-19 odată cu creșterea procentului de populație complet vaccinată (Fig. 3). 

https://4f9e267203ca48436ef86e7981b29a60.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html
Dintre primele 5 comitate cu cel mai mare procent de populație complet vaccinată (99,9-84,3%), Centrele pentru Controlul și Prevenirea Bolilor (CDC) din SUA identifică 4 dintre ele ca fiind comitate cu transmitere „ridicată”. Comitatele Chattahoochee (Georgia), McKinley (New Mexico) și Arecibo (Puerto Rico) au peste 90% din populație complet vaccinată, toate trei fiind încadrate la categoria cu transmitere „ridicată”. În schimb, dintre cele 57 de comitate care au fost clasificate de CDC drept comitate cu transmitere „scăzută”, 26,3% (15) au un procentaj al populației complet vaccinate sub 20%.
Întrucât se crede că imunitatea completă conferită de vaccin se obține după aproximativ 2 săptămâni de la a doua doză, am efectuat analize de sensibilitate folosind un decalaj de o lună pentru procentul de populație complet vaccinată, pentru fiecare țară (a lumii) și comitat din SUA. Constatările de mai sus privind lipsa unei asocieri vizibile între cazurile de COVID-19 și nivelurile de vaccinare completă au fost observate și atunci când am analizat nivelul de vaccinare completă cu un decalaj de o lună.
Trebuie menționat faptul că datele COVID-19 se referă la cazurile confirmate, ceea ce este o funcție atât a factorilor de ofertă (de exemplu, diferențele în ceea ce privește capacitățile de testare sau practicile de raportare), cât și a celor de cerere (de exemplu, diferențele în ceea ce privește decizia oamenilor în legătură cu momentul în care trebuie să se testeze).
Interpretare
Încrederea exclusivă în vaccinare ca strategie principală de limitare a COVID-19 și a consecințelor sale adverse trebuie reevaluată, în special având în vedere varianta Delta (B.1.617.2) și probabilitatea apariției unor variante viitoare. Este posibil să fie nevoie și de alte intervenții farmacologice și non-farmacologice (…). O astfel de corectare a direcției, în special în ceea ce privește narațiunea strategică, devine extrem de importantă, având în vedere dovezile științifice emergente referitoare la nivelul de eficacitate al vaccinurilor în lumea reală.
De exemplu, într-un raport publicat de Ministerul Sănătății din Israel, eficacitatea a 2 doze de vaccin BNT162b2 (Pfizer-BioNTech) împotriva prevenirii infecției cu COVID-19 a fost raportată ca fiind de 39%, considerabil mai mică decât eficacitatea de 96%, conform studiilor clinice. De asemenea, se pare că imunitatea derivată din vaccinul Pfizer-BioNTech ar putea să nu fie la fel de puternică precum imunitatea dobândită prin recuperarea din COVID-19. S-a raportat, de asemenea, o scădere semnificativă a imunității la 6 luni după injectarea cu vaccinurile cu ARNm. Chiar dacă vaccinarea oferă protecție împotriva spitalizărilor cu forme grave și a deceselor, CDC a raportat o creștere de la 0,01 la 9% și de la 0 la 15,1% (între ianuarie și mai 2021) a ratelor de spitalizare și, respectiv, de deces, în rândul celor complet vaccinați. […]”

Iată și țările cercetate, cu rezultatele specificate în tabel:

Date despre autori și publicare:
Autorii studiului – trimis în data de 17 august Jurnalului European de Epidemiologie, acceptat de revistă, după o revizuire inter-pares, la 9 septembrie și publicat online pe 30 septembrie 2021 – sunt S. V. Subramanian și Akhil KumarS. V. Subramanian este cercetător la Centrul Harvard pentru Studii ale Populației și Dezvoltării, din Cambridge, Massachusetts, SUA, și profesor la Departamentul de științe sociale și comportamentale al Facultății de Sănătate Publică „T.H. Chan” cât și profesor afiliat la Departamentul de Sociologie din cadrul universității Harvard, din Boston, MA, SUA, iar Akhil Kumar este un student eminent de la Turner Fenton Secondary School, Brampton, Ontario, Canada, și stagiar la Centrul de Analiză Geografică al Universității Harvard și este autor sau co-autor a numeroase studii științifice Bibliografia, în original:

References

  1. 1.Vaccinations CDC. CDC COVID data tracker. Centers for Disease Control and Prevention. 2021. https://covid.cdc.gov/covid-data-tracker/#vaccinations.
  2. 2.Nicolas E. Germany mulls restrictions for unvaccinated as cases soar. EUobserver; 2021. https://euobserver.com/coronavirus/152534.
  3. 3.Estrin D. Highly vaccinated Israel is seeing a dramatic surge in New COVID cases. Here’s why. NPR; 2021. https://www.npr.org/sections/goatsandsoda/2021/08/20/1029628471/highly-vaccinated-israel-is-seeing-a-dramatic-surge-in-new-covid-cases-heres-why.
  4. 4.Ritchie H, Ortiz-Ospina E, Beltekian D, Mathieu E, Hasell J, Macdonald B, Giattino C, Appel C, Rodés-Guirao L, Roser M. Coronavirus pandemic (COVID-19). 2020. Published online at OurWorldInData.org. Retrieved from: https://ourworldindata.org/coronavirus.
  5. 5.ADVERTISEMENThttps://4f9e267203ca48436ef86e7981b29a60.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.htmlWhite House COVID-19 Team. COVID-19 community profile report. 2020. HealthData.gov. https://healthdata.gov/Health/COVID-19-Community-Profile-Report/gqxm-d9w9.
  6. 6.Ministry of Health Israel. Two-dose vaccination data. Government of Israel; 2021. https://www.gov.il/BlobFolder/reports/vaccine-efficacy-safety-follow-up-committee/he/files_publications_corona_two-dose-vaccination-data.pdf.
  7. 7.Thomas SJ, Moreira ED, Kitchin N, Absalon J, Gurtman A, Lockhart S, Perez JL, et al. Six Month safety and efficacy of the BNT162b2 Mrna Covid-19 vaccine. MedRxiv. 2021. https://doi.org/10.1101/2021.07.28.21261159.ADVERTISEMENThttps://4f9e267203ca48436ef86e7981b29a60.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.htmlArticle  PubMed  PubMed Central  Google Scholar 
  8. 8.Gazit S, Shlezinger R, Perez G, Lotan R, Peretz A, Ben-Tov A, Cohen D, Muhsen K, Chodick G, Patalon T. Comparing sars-cov-2 natural immunity to vaccine-induced immunity: reinfections versus breakthrough infections. MedRxiv. 2021. https://doi.org/10.1101/2021.08.24.21262415.Article  Google Scholar 
  9. 9.Canaday DH, Oyebanji OA, Keresztesy D, Payne M, Wilk D, Carias L, Aung H, Denis KS, Lam EC, Rowley CF, Berry SD, Cameron CM, Cameron MJ, Wilson B, Balazs AB, King CL, Gravenstein S. Significant reduction in humoral Immunity among healthcare workers and nursing home residents 6 months AFTER COVID-19 BNT162b2 mRNA vaccination. MedRxiv. 2021. https://doi.org/10.1101/2021.08.15.21262067.Article  PubMed  PubMed Central  Google Scholar 
  10. 10.McMorrow M. (rep.). Improving communications around vaccine breakthrough and vaccine effectiveness. 2021. Retrieved from https://context-cdn.washingtonpost.com/notes/prod/default/documents/8a726408-07bd-46bd-a945-3af0ae2f3c37/note/57c98604-3b54-44f0-8b44-b148d8f75165.

https://www.activenews.ro/covid-dezvaluiri-covid/Studiu-publicat-in-Jurnalul-European-de-Epidemiologie-Vaccinarea-nu-diminueaza-infectarea-ba-chiar-dimpotriva.-Autorii-sunt-cercetatori-la-Harvard-iar-redactorul-sef-al-revistei-este-presedintele-Departamentului-de-Epidemiologie-al-Universitatii-170090

Imunitatea dobandita natural prin infectarea cu Sars-cov-2 ofera protectie impotriva tulpinei Delta de 13 ori mai buna comparativ cu 2 doze vaccin Pfizer(BionTech)

Un nou studiu din Israel sugerează că imunitatea câștigată după recuperarea după o infectie/vindecare de COVID-19 este mai protectoare împotriva noii variante Delta decât imunitatea indusă de vaccin. S-a estimat că imunitatea naturală este de aproximativ 13 ori mai puternică decât administrarea a două doze de vaccin Pfizer-BioNTech.

Cercetătorii scriu:

Acest studiu a demonstrat că imunitatea naturală conferă o protecție mai durabilă și mai puternică împotriva infecțiilor, bolilor simptomatice și spitalizării cauzate de varianta Delta a SARS-CoV-2, comparativ cu imunitatea indusă de vaccinul cu două doze BNT162b2.

Cu toate acestea, vaccinurile pot adăuga un plus de protecție la persoanele care s-au recuperat de la COVID-19(cu riscurile aferente). Rezultatele au arătat că o doză unică de vaccin cu imunitate naturală asigura o protecție mai mare împotriva reinfecției decât persoanele cu imunitate naturală singură.Studiu: Compararea imunității naturale a SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite.  Credit de imagine: ktsdesign / ShutterstockStudiu: Compararea imunității naturale a SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite . Credit de imagine: ktsdesign / Shutterstock

Studiul „Compararea imunității naturale SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite” este publicat pe serverul de preimprimare medRxiv *.

Cum au efectuat studiul

Echipa de cercetare a comparat rata infecției cu SARS-CoV-2, severitatea bolii, spitalizarea și decesul la vârsta de peste 16 ani, care au avut fie imunitatea indusă de vaccin, fie imunitatea naturală.

Au existat trei grupuri în studiu: 673.676 de persoane care au fost complet vaccinate cu vaccinul Pfizer-BioNTech și fără expunere prealabilă la SARS-CoV-2; 62.883 de persoane nevaccinate care s-au recuperat din COVID-19; și 42.099 persoane cu infecție prealabilă SARS-CoV-2 și care au primit o singură doză de vaccin.

Echipa de cercetare a urmărit participanții la studiu în perioada 1 iunie – 14 august 2021. Perioada de urmărire a avut loc atunci când varianta Delta era obișnuită în Israel.

Israelul a avut una dintre cele mai rapide lansări de vaccinuri la nivel global. În prezent, în țară au fost administrate peste 13 milioane de doze. Ca rezultat, descoperirile alcătuiesc cel mai mare studiu observațional din lumea reală, care compară imunitatea naturală cu cea indusă de vaccin.

Creșterea infecțiilor descoperite și a spitalizărilor la persoanele vaccinate

Persoanele vaccinate fără expunere prealabilă la SARS-CoV-2 au avut un risc crescut de 13,06 ori de a se infecta cu varianta Delta. În plus, a existat un risc crescut de 27 de ori pentru COVID-19 simptomatic.

Deși rezultatele ar putea sugera scăderea imunității naturale împotriva variantei Delta, cei vaccinați prezintă încă un risc crescut de 5,96 ori de infecție descoperită și un risc crescut de 7,13 ori de boală simptomatică comparativ cu cei infectați anterior ”, au explicat cercetătorii.

În plus, persoanele vaccinate au prezentat un risc mai mare de a necesita spitalizare din cauza unei infecții descoperite decât persoanele nevaccinate cu imunitate naturală.

Persoanele cu o singură doză de vaccin și care s-au recuperat anterior de la infecție păreau să aibă mai multă protecție împotriva Delta decât persoanele nevaccinate cu imunitate naturală.

Nu au fost observate decese legate de COVID-19 la toate cele trei grupuri.

Mai sunt necesare mai multe cercetări care să investigheze protecția pe termen lung a imunității naturale. Cu toate acestea, cercetătorii teoretizează că imunitatea naturală ar putea oferi un răspuns imun mai mare față de proteinele SARS-CoV-2 decât activarea imună a proteinei anti- spike oferită de vaccinul Pfizer-BioNTech.

limitările și punctele de luat în considerare

Este posibil ca studiul să fi subestimat numărul de infecții asimptomatice, deoarece și-a colectat datele din testele PCR. Persoanele cu infecții asimptomatice sunt mai puțin susceptibile de a fi testate pentru SARS-CoV-2, sugerând că rezultatele se aplică în primul rând infecțiilor simptomatice.

Descoperirile s-au concentrat, de asemenea, asupra pacienților care au primit vaccinul Pfizer-BioNTech la începutul anului 2021. Alte cercetări din Israel au sugerat recent că nivelurile de anticorpi induse de vaccin scad după câteva luni, dar focurile de rapel pot spori răspunsul imun. Rămâne necunoscut modul în care imunitatea naturală se compară cu imunitatea indusă de vaccin cu lovituri de rapel.

În plus, rezultatele studiului nu se traduc în vaccinuri care nu sunt bazate pe mARN, cum ar fi AstraZeneca-Oxford și vaccinurile Johnson & Johnson.

Studiul s-a axat în principal pe varianta Delta, care a devenit răspândită în multe țări, inclusiv în Israel. Deoarece Delta a fost cea mai răspândită în timpul studiului, constatările nu pot evalua modul în care imunitatea naturală protejează împotriva altor variante SARS-CoV-2.

În cele din urmă, cercetătorii recunosc că diferite comportamente de sănătate, cum ar fi aderența la distanțarea socială și purtarea măștilor, nu au putut fi controlate în cadrul studiului și ar fi putut afecta riscul de infectare.

*Notă importantă

medRxiv publică rapoarte științifice preliminare care nu sunt evaluate de colegi și, prin urmare, nu ar trebui să fie considerate concludente, să ghideze practica clinică / comportamentul legat de sănătate sau tratate ca informații stabilite.Referință jurnal:

https://www.news-medical.net/news/20210830/Does-SARS-CoV-2-natural-infection-immunity-better-protect-against-the-Delta-variant-than-vaccination.aspx

Statistici alarmante din Israel: atacurile de cord și stopurile cardiace explodează în rândul tinerilor vaccinați

Profesorul Retsef Levi, de la Sloan School of Management din cadrul renumitului MIT din Massachusetts (SUA), a dezvăluit informații îngrijorătoare, rezultate în urma unui studiu israelian recent. Ca urmare a vaccinării împotriva Covid în Israel (60% din populația acestui stat este deja complet vaccinată, iar peste 80% este vaccinată cu o singură doză), există o incidență tot mai mare a sechelelor și vătămărilor grave provocate de vaccin, care prezintă relevanță clinică sau necesită chiar terapie intensivă, informează Report24.News.
Astfel, s-a înregistrat o creștere cu 25% a cazurilor de stop cardiac și de infarct în rândul tinerilor de 16-29 de ani care au fost vaccinați. În rândul femeilor vaccinate din grupa de vârstă 20-29 de ani, atacurile de cord au crescut chiar și cu 83,6%. Potrivit studiului citat de Levi, această creștere este „în mod clar legată” de campania de vaccinare. Daunele colaterale și „efectele secundare” generate de politica Corona sunt în centrul activității lui Levi, un statistician medical de la MIT, considerat o autoritate internațională în domeniu.


Daune colaterale ale politicii de vaccinare și ale politicii Covid
Printre altele, anul trecut, el a studiat creșterea numărului de boli cardiovasculare ca urmare a neacordării sau evitării tratamentului de urgență (din cauza reticenței de a se prezenta la spital a oamenilor) în timpul primului lockdown și a publicat rezultatele șocante în studiul său „Evidence of Worse Outcomes Related to Cardiac Arrest during the COVID-19 Pandemic due to Patient Reluctance to Seek Care (2020)”.
https://75a53b134cd3e68e38c68056eda40d27.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html

Israelul, care „de la campionul mondial la vaccinare a ajuns campionul mondial la infectare”, după cum comentează chiar postul public german de televiziune ZDF, a vaccinat în principal cu serul de la Pfizer/Biontech.
Între timp, ei au început deja cu cea de-a treia doză. Se pare că presupusa soluție este, de fapt, problema aici și că, încă o dată, cauza este confundată cu efectul. Nimeni nu pare să fie îngrijorat cu adevărat – așa cum se întâmplă în cazul celorlalte guverne occidentale captive ale intereselor industriei farmaceutice.

Meta-analiza studiilor randomizate de Ivermectină pentru tratarea infecției cu SARS-CoV-2

Metaanaliza studiilor randomizate cu ivermectină pentru tratarea infecției cu SARS-CoV-2 

Andrew Hill1, Anna Garratt2, Jacob Levi3, Jonathan Falconer4, Leah Ellis5, Kaitlyn McCann5, Victoria Pilkington6, Ambar Qavi5, Junzheng Wang5, Hannah Wentzel5

  1. Departamentul de farmacologie și terapie, Universitatea din Liverpool, Liverpool, L7 3NY, Marea Britanie
  2. Departamentul de Boli Infecțioase, Spitalul Universitar din Țara Galilor, Consiliul de Sănătate al Universității Cardiff și Vale, Marea Britanie
  3. Departamentul de terapie intensivă, University College London Hospital, ULCH NHS Trust, Londra, Marea Britanie
  4. Departamentul de Boli Infecțioase, Spitalul Chelsea și Westminster, Imperial NHS Trust, Londra, Marea Britanie
  5. Facultatea de Medicină, Imperial College London, Marea Britanie 6. Oxford University Clinical Academic Graduate School, University of Oxford, UK

Open Forum Boli infecțioase , ofab358, https://doi.org/10.1093/ofid/ofab358Publicat: 06 iulie 2021 Istoricul articolelor

A fost publicată o corecție:Open Forum Infectious Diseases , volumul 8, numărul 8, august 2021, ofab394, https://doi.org/10.1093/ofid/ofab394

Abstract

Ivermectina este un medicament antiparazitar care este investigat pentru reutilizarea împotriva SARS-CoV-2. Ivermectina a prezentat activitate in vitro împotriva SARS-COV-2 la concentrații mari.

Această meta-analiză a investigat ivermectina în 24 de studii clinice randomizate (3328 de pacienți) identificate prin căutări sistematice ale registrelor PUBMED, EMBASE, MedRxiv și ale studiilor.

Ivermectina a fost asociată cu markeri inflamatori reduși (C-Reactive Protein, d-dimer și feritină) și un clearance viral mai rapid prin PCR. Clearance-ul viral a fost dependent de doză și durată de tratament. În 11 studii randomizate de infecție moderată / severă, a existat o reducere cu 56% a mortalității (Risc relativ 0,44 [IÎ 95% 0,25-0,77]; p = 0,004; 35/1064 (3%) decese pe ivermectină; 93/1063 ( 9%) decese la controale) cu recuperare clinică favorabilă și spitalizare redusă.

Multe studii incluse nu au fost evaluate de colegi și au fost evaluate o gamă largă de doze.

În prezent, OMS recomandă utilizarea ivermectinei numai în cadrul studiilor clinice. O rețea de studii clinice mari este în desfășurare pentru a valida rezultatele observate până în prezent.

Introducere
Pandemia SARS-CoV-2 continuă să crească, cu peste 350.000 de infecții noi și peste 7.000 de decese înregistrate zilnic în toată lumea în mai 2021 [1]. Vaccinurile de protecție au fost dezvoltate, dar livrările actuale sunt prea mici pentru a acoperi cererea mondială în următoarele luni [2]. Cercetătorii din întreaga lume caută de urgență intervenții pentru a preveni noi infecții sau pentru a preveni progresia bolii și pentru a reduce severitatea bolii pentru cei deja infectați.
În timp ce cercetarea asupra noilor agenți terapeutici pentru COVID-19 este esențială, există, de asemenea, un mare interes în evaluarea potențialului medicamentelor deja existente împotriva COVID-19, iar multe studii clinice sunt în curs de realizare a unor medicamente „cu scopuri speciale”, indicate în mod normal pentru alte boli. . Profilurile de siguranță cunoscute, termenele de dezvoltare scurtate și piețele bine stabilite (cu prețuri scăzute și capacitate mai mare de livrare la scară) pentru majoritatea compușilor deja existenți propuși pentru COVID-19 sunt deosebit de avantajoși în comparație cu descoperirea de noi medicamente într-o pandemie situatie. Trei medicamente antiinflamatorii re-propuse au arătat beneficii semnificative de supraviețuire până în prezent: corticosteroidul dexametazonă în studiul UK RECOVERY [3] și medicamentele antagoniste ale receptorului Interleukin-6 (IL-6), tocilizumab și sarilumab, în ​​REMAP- Procesul CAP și procesul RECUPERARE [4,5].Alți antimicrobieni reutilizați, cum ar fi, hidroxiclorochina, lopinavir / ritonavir, remdesivir și interferon-beta, nu au arătat niciun beneficiu semnificativ de supraviețuire în două studii mari, randomizate [3, 6], în ciuda rapoartelor inițiale de eficacitate, subliniind nevoia de precauție la interpretarea date precoce ale studiilor clinice.
Dexametazona este recomandată pentru utilizare de către OMS și are beneficii dovedite de supraviețuire pentru pacienții dependenți de oxigen cu COVID-19, în timp ce tocilizumab și sarilumab îmbunătățesc supraviețuirea pentru pacienții aflați în terapie intensivă [3, 4]. Datele preliminare sugerează că nitazoxanida și budesonida pot avea un rol în infecția ușoară [7,8]. Cu toate acestea, nu există tratamente aprobate pentru pacienții cu infecție ușoară cu SARS-CoV-2, fie pentru a preveni progresia bolii, fie pentru a reduce transmiterea virală. Tratamentele care cresc rata de eliminare virală pot reduce riscul transmiterii ulterioare, dar acest lucru necesită o demonstrație empirică.


Ivermectina este un medicament antiparazitar bine stabilit, utilizat la nivel mondial pentru un număr mare de paraziți și, de asemenea, pentru utilizarea topică împotriva rozaceei. Activitatea antivirală a ivermectinei a fost demonstrată recent pentru SARS-CoV-2 în celulele Vero / hSLAM [9]. Cu toate acestea, concentrațiile necesare pentru a inhiba replicarea virală in-vitro (EC50 = 2,2 – 2,8 μM; EC90 = 4,4 μM) nu sunt atinse sistemic după administrarea orală a medicamentului la oameni [9, 10].
Medicamentul se estimează că se acumulează în țesuturile pulmonare (de 2,67 ori cel al plasmei) [11], dar este, de asemenea, puțin probabil să fie suficient pentru a menține concentrațiile țintă pentru activitatea antivirală pulmonară [10, 12]. Cu toate acestea, ivermectina este de obicei prezentă ca un amestec de doi agenți și, deși este excretată în principal neschimbată la om, are doi metaboliți principali [13]. Datele actuale sunt insuficiente pentru a determina dacă forma minoră sau un metabolit circulant are o potență directă mai mare împotriva SARS-CoV-2, dar se pare că ar trebui să fie mult mai puternic decât valorile raportate.
Ivermectina a demonstrat, de asemenea, mecanisme de acțiune imunomodulatoare și antiinflamatoare în modele preclinice ale altor câteva indicații. Studiile in vitro au demonstrat că ivermectina suprimă producția mediatorilor inflamatori de oxid nitric și prostaglandină E2 [14]. Mai mult, avermectina (din care derivă ivermectina) afectează semnificativ secreția pro-inflamatorie de citokine (IL-1β și TNF-α) și crește secreția citokinei imunoregulatoare IL-10 [15]. Ivermectina a redus, de asemenea, TNF-α, IL-1 și IL-6 și a îmbunătățit supraviețuirea la șoareci cărora li s-a administrat o doză letală de lipopolizaharidă [16]. Dovezi preclinice care susțin aceste mecanisme de acțiune imunomodulatoare și antiinflamatoare au fost generate și în modelele murine [17, 18]. În cele din urmă, la hamsterii sirieni de aur infectați cu SARS-CoV-2,ivermectina subcutanată a demonstrat o reducere a raportului IL-6 / IL-10 în țesuturile pulmonare. În acest studiu, ivermectina a prevenit și deteriorarea patologică [19]. În cele din urmă, există diferite mecanisme potențiale de acțiune pentru ivermectină împotriva COVID19 și sunt în curs de investigare ulterioară, așa cum este rezumat recent într-un articol de revizuire [20].
La doze standard, de 0,2-0,4 mg / kg timp de 1-2 zile, ivermectina are un profil de siguranță bun și a fost distribuită miliardelor de pacienți din întreaga lume în cadrul programelor de administrare în masă a medicamentelor. O meta-analiză recentă nu a constatat nicio diferență semnificativă în evenimentele adverse la cei cărora li s-au administrat doze mai mari de ivermectină, de până la 2 mg / kg, și la cei care au primit cure mai lungi, de până la 4 zile, comparativ cu cei care au primit doze standard [21]. Ivermectina nu este autorizată pentru femeile însărcinate sau care alăptează sau pentru copii <15 kg.

Grupul de orientări al OMS a constatat că în 16 RCT cu 2407 de participanți ivermectina a îmbunătățit rezultatele mortalității în comparație cu controlul, dar a evaluat calitatea dovezilor disponibile ca fiind scăzută sau foarte scăzută [22]. În prezent, OMS nu recomandă utilizarea ivermectinei în afara studiilor clinice.Obiectivul acestei revizuiri sistematice și meta-analize a fost de a combina rezultatele disponibile din studiile randomizate noi publicate sau nepublicate de ivermectină în infecția cu SARS-CoV-2 pentru a informa ghidurile actuale. Metode Revizuirea sistematică și meta-analiza au fost efectuate în conformitate cu orientările PRISMA. O căutare sistematică a PUBMED și EMBASE a fost efectuată pentru a identifica studii randomizate controlate (RCT/ECA) care evaluează tratamentul cu ivermectină pentru pacienții infectați cu SARS-CoV-2. Studiile clinice fără braț de control sau cele care evaluează prevenirea infecției au fost excluse alături de studii non-randomizate și studii de caz-control. Datele cheie extrase au inclus caracteristici de bază (vârstă, sex, greutate, saturație de oxigen, stadiul infecției), modificări ale markerilor inflamatori, supresie virală după tratament, recuperare clinică, spitalizare și supraviețuire.Datele au fost extrase și verificate încrucișat de către doi recenzori independenți (HW și LE). Strategia de căutare și criteriile de selecție RCT au fost eligibile pentru includere dacă au comparat un regim pe bază de ivermectină cu un comparator sau standard de îngrijire (SOC) pentru tratamentul infecției cu SARS-CoV-2. Lista de verificare PRISMA, diagrama de flux PRISMA, termenii de căutare și criteriile de includere / excludere utilizate sunt detaliate în figura suplimentară 1, tabelele suplimentare 1, 2 și 3. Bazele de date ale registrului au fost căutate până la 12 mai 2021. Clinicaltrials.gov [23] a fost căutat folosind cuvintele cheie COVID, SARS-CoV-2 și ivermectină pentru identificarea studiilor. Platforma OMS International Clinical Trials Registry Platform (ICTRP) a fost accesată prin instrumentul de cartografiere al Inițiativei COVID-NMA [24] și cercetarea antivirală asupra Coronavirus a Universității Stanford.Platforma OMS International Clinical Trials Registry Platform (ICTRP) a fost accesată prin instrumentul de cartografiere al Inițiativei COVID-NMA [24] și cercetarea antivirală asupra Coronavirus a Universității Stanford.

Baza de date (CoV-RDB) [25] pentru identificarea studiilor suplimentare listate pe alte registre naționale și internaționale. Căutările de literatură prin PubMed, Embase și serverele de preimprimare MedRxiv și Researchsquare au fost efectuate pentru a identifica studiile publicate. Înregistrările duplicate, studiile non-randomizate și studiile de prevenire au fost excluse în urma discuției dintre autori. În plus, echipele de cercetare care desfășoară studii clinice nepublicate au fost contactate și li s-a solicitat să se alăture întâlnirilor periodice ale echipei internaționale din decembrie 2020 până în mai 2021. Toate rezultatele disponibile din studiile nepublicate eligibile au fost, de asemenea, incluse în această revizuire sistematică. Toate studiile clinice incluse în această meta-analiză au fost aprobate de comitetele etice locale și toți pacienții au dat consimțământul informat.Rezultatul principal a fost mortalitatea cauzată de toate cauzele, de la randomizare până la sfârșitul urmăririi. Rezultatele secundare au inclus timpul până la eliminarea virală, negativitatea PCR în ziua 7, recuperarea clinică, timpul până la recuperarea clinică, ventilația mecanică, durata spitalizării și numărul de spitalizări. Modificările markerilor inflamatori, supresia virală, recuperarea clinică și spitalizarea au fost, de asemenea, rezumate pentru studii individuale în care criteriile finale nu au putut fi combinate.

Analiza datelor

Analizele statistice pentru mortalitatea din toate cauzele, timpul până la eliminarea virală și recuperarea clinică au fost efectuate folosind rezumate de date publicate. Pentru rezultatul mortalității, studiile clinice cu cel puțin un deces raportat au fost incluse în această analiză. Mai mult, orice spitalizare în decurs de 12 ore de la randomizare a fost exclusă.Efectele tratamentului au fost exprimate ca raporturi de risc (RR) pentru rezultatele binare și diferența medie (MD) pentru rezultatele continue. Pentru fiecare rezultat, am reunit statisticile individuale ale studiului utilizând modelul de varianță inversă cu efecte aleatorii; o corecție de continuitate de 0,5 a fost aplicată brațelor de tratament fără decese. Eterogenitatea a fost evaluată de I2. Pragul de semnificație a fost stabilit la 5% (față-verso) și toate analizele au fost efectuate folosind Revman 5.3. Un grafic de pâlnie pentru rezultatul mortalității a fost creat pentru a evalua prejudecățile publicării și efectele mici ale studiului; valoarea p a fost estimată din testul Harbord bazat pe regresie pentru efecte de studiu mici. Toate studiile incluse în această analiză au fost evaluate în ceea ce privește riscul de prejudecată utilizând instrumentul de evaluare standardizat Cochrane Collaboration pentru riscul de prejudecată [26]. Rezultatul acestei evaluări este dat în tabelul suplimentar 3.Fiecare studiu a fost evaluat pentru riscul de prejudecată pentru obiectivul primar, sarcina virală și rezultatele supraviețuirii. Obiectivul principal în cadrul studiilor a avut tendința de a fi recuperarea clinică, care este mai subiectivă și probabil că va fi influențată de cunoașterea brațelor de tratament. De asemenea, a fost efectuată o evaluare a obiectivelor mai obiective, inclusiv supraviețuirea și încărcătura virală, care sunt mai puțin susceptibile de a fi influențate de această prejudecată. În cazul în care informațiile nu erau disponibile în lucrările publicate, investigatorii studiilor clinice au fost contactați proactiv pentru a informa analiza prejudecății riscului.

Rezultate

În această meta-analiză au fost incluse 24 stucii clinice controlate randomizate(aleatorii) RCT implicând un total de 3328 de participanți. Mărimea eșantionului pentru fiecare studiu a variat între 24 și 400 de participanți. Dintre cele 24 de studii incluse, opt au fost lucrări publicate, nouă au fost disponibile ca pre-tipărituri, șase au fost rezultate nepublicate împărtășite pentru această analiză,și unul a raportat rezultatele printr-un site de registru de probă. În general, nouă studii au investigat ivermectina ca doză unică (Tabelul 1A) [27-35], 15 studii au investigat dozarea pe mai multe zile până la șapte zile (Tabelul 1B) [36-50], dintre care patru studii au fost cuprinse între doze [ 28,39, 46, 48]. În studiile incluse, ivermectina a fost investigată în mare parte la participanții ușori / moderate (15 studii). În general, 18 studii au fost simple sau dublu-orb și șase au fost deschise.

Evaluarea studiilor.

O evaluare a calității studiilor incluse în această meta-analiză a fost realizată în conformitate cu instrumentul Cochrane Collaboration pentru a evalua riscul de prejudecată în următoarele rezultate: obiective primare, sarcină virală și supraviețuire. Pentru evaluarea rezultatului primar, studiile 6/24 (25%) au fost evaluate ca fiind un risc ridicat de prejudecată [Tabelul suplimentar 3A]. In orice caz,în evaluările rezultatelor mai obiective, inclusiv sarcina virală și mortalitatea, numărul studiilor cu risc ridicat a fost mai mic. În evaluarea PCR, 3/15 (20%) din studii au fost evaluate cu risc ridicat [Tabelul suplimentar 3B]. În evaluarea supraviețuirii, 1/11 (9%) din studii au fost evaluate cu risc ridicat de. [Tabelul suplimentar 3C].

Efecte asupra markerilor inflamatori

Cinci studii au furnizat rezultate ale efectului ivermectinei asupra markerilor inflamatori, inclusiv proteina C reactivă (CRP), feritina și dimerul (Tabelul 2).

Patru dintre aceste studii au demonstrat reduceri semnificative ale CRP comparativ cu controlul. Mai mult, în studiul Elgazzar [36], ivermectina a redus semnificativ nivelurile de feritină în comparație cu controlul în populația severă de pacienți, în timp ce nu s-a demonstrat nicio diferență semnificativă în populația ușoară / moderată.Studiul Okumus [47] a arătat reduceri semnificativ mai mari ale feritinei în ziua 10 de urmărire pentru ivermectină versus control. Studiile Chaccour [35] și Ahmed [46] nu au arătat nicio diferență semnificativă în numărul de feritină între ivermectină și martor. Elgazzar [36] a arătat diferențe semnificative în dimerul d între ivermectină și martor atât la populațiile ușoare / moderate, cât și la cele severe. Okumus [47] a prezentat diferențe semnificative în dimerul d în ziua 5, în timp ce Chaccour [35] nu a găsit diferențe semnificative în dimerul d între ivermectină și martor, dar cu o dimensiune mai mică a eșantionului.

Efecte asupra eliminării virale

Au fost utilizate trei obiective diferite pentru a analiza clearance-ul viral: procentul de pacienți nedetectabili într-o zi stabilită (Tabelul 3A), numărul de zile de la randomizare la negativitate (Tabelul 3B),și alte măsuri, cum ar fi valorile ciclului de timp (Ct) și corelațiile doză-răspuns (Tabelul 3C). Studiile Kirti [43] și Okumus [47] au inclus analiza încărcăturii virale numai la un subgrup de pacienți. Efectele ivermectinei asupra clearance-ului viral au fost, în general, mai mici atunci când s-a administrat o singură zi. Mai multe studii nu au arătat niciun efect semnificativ statistic al ivermectinei asupra clearance-ului viral [28, 29, 34]. Cele trei studii randomizând pacienții la doze sau durate diferite de ivermectină au arătat efecte aparente dependente de doză asupra clearance-ului viral. În primul rând, în studiul Babalola (n = 60) [48], doza de 0,4 mg / kg a arătat tendințe de eliminare virală mai rapidă decât doza de 0,2 mg / kg. În al doilea rând, în studiul Mohan (n = 125) [28], doza de 0,4 mg / kg de ivermectină a condus la un procent numeric mai mare de pacienți cu clearance viral în ziua a cincea decât doza de 0,2 mg / kg. Al treilea,în studiul Ahmed (n = 72) [46], tratamentul cu ivermectină timp de cinci zile a condus la un procent mai mare de pacienți cu clearance viral în ziua 13 comparativ cu o zi de tratament. În cele din urmă, în Krolewiecki (n = 45) [50], corelațiile PK / PD au arătat un clearance viral semnificativ mai rapid pentru pacienții cu expuneri la PK peste 160ng / mL.

Efectul ivermectinei asupra clearance-ului viral a fost cel mai pronunțat în studiile randomizate care au evaluat doze de până la cinci zile de ivermectină folosind doze de 0,4 mg / kg. La aceste doze, au existat efecte semnificative statistic asupra clearance-ului viral în toate cele patru studii randomizate. Într-o meta-analiză a clearance-ului viral cu subgrupuri de durată a dozei, au existat diferențe semnificative în timp până la clearance-ul viral în favoarea ivermectinei (Diferența medie -3,00 zile [IÎ 95% -4,96, -1,03]; p = 0,003, Figura 1A ].Într-o analiză de sensibilitate, excluzând studiile cu risc ridicat de prejudecată, s-au observat efecte similare ale ivermectinei la timp cu clearance-ul viral [Figura suplimentară 2]. Mai mult, într-o altă analiză, ivermectina a prezentat un clearance viral îmbunătățit în ziua 7 (Risc relativ 1,35 [95% CI 1,05-1,75]; p = 0,02, Figura 1B].

Efecte asupra recuperării clinice și duratei spitalizării

Definițiile recuperării clinice au variat între studii , așa cum se arată în Tabelul 4. În Tabelul 4A, trei dintre cele șase studii au arătat un timp semnificativ mai rapid până la recuperarea clinică a ivermectinei comparativ cu martorul. metaanaliza recuperării clinice cu subgrupuri de durată a dozei,au existat diferențe semnificative în timp până la recuperarea clinică în favoarea ivermectinei (Diferența medie -1,58 zile [95% CI -2,80, -0,35]; p = 0,01, Figura 1C]. În plus, ivermectina a arătat o îmbunătățire cu 29% a recuperării clinice în o analiză cu subgrupuri de durată a dozei (RR 1,29 [IÎ 95% 1,12-1,47]; p = 0,0003, Figura 1D]. Ivermectina a demonstrat o durată mai mică de spitalizare comparativ cu martorul (Diferența medie -4,27 zile [IÎ 95% -8,60- 0,06]; p = 0,05, Figura 1E). Ivermectina nu a fost asociată cu un risc mai mic de spitalizare comparativ cu martorul (RR 0,40 [IC 95% 0,14-1,08]; p = 0,07, Figura 1F). Cu toate acestea, această analiză a implicat doar patru studii la 704 de participanți. Într-o analiză de sensibilitate, incluzând orice spitalizare în decurs de 12 ore de la randomizare, au existat semnificativ mai puține spitalizări comparativ cu controlul (RR 0,32 [95% CI 0.13-0.80]; p = 0,01, Figura suplimentară 3).

Efectele asupra supraviețuirii

11 studii randomizate au raportat că cel puțin o persoană a murit după randomizare și a fost inclusă în analiză (Tabelul 5). Pe parcursul acestor 11 studii la 2127 de pacienți, au existat 35/1064 (3%) decese în brațele cu ivermectină, comparativ cu 93/1063 (9%) decese în brațele de control. Într-o analiză combinată utilizând ponderarea inversă a varianței, ivermectina a arătat o reducere cu 56% a mortalității (RR 0,44 [95% CI 0,25-0,77]; p = 0,004, Figura 1G). Heterogenitatea a fost moderată, I2 = 43%. A existat o îmbunătățire cu 70% a supraviețuirii în subgrupul de participanți ușori / moderate (RR 0,30 [IC 95% 0,15-0,58]; p = 0,0004). Numărul total de decese a fost mic, analiza sa bazat pe 128 de decese și nu a existat nicio diferență semnificativă între ivermectină și martor în subgrupul sever (0,58 [IÎ 95% 0,25-1,32]; p = 0,19).Rezultate consistente au fost observate într-o analiză, excluzând studiile cu risc ridicat de prejudecată (RR 0,45 (IÎ 95% 0,24-0,82); p = 0,01, Figura suplimentară 4). Când au fost incluse doar studii cu risc scăzut de prejudecată, acest rezultat a fost, de asemenea, menținut (RR 0,31 [IÎ 95% 0,10-0,90]; p = 0,03, Figura suplimentară 5). O analiză suplimentară a subgrupului a rezultatului mortalității cu studii separate prin doză-durată, orbire și grup de control a arătat un beneficiu de supraviețuire consistent și nu s-au găsit diferențe semnificative de subgrup (Figurile Suplimentare 6, 7 și 8). A fost efectuată o analiză a sensibilității la o singură ieșire și niciun studiu unic nu a avut un efect substanțial asupra dimensiunii globale a efectului (Tabelul suplimentar 4). Un grafic de pâlnie pentru rezultatul mortalității nu a arătat efecte semnificative ale prejudecății publicării: efectele tratamentului au fost similare în studii de dimensiuni diferite, p = 0.618 (Figura suplimentară 9).

Ivermectina nu a fost asociată cu un risc mai mic de ventilație mecanică (RR 0,97 [IC 95% 0,57-1,67]; p = 0,92, Figura 1H]. Cu toate acestea, această estimare s-a bazat pe cinci studii efectuate pe 641 de participanți, incluzând doar 49 de evenimente. revizuirea și meta-analiza a 24 RCT/ ECA (n = 3328) au arătat că tratamentul cu ivermectină reduce markerii inflamatori, realizează clearance-ul viral mai rapid și îmbunătățește supraviețuirea în comparație cu SOC. Efectele ivermectinei asupra clearance-ului viral au fost mai puternice pentru doze mai mari și durate mai mari de tratament. Aceste efecte au fost observate într-o gamă largă de RCT/ECA efectuate în mai multe țări diferite. Rezultatele acestei analize au apărut în cadrul reuniunilor echipei internaționale a proiectului Ivermectin în perioada decembrie 2020 – mai 2021.Echipe independente de cercetare desfășurau testele în 16 țări și au convenit să împărtășească datele lor, care erau adesea nepublicate, pentru a accelera viteza de raportare și pentru a asigura că cercetarea fragmentată, răspândită în întreaga lume, ar putea contribui la învățarea globală. Clearance-ul viral a fost evaluat prin teste de reacție în lanț polimerazică (PCR) în toate studiile. Am inclus doar studii clinice randomizate în această meta-analiză. Cele 24 RCT/ECA incluse au fost concepute și realizate independent, cu rezultate combinate în mai 2021. Cu toate acestea, fiecare studiu individual a fost mic și a inclus o gamă largă de tipuri de populație. Definițiile de recuperare clinică au diferit între studii și nu au existat diferențe semnificative în ceea ce privește supraviețuirea la participanții severi.

Obiective secundare

Obiective secundare pentru unele RCT/ECR au inclus biomarkeri de severitate a bolii.Unele dintre acestea oferă dovezi pentru un mecanism antiinflamator de acțiune al ivermectinei la pacienții infectați cu SARS-CoV-2. Metaanalizele anterioare au demonstrat că nivelurile ridicate de CRP, feritină, dimer d și limfocitopenie sunt legate de severitatea COVID-19 și de hiperinflamarea [51, 52]. Studiile asupra antagoniștilor receptorilor IL-6 s-au dovedit a reduce nivelul CRP și dimerul d la pacienții cu COVID-19 [5].

Ivermectina poate avea, de asemenea, un rol în prevenirea pe termen scurt a infecției cu SARS-CoV-2, sugerată de studii pilot [53, 54]. Acest beneficiu potențial trebuie validat și în studii randomizate mai mari.

Mecanismul de acțiune

În momentul scrierii, lipsurile de cunoștințe împiedică o concluzie solidă cu privire la mecanismul de acțiune al ivermectinei. S-a propus că efectele antivirale cu spectru larg ale Ivermectinei sunt legate de impactul său asupra căii NF-κB și prin legarea la celula gazdă importin α / β1 heterodimer, proteine ​​de transport nuclear responsabile de intrarea nucleară a încărcăturilor și aceste efecte în rândul său, de asemenea, preveni replicarea virală. După cum sa discutat în introducere, estimările actuale in vitro EC50 (2,2 μ, 2,4 μM și 2,8 μM în funcție de testul genetic analizat prin RT-qPCR) sunt încă de 35 de ori mai mari decât concentrațiile plasmatice după dozarea orală normală.Chiar și dozele de 8,5 ori mai mari decât cele recomandate de FDA 200 μg / kg de 1,7 mg / kg ating doar concentrații plasmatice de 0,28 μM [55]. Biodisponibilitatea crescută în starea de hrănire și concentrațiile mai mari observate în țesutul pulmonar comparativ cu plasma este încă sub rezultatele EC50 publicate curent. Cu toate acestea, rezultatele EC50 pot varia foarte mult în funcție de metodologia de laborator; linia celulară, metodele de cuantificare virală, tulpina virusului cultivat și Multiplicitatea infecției utilizate. Acesta este un fenomen stabilit: polimorfismele virale ale gripei au demonstrat o variație de 5 ori în EC50 a diferitelor teste de neuraminidază care au analizat susceptibilitatea izolatelor de câmp ale virusului gripal împotriva oseltamivirului [56]. În mod specific în SARS-CoV-2, EC50 pentru medicamentele reutilizate anterior au variat semnificativ. Remdesivir, acum licențiat pentru SARS-CoV-2, a efectuat>De 10 ori mai bine în celulele A549 augmentate hACE2 (0.115 μM) decât Vero E6 (1.28μM) [57]. întrucât alte exemple de medicamente reutilizate, cum ar fi sofosbuvirul, au demonstrat o variație de peste 10 ori a EC50 atunci când sunt utilizate în celulele Vero E6 față de HUH7 [58]. În consecință, EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și susceptibil de a se modifica în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și să poată fi modificată în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și susceptibil de a se modifica în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.
Limitări

O limitare cheie a acestei meta-analize este comparabilitatea datelor, cu studii diferite în ceea ce privește dozarea, durata tratamentului și criteriile de includere. Mai mult, standardul de îngrijire utilizat în brațul de control a diferit între studii. În această meta-analiză, studiile care au utilizat controale active precum hidroxiclorochina sau lopinavir / ritonavir au fost combinate împreună cu cele care au utilizat placebo sau îngrijire standard. Cu toate acestea, lopinavir / ritonavir și hidroxiclorochina nu au arătat niciun beneficiu general sau vătămare în studiile randomizate și meta-analize mari. [7, 59-61] Mai mult, analize suplimentare în această lucrare care separă studiile pe subgrupuri de îngrijire standard / placebo și control activ nu au arătat nicio diferență semnificativă între grupuri. O altă limitare este că ivermectina a fost administrată în asociere cu doxiciclina în trei studii.Este posibil ca studiile individuale să nu aibă puterea de a detecta efectele tratamentului asupra unor obiective rare, cum ar fi supraviețuirea. Măsurile de rezultat nu au fost standardizate; clearance-ul viral a fost măsurat în majoritatea studiilor, dar în momente de timp diferite și cu praguri diferite ale ciclului PCR. Fiabilitatea testelor PCR în scopuri de cuantificare a făcut obiectul unei dezbateri de fond. Majoritatea studiilor au fost efectuate la populații cu infecție ușoară / moderată, iar unele studii au exclus pacienții cu comorbidități multiple. Pentru studiile deschise, există un risc de părtinire în evaluarea obiectivelor subiective, cum ar fi recuperarea clinică și externarea la spital. Cu toate acestea, riscul este mai mic pentru obiectivele finale obiective, cum ar fi clearance-ul viral și supraviețuirea. Am încercat să controlăm prejudecățile de publicare contactând fiecare echipă de cercetare care efectuează testele direct.Acest lucru a generat mai multe rezultate decât ar fi evident dintr-un sondaj de studii clinice publicate numai, dar înseamnă că multe dintre studiile incluse nu au fost evaluate de colegi. Revizuirea și publicarea ECR durează în general trei până la șase luni. A devenit o practică obișnuită pentru studiile clinice ale tratamentelor cheie COVID-19 care trebuie evaluate din pre-tipăriri, cum ar fi studiile OMS SOLIDARITATE, RECUPERARE și REMAP-CAP [4,5,7].


Aceste RCT au fost efectuate într-o gamă largă de țări, adesea în condiții de resurse reduse și sisteme de sănătate supraîncărcate. În prezent sunt în curs de desfășurare ECA mai mari în Spania, America de Sud, Africa și America de Nord, cu rezultate de la alți 5000 de participanți așteptați în vara anului 2021 (Tabelul suplimentar 5). În ciuda limitărilor, această analiză sugerează o doză și un impact dependent de durată de ivermectină asupra ratei clearance-ului viral. Aceste studii au evaluat o gamă largă de dozare a ivermectinei, de la 0,2 mg / kg timp de 1 zi la 0,6 mg / kg timp de 5 zile. Această gamă largă de doze a permis o estimare a dependenței de doză de clearance-ul viral, dar reduce numărul pacienților incluși cărora li s-a administrat în mod constant aceeași doză pentru aceeași durată. Doza maximă eficientă de ivermectină nu este încă clară, iar noile studii clinice evaluează doze mai mari,până la 1,2 mg / kg timp de 5 zile. Beneficiul de supraviețuire de 56% observat în această meta-analiză se bazează pe 128 de decese, în 11 studii clinice diferite. Acesta este un număr total mai mic de decese decât procesul RECUPERARE, care a condus la aprobarea dexametazonei și se bazează pe 1592 de decese. Cu toate acestea, beneficiul de supraviețuire observat de 56% în ivermectină este mai puternic decât pentru alte medicamente reutilizate, necesitând să se demonstreze o dimensiune mai mică a eșantionului. Rezultatele emergente ale mortalității din studii mai ample de ivermectină vor necesita o evaluare atentă și pot schimba concluziile din analiza actuală. Mai multe alte medicamente reutilizate s-au dovedit promițătoare în studiile timpurii mai mici, de exemplu sofosbuvir / daclatasvir, colchicină și remdesivir, dar beneficiul nu a fost văzut mai târziu în studiile mai mari

.Această meta-analiză a 24 studii clinice randomizate cu brate control RCT / ECA la 3328 de pacienți a arătat o îmbunătățire a supraviețuirii cu 56%, un timp mai rapid până la recuperarea clinică și semne ale unui efect dependent de doză al clearance-ului viral la pacienții cărora li s-a administrat ivermectină versus tratament de control. Acest beneficiu trebuie validat în studii de confirmare mai mari.


Mulțumiri
Dorim să mulțumim întregului personal clinic, echipelor de cercetare și pacienților care au participat la aceste studii.
Finanțare: Fundația apei de ploaie
Conflicte de interese potențiale: Niciunul dintre autori nu a declarat un conflict de interese
Declarație de consimțământ al pacientului: Toate studiile clinice incluse în această meta-analiză au fost aprobate de comitetele etice locale și toți pacienții au semnat consimțământul informat

referinte si tabele si figuri in pdf

150 de STUDII și articole despre efectele adverse ale vaccinurilor Covid și afecțiunile cauzate, de la copii și adolescenți la adulți și bătrâni.

Iata o lista cu cazuri reale de efecte adverse si reactii secundare, dupa administrarea vaccinurilor anti-COVID-19. Am ordonat lista astfel incat sa incep cu studii clare despre efectele secundare de la nivelul inimii si am inceput lista cu cazurile de adolescenti, tocmai pentru ca cei care sunt interesati sa isi protejeze copiii, sa poata lua aceste studii de caz si sa le prezinte medicilor de familie, astfel incat sa demonstreze ca sunt informati si ca nu mai suporta dezinformarea masiva a majoritatii mass-mediei care ascunde aceste adevaruri stiintifice, in loc sa informeze corect si complet.

I. AFECTARE CARDIACA:

A. ADOLESCENTI (PANA IN 18 ANI):

1. Association of Myocarditis With BNT162b2 Messenger RNA COVID-19 Vaccine in a Case Series of Children:

https://jamanetwork.com/journals/jamacardiology/fullarticle/2783052

2. Recurrence of Acute Myocarditis Temporally Associated with Receipt of the mRNA Coronavirus Disease 2019 (COVID-19) Vaccine in a Male Adolescent:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8216855/

3. Myopericarditis in a previously healthy adolescent male following COVID-19 vaccination: A case report:

https://onlinelibrary.wiley.com/doi/10.1111/acem.14322

4. COVID-19 Vaccination-Associated Myocarditis in Adolescents:

https://pediatrics.aappublications.org/content/pediatrics/early/2021/08/12/peds.2021-053427.full.pdf

5. Symptomatic Acute Myocarditis in 7 Adolescents After Pfizer-BioNTech COVID-19 Vaccination:

https://pediatrics.aappublications.org/content/pediatrics/early/2021/08/12/peds.2021-052478.full.pdf

6. Myopericarditis after the Pfizer mRNA COVID-19 Vaccine in Adolescents:

https://www.sciencedirect.com/science/article/pii/S002234762100665X

B. TINERI ADULTI (INTRE 19 SI 23 DE ANI):

1. Perimyocarditis following first dose of the mRNA-1273 SARS-CoV-2 (Moderna) vaccine in a healthy young male: a case report:

https://link.springer.com/article/10.1186/s12872-021-02183-3

2. Cardiac Imaging of Acute Myocarditis Following COVID-19 mRNA Vaccination:

https://jkms.org/DOIx.php?id=10.3346/jkms.2021.36.e229

3. COVID-19 mRNA Vaccine and Myocarditis:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8276934/

4. Myocarditis after BNT162b2 vaccination in a healthy male:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8238643/

5. Myopericarditis in young adults presenting to the emergency department after receiving a second COVID-19 mRNA vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/acem.14307

C. ADULTI (PESTE 24 DE ANI):

1. Unusual Presentation of Acute Perimyocarditis Following SARS-COV-2 mRNA-1237 Moderna Vaccination:

https://www.cureus.com/articles/64219-unusual-presentation-of-acute-perimyocarditis-following-sars-cov-2-mrna-1237-moderna-vaccination

2. Myocarditis and Pericarditis After Vaccination for COVID-19:

https://jamanetwork.com/journals/jama/fullarticle/2782900?resultClick=1

3. Myocarditis Following Immunization With mRNA COVID-19 Vaccines in Members of the US Military:

https://jamanetwork.com/journals/jamacardiology/fullarticle/2781601?resultClick=1

4. Myocarditis Occurring After Immunization With mRNA-Based COVID-19 Vaccines:

https://jamanetwork.com/journals/jamacardiology/fullarticle/2781600?resultClick=1

5. Acute myocarditis after a second dose of the mRNA COVID-19 vaccine: a report of two cases:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8216670/

6. Myocarditis and Other Cardiovascular Complications of the mRNA-Based COVID-19 Vaccines:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8270057/

7. A Series of Patients With Myocarditis Following SARS-CoV-2 Vaccination With mRNA-1279 and BNT162b2:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8219373/

8. COVID-19 vaccine-induced myocarditis: Case report with literature review:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8270733/

9. Hyper-eosinophilic syndrome with myocarditis after inactivated SARS-CoV-2 vaccination: A case study:

https://www.researchsquare.com/article/rs-806335/v1

10. Acute myocarditis following Comirnaty vaccination in a healthy man with previous SARS-CoV-2 infection:

https://www.sciencedirect.com/science/article/pii/S1930043321005549

11. Myocarditis, Pericarditis and Cardiomyopathy After COVID-19 Vaccination:

https://www.sciencedirect.com/science/article/pii/S1443950621011562

12. Takotsubo Cardiomyopathy After mRNA COVID-19 Vaccination:

https://www.sciencedirect.com/science/article/pii/S1443950621011331

13. Acute Myocarditis Following mRNA-1273 SARS-CoV-2 Vaccination:

https://www.sciencedirect.com/science/article/pii/S2589790X21001931

14. Myocarditis following mRNA vaccination against SARS-CoV-2, a case series:

https://www.sciencedirect.com/science/article/pii/S2666602221000409?via%3Dihub

15. Acute myocarditis after SARS-CoV-2 vaccination in a 24-year-old man:

https://www.sciencedirect.com/science/article/pii/S0870255121003243?via%3Dihub#fig0005

16. Myocarditis after Covid-19 mRNA Vaccination:

https://www.nejm.org/doi/10.1056/NEJMc2109975?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%20%200pubmed

II. AFECTARE PIELE SI MUCOASE:

1. BCG Scar Local Skin Inflammation as a Novel Reaction Following mRNA COVID-19 Vaccines in Two International Healthcare Workers:

https://www.cureus.com/articles/55547-bcg-scar-local-skin-inflammation-as-a-novel-reaction-following-mrna-covid-19-vaccines-in-two-international-healthcare-workers

2. Toxic Epidermal Necrolysis Post COVID-19 Vaccination – First Reported Case:

https://www.cureus.com/articles/68051-toxic-epidermal-necrolysis-post-covid-19-vaccination–first-reported-case

3. Varicella-zoster virus reactivation after SARS-CoV-2 BNT162b2 mRNA vaccination: Report of 5 cases:

https://www.jaadcasereports.org/article/S2352-5126(21)00281-2/fulltext#relatedArticles

4. Cutaneous small vessel vasculitis following single-dose Janssen Ad26.COV2.S vaccination:

https://www.jaadcasereports.org/article/S2352-5126(21)00474-4/fulltext

5. Skin necrosis at both COVID-19 vaccine injection sites:

https://www.jaadcasereports.org/article/S2352-5126(21)00510-5/fulltext

6. Association of Facial Pustular Neutrophilic Eruption With Messenger RNA–1273 SARS-CoV-2 Vaccine:

https://jamanetwork.com/journals/jamadermatology/fullarticle/2782441?resultClick=1

7. Incidence of Cutaneous Reactions After Messenger RNA COVID-19:

https://jamanetwork.com/journals/jamadermatology/fullarticle/2781364?resultClick=1

8. Herpes zoster and the risk of ischemic and hemorrhagic stroke: A systematic review and meta-analysis:

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0171182

9. A case of reactivation of varicella–zoster virus after BNT162b2 vaccine second dose?:

https://link.springer.com/article/10.1007/s00011-021-01491-w

10. Reactivation of Varicella Zoster Virus after Vaccination for SARS-CoV-2:

https://www.mdpi.com/2076-393X/9/6/572/htm

11. „COVID Toes” After mRNA COVID-19 Vaccines:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8214806/

12. Cutaneous lymphocytic vasculitis after administration of COVID-19 mRNA vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/dth.15076

13. Exacerbation of psoriasis following COVID-19 vaccination in a patient previously treated with PD-1 inhibitor:

https://onlinelibrary.wiley.com/doi/10.1111/dth.15055

14. Exacerbation of subacute cutaneous lupus erythematosus following vaccination with BNT162b2 mRNA vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/dth.15017

15. Recurrent varicella following SARS-CoV-2 vaccination with BNT162b2:

https://onlinelibrary.wiley.com/doi/10.1111/ijd.15660

16. Herpes zoster after ChAdOx1 nCoV-19 vaccine: a case series:

https://onlinelibrary.wiley.com/doi/10.1111/jdv.17576

17. Covid-19 vaccine induced Steven-Johnson syndrome: a case report:

https://onlinelibrary.wiley.com/doi/10.1111/ced.14784

18. Development of severe pemphigus vulgaris following SARS-CoV-2 vaccination with BNT162b2:

https://onlinelibrary.wiley.com/doi/10.1111/jdv.17480

19. Post Covid-19 vaccination papulovesicular pityriasis rosea-like eruption in a young male:

https://onlinelibrary.wiley.com/doi/10.1111/dth.15040

20. New-onset cutaneous lichen planus triggered by COVID-19 vaccination:

https://onlinelibrary.wiley.com/doi/10.1111/jdv.17504

21. Vitiligo in a COVID-19-vaccinated patient with ulcerative colitis: coincidence?:

https://onlinelibrary.wiley.com/doi/10.1111/ced.14842

22. Widespread purpura annularis telangiectodes following mRNA SARS-CoV-2 vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/jdv.17497

23. Cutaneous thrombosis associated with skin necrosis following Oxford-AstraZeneca COVID-19 vaccination:

https://onlinelibrary.wiley.com/doi/full/10.1111/ced.14819

24. Immune thrombocytopenic purpura after SARS‐CoV‐2 vaccine:

https://www.researchgate.net/publication/351284881_Immune_thrombocytopenic_purpura_after_SARS-CoV-2_vaccine

25. Varicella zoster virus reactivation and mRNA vaccines as a trigger:

https://www.sciencedirect.com/science/article/pii/S2352512621004914

26. Stevens-Johnson syndrome post second dose of Pfizer COVID-19 vaccine: a case report:

https://www.sciencedirect.com/science/article/pii/S2212440321005058

27. Reactivation of IgA vasculitis after COVID-19 vaccination:

https://www.sciencedirect.com/science/article/pii/S2665991321002113

28. A case of severe cutaneous adverse reaction following administration of the Janssen Ad26.COV2.S COVID-19 vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8149168/

29. Ribonucleic acid COVID-19 vaccine-associated cutaneous adverse drug events: a case series of two patients:

https://onlinelibrary.wiley.com/doi/10.1111/ced.14673

III. AEFCTARE SANGE SI VASE SANGVINE:

1. Acute Immune Thrombocytopenia (ITP) Following COVID-19 Vaccination in a Patient With Previously Stable ITP:

https://academic.oup.com/ofid/article/8/7/ofab343/6308965

2. Autoimmune and complement-mediated hematologic condition recrudescence following SARS-CoV-2 vaccination:

https://ashpublications.org/bloodadvances/article/5/13/2794/476324/Autoimmune-and-complement-mediated-hematologic

3. A Case of Autoimmune Hemolytic Anemia Following COVID-19 Messenger Ribonucleic Acid Vaccination:

https://www.cureus.com/articles/58777-a-case-of-autoimmune-hemolytic-anemia-following-covid-19-messenger-ribonucleic-acid-vaccination

4. Newly Diagnosed Idiopathic Thrombocytopenia Post COVID-19 Vaccine Administration:

https://www.cureus.com/articles/56899-newly-diagnosed-idiopathic-thrombocytopenia-post-covid-19-vaccine-administration

5. Severe, Refractory Immune Thrombocytopenia Occurring After SARS-CoV-2 Vaccine:

https://www.dovepress.com/severe-refractory-immune-thrombocytopenia-occurring-after-sars-cov-2-v-peer-reviewed-fulltext-article-JBM

6. COVID-19 vaccination associated severe immune thrombocytopenia:

https://ehoonline.biomedcentral.com/articles/10.1186/s40164-021-00235-0

7. SARS-CoV-2 vaccine-induced cerebral venous thrombosis:

https://www.ejinme.com/article/S0953-6205(21)00185-0/fulltext

8. Thrombosis with Thrombocytopenia Syndrome associated with viral vector COVID-19 vaccines:

https://www.ejinme.com/article/S0953-6205(21)00190-4/fulltext

9. Primary adrenal insufficiency associated with Oxford-AstraZeneca ChAdOx1 nCoV-19 vaccine-induced immune thrombotic thrombocytopenia (VITT):

https://www.ejinme.com/article/S0953-6205(21)00236-3/fulltext

10. Blood pressure increase after Pfizer/BioNTech SARS-CoV-2 vaccine:

https://www.ejinme.com/article/S0953-6205(21)00212-0/fulltext

11. Deep vein thrombosis (DVT) occurring shortly after the second dose of mRNA SARS-CoV-2 vaccine:

https://link.springer.com/article/10.1007/s11739-021-02685-0

12. Vaccine-induced thrombotic thrombocytopenia: the elusive link between thrombosis and adenovirus-based SARS-CoV-2 vaccines:

https://link.springer.com/article/10.1007/s11739-021-02793-x

13. Thrombosis and thrombocytopenia after vaccination against and infection with SARS-CoV-2: a population-based cohort analysis:

https://www.medrxiv.org/content/10.1101/2021.07.29.21261348v1.full

14. Thromboembolism after COVID-19 vaccine in patients with preexisting thrombocytopenia:

https://www.nature.com/articles/s41419-021-04058-z

15. First-dose ChAdOx1 and BNT162b2 COVID-19 vaccines and thrombocytopenic, thromboembolic and hemorrhagic events in Scotland:

https://www.nature.com/articles/s41591-021-01408-4

16. De novo vasculitis after mRNA-1273 (Moderna) vaccination:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8166777/

17. Autoimmune Hematologic Disorders in Two Patients After mRNA COVID-19 Vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8274740/

18. Pulmonary embolism, transient ischaemic attack and thrombocytopenia after the Johnson & Johnson COVID-19 vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8280905/

19. SARS-CoV-2 Vaccine–Induced Immune Thrombotic Thrombocytopenia:

https://www.nejm.org/doi/10.1056/NEJMe2106315

20. A case report of acquired hemophilia following COVID-19 vaccine:

https://onlinelibrary.wiley.com/doi/full/10.1111/jth.15291

21. A case of severe autoimmune hemolytic anemia after a receipt of a first dose of SARS-CoV-2 vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/ijlh.13653

22. Exacerbation of immune thrombocytopenia following COVID-19 vaccination:

https://onlinelibrary.wiley.com/doi/10.1111/bjh.17645

23. Thrombocytopenia following Pfizer and Moderna SARS-CoV-2 vaccination:

https://onlinelibrary.wiley.com/doi/10.1002/ajh.26132

24. Haemophagocytosis and atypical vacuolated lymphocytes in bone marrow and blood films after SARS-CoV-2 vaccination:

https://onlinelibrary.wiley.com/doi/10.1111/bjh.17660

25. Three cases of acute venous thromboembolism in females following vaccination for COVID-19:

https://www.sciencedirect.com/science/article/pii/S2213333X21003929?via%3Dihub

IV. AFECTARE RINICHI SI GLANDE SUPRARENALE:

1. Nephrotic syndrome and vasculitis following SARS-CoV-2 vaccine: true association or circumstantial?:

https://academic.oup.com/ndt/advance-article/doi/10.1093/ndt/gfab215/6318785

2. Minimal Change Disease (Boala cu schimbare minima – Sindrom nefrotic) Following the Pfizer-BioNTech COVID-19 Vaccine:

https://www.ajkd.org/article/S0272-6386(21)00509-6/fulltext

3. Relapse of Minimal Change Disease Following the Pfizer-BioNTech COVID-19 Vaccine:

https://www.ajkd.org/article/S0272-6386(21)00627-2/fulltext

4. IgA Nephropathy After SARS-CoV-2 Vaccination:

https://www.kidneymedicinejournal.org/article/S2590-0595(21)00155-2/fulltext

5. Nephrotic Syndrome Following ChAdOx1 nCoV-19 Vaccine Against SARScoV-2:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8257404/

6. Minimal change disease relapse following SARS-CoV-2 mRNA vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8098029/

7. Minimal change disease following the Moderna mRNA-1273 SARS-CoV-2 vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8149162/

8. IgA nephropathy presenting as macroscopic hematuria in 2 pediatric patients after receiving the Pfizer COVID-19 vaccine:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8256683/

9. Gross hematuria following SARS-CoV-2 vaccination in patients with IgA nephropathy:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8166778/

10. Gross hematuria following vaccination for severe acute respiratory syndrome coronavirus 2 in 2 patients with IgA nephropathy:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7987498/

11. A case of gross hematuria and IgA nephropathy flare-up following SARS-CoV-2 vaccination:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8079938/

12. A Case of Membranous Nephropathy Following Pfizer-BioNTech mRNA vaccine against Coronavirus 2019:

https://www.sciencedirect.com/science/article/pii/S0085253821007353

13. Scleroderma renal crisis following mRNA vaccination against SARS-CoV-2:

https://www.sciencedirect.com/science/article/pii/S0085253821007377

14. Primary adrenal insufficiency associated with Oxford-AstraZeneca ChAdOx1 nCoV-19 vaccine-induced immune thrombotic thrombocytopenia (VITT):

https://www.sciencedirect.com/science/article/pii/S0953620521002363

IV. AFECTARE SISTEM NERVOS CENTRAL SI CREIER:

1. Neurological Complications of COVID-19: Guillain-Barre Syndrome Following Pfizer COVID-19 Vaccine:

https://www.cureus.com/articles/52295-neurological-complications-of-covid-19-guillain-barre-syndrome-following-pfizer-covid-19-vaccine

2. An Unusual Case of Acute Hemorrhagic Necrotizing Encephalomyelitis in a COVID-19 Patient:

https://www.cureus.com/articles/60949-an-unusual-case-of-acute-hemorrhagic-necrotizing-encephalomyelitis-in-a-covid-19-patient

3. Cerebral venous sinus thrombosis 2 weeks after the first dose of mRNA SARS-CoV-2 vaccine:

https://link.springer.com/article/10.1007/s00701-021-04860-w

4. Acute disseminated encephalomyelitis-like presentation after an inactivated coronavirus vaccine:

https://link.springer.com/article/10.1007/s13760-021-01699-x

5. Guillain-Barré syndrome following BNT162b2 COVID-19 vaccine:

https://link.springer.com/article/10.1007/s10072-021-05523-5

6. Malignant cerebral infarction after ChAdOx1 nCov-19 vaccination: a catastrophic variant of vaccine-induced immune thrombotic thrombocytopenia:

https://www.nature.com/articles/s41467-021-25010-x

7. Delirium triggered by COVID-19 vaccine in an elderly patient:

https://onlinelibrary.wiley.com/doi/10.1111/ggi.14163

8. The Development of Guillain Barre Syndrome Subsequent to Administration of Ad26.COV2.S Vaccine:

https://www.onlinescientificresearch.com/articles/the-development-of-guillain-barre-syndrome-subsequent-to-administration-of-ad26cov2s-vaccine.pdf

9. Acute disseminated encephalomyelitis after SARS-CoV-2 vaccination:

https://www.researchgate.net/publicatio/353466948_Acute_disseminated_encephalomyelitis_after_SARS-CoV-2_vaccination

10. COVID‐19 vaccine (ChAdOx1 nCoV‐19 Corona virus vaccine (Recombinant) – COVISHIELD related MS relapse:

https://www.sciencedirect.com/science/article/pii/S2667257X2100005X

11. Post-COVID-19 vaccine Guillain-Barré syndrome; first reported case from Qatar:

https://www.sciencedirect.com/science/article/pii/S2049080121004908

12. Neurologic adverse events among 704,003 first-dose recipients of the BNT162b2 mRNA COVID-19 vaccine in Mexico: A nationwide descriptive study:

https://www.sciencedirect.com/science/article/pii/S1521661621001236

13. New-Onset Neurologic Symptoms and Related Neuro-Oncologic Lesions Discovered After COVID-19 Vaccination: Two Neurosurgical Cases and Review of Post-Vaccine Inflammatory Responses:

https://www.cureus.com/articles/61880-new-onset-neurologic-symptoms-and-related-neuro-oncologic-lesions-discovered-after-covid-19-vaccination-two-neurosurgical-cases-and-review-of-post-vaccine-inflammatory-responses

14. First manifestation of multiple sclerosis after immunization with the Pfizer-BioNTech COVID-19 vaccine:

https://link.springer.com/article/10.1007/s00415-021-10648-w

VI. AFECTARE OCULARA:

1. Watch out for neuromyelitis optica spectrum disorder after inactivated virus vaccination for COVID-19:

https://link.springer.com/article/10.1007/s10072-021-05427-4?fbclid=IwAR2DGcW8Y5UxvdzcOQaBUPn6_RTZGQRSsNo6bzanyAm9yN6387E3Z6WrKlI

2. Acute reduction of visual acuity and visual field after Pfizer-BioNTech COVID-19 vaccine 2nd dose: a case report:

https://link.springer.com/article/10.1007/s00011-021-01476-9?fbclid=IwAR3zAvenOwPAZmuVsx9CM7bFwOliHerfJK3M3nQCMe-3BWoT4QdNCWK7cNo

3. Acute macular neuroretinopathy following COVID-19 vaccination:

https://www.nature.com/articles/s41433-021-01610-1.epdf?fbclid=IwAR1PuBuxzIdyCMPxFNRGsTbLL6YZw9zMBOROorfHrXAPoAOh_-d5rYdyWVc

4. Acute-onset central serous retinopathy after immunization with COVID-19 mRNA vaccine:

https://www.sciencedirect.com/science/article/pii/S2451993621001456?via%3Dihub

5. Panuveitis following Vaccination for COVID-19:

https://www.tandfonline.com/doi/abs/10.1080/09273948.2021.1949478?journalCode=ioii20

6. Bilateral Multifocal Choroiditis following COVID-19 Vaccination:

https://www.tandfonline.com/doi/full/10.1080/09273948.2021.1957123

7. Acute Uveitis following COVID-19 Vaccination:

https://www.tandfonline.com/doi/full/10.1080/09273948.2021.1962917

8. Acute Macular Neuroretinopathy following Coronavirus Disease 2019 Vaccination:

https://www.tandfonline.com/doi/full/10.1080/09273948.2021.1946567

9. New Onset of Unilateral Orbital Myositis following Mild COVID-19 Infection:

https://www.tandfonline.com/doi/full/10.1080/09273948.2021.1887282

10. Acute Thyroiditis and Bilateral Optic Neuritis following SARS-CoV-2 Vaccination with CoronaVac: A Case Report:

https://www.tandfonline.com/doi/full/10.1080/09273948.2021.1961815

VII. REACTII ALERGICE:

1. Reports of Anaphylaxis After Receipt of mRNA COVID-19 Vaccines in the US—December 14, 2020-January 18, 2021:

https://jamanetwork.com/journals/jama/fullarticle/2776557?resultClick=1

2. Acute Allergic Reactions to mRNA COVID-19 Vaccines:

https://jamanetwork.com/journals/jama/fullarticle/2777417?resultClick=1

3. Delayed Localized Hypersensitivity Reactions to the Moderna COVID-19 Vaccine:

https://jamanetwork.com/journals/jamadermatology/fullarticle/2779643?resultClick=1

4. Delayed Cutaneous Hypersensitivity Reaction to Vaxzevria (ChAdOx1-S) Vaccine against SARS-CoV-2:

https://link.springer.com/article/10.1007/s40268-021-00358-z

5. Local reactions to the second dose of the BNT162 COVID-19 vaccine:

https://onlinelibrary.wiley.com/doi/10.1111/dth.15000

6. Biphasic anaphylaxis after first dose of mRNA COVID-19 vaccine with positive polysorbate 80 skin testing:

https://www.sciencedirect.com/science/article/pii/S1081120621005196

7. Prolonged Anaphylaxis to Pfizer Coronavirus Disease 2019 Vaccine: A Case Report and Mechanism of Action:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8021358/

VIII. AFECTARE FICAT:

1. Autoimmune Hepatitis Developing After Coronavirus Disease 2019 (COVID-19) Vaccine: One or Even Several Swallows Do Not Make a Summer:

https://www.journal-of-hepatology.eu/article/S0168-8278(21)01965-6/fulltext

2. Liver injury following SARS-CoV-2 vaccination: a multicenter case series:

https://www.journal-of-hepatology.eu/article/S0168-8278(21)01953-X/fulltext

3. COVID-19-vaccine-pfizer-biontech Autoimmune hepatitis: case report:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8256942/

4. Autoimmune hepatitis triggered by SARS-CoV-2 vaccination:

https://www.researchgate.net/publication/353523152_Autoimmune_hepatitis_triggered_by_SARS-CoV-2_vaccination

6. Acute autoimmune-like hepatitis with atypical anti-mitochondrial antibody after mRNA COVID-19 vaccination: A novel clinical entity?:

https://www.sciencedirect.com/science/article/pii/S0896841121001141

IX. AFECTARE SISTEM NERVOS PERIFERIC:

1. Trigeminal and cervical radiculitis after tozinameran vaccination against COVID-19:

https://casereports.bmj.com/content/14/6/e242344.long

2. Bell’s Palsy After 24 Hours of mRNA-1273 SARS-CoV-2 Vaccine:

https://www.cureus.com/articles/63121-bells-palsy-after-24-hours-of-mrna-1273-sars-cov-2-vaccine

3. A case of acute demyelinating polyradiculoneuropathy with bilateral facial palsy after ChAdOx1 nCoV-19 vaccine:

https://link.springer.com/article/10.1007/s10072-021-05467-w

4. Bell’s palsy and SARS-CoV-2 vaccines—an unfolding story:

https://www.researchgate.net/publication/352205118_Bell%27s_palsy_and_SARS-CoV-2_vaccines-an_unfolding_story

X. AFECTARE SISTEM IMUNITAR:

1. Hemophagocytic lymphohistiocytosis after COVID-19 vaccination:

https://jhoonline.biomedcentral.com/articles/10.1186/s13045-021-01100-7

2. Immune-Mediated Disease Flares or New-Onset Disease in 27 Subjects Following mRNA/DNA SARS-CoV-2 Vaccination:

https://www.mdpi.com/2076-393X/9/5/435/htm

3. Adult-onset Still’s disease after mRNA COVID-19 vaccine:

https://www.sciencedirect.com/science/article/pii/S2665991321002198

4. Autoimmune phenomena following SARS-CoV-2 vaccination:

https://www.sciencedirect.com/science/article/pii/S1567576921006068

XI. AFECTARE SISTEM LIMFATIC:

1. A Case of Cervical Lymphadenopathy After Vaccination Against COVID-19:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8204135/

2. P-257 Cervical lymphadenopathy following COVID-19 vaccine: Clinical characteristics and implications for head and neck cancer services:

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8241354/

3. SARS-CoV-2-induced remission of Hodgkin lymphoma:

https://onlinelibrary.wiley.com/doi/full/10.1111/bjh.17116

XII. AFECTARE PANCREAS:

1. Acute Pancreatitis: A Possible Side Effect of COVID-19 Vaccine:

https://www.cureus.com/articles/57700-acute-pancreatitis-a-possible-side-effect-of-covid-19-vaccine

2. Pancreatic Injury after COVID-19 Vaccine—A Case Report:

https://www.mdpi.com/2076-393X/9/6/576/htm

XIII. AFECTARE MUSCULATURA:

1. Rhabdomyolysis Secondary to COVID-19 Vaccination:

https://www.cureus.com/articles/59492-rhabdomyolysis-secondary-to-covid-19-vaccination

2. A Case of COVID-19 Vaccine Causing a Myasthenia Gravis Crisis:

https://www.cureus.com/articles/60348-a-case-of-covid-19-vaccine-causing-a-myasthenia-gravis-crisis

XIV. AFECTARE TIROIDA:

1. Three Cases of Subacute Thyroiditis Following SARS-CoV-2 Vaccine: Postvaccination ASIA Syndrome:

https://academic.oup.com/jcem/article/106/9/2600/6287003

2. Two Cases of Graves’ Disease Following SARS-CoV-2 Vaccination: An Autoimmune/Inflammatory Syndrome Induced by Adjuvants:

https://www.liebertpub.com/doi/full/10.1089/thy.2021.0142

XV. AFECTARE MADUVA SPINARII:

1. SARS-CoV-2 Vaccination-Induced Transverse Myelitis:

https://www.cureus.com/articles/63667-sars-cov-2-vaccination-induced-transverse-myelitis

XVI. AFECTARE SISTEMICA SAU MULTIORGANICA:

1. Multisystem inflammatory syndrome in an adult following the SARS-CoV-2 vaccine (MIS-V):

https://casereports.bmj.com/content/14/7/e243888

https://www.activenews.ro/stiri/150-de-STUDII-si-articole-despre-efectele-adverse-ale-vaccinurilor-Covid-si-afectiunile-cauzate-de-la-copii-si-adolescenti-la-adulti-si-batrani.-Resursa-de-date-a-Cititorului-ActiveNews-168807