Arhive etichetă | SARS-CoV-2

Canabidiolul inhibă replicarea SARS-CoV-2 prin inducerea stresului ER al gazdei și a răspunsurilor imune înnăscute

Abstract

Răspândirea SARS-CoV-2 și pandemia COVID-19 în curs de desfășurare subliniază necesitatea unor noi tratamente. Aici raportăm că canabidiolul (CBD) inhibă infecția cu SARS-CoV-2 în celule și șoareci. CBD și metabolitul său 7-OH-CBD, dar nu THC sau alți canabinoizi congeneri testați, blochează puternic replicarea SARS-CoV-2 în celulele epiteliale pulmonare. CBD acționează după intrarea virală, inhibând expresia genelor virale și inversând multe efecte ale SARS-CoV-2 asupra transcripției genei gazdă. CBD inhibă replicarea SARS-CoV-2 parțial prin reglarea în sus a răspunsului la stres al reticulului endoplasmatic (ER) IRE1α RNază gazdă și a căilor de semnalizare a interferonului.

În grupurile de pacienți umani din National COVID Cohort Collaborative, CBD (100 mg/ml soluție orală pe fișa medicală) a avut o asociere negativă semnificativă cu testele pozitive pentru SARS-CoV-2. Acest studiu evidențiază CBD ca un potențial agent preventiv pentru infecția cu SARS-CoV-2 în stadiu incipient și merită studii clinice viitoare. În prezent, vă avertizăm împotriva utilizării formulărilor non-medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.medicale, inclusiv comestibile, inhalante sau topice, ca terapie preventivă sau de tratament.

INTRODUCERE

Sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) este responsabil pentru boala coronavirus 2019 (COVID-19), o pandemie care continuă să provoace morbiditate și mortalitate pe scară largă pe tot globul. SARS-CoV-2 este a șaptea specie de coronavirus cunoscută că infectează oamenii. Aceste coronavirusuri, care includ SARS-CoV, 229E, NL63, OC43, HKU1 și MERS-CoV, provoacă o serie de simptome de la răceala obișnuită până la patologii mai severe ( 1 ). În ciuda disponibilității recente a vaccinurilor, SARS-CoV-2 se răspândește în continuare rapid ( 2), subliniind necesitatea unor tratamente alternative, în special pentru populațiile cu înclinație sau acces limitat la vaccinuri. Până în prezent, au fost identificate puține terapii care blochează replicarea SARS-CoV-2 și producția virală.SARS-CoV-2 este un virus învelit cu ARN simplu (+ssRNA) cu sens pozitiv, compus dintr-un strat dublu lipidic și patru proteine ​​structurale care conduc la formarea particulelor virale. Spicul (S), membrana (M) și învelișul (E) sunt proteine ​​​​integrale ale membranei virale și promovează înmugurirea virionului în timp ce, de asemenea, recrutează proteina nucleocapside (N) și ARN-ul genomic viral în virionii în curs de dezvoltare. La fel ca ruda sa apropiată SARS-CoV, SARS-CoV-2 intră în principal în celulele umane prin legarea proteinei virale S de receptorul enzimei de conversie a angiotensinei 2 (ACE2) ( 3 – 5 ).), după care proteina S suferă proteoliza de către protează serină transmembranară 2 (TMPRSS2) sau alte proteaze în două peptide legate necovalent (S1, S2) care facilitează intrarea virală în celula gazdă. N – terminalul S1 leagă receptorul ACE2, iar C – terminalul S2 mediază fuziunea membranei celulare virale în urma clivajului proteolitic. În funcție de tipul de celulă, intrarea virală poate apărea și după legarea ACE2, independent de clivajul proteolitic ( 6 – 8 ). După intrarea în celule, genomul SARS-CoV-2 este tradus în două polipeptide mari care sunt scindate de două proteaze virale, Mpro și PLpro ( 9 , 10 ), pentru a produce 15 proteine, pe lângă sinteza ARN-urilor subgenomice care codifică alte 10 proteine ​​accesorii plus cele 4 proteine ​​structurale. Aceste proteine ​​permit replicarea virală, asamblarea și înmugurirea. Într-un efort de a suprima infecția cu SARS-CoV-2 beta-coronavirus, precum și cu alte viruși patogeni în evoluție, am testat potențialul antiviral al unui număr de molecule mici care vizează căile de răspuns la stres ale gazdei.Un potențial regulator al stresului gazdei și al răspunsurilor inflamatorii antivirale este canabidiolul (CBD), un membru al clasei canabinoide de produse naturale ( 11 ) produse de Cannabis sativa (Cannabaceae; marijuana/cânepă). Cânepa se referă la plantele de canabis sau la materialele derivate din acestea care conțin 0,3% sau mai puțin tetrahidrocannabinol psihotrop (THC) și au de obicei un conținut relativ ridicat de CBD. Prin contrast, marijuana se referă la materialele C. sativa cu mai mult de 0,3% THC în greutate uscată. THC acționează prin legarea de receptorul canabinoid, iar CBD potențează această interacțiune ( 11). În ciuda numeroaselor studii și a multor afirmații nefondate legate de produsele care conțin CBD, acțiunile biologice ale CBD în sine sunt neclare și țintele specifice sunt în mare parte necunoscute ( 12 ). Cu toate acestea, o soluție orală de CBD este un medicament aprobat de FDA, în mare parte pentru tratamentul epilepsiei ( 13 ). Astfel, CBD are statut de medicament, este viabil ca și terapeutic și nu poate fi comercializat ca supliment alimentar în Statele Unite ( 12 ). Deși limitate, unele studii au raportat că anumiți canabinoizi au efecte antivirale împotriva virusului hepatitei C (VHC) și a altor virusuri ( 14 ).

REZULTATE

CBD de înaltă puritate inhibă replicarea SARS-CoV-2 în celulele epiteliale pulmonare umane

Pentru a testa efectul CBD asupra replicării SARS-CoV-2, am pretratat celulele de carcinom pulmonar uman A549 care exprimă receptorul ACE-2 uman exogen (A549-ACE2) timp de 2 ore cu 0-10 μM CBD înainte de infectarea cu SARS-CoV- 2. După 48 de ore, am monitorizat celulele pentru exprimarea proteinei spike virale (S) și titrul viral. CBD a inhibat puternic replicarea virală în condiții netoxice cu o EC50 de ~ 1 μM ( Fig. 1A; smochin. S1A). CBD a inhibat replicarea SARS-CoV-2 în plămânul uman Calu3 și celulele epiteliale ale rinichilor de maimuță Vero E6 (fig. S1B) și nu a fost observată nicio toxicitate la dozele eficiente (fig. S1C,D). În cele din urmă, am testat trei variante de îngrijorare SARS-CoV-2 (α, β și γ) în plus față de tulpina originală SARS-CoV-2, iar capacitatea lor de a infecta celulele a fost inhibată în mod comparabil de CBD ( Fig. 1C ).

FIG. 1 . Canabidiolul (CBD) este un inhibitor puternic al infecției cu SARS-CoV-2 in vitro . ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de CBD de la patru furnizori diferiți, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. ( B ) Spectrele 1H qNMR ale materialului de referință CBD și probelor CBD de la patru furnizori diferiți. ( C) Celulele A549-ACE2 au fost tratate cu CBD de la furnizorul A urmată de infecție cu SARS-CoV-2 sau variante α,β sau γ la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50.

Când este izolat din planta sa sursă, CBD natural nesintetic este de obicei extras împreună cu alți canabinoizi, reprezentând complexitatea reziduală inevitabilă a produselor naturale ( 12 ). Pentru a verifica dacă CBD este într-adevăr responsabil pentru inhibarea virală, am analizat un standard de referință CBD, precum și CBD din patru surse diferite pentru puritate, folosind 100% RMN cantitativ (qNMR). Aceste surse au inclus doi furnizori de produse chimice (Furnizorii A și B) și doi vânzători comerciali (Furnizorii C și D). Congruența izbitoare dintre 1H RMN experimental și HiFSA mecanic cuantic recent stabilit ( 1Profilurile H Iterative Full Spin Analysis) observate pentru toate materialele au confirmat că 1) compușii utilizați au fost într-adevăr CBD cu purități de cel puțin 97% ( Fig. 1B ) și 2) canabinoizii congeneri nu erau prezenți la niveluri mai mari de 1,0%. Analiza acestor probe diferite de CBD în testul de infecție virală A549-ACE2 a arătat EC50 similare cu un interval de la 0,6-1,8 μM, reflectând probabil variabilitatea intrinsecă a testului biologic ( Fig. 1A ). Nu a fost observată nicio toxicitate pentru niciunul dintre preparatele CBD la dozele utilizate pentru a inhiba infecția virală (fig. S1 EG).

Metabolitul CBD 7-OH-CBD, dar nu un grup de congeneri CBD strâns înrudiți, prezintă activitate antivirală

CBD este adesea consumat ca parte a unui extract de C. sativa , în special în combinație cu THC psihoactiv îmbogățit în plante de marijuana. Prin urmare, am stabilit dacă canabinoizii congeneri, în special analogii cu structuri și polarități strâns înrudite produse de planta de cânepă, sunt, de asemenea, capabili să inhibe infecția cu SARS-CoV-2. În mod remarcabil, din acest grup, numai CBD a fost un agent puternic, în timp ce nu a fost prezentată activitate antivirală sau foarte limitată de acești congeneri strâns înrudiți din punct de vedere structural care împărtășesc căi de biosinteză și formează complexitatea reziduală determinată biogenetic a CBD purificat din C. sativa : THC, canabidiolic. acid (CBDA), canabidirina (CBDV), canabicromen (CBC) sau canabigerol (CBG) ( Fig. 2 A ,D ; vezi Metode). Niciunul dintre acești canabinoizi nu a fost toxic pentru celulele A549-ACE2 în intervalul de doză de interes (fig. S2). În special, combinarea CBD cu THC (1:1) a suprimat semnificativ eficacitatea CBD în concordanță cu inhibarea competitivă a THC.

FIG. 2 . Inhibarea limitată sau deloc a infecției cu SARS-CoV-2 de către canabinoizi, alții decât CBD. ( A ) Celulele A549-ACE2 au fost tratate cu doze indicate de diverși canabinoizi sau un amestec CBD/THC 1:1 urmat de infecția cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Toți canabinoizii testați au fost izolați dintr-un extract de cânepă așa cum este descris în Metode. ( B ) Structurile chimice ale canabinoizilor și 7-OH CBD. ( C) Celulele A549-ACE2 au fost tratate cu doze indicate de 7-OH CBD, urmate de infectarea cu SARS-CoV-2 la un MOI de 0,5. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Datele reprezentative ale CBD din Figura 1C (furnizorul A) sunt utilizate pentru comparație. Sunt indicate valorile EC50.

CBD este metabolizat rapid în intestin și ficat în doi metaboliți principali, 7-carboxi-cannabidiol (7-COOH-CBD) și 7-hidroxi-cannabidiol (7-OH-CBD). Nivelul de 7-COOH-CBD este de 40 de ori mai mare, iar nivelul de 7-OH-CBD este de 38% din nivelul CBD din plasma umană ( 15 ). CBD și metabolitul său 7-OH-CBD sunt ingredientele active și echipotente pentru tratamentul epilepsiei ( 13 ). La fel ca CBD, 7-OH-CBD a inhibat eficient replicarea SARS-CoV-2 în celulele A549-ACE2 ( Fig. 2C ) și a fost netoxic pentru celule (fig. S2H, I). Analiza nivelurilor plasmatice din sânge la pacienții sănătoși care luau 1500 mg zilnic de soluție CBD aprobată de FDA (Epidiolex) a arătat o concentrație maximă (C max) la 7 zile pentru CBD și 7-OH-CBD de 1,7 μM și, respectiv, 0,56 μM; C max poate fi crescut în continuare de câteva ori prin administrarea concomitentă cu o masă bogată în grăsimi ( 15 ). Luate în ansamblu, aceste rezultate sugerează că concentrațiile plasmatice eficiente ale CBD și metabolitul său se află în intervalul terapeutic pentru a inhiba infecția cu SARS-CoV-2 la oameni.

CBD acționează într-un pas timpuriu după intrarea virală în celule

CBD ar putea acționa prin blocarea pătrunderii virale în celulele gazdă sau în etapele ulterioare după infecție. Deoarece s-a raportat că CBD scade expresia ACE2 în unele celule epiteliale, inclusiv A549 ( 16 ), am stabilit mai întâi dacă CBD a suprimat receptorul SARS-CoV-2 în celulele A549-ACE2, Calu-3 și Vero E6. Nu a fost observată nicio scădere a expresiei ACE2 ( Fig. 3A ; fig. S4A, B). Mai mult, analiza lentivirusurilor pseudotipizate fie cu proteina spike SARS-CoV-2, fie cu glicoproteina virusului stomatitei veziculoase (VSV) ( 17 ).) a arătat că 10 μM CBD a inhibat doar slab intrarea în celule de către virusul care exprimă vârful, sugerând că alte mecanisme sunt în mare măsură responsabile pentru efectele sale antivirale. Robustețea testului a fost confirmată prin utilizarea anticorpilor anti-spike care au blocat eficient infecția virală a lentivirusului pseudotipizat cu spike, dar nu VSVg ( Fig. 3B și fig. S3 A ​​și B). Spre deosebire de efectul neglijabil asupra intrării virale, CBD a fost foarte eficient (~95–99%) la inhibarea expresiei proteinei spike SARS-CoV-2 în celulele gazdă la 2 și 6 ore după infecție după intrare ( Fig. 3C ). Acest lucru a fost adevărat chiar și în prezența anticorpilor la proteina spike pentru a preveni reinfecția ( Fig. 3D) sugerând că CBD acționează la începutul ciclului de infecție, într-o etapă de după intrare. CBD a fost, de asemenea, parțial eficient (~60%) la inhibarea SARS-CoV-2 la 15 ore după infecție ( Fig. 3C ), sugerând un posibil efect secundar asupra adunării și eliberării virale. Pentru a evalua dacă CBD ar putea împiedica procesarea proteinelor virale de către proteazele virale Mpro sau PLpro, am testat activitatea acestora in vitro (fig. S4C, D). CBD nu a afectat activitatea niciunei proteaze, crescând posibilitatea ca CBD să țintească procesele celulei gazdă.

FIG. 3 . CBD inhibă replicarea virală după intrarea SARS-CoV-2 în celula gazdă. ( A ) Imunobloturi ale expresiei proteinei ACE2 din lizatele de celule A549-ACE2 fie netratate, fie tratate cu vehicul sau CBD la dozele indicate (n = 3). Petele au fost testate cu anticorpi împotriva ACE2 și tubulinei. Nivelurile de expresie a proteinei ACE2 au fost normalizate la semnalul tubulinei din fiecare probă. Nivelurile de expresie ACE2 au fost reprezentate grafic în raport cu probele netratate. ( B ) Celulele 293 T-ACE2 au fost infectate cu pseudovirusul spike sau VSV-G timp de 72 de ore cu dozele indicate de tratament cu CBD, iar procentul de celule infectate a fost reprezentat grafic. ( C) Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. S-a adăugat apoi DMSO sau 10 μM CBD la 2, 6 sau 15 ore după infectare. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. ( D) Panoul din stânga: celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la un MOI de 0,5 timp de 2 ore. DMSO sau 10 μM CBD a fost apoi adăugat la 2 ore după infectarea cu anticorpul de neutralizare a vârfurilor pentru a preveni reinfectarea. După 16 ore, celulele pozitive cu vârf au fost cuantificate și normalizate doar la mostrele infectate cu virus. Panoul din dreapta: Validarea eficacității anticorpilor neutralizanți. 400 pfu de virus SARS-CoV-2 au fost incubate cu sau fără 100 μM de anticorp neutralizant timp de 1 oră. Celulele A549-ACE2 au fost tratate cu amestecul timp de 16 ore și au fost cuantificate celulele Spike pozitive.

CBD inhibă expresia ARN viral și inversează modificările induse de virus în expresia genei gazdă

În conformitate cu această interpretare, analiza ARN-seq a celulelor A549-ACE2 infectate tratate cu CBD timp de 24 de ore arată o suprimare izbitoare a modificărilor induse de SARS-CoV-2 în expresia genelor. CBD a eradicat în mod eficient expresia ARN viral în celulele gazdă, inclusiv ARN-ul care codifică proteinele cu vârf, membrană, înveliș și nucleocapsid ( Figurile 4 A și B ). Atât SARS-CoV-2, cât și CBD au indus fiecare modificări semnificative în expresia genelor celulare (figurile S5 și S6). Analiza componentelor principale (PCA) a ARN-ului celulei gazdă arată inversarea aproape completă a modificărilor virale, dar, în loc să revină la o stare normală a celulei, celulele infectate cu virusul CBD + seamănă cu cele tratate numai cu CBD ( Fig. 4C).). Analiza grupării folosind Metascape dezvăluie câteva modele interesante și teme asociate ( Fig. 4D , figurile S7 și S8). De exemplu, inducerea virală a genelor asociate cu modificarea și transcripția cromatinei (Cluster 1) este inversată de CBD, deși CBD singur nu are niciun efect. În mod similar, inhibarea virală a genelor asociate cu ribozomi și neutrofile (Cluster 3) este în mare măsură inversată de CBD, dar medicamentul în sine nu are niciun efect. Acest lucru contrastează cu Clusterele 5 și 6 în care CBD singur induce activarea puternică a genelor asociate cu răspunsul la stres al gazdei. Împreună, aceste rezultate sugerează că CBD acționează pentru a preveni traducerea proteinelor virale și modificările celulare asociate.

FIG. 4 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBD la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Pentru fiecare genă sunt indicate modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBD (CBD_mock) și infectate cu SARS-CoV-2 plus tratate cu CBD (CBD_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

Pentru a obține o mai bună înțelegere a acțiunii antivirale specifice a CBD, am analizat ARNseq din lizate de celule neinfectate sau infectate cu SARS-CoV-2 tratate timp de 24 de ore cu omologul CBDV inactiv. Inducerea genelor virale pentru proteinele cu vârf, înveliș și nucleocapsid este redusă cu doar 60% cu CBDV, spre deosebire de ~99% cu CBD ( Fig. 5A,B ). Tratamentul CBDV provoacă mai puține modificări transcriptomice decât CBD în celulele A549-ACE2 și este în mare măsură ineficient în inversarea modificărilor transcripționale induse de SARS-CoV-2 ( Fig. 5C ). Analiza grupării folosind Metascape dezvăluie doar câteva grupuri care arată inversarea CBDV a modificărilor transcriptomice virale ( Fig. 5D). Acestea includ autofagia și metabolismul lipidic (Cluster 1) care sunt induse de CBDV, precum și traducerea proteinelor/ciclul celular/replicarea ADN-ului (Cluster 3) care sunt suprimate de CBDV.

FIG. 5 . Modificări ale transcripției virale și ale celulelor gazdă în urma infecției cu SARS-CoV-2 sau a tratamentului cu CBDV. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament CBDV la 10 μM timp de 24 de ore. ARN-seq a fost efectuat așa cum este descris în Metode. ( A ) Harta termică a nivelurilor relative ale genelor SARS-CoV-2 din probele de ARN-seq. ( B ) Nivelurile de expresie ale genelor de vârf și nucleocapside SARS-CoV-2. Modificările procentuale ale nivelului de expresie pentru genele din celulele infectate în comparație cu celulele infectate și tratate cu CBD sunt indicate pentru fiecare genă. ( C) Analiza componentelor principale (PCA) a datelor ARN-seq care arată probe de control (veh_mock), infectate cu SARS-CoV-2 (veh_infect), tratate cu CBDV (CBDV_mock) și infectate cu SARS-CoV-2 plus tratate cu CBDV (CBDV_infect). Prima și a doua componentă principală (PC1 și PC2) ale fiecărei probe sunt reprezentate grafic. ( D ) Hartă termică a nivelurilor de expresie normalizate ale celor 5.000 de gene cele mai variabile din toate probele de ARN-seq, grupate în 6 grupuri pe baza expresiei diferențiale între condițiile de tratament.

CBD induce răspunsul la stres ER și activitatea IRE1α ca un mecanism cheie pentru acțiunea sa antivirale

De interes deosebit sunt trei seturi de gene legate de răspunsul la stres reticulului endoplasmatic (ER), răspunsul proteic desfășurat (UPR) și inducerea interferonului care sunt reglate selectiv în sens pozitiv de CBD, dar nu de CBDV ( Fig. 6A ). Prin contrast, genele asociate cu răspunsul la stres oxidativ sunt induse de ambii canabinoizi. Celulele se confruntă cu stresul ER atunci când volumul de muncă al mașinilor de pliere a proteinei ER depășește capacitatea sa. Sub stresul ER, proteinele secretoare se acumulează în forme desfășurate în organele pentru a declanșa un set de căi de semnalizare intracelulare numite UPR, care face parte dintr-un răspuns la stres celular mai mare care menține proteostaza în întreaga celulă ( 18 ).). Calea UPR este controlată de trei proteine ​​transmembranare ER – IRE1α, PERK și ATF6 – care conțin un domeniu luminal ER capabil să detecteze direct sau indirect proteinele pliate greșit. Ca răspuns la stresul ER, fiecare dintre acești senzori pune în mișcare modificări transcripționale și translaționale care cresc capacitatea de pliere a proteinelor și încearcă să restabilească homeostazia. Cu toate acestea, dacă stresul asupra ER este iremediabil, UPR comută ieșirile și semnalează moartea celulei. Am validat inducerea CBD a expresiei genelor IRE1α, PERK și ATF6 prin qRT-PCR (fig. S9A), în concordanță cu rapoartele anterioare ( 19 ). Analiza ingeniozității a confirmat că CBD induce UPR semnificativ mai mult decât CBDV (fig. S9B, S10B, S11).

FIG. 6 . CBD promovează răspunsurile la stres ER ale celulei gazdă și splicing-ul IRE1α/XBP1, iar IRE1α contribuie la activitatea anti-virale CBD. Celulele A549-ACE2 au fost infectate cu SARS-CoV-2 la MOI de 3 cu sau fără tratament cu CBD sau CBDV la 10 μM (A,B) sau conform indicațiilor (C) timp de 24 de ore (A, B) sau conform indicațiilor (C). ). ( A ) Harta termică a activării căii prezise pe baza analizei Ingeniozității a scorurilor z de activare pentru fiecare cale și fiecare comparație. Roșu: calea este activată. Albastru: calea este inhibată. Alb: calea este neschimbată. Gri: nicio predicție din cauza lipsei de semnificație. ( B) Analiza îmbinării XBP1 de către RNază IRE1α. Au fost identificate și cuantificate citirile reprezentând XBP1 spliced ​​sau nespliced ​​pentru celulele care au fost tratate simulat, SARS-CoV-2 tratate sau tratate cu CBD sau CBDV fie singure, fie în prezența virusului (panoul din stânga). Au fost reprezentate grafice procentul de citiri îmbinate alternativ pentru probele de ARN-seq și au fost efectuate teste t nepereche comparând probele simulate ale fiecărui experiment cu alte probe (panoul din dreapta). ( C ) Celulele A549-ACE2 au fost tratate cu concentrațiile indicate de CBD timp de 3 și 6 ore. Relația dintre concentrația CBD și îmbinarea XBP1 a fost determinată prin qRT-PCR. ( D) Efectul IRE1α asupra răspunsului la doză pentru activitatea antivirală a CBD. Celulele A549-ACE2 sau A549-ACE2 lipsite de IRE1α (IRE1 KO) au fost tratate cu doze indicate de CBD, urmate de infectare cu SARS-CoV-2 la un MOI de 0,5 timp de 48 de ore. Celulele au fost colorate pentru proteina de vârf și procentul de celule care exprimă proteina de vârf în fiecare stare a fost reprezentat grafic. Sunt indicate valorile EC50. Testele t nepereche au fost efectuate la fiecare concentrație și au fost arătate valori p semnificative. Acesta este reprezentativ pentru trei experimente independente (Compozit EC50 1,7 v. 1,2, p < 0,05). ( E ) Schemă care ilustrează efectul CBD și SARS-CoV-2 asupra activității IRE1α RNază și îmbinării XBP1.

Numeroase studii raportează dovezi convingătoare că UPR este hiperactivat și necesar pentru replicarea altor membri ai familiei coronavirusului strâns înrudiți ( 20 , 21 ). În mod surprinzător, deși analiza de îmbogățire GSEA a datelor ARN-seq a arătat că calea IRE1α este puternic activată de CBD în prezența sau absența virusului, această cale nu a fost activată numai de SARS-CoV-2 ( Tabelul 1 ).; smochine. S12, S13, S14). PERK, prin contrast, a fost activat funcțional atât de SARS-CoV-2, cât și de CBD. IRE1α este o proteină transmembranară ER cu o singură trecere cu activități bifuncționale kinază/endoribonuclează (RNază). Ca răspuns la stresul ER, IRE1α suferă oligomerizare și autofosforilare, care își activează alosteric RNaza pentru a iniția îmbinarea productivă a ARNm XBP1. XBP1 îmbinat codifică un factor de transcripție care reglează în sus multe răspunsuri la stresul gazdei, inclusiv inducerea însoțitorului ER și componentele de degradare asociată ER (ERAD) ( 22 ) ( Fig. 6E ).

Comparaţiefiliala UPRGSEA NESARN-seq
schimbare de pliere
CBD vs mockPERK1.432.46
IRE11,382.29
ATF6ND*1.40
Virus vs batjocurăPERK1,921,85
IRE1Nu este îmbogățit2,67
ATF6ND*0,91
CBD + virus vs simulatPERK1.453.24
IRE11.442,76
ATF6ND*1.24

TABELUL 1 . Inducerea expresiei genelor PERK, IRE1 sau ATF6 și a funcției ca răspuns la virusul CBD și/sau SARS-CoV-2. Datele de expresie a genei ARN-seq sunt utilizate pentru GSEA pe trei termeni GO „UPR mediat de PERK”, „UPR mediat de IRE1” și „UPR mediat de ATF6” (numere Ontologie genică 36498, 36499, 36500). Scorul de îmbogățire normalizat este afișat în coloana „GSEA NES” (scor mai mare = mai multă îmbogățire). Schimbarea plierii pentru diferențele de expresie transcripțională între PERK, IRE1 și ATF6 este afișată pentru fiecare comparație în coloana „ARN-seq fold-change”. 

*ND = Nedeterminat din cauza lipsei de gene pentru a obține valori fiabile.CBD activează puternic activitatea IRE1α RNază așa cum se arată prin analiza splicing-ului XBP1 folosind atât datele ARNseq pentru a cuantifica XBP1 spliced, cât și confirmarea directă prin qRT-PCR ( Fig. 6B ; fig. S15). După cum sa prezis, CBD a indus îmbinarea XBP1 în prezența sau absența virusului, în timp ce CBDV nu a avut un efect semnificativ și este comparabil doar cu virusul. Curbele de timp și de răspuns la doză pentru inducerea CBD a splicing-ului XBP1 în absența virusului au fost în concordanță cu cursul în timp și răspunsurile la doză pentru inhibarea CBD a exprimării proteinei spike virale în celulele A549-ACE2 ( Fig. 6C).). În plus, în timp ce un knockout IRE1α nu a avut un efect semnificativ asupra infecției cu SARS-CoV-2, a schimbat răspunsul la doză și a redus semnificativ efectele antivirale ale CBD, ducând la o creștere de aproximativ 2 ori a EC50 împotriva SARS-CoV- 2 ( fig. 6D ; fig. S16). Împreună, aceste rezultate indică faptul că inducerea CBD a IRE1α este o componentă critică a acțiunii sale antivirale împotriva SARS-CoV-2.

CBD induce expresia interferonului ca parte a activității sale antivirale

Un alt mecanism prin care CBD ar putea suprima infecția virală și poate promova degradarea ARN viral este prin inducerea căii de semnalizare a interferonului. Interferonii sunt printre cele mai timpurii răspunsuri imune înnăscute ale gazdei la expunerea la patogen ( 23 ). După cum sa raportat ( 24 ), infecția cu SARS-CoV-2 suprimă calea de semnalizare a interferonului ( fig. 7A și fig. S17). Multe gene din cale, cum ar fi ISG15, IFIT1, IFIT3, SOCS1 și OAS1, o genă indusă de interferon care duce la activarea RNazelor L și a degradării ARN ( 25 ), au fost moderat up-reglate numai de CBD, dar puternic induse de CBD în prezența virusului ( Fig. 7Asi smochine. S18,19). Aceste din urmă rezultate sunt în concordanță cu posibilitatea ca CBD să reducă titrul viral efectiv suficient pentru a permite activarea normală a căii interferonului a gazdei. În același timp, CBD a inversat eficient inducerea virală a citokinelor care poate duce la furtuna mortală de citokine în stadiile ulterioare ale infecției ( Fig. 7B ). Prin contrast, omologul inactiv CBDV nu induce în mod semnificativ gene în cadrul căii interferonului și nici nu previne inducerea citokinelor ( Fig. 6A , 7A , 7C , figurile S20A, B și S21).

FIG. 7 . CBD promovează răspunsurile la interferonul celulei gazdă și inhibă inducerea virală a citokinelor. ( A ) Harta termică a schimbării de pliere (log2) a genelor din calea canonică de răspuns la interferon pentru toate probele tratate cu virus sau CBD în comparație cu probele tratate simulat. Coloanele 1-3 folosesc mostre din experimentul ARN-seq pe CBD și SARS-CoV-2. Coloanele 4-6 folosesc mostre din experimentul ARN-seq pe CBDV și SARS-COV-2. ( B ) Hartă termică a nivelurilor de expresie normalizate ale genelor GO Cytokine Activity care au fost reglate în sus de infecția virală, dar au fost reglate în jos prin tratamentul CBD pentru toate probele de ARN-seq din experimentul pe CBD și SARS-CoV-2. ( C) Hartă termică a nivelurilor de expresie normalizate ale acelorași gene pentru toate probele de ARN-seq din experimentul pe CBDV și SARS-CoV-2. ( D ) Celulele A549-ACE2 au fost tratate cu 2,5 μM de vehicul sau CBD cu sau fără anticorp uman IFN-γ și amestec uman de neutralizare a IFN de tip I cu 2 ore înainte de infectare. Celulele au fost apoi infectate cu 0,5 MOI SARS-CoV-2 și incubate timp de 24 de ore, iar virusul activ a fost măsurat utilizând un test pe placă. Rezultatele sunt reprezentative pentru trei experimente independente.

Pentru a testa direct posibilitatea ca interferonii să țină cont parțial de activitatea antivirală a CBD, am expus celulele ACE2-A549 la un amestec de anticorpi împotriva interferonilor de tip I (α,β,ο) și de tip II (γ) înainte de Tratament cu CBD de 2,5 μM și infecție virală. Rezultatele arată că anticorpii anti-interferon reduc efectele anti-virale ale CBD și salvează parțial infecția cu SARS-CoV-2 ( Fig. 7D ). Colectiv, aceste rezultate sugerează că CBD inhibă infecția cu SARS-CoV-2 parțial prin activarea IRE1α și a căilor interferonului, ceea ce duce la degradarea ARN viral și la modificări ulterioare induse de virus în expresia genei gazdă, inclusiv citokinele.

Tratamentul cu CBD inhibă semnificativ replicarea SARS-CoV-2 la șoareci

Deoarece mai mulți agenți, inclusiv medicamente amfipatice cationice, blochează replicarea SARS-CoV-2 în celulele cultivate, dar nu in vivo ( 26) , am determinat dacă CBD reduce titrul viral la șoarecii femele K18-hACE2 ( 27 ). Șoarecii au fost injectați intraperitoneal de două ori pe zi cu CBD (20 sau 80 mg/kg) timp de 7 zile înainte de provocarea intranazală cu SARS-CoV-2 (2×104 PFU ). După provocare, administrarea CBD a continuat de două ori pe zi timp de încă 4 zile ( Fig. 8A ). Tratamentul cu CBD a inhibat semnificativ replicarea virală în plămâni și cornetele nazale în ziua 5 după infecție într-o manieră dependentă de doză ( Figurile 8B-C). Doza mai mică de CBD a redus încărcătura virală de 4,8 ori în plămâni și de 3,7 ori în cortinele nazale, în timp ce doza mai mare a scăzut titrurile virale de 40 și, respectiv, de 4,8 ori în plămâni și, respectiv, în cortinele nazale. În această perioadă, șoarecii nu au prezentat semne de boală clinică, iar greutățile lor corporale nu au fost modificate semnificativ ( Fig. 8D ). Aceste rezultate stabilesc eficacitatea preclinica a CBD ca medicament antiviral pentru SARS-CoV-2 în stadiile incipiente ale infecției.

FIG. 8 . CBD inhibă replicarea SARS-CoV-2 la șoareci. ( A ) Cronologia experimentului cu șoarece. ( B ) Titrul viral în plămâni de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( C ) Titrul viral în cornetele nazale de la toate animalele măsurat la 5 zile după provocarea virală (ziua 12). ( D ) Măsurătorile de greutate ale șoarecilor din fiecare grup de tratament (n = 10) în timpul studiului. Greutatea corporală a fiecărui șoarece este normalizată la greutatea sa măsurată în ziua 0. Toate animalele au fost provocate cu SARS-CoV-2 prin instilare intranazală în ziua 7.

Utilizarea CBD este asociată negativ cu indicațiile de infecție cu SARS-CoV-2 la pacienți

Având în vedere că preparatele CBD de înaltă puritate sunt luate de un număr mare de persoane, am examinat dacă înregistrările de medicamente ale prescripțiilor sau utilizării CBD sunt asociate cu indicații ale infecției cu SARS-CoV-2 (adică, teste COVID-19 pozitive și/sau COVID-19). diagnostice proximale testelor COVID-19). O soluție orală de CBD 100 mg/mL (CBD100) este adesea utilizată pentru tratamentul convulsiilor (vezi suplimentul de analiză a pacientului). Analiza a 1.212 de pacienți din National COVID Cohort Collaborative (N3C) ( 28) cu un istoric de afecțiuni legate de convulsii și un dosar de medicație CBD100 a evidențiat 6,2% (75 de pacienți) cu o indicație de infecție cu SARS-CoV-2 proximă la datele primului lor test COVID-19 în datele lor N3C. Aceasta a fost o rată semnificativ mai mică decât ratele grupurilor de control potrivite de pacienți care nu au avut nicio înregistrare CBD100 (de exemplu, 6,2% pentru pacienții cu CBD100, comparativ cu 8,9% pentru pacienții non-CBD100, p = 0,014; raportul cotelor modelului logit multivariabil ( OR) de 0,65, p = 0,009, 95% CI [0,47, 0,90]). Datele demografice și istoricul medicației pacienților cu CBD100 au fost similare cu cele ale grupului de control potrivit. Istoricul stării medicale pentru acești pacienți a inclus afecțiuni legate de convulsii, lista CDC a afecțiunilor cu risc ( 29) și alți factori potențiali de confuzie, cum ar fi condițiile de mobilitate redusă, durerea cronică sau dizabilitățile de dezvoltare care pot limita interacțiunea publică și expunerea la COVID-19. Asocierea negativă a fost și mai semnificativă în analizele unui subgrup de 531 de pacienți cu CBD100 care probabil luau CBD100 la datele primelor lor teste COVID-19 (de exemplu, 4,9% dintre acești pacienți CBD100, comparativ cu 9,0% dintre 531 de martori potriviți, p. = 0,011; OR = 0,48, p = 0,006, 95% CI [0,29, 0,81]) ( Fig. 9 ; Tabelul S4 din Suplimentul de analiză a pacientului care descrie metodele și constatările de analiză a datelor pacientului în detaliu).

FIG. 9 . Înregistrările de medicamente CBD 100 mg/mL la pacienți sunt asociate în mod semnificativ cu o mai puțină pozitivitate pentru COVID-19. Schemă care arată derivarea eșantionului nostru principal de analiză și a grupurilor de pacienți cu canabidiol (CBD) obținute din National COVID Cohort Collaborative (N3C). Sunt ilustrate analize succesive ale subgrupurilor de pacienți. Panoul final arată asocieri între a avea o înregistrare a medicamentelor CBD de 100 mg/mL la data primului test COVID-19 și starea pozitivă pentru COVID-19 în rândul grupurilor de control potrivite de mărime în creștere (adică, 1-la-1, 2-la). -1 și 3 la 1 dintre controale față de pacienții cu CBD). O covariabilă nepotrivită are o diferență medie standardizată mai mare de 0,10 și o valoare p a testului exact Fisher pe două fețe mai mică de 0,05 atunci când se compară distribuția sa între pacienții cu CBD și martorii lor potriviți. AUC se referă la aria sub curba caracteristică de funcționare a receptorului.Informații detaliate cu privire la metodele și constatările de analiză a datelor pacientului se găsesc în Suplimentul de analiză a pacientului.

DISCUŢIE

Rezultatele noastre sugerează că CBD și metabolitul său 7-OH-CBD pot bloca infecția cu SARS-CoV-2 în stadiile incipiente și chiar ulterioare ale infecției. Mecanismul pare să fie mediat parțial de activarea căilor IRE1α RNază și interferon. În plus față de aceste descoperiri bazate pe celule, studiile preclinice arată că tratamentul cu CBD a redus titrurile virale în plămânii și turbinatele nazale ale șoarecilor infectați cu SARS-CoV-2. În cele din urmă, analiza unui eșantion național de pacienți cu înregistrări active de consum de 100 mg/ml CBD la momentul testării COVID a dezvăluit o asociere cu mult mai puține rezultate pozitive ale testelor SARS-CoV-2. Această asociere negativă a fost solidă pentru multe analize de sensibilitate, inclusiv modificări ale modelelor de potrivire și rezultate și merită cercetări suplimentare asupra potențialului CBD de a combate infecția cu SARS-CoV-2,cum ar fi validarea în alte seturi de date mari, cu mai multe site-uri, pentru dosarele de sănătate electronice sau proiecte experimentale prospective.Un mecanism care contribuie la activitatea antivirală a CBD este inducerea căii interferonului, atât direct, cât și indirect, după activarea răspunsului imun al gazdei la agentul patogen viral. De fapt, interferonii au fost testați clinic ca potențiale tratamente pentru COVID-19 ( 30 ). Când este hiperactivată de stres sever al ER, activitatea RNazei IRE1α duce la dezintegrarea endonucleolitică a multor ARNm localizați în ER (RIDD) și la activarea ulterioară a RIG-I și interferonilor ( 18 ).). Deși SARS-CoV-2 induce activitatea kinazei IRE1α, nu își activează activitatea RNază monitorizată prin splicing XBP1. Astfel, activitatea RNază a IRE1α indusă de CBD poate explica atât degradarea ARN viral, cât și inducerea interferonilor de către fragmentele de ARN. Vor fi necesare investigații suplimentare pentru a determina dacă ambele efecte antivirale ale CBD sunt legate de răspunsul la stres ER. Important, CBD suprimă, de asemenea, activarea citokinelor ca răspuns la infecția virală, reducând probabilitatea recrutării celulelor imune și a furtunilor ulterioare de citokine în plămâni și în alte țesuturi afectate. Aceste rezultate completează descoperirile anterioare care sugerează că CBD suprimă producția de citokine în celulele imune recrutate, cum ar fi macrofagele ( 31 ).). Astfel, CBD are potențialul nu numai de a acționa ca agent antiviral în stadiile incipiente ale infecției, ci și de a proteja gazda împotriva unui sistem imunitar hiperactiv în stadiile ulterioare.CBD are o serie de avantaje ca potențial agent preventiv împotriva SARS-CoV-2. CBD ca aditiv alimentar cu un conținut de THC mai mic de 0,3% este disponibil pe scară largă fără acces restricționat. Cu o formulare adecvată, control al calității și livrare, CBD ar putea fi utilizat profilactic, spre deosebire de medicamentele antivirale recente. Sunt posibile mai multe mijloace de ingerare a CBD, inclusiv potențialul de inhalare și livrare nazală. CBD blochează replicarea virală după intrarea în celule și, prin urmare, este probabil să fie eficient împotriva variantelor virale cu proteine ​​​​pic mutante. Spre deosebire de medicamente precum remdesivir sau anticorpii antivirali, administrarea CBD nu necesită injectare în spitale. În cele din urmă, CBD este asociat doar cu efecte secundare minore ( 32 ).Cu toate acestea, mai multe probleme necesită o examinare atentă înainte ca CBD să poată fi luat în considerare în continuare sau chiar explorat ca o pistă terapeutică pentru COVID-19 ( 12mai ales în lumina descoperirilor noastre care sugerează că alți canabinoizi, cum ar fi THC, ar putea acționa pentru a contracara eficacitatea antivirale CBD. Acest lucru elimină în esență fezabilitatea ca marijuana să servească drept sursă eficientă de CBD antiviral, în plus față de problemele legate de statutul său legal. În cele din urmă, alte mijloace de administrare a CBD, cum ar fi vapoarea și fumatul, ridică preocupări suplimentare cu privire la potențialele leziuni pulmonare.Vor fi necesare studii viitoare pentru a explora mijloacele optime de livrare a CBD către pacienți, împreună cu studii clinice, pentru a evalua în continuare promisiunea CBD ca medicament terapeutic pentru blocarea infecției cu SARS-CoV-2. Studiile noastre pe animale oferă suport preclinic pentru evaluarea CBD ca agent terapeutic anti-SARS-CoV-2 în studiile clinice. Susținem studii clinice controlate cu placebo concepute cu atenție, cu concentrații cunoscute și formulări foarte caracterizate, pentru a defini rolul CBD în prevenirea și tratarea infecției precoce cu SARS-CoV-2. Omul necesar in vivoconcentrația și calea optimă și formularea rămân de definit. Avertizăm cu tărie împotriva tentației de a lua CBD în formulările disponibile în prezent, inclusiv comestibile, inhalante sau topice ca terapie preventivă sau de tratament în acest moment, mai ales fără cunoștințele unui studiu clinic riguros randomizat cu acest produs natural ( 33 ).

MATERIALE SI METODE

Design de studiu

Am demonstrat utilizând celule knockout IRE1α și anticorpi anti-interferon care blochează că atât IRE1, cât și interferonii contribuie la activitatea anti-virală a CBD. În cele din urmă, utilizând înregistrările medicale pentru grupuri de pacienți umani din National COVID Cohort Collaborative în cadrul protocoalelor IRB adecvate, am analizat asocierea pacienților care iau CBD cu riscul lor de a fi testat pozitiv pentru SARS-CoV-2. Statisticile sunt furnizate în cifrele corespunzătoare și în metode.

Materiale, celule și viruși

CBD de înaltă puritate a fost achiziționat de la două companii chimice sau de la două surse comerciale online. 7-OH-CBD a fost achiziționat de la Cerilliant Corporation (Round Rock, TX). Toți compușii comerciali utilizați au fost validați prin RMN așa cum este descris mai jos. Uleiul de cânepă infuzat cu canabinoizi care conține peste 1.500 mg de canabinoizi a fost de la Bluebird Botanicals (Louisville, CO, SUA). Extractul de cânepă din biomasa C. sativa a fost de la Hopsteiner Ltd. (Yakima, Washington, SUA). Uleiul de cânepă cu conținut scăzut de CBD a fost obținut dintr-o sursă comercială online. Celulele A549-ACE2 au fost furnizate cu generozitate de tenOever și colegii ( 24). Celulele Vero E6 și celulele Calu3 au fost achiziționate de la ATCC. SARS-CoV-2 (nCoV/Washington/1/2020) a fost furnizat de Natalia Thornburg (Centre pentru Controlul Bolilor) prin Centrul Mondial de Referință pentru Viruși și Arbovirusuri Emergente (Galveston, Texas) și de la BEI Resources for the in vivostudii. Variantele SARS-CoV-2 au fost furnizate de resursele BEI. Varianta α este numărul BEI NR-54000, izolat hCoV-19/England/204820464/2020 provenit de la Public Health England. Varianta β este numărul BEI 54009, B.1.351(20H/501Y.V2) provenită de la Institutul de Cercetare în Sănătate din Africa. Varianta γ este numărul BEI 54982, izolat hCoV-19/Japan/TY7–503/2021 provenit de la Institutul Național de Boli Infecțioase din Japonia. Stocurile virale au fost realizate prin două treceri în celulele Vero E6 și titrurile stoc au fost determinate prin limitarea titrului plăcii de diluție pe celulele VeroE6 (descris mai jos).

Test de infecție cu SARS-CoV-2

Toate infecțiile cu SARS-CoV-2 au fost efectuate în condiții de nivel 3 de biosecuritate la Laboratorul Regional de Bioconteniment Howard T. Rickett, Universitatea din Chicago. In vivoinfecțiile au fost efectuate în condiții ABSL-3 la Centrul de Medicină Predictive pentru Bioapărare și Boli Infecțioase Emergente, Laboratorul Regional de Biocontainment al Universității din Louisville. Celulele din DMEM + 2% FBS au fost tratate cu CBD sau alți inhibitori sau 2 ore cu diluții de 2 ori începând cu 10 μM în triplicat pentru fiecare test. Celulele A549-ACE2 au fost infectate cu un MOI (multiplicitatea infecției) de 0,5 în medii care conțineau concentrația adecvată de medicamente. Celulele Vero E6 au fost infectate cu un MOI de 0,1 în medii care conțineau concentrația adecvată de medicamente. După 48 de ore, celulele au fost fixate cu formol 3,7%, blocate și testate cu anticorp anti-Spike de șoarece (GTX632604, GeneTex) diluat 1:1.000 timp de 4 ore, clătite și testate cu HRP anti-șoarece timp de 1 oră, spălat, apoi dezvoltat cu substrat DAB 10 minute. 40) au fost cuantificate prin microscopie cu lumină ca probe orbite. Titrurile virale au fost determinate prin analiza pe placă. Pe scurt, un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns. un monostrat de celule E6 este infectat cu o serie de diluții în serie de probă de virus timp de 1 oră la 37°C. Inoculul viral este apoi îndepărtat și înlocuit cu un mediu de suprapunere MEM care conține 1,25% carboximetil celuloză. Celulele sunt incubate timp de 72 de ore, după care mediul de suprapunere este îndepărtat și celulele sunt fixate cu formol 10% și colorate cu soluție de violet cristal 0,25%. Plăcile sunt numărate în godeul de diluție cu între 10-100 de plăci și se calculează concentrația originală a probei virale. Datele au fost analizate și reprezentate grafic folosind GraphPad Prism și valorile EC50 au fost extrase din potrivirea neliniară a curbelor de răspuns.

Test de toxicitate Crystal Violet

Celulele au fost tratate cu concentrații diferite de compuși diferiți în 2% DMEM, începând cu 10 μM și coborând cu 1/2 pentru încă șase diluții. Celulele au fost incubate cu medicamentul timp de 48 de ore. Celulele au fost fixate cu soluție de formol 10% timp de 30 de minute. Apoi au fost colorați cu soluție Crystal Violet 1% timp de 30 de minute, după care plăcile au fost uscate și cantitatea de colorare Crystal Violet a fost evaluată prin măsurarea absorbanței la 595 nm pe un cititor de plăci TECAN M200. Citirile de absorbție au fost normalizate la cele ale godeurilor de control netratate cu medicament pentru a măsura diferențele de creștere a celulelor cu sau fără tratamentul medicamentos.

Test de neutralizare a proteinelor și a anticorpilor în vârf

Celulele A549-ACE2 au fost tratate cu 10 μM de CBD fie cu 2 ore înainte de infectare, fie cu 2, 6 sau 15 ore după infecție. Celulele au fost infectate cu MOI de 0,5 timp de 2 ore. Apoi, mediul de infecție a fost înlocuit cu mediu care conține CBD sau DMSO și probele au fost incubate la 37°C timp de 16 ore. Într-un experiment când CBD a fost adăugat la 2 ore după infecție, mediul de infecție a fost înlocuit cu CBD sau DMSO și μM de anticorp neutralizant (Active Motif 001414). După 16 ore, probele au fost fixate cu formol 10% și au fost supuse IHC pentru proteina spike. Eficiența anticorpului de neutralizare a fost testată prin incubarea a 400 pfu de virus cu sau fără 100 μM de anticorp la 37°C timp de 1 oră. Apoi celulele A549-ACE2 au fost infectate cu amestecul timp de 16 ore. Celulele Spike pozitive au fost cuantificate așa cum este descris mai sus.

Test de neutralizare a anticorpilor interferonului

Celulele A549-ACE2 au fost tratate cu 2,5 μM de CBD, 1 μg/ml anticorp IFN-γ uman (MAB285–100) și diluție 1:25 de amestec de Ab neutralizant IFN uman de tip I (PBL Assay Science 39000–1) cu 2 ore înainte infecţie. Celulele au fost apoi infectate cu 0,5 MOI și incubate timp de 24 de ore, după care supernatanții au fost colectați și virusul activ măsurat folosind testul pe placă descris mai sus.

Generarea de celule knockout IRE1α de către CRISPR-Cas9

Stocurile de lentivirus au fost prin utilizarea lentiCRISPR v2 (Addgene) cu ARN ghid unic (sgRNA) care vizează secvența IRE1 (CGGTCACTCACCCCGAGGCC). Celulele A549-ACE2 infectate au fost selectate policlonal și menținute folosind mediu suplimentat cu 4 μg/mL puromicină timp de 1 săptămână.

Descrierea canabinoizilor

CBD poate fi obținut prin izolarea acidului canabidiolic (CBDA) din materialul vegetal de Cannabis sativa și apoi inducerea decarboxilării chimice sau prin decarboxilarea canabinoizilor conținuti în materia primă de plante sau extract și izolarea ulterioară a CBD. Cannabidivarina (CBDV) este un omolog CBD natural care are un n -propil în locul lanțului lateral n – pentil al CBD . Cannabigerol (CBG), sub formă de acid cannabigerolic, este precursorul metabolic atât al acidului tetrahidrocannabidiolic, cât și al CBDA în C. sativa. Tetrahidrocannabinolul (THC) este un congener ciclizat al CBD care se obține după decarboxilarea acidului tetrahidrocannabinolic. THC este prezent în C. sativa atât în stereoizomerii Δ 9 – cis cât și Δ 9 – trans . Canabicromenul (CBC), sub formă de acid canabicromenic, reprezintă un al treilea metabolit posibil al acidului canbigerolic cu un inel de cromen în restul de geranil.

Achiziția, izolarea și caracterizarea canabinoizilor

În studiul de față, purificarea CBD din surse naturale a folosit (a) ulei de cânepă infuzat cu canabinoizi, care conține 1.500+ mg de canabinoizi în trigliceride cu lanț mediu pe uncie fluide, fabricat de Bluebird Botanicals (Louisville, CO, SUA) și (b) cânepă extract preparat prin extracție cu fluid supercritic (SFE) cu CO 2 din C. sativabiomasă care se califică drept cânepă, fabricată de Hopsteiner Ltd. (Yakima, Washington, SUA) cu un conținut total de 54,7% CBD, calculat ca CBD + CBDa*0,877. Puritățile tipice ale acestor preparate CBD sunt în intervalul 90-97%, inclusiv impuritățile străine (de exemplu, solvent rezidual) determinate de qHNMR. Detaliile metodologiilor de purificare și analiză a structurii sunt detaliate într-o publicație concomitentă, care este în prezent în presă (Journal of Natural Products). Pe scurt, metodologiile pot fi rezumate după cum urmează:

Procedura de purificare

CBD, CBC, CBG, Δ 9 – trans -THC, Δ 9 – cis -THC și CBDV au fost izolate din uleiul de cânepă, iar CBDA din extractul brut de cânepă SFE, utilizând cromatografia de partiție centrifugală (CPC), o tehnică de separare în contracurent. , și un sistem bifazic lichid-lichid.

Metodologia de elucidare a structurii

Identitățile CBD din sursă comercială și ale altor eșantioane de canabinoizi au fost verificate prin analiză 1D 1H RMN , efectuată ca măsurare qNMR, prin comparație cu un profil HiFSA autentic al CBD așa cum a fost publicat ( 12 ). Pe lângă o potrivire excelentă generală a profilurilor, semnalul de amprentă puternic cuplat al axului H-4” a servit ca un marker de identitate foarte specific. Structurile canabinoizilor care au fost obținute comercial sau purificate din surse naturale au fost stabilite printr-o combinație de analiză 1D/2D RMN și LC-HRMS, ținând cont de datele de referință din literatură.

Prepararea probelor RMN

Pentru probele comerciale furnizate ca soluție, solventul a fost îndepărtat cu grijă în vid și 450 μL de metanol deuterat (MeOH- 4) adăugat la reziduu folosind o seringă de precizie. Soluția a fost transferată într-un tub RMN de 5 mm cu o pipetă de sticlă, flaconul a fost clătit de trei ori cu 25 μL de solvent și soluția de clătire a fost transferată în același tub RMN, pentru un volum final de 525 μL. Probele comerciale și izolate disponibile ca solide au fost cântărite direct într-un tub RMN de 5 mm și au fost adăugate 500 μL de solvent cu o seringă de precizie. Pentru analiza preparatului comercial de ulei de cânepă, s-au adăugat direct 10 picături (0,25 ml echivalent cu 14-15 picături) într-un tub RMN de 5 mm. Greutatea netă a uleiului de cânepă în tubul RMN a fost de 198,50 mg, determinată pe o balanță de precizie de 0,01 mg și s-au adăugat 0,90 mg de acid dinitrobenzoic ca calibrant intern pentru IC-qHNMR; 325 μL de CDCl 3 și 10 μL de CD 3S-au adăugat OD, iar tubul a fost sigilat la flacără.

Achiziția și prelucrarea datelor RMN și evaluarea qNMR

Toate datele 1H RMN au fost achiziționate pe un Bruker 600 Avance III cu o sondă criogenică directă 13C cu două canale . Domeniul de timp (TD) a fost setat la 64 k, întârzierea de relaxare (D1) a fost de 60 de secunde, au fost utilizate impulsuri de excitație de 90 de grade pentru un total de 32 de scanări mediate de semnal. Câștigul receptorului (RG) a fost de 32 pentru toate probele, cu excepția unei probe cu masă limitată < 1 mg (RG = 101) și a probei de ulei de cânepă în cantitate mare (RG = 2; puls de excitație de 15 grade utilizat). Determinarea purității probei și a conținutului de CBD în uleiul de cânepă prin RMN cantitativ (qNMR) folosind abordarea 100% qNMR și foi de lucru publicate în mod deschis ( https://gfp.people.uic.edu/qnmr/content/qnmrcalculations/100p.html). Puritatea qNMR a tuturor probelor de CBD a fost > 97%, inclusiv impuritățile străine, și nu au putut fi detectați congeneri canabinoizi la niveluri de peste 1,0%. Folosind metoda absolută qHNMR cu calibrare internă (IC abs-qNMR), conținutul de CBD din uleiul de cânepă a fost determinat ca 0,30%.

Producția de lentivirus pseudotipizat

Celulele 293 T și 293 T-ACE2 au fost cultivate în DMEM (Corning 10017CV) cu piruvat de sodiu 1X (Gibco 11360070) și 10% FBS (HyClone SH30910). Particulele de lentivirus pseudotipizate cu proteina spike SARS-CoV-2 (Wuhan-Hu-1) sau VSV-G au fost generate așa cum este descris ( 19). Pe scurt, 293 de celule T au fost transfectate folosind TransIT-LT1 (Mirus) cu vectori de ambalare lentivirus de a treia generație (HDM-Hgpm2, HDM-tat1b, pRC-CMV-Rev1b), vector de transfer (pHAGE-CMV-ZsGreen-W) și fie SARS – Spike CoV-2 (HDM-IDTSpike-fixK) sau VSV-G (HDH-VSVG). Supernatanții colectați la 36 și 60 de ore după transfecție au fost reuniți, seringa filtrată și congelată în alicote de unică folosință la -80°C. Toate plasmidele utilizate pentru producerea de lentivirus au fost oferite cu amabilitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de legare a pseudovirusului

293 de celule T-ACE2 au fost însămânțate la 1,2 × 104 celule per 96 de godeuri în perete negru, plăci de fund clare. A doua zi, au fost preparate diluții de două ori de stoc CBD (10 mM) în DMSO, urmate de diluții 1:1000 fie în DMEM complet, fie în preparat pseudovirus. Pseudovirusul SARS-CoV-2 a fost utilizat nediluat, în timp ce pseudovirusul VSV-G a fost diluat 1:1.500 în DMEM complet. Celulele și pseudovirusul au fost pre-tratate cu diluții de CBD timp de 2 ore și, respectiv, 1 oră la 37°C. Celulele au fost infectate cu pseudovirus timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu un marker nuclear (Hoechst 33342, ThermoFisher H3570) și fotografiate. 293 de celule T-ACE2 au fost furnizate cu generozitate de Dr. Jesse Bloom (Universitatea din Washington, Seattle).

Test de neutralizare a pseudovirusului

Celulele 293 T sau 293 T-ACE2 au fost însămânțate la 1,2 × 104 celule pe 96 de godeuri în perete negru, plăci de fund clar. A doua zi, anticorpul de neutralizare a vârfului SARS-CoV-2 (Sino Biological 40592-R001) a fost diluat în DMEM complet la o concentrație finală inițială de 300 ng per 100 ul per 96 de godeuri, urmată de diluții ulterioare de 3 ori. Anticorpul de neutralizare a fost incubat cu pseudovirus timp de 1 oră. la 37°C. Celulele au fost infectate cu pseudovirus +/- anticorp neutralizant timp de 72 de ore, fixate cu paraformaldehidă 4%, colorate cu marker nuclear Hoechst 33342 și fotografiate.

Test de inhibiție a proteazei

Testele au fost efectuate în duplicat, la temperatura camerei, în plăci negre cu 96 de godeuri la 25°C. Reacțiile care conțineau concentrații diferite de inhibitor (10 sau 50 μM) și enzima 3CLpro (0,4 μM) sau enzima PLpro (0,3 μM) în Tris-HCl pH 7,3, 1 mm EDTA au fost incubate timp de aproximativ cinci minute. Reacțiile 3CLpro au fost apoi inițiate cu substratul sondei TVLQ-AMC (40 μM), iar reacțiile PLpro au fost inițiate cu substratul sondei LKGG-AMC (40 μM). Placa de reacție a fost agitată liniar timp de 5 s și apoi măsurată pentru intensitatea emisiei de fluorescență (excitație λ: 364 nm; emisie λ: 440 nm) în timp (1 min-3 h) pe un Synergy Neo2 Hybrid). Fiecare test a conținut 2-3 godeuri de control pozitiv (DMSO) și 2 godeuri de control negativ (componentele testului fără protează). Datele au fost normalizate la godeurile de control pozitiv la 3 ore,căruia i s-a atribuit o valoare arbitrară de 100.

Imunoblotting

Celulele A549-ACE2 au fost tratate cu CBD, vehicul (DMSO) sau nu au fost tratate timp de 24 de ore. Celulele au fost mai întâi spălate cu PBS rece cu gheață. Extracția celulelor întregi a fost preparată prin lizarea directă a celulelor cu tampon de probă Laemmli (Bio-rad 1610747) suplimentat cu inhibitor de protează (Roche 4693159001), PMSF (Roche 10837091001) și inhibitor de fosfatază (GB-450) la 44°C. Probele de proteine ​​au fost în cele din urmă fierte la 98°C timp de 5 minute. Western blot a fost efectuat folosind anticorpi pentru ACE2 (Abcam 108252) și α-tubulină (Invitrogen MA1–19401) pentru control. Pentru validările knockout-ului IRE1α în A549-ACE2, au fost utilizate celule, anticorpi pentru IRE1α (Cell Signaling, 3294S) și GAPDH (Cell Signaling, 5174S). Petele au fost fotografiate și cuantificate folosind Licor Odyssey Fc.

secvențierea ARN

Celulele A549 alveolare pulmonare au fost supraexprimate stabil cu proteina enzimei de conversie a angiotensinei umane 2 (ACE2) și au fost însămânțate la 10.000 de celule per godeu într-o placă cu 96 de godeuri. Canabidiolul sau vehiculul au fost adăugate împreună la celule. Canabidiolul (Cayman Chemical, 90080) a fost dizolvat într-o soluție stoc 10 mM cu DMSO (Sigma-Aldrich, D2650-100 mL). Concentrația finală de CBD a fost de 10 μM. Stocul de virus a fost apoi îndepărtat și înlocuit cu mediu proaspăt 2% FBS DMEM cu medicament. Celulele au fost incubate încă 24 de ore înainte de extracția totală a ARN-ului cu trusa NucleoSpin 96 ARN (Takarabio, 740709). Au fost efectuate trei replici biologice independente per condiție experimentală, cu 12 probe totale de ARN. Verificarea calității probei de ARN, construcția bibliotecii,și secvențierea au fost efectuate de Universitatea din Chicago Genomics Facility urmând protocoale standard. Scorul mediu de integritate ARN a fost de 8,9. Toate cele 12 probe au fost secvențiate în două rulări de un secvențietor NovaSeq 6000 pentru a genera citiri de 100 bp la capătul pereche. Pentru fiecare probă, fișierele FASTQ brute din două celule de flux au fost combinate înainte de procesarea în aval. Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și s-au efectuat studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Cannabidivarina (CBDV) a fost izolată din uleiul de cânepă așa cum este descris mai sus și au fost efectuate studii identice cu cele descrise mai sus cu CBD. Scorul mediu de integritate ARN pentru probele CBDV a fost, de asemenea, 8,9.Datele ARN-seq pentru celulele tratate cu CBD și CBDV au fost analizate separat folosind o instanță locală Galaxy 20.05 pentru următorii pași ( 34 ). Calitatea și tăierea adaptorului au fost efectuate pe citirile de secvențiere brută folosind Trim Galore! 0,6,3 ( 35 ). Citirile au fost mapate atât la genomul uman (UCSC hg19 cu adnotare GENCODE), cât și la genomul SARS-COV-2 (NCBI Assembly ASM985889v3 cu adnotare Ensembl) folosind ARN STAR 2.7.5b ( 36 ). Citirile mapate rezultate din fiecare probă au fost numărate de featureCounts 1.6.4 ( 37) pentru a genera numere de citire pe genă. Numărările brute au fost analizate pentru expresia diferențială între condițiile experimentale folosind DESeq2 1.22.1 ( 38 ), care a generat, de asemenea, o matrice de expresie genică normalizată și o diagramă PCA a probelor.Numărul de citiri XBP1 îmbinate alternativ a fost numărat de Integrative Genomics Viewer 2.9.4 ( 39 ) folosind date de citire aliniate de la ARN STAR (vezi mai sus). Numărul total de citiri XBP1 a fost contorizat de featureCounts ca mai sus. Pentru fiecare probă, îmbinarea XBP1 relativă a fost determinată prin împărțirea citirilor care conțin locul de îmbinare alternativ la citirile totale XBP1.

qRT-PCR

ADNc a fost sintetizat din probe de ARN folosind kitul de transcripție inversă ADNc de mare capacitate (ThermoFisher, 4368813). Probele de ADNc au fost diluate în apă de calitate pentru biologie moleculară și au fost efectuate experimente qRT-PCR pe un instrument Roche LightCycler 96 folosind Applied Biosystems PowerUp SYBR Green Master Mix (ThermoFisher, A25776). Rezultatele au fost analizate de software-ul Roche LightCycler 96. RPL13A a fost folosit ca genă de referință. Au fost utilizate următoarele perechi de primeri (numele genei: primer primer, primer invers):ERN1: CCGAACGTGATCCGCTACTTCT, CGCAAAGTCCTTCTGCTCCACA.EIF2AK3: GTCCCAAGGCTTTGGAATCTGTC, CCTACCAAGACAGGAGTTCTGG.ATF6: CAGACAGTACCAACCGCTTATGCC, GCAGAACTCCAGGTGCTTGAAG.IFIT1: GCCTTGCTGAAGTGTGGAGGAA, ATCCAGGCGATAGGCAGAGATC.IFIT3: CCTGGAATGCTTACGGCAAGCT, GAGCATCTGAGAGTCTGCCCAA.ISG15: CTCTGAGCATCCTGGTGAGGAA, AAGGTCAGCCAGAACAGGTCGT.OAS1: AGGAAAGGTGCTTCCGAGGTAG, GGACTGAGGAAGACAACCAGGT.SOCS1: TTCGCCCTTAGCGTGAAGATGG, TAGTGCTCCAGCAGCTCGAAGA.Alt. XBP1 îmbinat: GCTGAGTCCCGCAGCAGGT, CTGGGTCCAAGTTGTCCAGAAT.Total XBP1: TGAAAACAGAGTAGCAGCTCAGA, CCCAAGCGCTGTCTTAACTC.RPL13A: CTCAAGGTGTTTGACGGCATCC, TACTTCCAGCCAACCTCGTGAG.

Clustering de gene variabile

Au fost selectate primele 5.000 de gene cele mai variabile, iar datele de expresie a genelor normalizate au fost analizate de software-ul Morpheus ( https://software.broadinstitute.org/morpheus ). Gruparea K-means cu 6 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBD și SARS-CoV-2, iar gruparea K-means cu 5 clustere a fost aplicată datelor de expresie genică a experimentului ARN-seq care implică CBDV și SARS-CoV-2. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice.

Testul de îmbinare XBP1

qRT-PCR a fost utilizat pentru a cuantifica expresia relativă a versiunii spliced ​​a XBP1 (XBP1s) prin utilizarea perechilor specifice de primeri pentru XBP1 spliced ​​uman alternativ și XBP1 total (secvențele de primer sunt descrise mai sus) așa cum s-a descris anterior ( 40 ). Procentul relativ de îmbinare alternativă a XBP1 (%XBP1s) a fost indicat prin calcularea raportului de semnale dintre XBP1s și XBP1 total.

Analiza căii ingeniozității

Datele de exprimare (modificarea log 2 ) și starea de activare prezisă a genelor au fost suprapuse pe calea de semnalizare a interferonului și pe hărțile căii de stres al reticulului endoplasmatic utilizând Ingenuity Pathway Analysis. Cifrele au fost generate prin utilizarea IPA (QIAGEN Inc). Valorile normalizate ale expresiei genelor sau schimbarea pliului (log2) ale genelor au fost analizate de software-ul Morpheus. Pentru fiecare genă, valorile de expresie normalizate ale tuturor probelor au fost transformate prin scăderea mediei și împărțirea la abaterea standard. Valorile expresiei genelor transformate au fost utilizate pentru a genera hărțile termice. Scorurile z de activare prezise de IPA ale căilor relevante din datele ARN-seq au fost, de asemenea, reprezentate grafic de software-ul Morpheus.

Analize de îmbogățire a setului de gene

Pentru a identifica temele din cele 6 clustere, au fost efectuate analize de îmbogățire a setului de gene funcționale pentru genele din fiecare cluster folosind Metascape ( 41).). Următoarele categorii au fost selectate pentru analizele de îmbogățire: Funcții moleculare GO, Seturi funcționale KEGG, Procese biologice GO, Căi canonice și Calea KEGG. Parametri suplimentari pentru Metascape: Min Overlap = 3, p-value Cutoff = 0,05, Min Enrichment = 1,5. Pentru a identifica seturile de gene care activitățile au fost inversate de CBD cu infecție virală, lista de gene de intrare include gene reglate în mod semnificativ în jos de virus (expresie diferențială comparând veh-infect vs veh-mock, limită pentru valoarea q 0,01), în timp ce, de asemenea, în creștere semnificativă. reglementat de CBD (expresie diferențială comparând CBD-infect vs veh-infect, limită pentru valoarea q 0,01). Analizele de îmbogățire a setului de gene au fost efectuate pe aceste două liste de gene folosind aceeași metodă Metascape. Aceleași analize au fost, de asemenea, efectuate asupra datelor de expresie diferențială din experimentele ARN-seq care implică CBDV și SARS-CoV-2 cu o valoare limită a q de 0,05. GSEA v4.1.0 a fost utilizat pentru a efectua analize specifice de îmbogățire a setului de gene pe termenii Ontologiei genetice Răspuns proteic nepliat mediat de PERK și Răspuns proteic nepliat mediat de IRE1 folosind datele de expresie diferențială din experimentul ARN-seq care implică CBD și SARS-CoV-2 ( 42 , 43 ).

Tratamentul CBD și provocarea SARS-CoV-2 la șoareci

Șoareci femele K18-hACE2 în vârstă de nouă până la unsprezece săptămâni ( 27) au fost achiziționate de la Jackson Laboratory (stock #034860). După aclimatizare, șoarecii au primit tratament cu CBD (20 sau 80 mg/kg) prin injecție intraperitoneală de două ori pe zi într-un volum de 0,1 ml. Soluția injectabilă a fost preparată imediat înainte de fiecare tratament. În primul rând, pulberea CBD de la furnizorul D a fost dizolvată în etanol 100%. Apoi soluția de CBD a fost amestecată cu Cremophor EL (Millipore Sigma 238470) urmată de soluție de PBS într-un raport de 1:1:18. Soluția de injecție vehicul a fost preparată prin amestecarea etanolului 100%, Cremophor EL și PBS la 1:1:18. Pentru fiecare injecție, cantitatea finală de CBD a fost fie de 20 mg, fie de 80 mg per kg de greutate corporală la șoarece, în funcție de grupul de tratament. Grupurile de control au fost tratate numai cu vehicul sau nu au primit niciun tratament. După șapte zile de tratament,

Titrarea virusului SARS-CoV-2 din țesuturile de șoarece prin testul TCID 50

Celulele Vero E6 (ATCC # CRL-1586) au fost însămânțate la o densitate de 20.000 celule/godeu în plăci de cultură de țesut cu fund plat cu 96 de godeuri (Nunc) și incubate peste noapte la 37°C cu 5% C02 și umiditate. Țesuturile omogenizate au fost centrifugate la 8.000 rpm timp de 10 minute la 4°C, iar supernatantul a fost colectat și diluat în serie de zece ori (până la 10 -7 ) în mediu de creștere virală (DMEM care conține 5% FBS și 1% soluție antibiotic/antimicotică) . După incubarea peste noapte, plăcile de celule au fost spălate de două ori cu PBS și diluțiile în serie adăugate în fiecare godeu în patru exemplare. Plăcile au fost incubate în continuare la 37°C într-un incubator umidificat cu 5% CO2. După 3 zile, celulele au fost colorate cu violet cristal 0,1% care conține 10% formol tamponat neutru și au fost marcate pentru dezvoltarea efectului citopatic (CPE). Doza TCID 50 a fost calculată conform metodei Reed și Muench ( 44 ) și corectată pentru greutatea pe gram a fiecărui omogenat pulmonar. Toate lucrările la animale au fost aprobate de Comitetul instituțional pentru îngrijirea și utilizarea animalelor de la Universitatea din Louisville. Toate lucrările cu SARS-CoV-2 viu au fost aprobate de Comitetul Instituțional de Biosecuritate al Universității și desfășurate în limita nivelului de biosecuritate trei.

Analiza datelor pacientului

Toate analizele datelor pacienților au fost aprobate de National COVID Cohort Collaborative și de comitetul de revizuire instituțional al Diviziei de Științe Biologice a Universității din Chicago (IRB21–0591), care a acordat o renunțare la consimțământ, deoarece identitățile participanților la studiu nu pot fi verificate cu ușurință de către anchetatori, anchetatorii nu contactează participanții, iar anchetatorii nu vor reidentifica participanții. O descriere detaliată a metodelor și constatărilor de analiză a datelor pacientului se găsește în Suplimentul de analiză a pacientului.

analize statistice

Datele sunt afișate ca medii ± SD. Pentru analiza expresiei diferențiale ARN-seq, a fost utilizată versiunea DESeq2 1.22.1 cu un prag de semnificație minim al valorii P corectate cu FDR (valoarea Q) de 0,01 pentru experimentul ARN-seq care implică CBD și SARS-CoV-2 și un prag de 0,05 pentru experimentul ARN-seq care implică CBDV și SARS-CoV-2. Pentru analiza îmbogățirii setului de gene, Metascape a fost utilizat cu un P minimpragul de semnificație a valorii de 0,05. Pentru calculele EC50 ale tratamentelor medicamentoase, software-ul GraphPad Prism a fost utilizat cu o potrivire a curbei neliniare cu patru parametri. Prism a fost, de asemenea, utilizat pentru teste t nepereche și ANOVA unidirecțional cu semnificație statistică definită ca p < 0,05. Pentru metodele de analiză statistică a datelor pacientului, vă rugăm să consultați secțiunea Analiză statistică din Suplimentul de analiză a pacientului.

Mulțumiri

Per total . Următorul reactiv a fost depus de către Centers for Disease Control and Prevention și obținut prin BEI Resources, NIAID, NIH: SARS-Related Coronavirus 2, Isolate USA-WA1/2020, NR-52281. Figura 8A a fost creată folosind BioRender.comSCR_019196) în special Sandhiya Arun și Pieter Faber, pentru asistența acordată cu secvențierea ARN. În cele din urmă, dorim să mulțumim viceprovostului pentru cercetare de la Universitatea din Chicago, Karen Kim, și decanului diviziei de științe biologice, Kenneth Polonsky, pentru sprijinul lor ferm.National COVID Cohort Collaborative (N3C) . Analizele datelor pacientului descrise în această publicație au fost efectuate cu date sau instrumente accesate prin intermediul Enclavei de date NCATS N3C covid.cd2h.org/enclave și susținute de NCATS U24 TR002306. Această cercetare a fost posibilă datorită pacienților ale căror informații sunt incluse în datele de la organizațiile participante ( covid.cd2h.org/dtas ) și organizațiile ( https://ncats.nih.gov/n3c/resources/data-contribution/data ). -semnatarii-acordului de transfer ) și oameni de știință care au contribuit la dezvoltarea continuă a acestei resurse comunitare ( 28). Proiectul descris a fost susținut de Institutul Național de Științe Medicale Generale, 5U54GM104942-04. Conținutul este responsabilitatea exclusivă a autorilor și nu reprezintă neapărat opiniile oficiale ale NIH. Analiza a folosit doar date de-identificate (adică, N3C Data Access Tier 2, descris la https://covid.cd2h.org/N3C_governance ). Mulțumim cu recunoștință contribuțiile următoarelor echipe principale N3C:• Investigatori principali : Melissa A. Haendel, Christopher G. Chute, Kenneth R. Gersing, Anita Walden• Lideri de lucru, subgrup și administrativi : Melissa A. Haendel, Tellen D. Bennett, Christopher G. Chute, David A. Eichmann, Justin Guinney, Warren A. Kibbe, Hongfang Liu, Philip RO Payne, Emily R. Pfaff, Peter N Robinson, Joel H. Saltz, Heidi Spratt, Justin Starren, Christine Suver, Adam B. Wilcox, Andrew E. Williams, Chunlei Wu• Legături cheie pe site-urile partenerilor de date• Personal de reglementare la site-urile partenere de date• Persoane de pe site-uri care sunt responsabile pentru crearea seturilor de date și transmiterea datelor către N3C• Echipa de asimilare și armonizare a datelor : Christopher G. Chute, Emily R. Pfaff, Davera Gabriel, Stephanie S. Hong, Kristin Kostka, Harold P. Lehmann, Richard A. Moffitt, Michele Morris, Matvey B. Palchuk, Xiaohan Tanner Zhang, Richard L. Zhu• Echipa Phenotype (Persoane care creează scripturile pe care site-urile le folosesc pentru a-și trimite datele, pe baza definițiilor COVID și Long COVID) : Emily R. Pfaff, Benjamin Amor, Mark M. Bissell, Marshall Clark, Andrew T. Girvin, Stephanie S. Hong, Kristin Kostka, Adam M. Lee, Robert T. Miller, Michele Morris, Matvey B. Palchuk, Kellie M. Walters• Echipa de management și operațiuni de proiect : Anita Walden, Yooree Chae, Connor Cook, Alexandra Dest, Racquel R. Dietz, Thomas Dillon, Patricia A. Francis, Rafael Fuentes, Alexis Graves, Julie A. McMurry, Andrew J. Neumann, Shawn T O’Neil, Usman Sheikh, Andréa M. Volz, Elizabeth Zampino• Parteneri de la NIH și alte agenții federale : Christopher P. Austin, Kenneth R. Gersing, Samuel Bozzette, Mariam Deacy, Nicole Garbarini, Michael G. Kurilla, Sam G. Michael, Joni L. Rutter, Meredith Temple-O’Connor• Echipa de analiză (persoane care construiesc infrastructura Enclave, ajută la crearea seturi de coduri, variabile și ajută echipele de domeniu și echipele de proiect cu seturile de date) : Benjamin Amor, Mark M. Bissell, Katie Rebecca Bradwell, Andrew T. Girvin, Amin Manna, Nabeel Qureshi• Echipa de management al Comitetului de Publicare: Mary Morrison Saltz, Christine Suver, Christopher G. Chute, Melissa A. Haendel, Julie A. McMurry, Andréa M. Volz, Anita Walden• Echipa de revizuire a Comitetului de publicație : Carolyn Bramante, Jeremy Richard Harper, Wenndy Hernandez, Farrukh M Koraishy, ​​Federico Mariona, Saidulu Mattapally, Amit Saha, Satyanarayana Vedula• Parteneri de date cu date publicate ( 50). Universitatea Stony Brook — U24TR002306 • Centrul de Științe ale Sănătății al Universității din Oklahoma — U54GM104938: Institutul de Științe Clinice și Translaționale din Oklahoma (OCTSI) • Universitatea Virginia de Vest — U54GM104942: Institutul de Științe Clinice și Translaționale din Virginia de Vest (WVCTSI) • Centrul Medical al Universității din Mississippi — U5454GM:1 Centrul Mississippi pentru Cercetare Clinică și Translațională (CCTR) • Centrul Medical al Universității din Nebraska — U54GM115458: Great Plains IDeA-Clinic & Translational Research • Maine Medical Center — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Wake Forest Universitatea de Științe ale Sănătății — UL1TR001420: Wake Forest Clinical and Translational Science Institute • Northwestern University din Chicago — UL1TR001422:• Parteneri suplimentari de date care au semnat DTA și eliberarea datelor în așteptare ( 35). Universitatea Rockefeller — UL1TR001866: Centrul pentru Științe Clinice și Translaționale • Institutul de Cercetare Scripps — UL1TR002550: Institutul de Cercetare Scripps Translațional • Centrul de Științe ale Sănătății al Universității din Texas din San Antonio — UL1TR002645: Institutul pentru Integrarea Medicină și Știință • Universitatea din Texas Centrul de Știință din Houston — UL1TR003167: Centrul pentru Științe Clinice și Translaționale (CCTS) • NorthShore University HealthSystem — UL1TR002389: Institutul pentru Medicină Translațională (ITM) • Spitalul Yale New Haven — UL1TR001863: Centrul Yale pentru Investigații Clinice • Universitatea Emory — UL1371TR00 Georgia Clinical and Translational Science Alliance • Weill Medical College of Cornell University — UL1TR002384:Centrul de Științe Clinice și Translaționale de Medicină Weill Cornell • Centrul Medical Montefiore — UL1TR002556: Institutul de Cercetare Clinică și Translațională de la Einstein și Montefiore • Colegiul Medical din Wisconsin — UL1TR001436: Institutul de Științe Clinice și Translaționale din Wisconsin de Sud-Est • Centrul de Științe ale Sănătății al Universității din New Mexico — UL1TR001449: Centrul de știință clinică și translațională de la Universitatea din New Mexico • Universitatea George Washington — UL1TR001876: Institutul de știință clinică și translațională de la Children’s National (CTSA-CN) • Universitatea Stanford — UL1TR003142: Spectrul: Centrul Stanford pentru cercetare și educație clinică și translațională • Institutul Regenstrief — UL1TR002529: Indiana Clinical and Translational Science Institute • Cincinnati Children’s Hospital Medical Center — UL1TR001425:Centrul pentru Știință și Formare Clinică și Translațională • Campusul Medical al Universității din Boston — UL1TR001430: Institutul de Științe Clinice și Translaționale al Universității din Boston • Universitatea de Stat din New York din Buffalo — UL1TR001412: Institutul de Științe Clinice și Translaționale • Aurora Health Care — UL1TR002373: Rețeaua Wisconsin pentru Cercetare în sănătate • Universitatea Brown — U54GM115677: Cercetare translațională clinică avansată (Advance-CTR) • Rutgers, Universitatea de Stat din New Jersey — UL1TR003017: Alianța din New Jersey pentru Științe Clinice și Translaționale • Universitatea Loyola din Chicago — UL1TR002389: Institutul pentru Medicină Translațională ( ITM) • #N/A — UL1TR001445: Institutul de Științe Clinice și Translaționale Langone Health • Spitalul de Copii din Philadelphia — UL1TR001878:Institutul pentru Medicină Translațională și Terapeutică • Centrul Medical al Universității din Kansas — UL1TR002366: Frontiere: Institutul de Științe Clinice și Translaționale de la Universitatea din Kansas • General Brigham din Massachusetts — UL1TR002541: Catalizator Harvard • Școala de Medicină Icahn din Muntele Sinai — UL1TR001433: Institutul ConduITS pentru Științe Translaționale • Ochsner Medical Center — U54GM104940: Centrul Louisiana Clinical and Translational Science (LA CaTS) • HonorHealth — Niciunul (voluntar) • Universitatea din California, Irvine — UL1TR001414: Institutul UC Irvine pentru Științe Clinice și Translaționale (ICTS) • Universitatea din California, San Diego — UL1TR001442: Altman Clinical and Translational Research Institute • Universitatea din California, Davis — UL1TR001860: UCDavis Health Clinical and Translational Science Center • Universitatea din California,San Francisco — UL1TR001872: UCSF Clinical and Translational Science Institute • Universitatea din California, Los Angeles — UL1TR001881: UCLA Clinical Translational Science Institute • University of Vermont — U54GM115516: Northern New England Clinical & Translational Research (NNE-CTR) Network • Arkansas Children’s Hospital — UL1TR003107: Institutul de Cercetare Translațională UAMS• Confirmări suplimentare N3C . De asemenea, am dori să le mulțumim altora care nu sunt enumerate mai sus: Joy Alamgir (ARIScience), Seth Russell, MS (Universitatea din Colorado) și Hui Zhang, PhD MBA (Universitatea din Chicago), care au creat seturi de concepte N3C pe care le-am folosit pentru a defini unele a covariatelor indicatorului de stare medicală pentru analiza noastră statistică. De asemenea, am dori să mulțumim lui Steve Johnson, PhD (Universitatea din Minnesota) pentru că a scris un obiect de cunoștințe de calcul al IMC pe care l-am modificat pentru a calcula valorile IMC din datele de greutate și înălțime.Finanțarea:Această lucrare a fost susținută direct de: Grantul BIG Vision de la Universitatea din Chicago (MRR). National Institutes of Health grant R01 GM121735 (MRR). National Institutes of Health grant R01 CA184494 (MRR). Grantul National Institutes of Health R01 AI137514 (GR). Grantul Institutului Național de Sănătate R01 AI127518 (GR). Grantul Institutului Național de Sănătate R01 AI134980 (GR). National Institutes of Health grant R01 CA219815 (SAO). National Institutes of Health acordă R35 GM119840 (BCD). Grantul Institutului Național de Sănătate P30 CA014599 (grant de sprijin pentru Centrul de Cancer de la Universitatea din Chicago). Harry B. și Leona M. Helmsley Charitable Trust (KE P). Componenta de analiză a pacientului a acestei lucrări a fost susținută indirect de finanțarea enumerată în secțiunea N3C a secțiunii Mulțumiri.Contribuții ale autorului:Conceptualizare: MRR, LCN, DY, GR, SAO, GFP, DOM, ND, TJB. Metodologie: MRR, LCN, DY, GR, SAO, DOM, GFP, ND, BCD, TJB. Software: DY, TJB. Analiză formală: DY, TJB. Ancheta: LCN, DY, VN, TJB, TO, SN-C, JBF, ND, AM, CD, Diane Silva, HG, LS, LR-M, AV, ES, KAJ, S-AA. Resurse: GR, MRR, GFP, ST, BCD. Curatarea datelor: DOM, TJB, DY, National COVID Cohort Collaborative Consortium. Redactare – schiță originală: MRR. Scriere – revizuire și editare: LCN, DY, VN, TJB, SN-C, JBF, ND, AM, KAJ, Diane Silva, JMM, BCD, ST, SAO, GFP, DOM, GR, MRR. Vizualizare: LCN, DY, ND, AM, SN-C, BCD, JBF. Supraveghere: MRR. GR, DOM, GFP, SAO, ST, BCD. Administrare Proiect: MRR. Achiziție finanțare: MRR. Pentru experimentul pe animale: Investigație: Divyasha Saxena, CDA. Analiză formală: Divyasha Saxena, JDG. Metodologie: JDG, JKD, Divyasha Saxena, WES, KEP.Obținerea aprobărilor: WES, JDG. Achiziție finanțare: KEP.Interese concurente: SAO este cofondator și consultant la OptiKira., LLC (Cleveland, OH). Autorii nu declară alte interese concurente.Disponibilitatea datelor și a materialelor: Toate datele necesare pentru evaluarea concluziilor din lucrare sunt prezente în lucrare, Materialele suplimentare și/sau Datele suplimentare S1. Datele brute și procesate ARN-seq au fost depuse în baza de date GEO (GSE168797).

Materiale suplimentare

Acest fișier PDF include:

Figurile. S1 până la S24Supliment pentru analiza datelor pacientuluiTabelele de la S1 la S6DESCĂRCAȚI (9,91 MB)

Alte materiale suplimentare pentru acest manuscris includ următoarele:

Date S1DESCĂRCAȚI (9,91 MB)Vizualizați/solicitați un protocol pentru această lucrare de la Bio-protocol .

REFERINȚE ȘI NOTE

1SR Weiss, JL Leibowitz, Patogeneza coronavirusului. Adv. Virus Res. 81 , 85–164 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC2SE Galloway, P. Paul, DR MacCannell, MA Johansson, JT Brooks, AM Neil, RB Slayton, S. Tong, BJ Silk, GL Armstrong, M. Biggerstaff, VG Dugan, Apariția SARS-CoV-2 B.1.1. 7 descendență – Statele Unite, 29 decembrie 2020–12 ianuarie 2021. MMWR Morb Mortal Wkly Rep 70 , 95–99 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC3M. Hoffmann, H. Kleine-Weber, S. Schroeder, N. Krüger, T. Herrler, S. Erichsen, TS Schiergens, G. Herrler, N.-H. Wu, A. Nitsche, MA Müller, C. Drosten, S. Pöhlmann, intrarea în celulele SARS-CoV-2 depinde de ACE2 și TMPRSS2 și este blocată de un inhibitor de protează dovedit clinic. Celula 181 , 271–280.e8 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC4J. Jaimes, J. Millet, G. Whittaker, Clivajul proteolitic al proteinei spike SARS-CoV-2 și rolul site-ului roman S1/S2. iScience 23 , 101212 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC5S. Matsuyama, N. Nao, K. Shirato, M. Kawase, S. Saito, I. Takayama, N. Nagata, T. Sekizuka, H. Katoh, F. Kato, M. Sakata, M. Tahara, S. Kutsuna, N. Ohmagari, M. Kuroda, T. Suzuki, T. Kageyama, M. Takeda, Izolarea îmbunătățită a SARS-CoV-2 de către celulele care exprimă TMPRSS2. Proc. Natl. Acad. Sci. SUA 117 , 7001–7003 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC6R. Wang, CR Simoneau, J. Kulsuptrakul, M. Bouhaddou, KA Travisano, JM Hayashi, J. Carlson-Stevermer, JR Zengel, CM Richards, P. Fozouni, J. Oki, L. Rodriguez, B. Joehnk, K Walcott, K. Holden, A. Sil, JE Carette, NJ Krogan, M. Ott, Ecranele genetice identifică factorii gazdă pentru SARS-CoV-2 și coronavirusurile comune ale răcelii. Celula 184 , 106–119.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC7WM Schneider, JM Luna, H.-H. Hoffmann, FJ Sánchez-Rivera, AA Leal, AW Ashbrook, JL Pen, I. Ricardo-Lax, E. Michailidis, A. Peace, AF Stenzel, SW Lowe, MR MacDonald, CM Rice, JT Poirier, Genome-scale identification of Rețelele de factori gazdă SARS-CoV-2 și pan-coronavirus. Celula 184 , 120–132.e14 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC8Z. Daniloski, TX Iordania, H.-H. Wessels, DA Hoagland, S. Kasela, M. Legut, S. Maniatis, EP Mimitou, L. Lu, E. Geller, O. Danziger, BR Rosenberg, H. Phatnani, P. Smibert, T. Lappalainen, BR tenOever, NE Sanjana, Identificarea factorilor gazdă necesari pentru infecția cu SARS-CoV-2 în celulele umane. Celula 184 , 92–105.e16 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC9DW Kneller, G. Phillips, HM O’Neill, R. Jedrzejczak, L. Stols, P. Langan, A. Joachimiak, L. Coates, A. Kovalevsky, Plasticitatea structurală a cavității site-ului activ SARS-CoV-2 3CL Mpro revelată prin cristalografie cu raze X la temperatura camerei. Nat. comun. 11 , 3202 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC10J. Osipiuk, SA Azizi, S. Dvorkin, M. Endres, R. Jedrzejczak, KA Jones, S. Kang, RS Kathayat, Y. Kim, VG Lisnyak, SL Maki, V. Nicolaescu, CA Taylor, C. Tesar, YA Zhang, Z. Zhou, G. Randall, K. Michalska, SA Snyder, BC Dickinson, A. Joachimiak, Structura proteazei asemănătoare papainei din SARS-CoV-2 și complexele sale cu inhibitori necovalenti. Nat. comun. 12 , 743 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC11F. Shahbazi, V. Grandi, A. Banerjee, JF Trant, Cannabinoids and cannabinoid receptors: The story so far. iScience 23 , 101301 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC12KM Nelson, J. Bisson, G. Singh, JG Graham, SN Chen, JB Friesen, JL Dahlin, M. Niemitz, MA Walters, GF Pauli, The essential medicinal chemistry of cannabidiol (CBD). J. Med. Chim. 63 , 12137–12155 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC13K. Sekar, A. Pack, Epidiolex ca terapie adjuvantă pentru tratamentul epilepsiei refractare: O revizuire cuprinzătoare, cu accent pe efectele adverse. F1000Res 8 , F1000 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC14HI Lowe, NJ Toyang, W. McLaughlin, Potentialul canabidiolului pentru tratamentul hepatitei virale. Farmacia. Res. 9 , 116–118 (2017).GOOGLE ACADEMIC15L. Taylor, B. Gidal, G. Blakey, B. Tayo, G. Morrison, A faza I, randomizat, dublu-orb, controlat cu placebo, doză crescătoare unică, doză multiplă și efect alimentar privind siguranța, tolerabilitatea și farmacocinetica canabidiolului înalt purificat la subiecții sănătoși. CNS Drugs 32 , 1053–1067 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC16SM Anil, N. Shalev, AC Vinayaka, S. Nadarajan, D. Namdar, E. Belausov, I. Shoval, KA Mani, G. Mechrez, H. Koltai, Compușii de canabis prezintă activitate antiinflamatoare in vitro în COVID-19 -inflamația asociată celulelor epiteliale pulmonare și activitatea proinflamatoare la macrofage. Sci. Rep. 11 , 1462 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC17KHD Crawford, R. Eguia, AS Dingens, AN Loes, KD Malone, CR Wolf, HY Chu, MA Tortorici, D. Veesler, M. Murphy, D. Pettie, NP King, AB Balazs, JD Bloom, Protocol și reactivi pentru pseudotiparea particulelor lentivirale cu proteina spike SARS-CoV-2 pentru teste de neutralizare. Virusuri 12 , 513 (2020).CROSSREFGOOGLE ACADEMIC18C. Hetz, E. Chevet, SA Oakes, Controlul proteostazei prin răspunsul proteic desfășurat. Nat. Cell Biol. 17 , 829–838 (2015).CROSSREFPUBMEDGOOGLE ACADEMIC19R. Dash, MC Ali, I. Jahan, YA Munni, S. Mitra, MA Hannan, B. Timalsina, DF Oktaviani, HJ Choi, IS Moon, Emerging potential of cannabidiol in reversing proteinopathies. Imbatranire Res. Rev. 65 , 101209 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC20J. Bechill, Z. Chen, JW Brewer, SC Baker, Infecția cu virusul hepatitei la șoarece activează calea Ire1/XBP1 a răspunsului proteic desfășurat. Adv. Exp. Med. Biol. 581 , 139–144 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC21TS Fung, DX Liu, senzorul de stres ER IRE1 și MAP kinaza ERK modulează inducerea autofagiei în celulele infectate cu virusul bronșitei infecțioase cu coronavirus. Virologie 533 , 34–44 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC22C. Hetz, K. Zhang, RJ Kaufman, Mecanisme, reglare și funcții ale răspunsului proteic desfășurat. Nat. Pr. Mol. Cell Biol. 21 , 421–438 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC23O. Haller, G. Kochs, F. Weber, The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344 , 119–130 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC24D. Blanco-Melo, BE Nilsson-Payant, W.-C. Liu, S. Uhl, D. Hoagland, R. Møller, TX Jordan, K. Oishi, M. Panis, D. Sachs, TT Wang, RE Schwartz, JK Lim, RA Albrecht, BR tenOever, Răspunsul dezechilibrat al gazdei la SARS- CoV-2 stimulează dezvoltarea COVID-19. Celula 181 , 1036–1045.e9 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC25H. Di, H. Elbahesh, MA Brinton, Caracteristicile proteinelor izoforme umane OAS1. Virusuri 12 , (2020).CROSSREFGOOGLE ACADEMIC26TA Tummino, VV Rezelj, B. Fischer, A. Fischer, MJ O’Meara, B. Monel, T. Vallet, Z. Zhang, A. Alon, HR O’Donnell, J. Lyu, H. Schadt, KM White , NJ Krogan, L. Urban, KM Shokat, AC Kruse, A. García-Sastre, O. Schwartz, F. Moretti, M. Vignuzzi, F. Pognan, BK Shoichet, Fosfolipidoza este un mecanism comun care stă la baza activității antivirale in vitro a multor medicamente reutilizate împotriva SARS-CoV-2. bioRxiv 10.1101 /2021.03.23.436648 (2021).GOOGLE ACADEMIC27PB McCray Jr., L. Pewe, C. Wohlford-Lenane, M. Hickey, L. Manzel, L. Shi, J. Netland, HP Jia, C. Halabi, CD Sigmund, DK Meyerholz, P. Kirby, DC Look , S. Perlman, Infecția letală a șoarecilor K18-hACE2 infectați cu coronavirus de sindrom respirator acut sever. J. Virol. 81 , 813–821 (2007).CROSSREFPUBMEDGOOGLE ACADEMIC28MA Haendel, CG Chute, TD Bennett, DA Eichmann, J. Guinney, WA Kibbe, PRO Payne, ER Pfaff, PN Robinson, JH Saltz, H. Spratt, C. Suver, J. Wilbanks, AB Wilcox, AE Williams, C Wu, C. Blacketer, RL Bradford, JJ Cimino, M. Clark, EW Colmenares, PA Francis, D. Gabriel, A. Graves, R. Hemadri, SS Hong, G. Hripscak, D. Jiao, JG Klann, K Kostka, AM Lee, HP Lehmann, L. Lingrey, RT Miller, M. Morris, SN Murphy, K. Natarajan, MB Palchuk, U. Sheikh, H. Solbrig, S. Visweswaran, A. Walden, KM Walters, GM Weber, XT Zhang, RL Zhu, B. Amor, AT Girvin, A. Manna, N. Qureshi, MG Kurilla, SG Michael, LM Portilla, JL Rutter, CP Austin, KR Gersing; Consorțiul N3C, Cohorta Națională COVID (N3C): justificare, proiectare, infrastructură,și desfășurare. J. Am. Med. Informa. conf. univ. 28 , 427–443 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC29Centre pentru Controlul și Prevenirea Bolilor, COVID-19, Persoane cu risc crescut, Persoane cu anumite afecțiuni medicale (2021).GOOGLE ACADEMIC30Q. Zhou, V. Chen, CP Shannon, XS Wei, X. Xiang, X. Wang, ZH Wang, SJ Tebbutt, TR Kollmann, EN Fish, Interferon-α2b Treatment for COVID-19. Față. Imunol. 11 , 1061 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC31T. Mutumalage, I. Rahman, Cannabidiolul reglează diferențial răspunsurile inflamatorii bazale și induse de LPS în macrofage, celule epiteliale pulmonare și fibroblaste. Toxicol. Aplic. Pharmacol. 382 , 114713 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC32Administrația pentru Alimente și Medicamente (FDA), numărul de cerere 210365Orig1s000,” Clinical Pharmacology and Biopharmaceutics Reviews (2017).GOOGLE ACADEMIC33BC Sorkin, AJ Kuszak, G. Bloss, NK Fukagawa, FA Hoffman, M. Jafari, B. Barrett, PN Brown, FD Bushman, SJ Casper, FH Chilton, CS Coffey, MG Ferruzzi, DC Hopp, M. Kiely, D Lakens, JB MacMillan, DO Meltzer, M. Pahor, J. Paul, K. Pritchett-Corning, SK Quinney, B. Rehermann, KDR Setchell, NS Sipes, JM Stephens, DL Taylor, H. Tiriac, MA Walters, D. Xi, G. Zappalá, GF Pauli, Îmbunătățirea traducerii cercetării produselor naturale: de la sursă la studiu clinic. FASEB J. 34 , 41–65 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC34E. Afgan, D. Baker, B. Batut, M. van den Beek, D. Bouvier, M. Čech, J. Chilton, D. Clements, N. Coraor, BA Grüning, A. Guerler, J. Hillman-Jackson , S. Hiltemann, V. Jalili, H. Rasche, N. Soranzo, J. Goecks, J. Taylor, A. Nekrutenko, D. Blankenberg, Platforma Galaxy pentru analize biomedicale accesibile, reproductibile și colaborative: actualizare 2018. Acizi nucleici Res. 46 , W537–W544 (2018).CROSSREFPUBMEDGOOGLE ACADEMIC35F. Krueger, Trim Galore. Un instrument de împachetare în jurul Cutadapt și FastQC pentru a aplica în mod constant calitatea și tăierea adaptorului fișierelor FastQ. 517 (2015).GOOGLE ACADEMIC36A. Dobin, CA Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, TR Gingeras, STAR: Ultrafast universal ARN-seq aligner. Bioinformatica 29 , 15–21 (2013).CROSSREFPUBMEDGOOGLE ACADEMIC37Y. Liao, GK Smyth, W. Shi, featureCounts: Un program eficient de uz general pentru atribuirea de secvențe citirilor caracteristicilor genomice. Bioinformatica 30 , 923–930 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC38MI Love, W. Huber, S. Anders, Estimarea moderată a schimbării pliului și a dispersiei pentru datele ARN-seq cu DESeq2. Genom Biol. 15 , 550 (2014).CROSSREFPUBMEDGOOGLE ACADEMIC39JT Robinson, H. Thorvaldsdóttir, W. Winckler, M. Guttman, ES Lander, G. Getz, JP Mesirov, Integrative genomics viewer. Nat. Biotehnologia. 29 , 24–26 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC40SB Yoon, YH Park, SA Choi, HJ Yang, PS Jeong, JJ Cha, S. Lee, SH Lee, JH Lee, BW Sim, BS Koo, SJ Park, Y. Lee, YH Kim, JJ Hong, JS Kim, YB Jin, JW Huh, SR Lee, BS Song, SU Kim, Cuantificarea PCR în timp real a proteinei de legare a casetei X spliced ​​1 (XBP1) folosind o metodă de primer universal. PLOS ONE 14 , e0219978 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC41Y. Zhou, B. Zhou, L. Pache, M. Chang, AH Khodabakhshi, O. Tanaseichuk, C. Benner, SK Chanda, Metascape oferă o resursă orientată către biologi pentru analiza seturilor de date la nivel de sisteme. Nat. comun. 10 , 1523 (2019).CROSSREFPUBMEDGOOGLE ACADEMIC42A. Subramanian, P. Tamayo, VK Mootha, S. Mukherjee, BL Ebert, MA Gillette, A. Paulovich, SL Pomeroy, TR Golub, ES Lander, JP Mesirov, Analiza îmbogățirii setului de gene: O abordare bazată pe cunoștințe pentru interpretarea genomului -profiluri largi de expresie. Proc. Natl. Acad. Sci. SUA 102 , 15545–15550 (2005).CROSSREFPUBMEDGOOGLE ACADEMIC43C. Hetz, F. Martinon, D. Rodriguez, LH Glimcher, The unfolded protein response: Integrating stress signals through the stress sensor IRE1α. Physiol. Apoc. 91 , 1219–1243 (2011).CROSSREFPUBMEDGOOGLE ACADEMIC44LJ Reed, H. Muench, O metodă simplă de estimare a punctelor finale de cincizeci la sută. A.m. J. Epidemiol. 27 , 493–497 (1938).CROSSREFGOOGLE ACADEMIC45Institutul OHDS, ATLAS. (2021).GOOGLE ACADEMIC46OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Standardized Derived Elements, Drug Era table (2021).GOOGLE ACADEMIC47Centers for Disease Control and Prevention, COVID-19: When to Carantine (CDC, 2021).GOOGLE ACADEMIC48Bibliotecă de servicii de procesare a textului, Operațiuni regulate de expresie (Servicii de procesare a textului, 2021).GOOGLE ACADEMIC49JJ Beltran-Montoya, T. Herrerias-Canedo, A. Arzola-Paniagua, F. Vadillo-Ortega, OF Dueñas-Garcia, H. Rico-Olvera, A randomized, clinical trial of ketorolac tromethamine vs ketorolac trometamine plus complex B vitamins for analgezie prin cezariană. Saudi J Anaesth 6 , 207–212 (2012).CROSSREFPUBMEDGOOGLE ACADEMIC50Centers for Disease Control and Prevention, COVID-19-spitalizare și deces în funcție de vârstă (CDC, 2021).GOOGLE ACADEMIC51OMOP (OMOP), OMOP Clinical Data Model v5.3.1, Clinical Data Tables, Person table. (2021).GOOGLE ACADEMIC52L. Kompaniyets, AB Goodman, B. Belay, DS Freedman, MS Sucosky, SJ Lange, AV Gundlapalli, TK Boehmer, HM Blanck, Indicele de masă corporală și riscul de spitalizare asociată cu COVID-19, internarea la terapie intensivă, ventilația mecanică invazivă , și Death – Statele Unite, martie-decembrie 2020. MMWR Morb. Muritor. Wkly Rep. 70 , 355–361 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC53CB Weir, A. Jan, în StatPearls . (Insula comorilor (FL), 2021).GOOGLE ACADEMIC54F. a. D. Administrație, (2020).GOOGLE ACADEMIC55EC Leas, EM Hendrickson, AL Nobles, R. Todd, DM Smith, M. Dredze, JW Ayers, Cannabidiol auto-raportat (CBD) pentru afecțiuni cu terapii dovedite. JAMA Netw. Deschis 3 , e2020977 (2020).CROSSREFPUBMEDGOOGLE ACADEMIC56M. Hepburn, N. Mullaguri, P. George, S. Hantus, V. Punia, A. Bhimraj, CR Newey, Convulsii simptomatice acute la pacientii critici cu COVID-19: Is there an association? Neurocrit. Care 34 , 139–143 (2021).CROSSREFPUBMEDGOOGLE ACADEMIC57S. Corp., Manual de referință Tabulate Twoway (2021).GOOGLE ACADEMIC58D. Ho, K. Imai, G. King, E. Suart, A. Whitworth, N. Greifer, MatchIt: Nonparametric Preprocessing for Parametric Causal Inference (2021).GOOGLE ACADEMIC59PC Austin, Diagnosticarea echilibrului pentru compararea distribuției covariatelor inițiale între grupurile de tratament în eșantioanele potrivite cu scorul de tendință. Stat. Med. 28 , 3083–3107 (2009).CROSSREFPUBMEDGOOGLE ACADEMIC60D. Pregibon, Metode analitice de date pentru modele liniare generalizate, disertație, (1979).GOOGLE ACADEMIC61L. Blizzard, DW Hosmer, Parameter estimation and goodness-of-fit in log binomial regresion. Biom. J. 48 , 5–22 (2006).CROSSREFPUBMEDGOOGLE ACADEMIC62Centrul JHCR, (2021).GOOGLE ACADEMIC63National COVID Cohort Collaborative, COVID-19 Pehnotyope 3.0 Additional Information (N3C, 2021).GOOGLE ACADEMIC

https://www.science.org/doi/10.1126/sciadv.abi6110

Imunitatea dobandita natural prin infectarea cu Sars-cov-2 ofera protectie impotriva tulpinei Delta de 13 ori mai buna comparativ cu 2 doze vaccin Pfizer(BionTech)

Un nou studiu din Israel sugerează că imunitatea câștigată după recuperarea după o infectie/vindecare de COVID-19 este mai protectoare împotriva noii variante Delta decât imunitatea indusă de vaccin. S-a estimat că imunitatea naturală este de aproximativ 13 ori mai puternică decât administrarea a două doze de vaccin Pfizer-BioNTech.

Cercetătorii scriu:

Acest studiu a demonstrat că imunitatea naturală conferă o protecție mai durabilă și mai puternică împotriva infecțiilor, bolilor simptomatice și spitalizării cauzate de varianta Delta a SARS-CoV-2, comparativ cu imunitatea indusă de vaccinul cu două doze BNT162b2.

Cu toate acestea, vaccinurile pot adăuga un plus de protecție la persoanele care s-au recuperat de la COVID-19(cu riscurile aferente). Rezultatele au arătat că o doză unică de vaccin cu imunitate naturală asigura o protecție mai mare împotriva reinfecției decât persoanele cu imunitate naturală singură.Studiu: Compararea imunității naturale a SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite.  Credit de imagine: ktsdesign / ShutterstockStudiu: Compararea imunității naturale a SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite . Credit de imagine: ktsdesign / Shutterstock

Studiul „Compararea imunității naturale SARS-CoV-2 cu imunitatea indusă de vaccin: reinfecții versus infecții descoperite” este publicat pe serverul de preimprimare medRxiv *.

Cum au efectuat studiul

Echipa de cercetare a comparat rata infecției cu SARS-CoV-2, severitatea bolii, spitalizarea și decesul la vârsta de peste 16 ani, care au avut fie imunitatea indusă de vaccin, fie imunitatea naturală.

Au existat trei grupuri în studiu: 673.676 de persoane care au fost complet vaccinate cu vaccinul Pfizer-BioNTech și fără expunere prealabilă la SARS-CoV-2; 62.883 de persoane nevaccinate care s-au recuperat din COVID-19; și 42.099 persoane cu infecție prealabilă SARS-CoV-2 și care au primit o singură doză de vaccin.

Echipa de cercetare a urmărit participanții la studiu în perioada 1 iunie – 14 august 2021. Perioada de urmărire a avut loc atunci când varianta Delta era obișnuită în Israel.

Israelul a avut una dintre cele mai rapide lansări de vaccinuri la nivel global. În prezent, în țară au fost administrate peste 13 milioane de doze. Ca rezultat, descoperirile alcătuiesc cel mai mare studiu observațional din lumea reală, care compară imunitatea naturală cu cea indusă de vaccin.

Creșterea infecțiilor descoperite și a spitalizărilor la persoanele vaccinate

Persoanele vaccinate fără expunere prealabilă la SARS-CoV-2 au avut un risc crescut de 13,06 ori de a se infecta cu varianta Delta. În plus, a existat un risc crescut de 27 de ori pentru COVID-19 simptomatic.

Deși rezultatele ar putea sugera scăderea imunității naturale împotriva variantei Delta, cei vaccinați prezintă încă un risc crescut de 5,96 ori de infecție descoperită și un risc crescut de 7,13 ori de boală simptomatică comparativ cu cei infectați anterior ”, au explicat cercetătorii.

În plus, persoanele vaccinate au prezentat un risc mai mare de a necesita spitalizare din cauza unei infecții descoperite decât persoanele nevaccinate cu imunitate naturală.

Persoanele cu o singură doză de vaccin și care s-au recuperat anterior de la infecție păreau să aibă mai multă protecție împotriva Delta decât persoanele nevaccinate cu imunitate naturală.

Nu au fost observate decese legate de COVID-19 la toate cele trei grupuri.

Mai sunt necesare mai multe cercetări care să investigheze protecția pe termen lung a imunității naturale. Cu toate acestea, cercetătorii teoretizează că imunitatea naturală ar putea oferi un răspuns imun mai mare față de proteinele SARS-CoV-2 decât activarea imună a proteinei anti- spike oferită de vaccinul Pfizer-BioNTech.

limitările și punctele de luat în considerare

Este posibil ca studiul să fi subestimat numărul de infecții asimptomatice, deoarece și-a colectat datele din testele PCR. Persoanele cu infecții asimptomatice sunt mai puțin susceptibile de a fi testate pentru SARS-CoV-2, sugerând că rezultatele se aplică în primul rând infecțiilor simptomatice.

Descoperirile s-au concentrat, de asemenea, asupra pacienților care au primit vaccinul Pfizer-BioNTech la începutul anului 2021. Alte cercetări din Israel au sugerat recent că nivelurile de anticorpi induse de vaccin scad după câteva luni, dar focurile de rapel pot spori răspunsul imun. Rămâne necunoscut modul în care imunitatea naturală se compară cu imunitatea indusă de vaccin cu lovituri de rapel.

În plus, rezultatele studiului nu se traduc în vaccinuri care nu sunt bazate pe mARN, cum ar fi AstraZeneca-Oxford și vaccinurile Johnson & Johnson.

Studiul s-a axat în principal pe varianta Delta, care a devenit răspândită în multe țări, inclusiv în Israel. Deoarece Delta a fost cea mai răspândită în timpul studiului, constatările nu pot evalua modul în care imunitatea naturală protejează împotriva altor variante SARS-CoV-2.

În cele din urmă, cercetătorii recunosc că diferite comportamente de sănătate, cum ar fi aderența la distanțarea socială și purtarea măștilor, nu au putut fi controlate în cadrul studiului și ar fi putut afecta riscul de infectare.

*Notă importantă

medRxiv publică rapoarte științifice preliminare care nu sunt evaluate de colegi și, prin urmare, nu ar trebui să fie considerate concludente, să ghideze practica clinică / comportamentul legat de sănătate sau tratate ca informații stabilite.Referință jurnal:

https://www.news-medical.net/news/20210830/Does-SARS-CoV-2-natural-infection-immunity-better-protect-against-the-Delta-variant-than-vaccination.aspx

Meta-analiza studiilor randomizate de Ivermectină pentru tratarea infecției cu SARS-CoV-2

Metaanaliza studiilor randomizate cu ivermectină pentru tratarea infecției cu SARS-CoV-2 

Andrew Hill1, Anna Garratt2, Jacob Levi3, Jonathan Falconer4, Leah Ellis5, Kaitlyn McCann5, Victoria Pilkington6, Ambar Qavi5, Junzheng Wang5, Hannah Wentzel5

  1. Departamentul de farmacologie și terapie, Universitatea din Liverpool, Liverpool, L7 3NY, Marea Britanie
  2. Departamentul de Boli Infecțioase, Spitalul Universitar din Țara Galilor, Consiliul de Sănătate al Universității Cardiff și Vale, Marea Britanie
  3. Departamentul de terapie intensivă, University College London Hospital, ULCH NHS Trust, Londra, Marea Britanie
  4. Departamentul de Boli Infecțioase, Spitalul Chelsea și Westminster, Imperial NHS Trust, Londra, Marea Britanie
  5. Facultatea de Medicină, Imperial College London, Marea Britanie 6. Oxford University Clinical Academic Graduate School, University of Oxford, UK

Open Forum Boli infecțioase , ofab358, https://doi.org/10.1093/ofid/ofab358Publicat: 06 iulie 2021 Istoricul articolelor

A fost publicată o corecție:Open Forum Infectious Diseases , volumul 8, numărul 8, august 2021, ofab394, https://doi.org/10.1093/ofid/ofab394

Abstract

Ivermectina este un medicament antiparazitar care este investigat pentru reutilizarea împotriva SARS-CoV-2. Ivermectina a prezentat activitate in vitro împotriva SARS-COV-2 la concentrații mari.

Această meta-analiză a investigat ivermectina în 24 de studii clinice randomizate (3328 de pacienți) identificate prin căutări sistematice ale registrelor PUBMED, EMBASE, MedRxiv și ale studiilor.

Ivermectina a fost asociată cu markeri inflamatori reduși (C-Reactive Protein, d-dimer și feritină) și un clearance viral mai rapid prin PCR. Clearance-ul viral a fost dependent de doză și durată de tratament. În 11 studii randomizate de infecție moderată / severă, a existat o reducere cu 56% a mortalității (Risc relativ 0,44 [IÎ 95% 0,25-0,77]; p = 0,004; 35/1064 (3%) decese pe ivermectină; 93/1063 ( 9%) decese la controale) cu recuperare clinică favorabilă și spitalizare redusă.

Multe studii incluse nu au fost evaluate de colegi și au fost evaluate o gamă largă de doze.

În prezent, OMS recomandă utilizarea ivermectinei numai în cadrul studiilor clinice. O rețea de studii clinice mari este în desfășurare pentru a valida rezultatele observate până în prezent.

Introducere
Pandemia SARS-CoV-2 continuă să crească, cu peste 350.000 de infecții noi și peste 7.000 de decese înregistrate zilnic în toată lumea în mai 2021 [1]. Vaccinurile de protecție au fost dezvoltate, dar livrările actuale sunt prea mici pentru a acoperi cererea mondială în următoarele luni [2]. Cercetătorii din întreaga lume caută de urgență intervenții pentru a preveni noi infecții sau pentru a preveni progresia bolii și pentru a reduce severitatea bolii pentru cei deja infectați.
În timp ce cercetarea asupra noilor agenți terapeutici pentru COVID-19 este esențială, există, de asemenea, un mare interes în evaluarea potențialului medicamentelor deja existente împotriva COVID-19, iar multe studii clinice sunt în curs de realizare a unor medicamente „cu scopuri speciale”, indicate în mod normal pentru alte boli. . Profilurile de siguranță cunoscute, termenele de dezvoltare scurtate și piețele bine stabilite (cu prețuri scăzute și capacitate mai mare de livrare la scară) pentru majoritatea compușilor deja existenți propuși pentru COVID-19 sunt deosebit de avantajoși în comparație cu descoperirea de noi medicamente într-o pandemie situatie. Trei medicamente antiinflamatorii re-propuse au arătat beneficii semnificative de supraviețuire până în prezent: corticosteroidul dexametazonă în studiul UK RECOVERY [3] și medicamentele antagoniste ale receptorului Interleukin-6 (IL-6), tocilizumab și sarilumab, în ​​REMAP- Procesul CAP și procesul RECUPERARE [4,5].Alți antimicrobieni reutilizați, cum ar fi, hidroxiclorochina, lopinavir / ritonavir, remdesivir și interferon-beta, nu au arătat niciun beneficiu semnificativ de supraviețuire în două studii mari, randomizate [3, 6], în ciuda rapoartelor inițiale de eficacitate, subliniind nevoia de precauție la interpretarea date precoce ale studiilor clinice.
Dexametazona este recomandată pentru utilizare de către OMS și are beneficii dovedite de supraviețuire pentru pacienții dependenți de oxigen cu COVID-19, în timp ce tocilizumab și sarilumab îmbunătățesc supraviețuirea pentru pacienții aflați în terapie intensivă [3, 4]. Datele preliminare sugerează că nitazoxanida și budesonida pot avea un rol în infecția ușoară [7,8]. Cu toate acestea, nu există tratamente aprobate pentru pacienții cu infecție ușoară cu SARS-CoV-2, fie pentru a preveni progresia bolii, fie pentru a reduce transmiterea virală. Tratamentele care cresc rata de eliminare virală pot reduce riscul transmiterii ulterioare, dar acest lucru necesită o demonstrație empirică.


Ivermectina este un medicament antiparazitar bine stabilit, utilizat la nivel mondial pentru un număr mare de paraziți și, de asemenea, pentru utilizarea topică împotriva rozaceei. Activitatea antivirală a ivermectinei a fost demonstrată recent pentru SARS-CoV-2 în celulele Vero / hSLAM [9]. Cu toate acestea, concentrațiile necesare pentru a inhiba replicarea virală in-vitro (EC50 = 2,2 – 2,8 μM; EC90 = 4,4 μM) nu sunt atinse sistemic după administrarea orală a medicamentului la oameni [9, 10].
Medicamentul se estimează că se acumulează în țesuturile pulmonare (de 2,67 ori cel al plasmei) [11], dar este, de asemenea, puțin probabil să fie suficient pentru a menține concentrațiile țintă pentru activitatea antivirală pulmonară [10, 12]. Cu toate acestea, ivermectina este de obicei prezentă ca un amestec de doi agenți și, deși este excretată în principal neschimbată la om, are doi metaboliți principali [13]. Datele actuale sunt insuficiente pentru a determina dacă forma minoră sau un metabolit circulant are o potență directă mai mare împotriva SARS-CoV-2, dar se pare că ar trebui să fie mult mai puternic decât valorile raportate.
Ivermectina a demonstrat, de asemenea, mecanisme de acțiune imunomodulatoare și antiinflamatoare în modele preclinice ale altor câteva indicații. Studiile in vitro au demonstrat că ivermectina suprimă producția mediatorilor inflamatori de oxid nitric și prostaglandină E2 [14]. Mai mult, avermectina (din care derivă ivermectina) afectează semnificativ secreția pro-inflamatorie de citokine (IL-1β și TNF-α) și crește secreția citokinei imunoregulatoare IL-10 [15]. Ivermectina a redus, de asemenea, TNF-α, IL-1 și IL-6 și a îmbunătățit supraviețuirea la șoareci cărora li s-a administrat o doză letală de lipopolizaharidă [16]. Dovezi preclinice care susțin aceste mecanisme de acțiune imunomodulatoare și antiinflamatoare au fost generate și în modelele murine [17, 18]. În cele din urmă, la hamsterii sirieni de aur infectați cu SARS-CoV-2,ivermectina subcutanată a demonstrat o reducere a raportului IL-6 / IL-10 în țesuturile pulmonare. În acest studiu, ivermectina a prevenit și deteriorarea patologică [19]. În cele din urmă, există diferite mecanisme potențiale de acțiune pentru ivermectină împotriva COVID19 și sunt în curs de investigare ulterioară, așa cum este rezumat recent într-un articol de revizuire [20].
La doze standard, de 0,2-0,4 mg / kg timp de 1-2 zile, ivermectina are un profil de siguranță bun și a fost distribuită miliardelor de pacienți din întreaga lume în cadrul programelor de administrare în masă a medicamentelor. O meta-analiză recentă nu a constatat nicio diferență semnificativă în evenimentele adverse la cei cărora li s-au administrat doze mai mari de ivermectină, de până la 2 mg / kg, și la cei care au primit cure mai lungi, de până la 4 zile, comparativ cu cei care au primit doze standard [21]. Ivermectina nu este autorizată pentru femeile însărcinate sau care alăptează sau pentru copii <15 kg.

Grupul de orientări al OMS a constatat că în 16 RCT cu 2407 de participanți ivermectina a îmbunătățit rezultatele mortalității în comparație cu controlul, dar a evaluat calitatea dovezilor disponibile ca fiind scăzută sau foarte scăzută [22]. În prezent, OMS nu recomandă utilizarea ivermectinei în afara studiilor clinice.Obiectivul acestei revizuiri sistematice și meta-analize a fost de a combina rezultatele disponibile din studiile randomizate noi publicate sau nepublicate de ivermectină în infecția cu SARS-CoV-2 pentru a informa ghidurile actuale. Metode Revizuirea sistematică și meta-analiza au fost efectuate în conformitate cu orientările PRISMA. O căutare sistematică a PUBMED și EMBASE a fost efectuată pentru a identifica studii randomizate controlate (RCT/ECA) care evaluează tratamentul cu ivermectină pentru pacienții infectați cu SARS-CoV-2. Studiile clinice fără braț de control sau cele care evaluează prevenirea infecției au fost excluse alături de studii non-randomizate și studii de caz-control. Datele cheie extrase au inclus caracteristici de bază (vârstă, sex, greutate, saturație de oxigen, stadiul infecției), modificări ale markerilor inflamatori, supresie virală după tratament, recuperare clinică, spitalizare și supraviețuire.Datele au fost extrase și verificate încrucișat de către doi recenzori independenți (HW și LE). Strategia de căutare și criteriile de selecție RCT au fost eligibile pentru includere dacă au comparat un regim pe bază de ivermectină cu un comparator sau standard de îngrijire (SOC) pentru tratamentul infecției cu SARS-CoV-2. Lista de verificare PRISMA, diagrama de flux PRISMA, termenii de căutare și criteriile de includere / excludere utilizate sunt detaliate în figura suplimentară 1, tabelele suplimentare 1, 2 și 3. Bazele de date ale registrului au fost căutate până la 12 mai 2021. Clinicaltrials.gov [23] a fost căutat folosind cuvintele cheie COVID, SARS-CoV-2 și ivermectină pentru identificarea studiilor. Platforma OMS International Clinical Trials Registry Platform (ICTRP) a fost accesată prin instrumentul de cartografiere al Inițiativei COVID-NMA [24] și cercetarea antivirală asupra Coronavirus a Universității Stanford.Platforma OMS International Clinical Trials Registry Platform (ICTRP) a fost accesată prin instrumentul de cartografiere al Inițiativei COVID-NMA [24] și cercetarea antivirală asupra Coronavirus a Universității Stanford.

Baza de date (CoV-RDB) [25] pentru identificarea studiilor suplimentare listate pe alte registre naționale și internaționale. Căutările de literatură prin PubMed, Embase și serverele de preimprimare MedRxiv și Researchsquare au fost efectuate pentru a identifica studiile publicate. Înregistrările duplicate, studiile non-randomizate și studiile de prevenire au fost excluse în urma discuției dintre autori. În plus, echipele de cercetare care desfășoară studii clinice nepublicate au fost contactate și li s-a solicitat să se alăture întâlnirilor periodice ale echipei internaționale din decembrie 2020 până în mai 2021. Toate rezultatele disponibile din studiile nepublicate eligibile au fost, de asemenea, incluse în această revizuire sistematică. Toate studiile clinice incluse în această meta-analiză au fost aprobate de comitetele etice locale și toți pacienții au dat consimțământul informat.Rezultatul principal a fost mortalitatea cauzată de toate cauzele, de la randomizare până la sfârșitul urmăririi. Rezultatele secundare au inclus timpul până la eliminarea virală, negativitatea PCR în ziua 7, recuperarea clinică, timpul până la recuperarea clinică, ventilația mecanică, durata spitalizării și numărul de spitalizări. Modificările markerilor inflamatori, supresia virală, recuperarea clinică și spitalizarea au fost, de asemenea, rezumate pentru studii individuale în care criteriile finale nu au putut fi combinate.

Analiza datelor

Analizele statistice pentru mortalitatea din toate cauzele, timpul până la eliminarea virală și recuperarea clinică au fost efectuate folosind rezumate de date publicate. Pentru rezultatul mortalității, studiile clinice cu cel puțin un deces raportat au fost incluse în această analiză. Mai mult, orice spitalizare în decurs de 12 ore de la randomizare a fost exclusă.Efectele tratamentului au fost exprimate ca raporturi de risc (RR) pentru rezultatele binare și diferența medie (MD) pentru rezultatele continue. Pentru fiecare rezultat, am reunit statisticile individuale ale studiului utilizând modelul de varianță inversă cu efecte aleatorii; o corecție de continuitate de 0,5 a fost aplicată brațelor de tratament fără decese. Eterogenitatea a fost evaluată de I2. Pragul de semnificație a fost stabilit la 5% (față-verso) și toate analizele au fost efectuate folosind Revman 5.3. Un grafic de pâlnie pentru rezultatul mortalității a fost creat pentru a evalua prejudecățile publicării și efectele mici ale studiului; valoarea p a fost estimată din testul Harbord bazat pe regresie pentru efecte de studiu mici. Toate studiile incluse în această analiză au fost evaluate în ceea ce privește riscul de prejudecată utilizând instrumentul de evaluare standardizat Cochrane Collaboration pentru riscul de prejudecată [26]. Rezultatul acestei evaluări este dat în tabelul suplimentar 3.Fiecare studiu a fost evaluat pentru riscul de prejudecată pentru obiectivul primar, sarcina virală și rezultatele supraviețuirii. Obiectivul principal în cadrul studiilor a avut tendința de a fi recuperarea clinică, care este mai subiectivă și probabil că va fi influențată de cunoașterea brațelor de tratament. De asemenea, a fost efectuată o evaluare a obiectivelor mai obiective, inclusiv supraviețuirea și încărcătura virală, care sunt mai puțin susceptibile de a fi influențate de această prejudecată. În cazul în care informațiile nu erau disponibile în lucrările publicate, investigatorii studiilor clinice au fost contactați proactiv pentru a informa analiza prejudecății riscului.

Rezultate

În această meta-analiză au fost incluse 24 stucii clinice controlate randomizate(aleatorii) RCT implicând un total de 3328 de participanți. Mărimea eșantionului pentru fiecare studiu a variat între 24 și 400 de participanți. Dintre cele 24 de studii incluse, opt au fost lucrări publicate, nouă au fost disponibile ca pre-tipărituri, șase au fost rezultate nepublicate împărtășite pentru această analiză,și unul a raportat rezultatele printr-un site de registru de probă. În general, nouă studii au investigat ivermectina ca doză unică (Tabelul 1A) [27-35], 15 studii au investigat dozarea pe mai multe zile până la șapte zile (Tabelul 1B) [36-50], dintre care patru studii au fost cuprinse între doze [ 28,39, 46, 48]. În studiile incluse, ivermectina a fost investigată în mare parte la participanții ușori / moderate (15 studii). În general, 18 studii au fost simple sau dublu-orb și șase au fost deschise.

Evaluarea studiilor.

O evaluare a calității studiilor incluse în această meta-analiză a fost realizată în conformitate cu instrumentul Cochrane Collaboration pentru a evalua riscul de prejudecată în următoarele rezultate: obiective primare, sarcină virală și supraviețuire. Pentru evaluarea rezultatului primar, studiile 6/24 (25%) au fost evaluate ca fiind un risc ridicat de prejudecată [Tabelul suplimentar 3A]. In orice caz,în evaluările rezultatelor mai obiective, inclusiv sarcina virală și mortalitatea, numărul studiilor cu risc ridicat a fost mai mic. În evaluarea PCR, 3/15 (20%) din studii au fost evaluate cu risc ridicat [Tabelul suplimentar 3B]. În evaluarea supraviețuirii, 1/11 (9%) din studii au fost evaluate cu risc ridicat de. [Tabelul suplimentar 3C].

Efecte asupra markerilor inflamatori

Cinci studii au furnizat rezultate ale efectului ivermectinei asupra markerilor inflamatori, inclusiv proteina C reactivă (CRP), feritina și dimerul (Tabelul 2).

Patru dintre aceste studii au demonstrat reduceri semnificative ale CRP comparativ cu controlul. Mai mult, în studiul Elgazzar [36], ivermectina a redus semnificativ nivelurile de feritină în comparație cu controlul în populația severă de pacienți, în timp ce nu s-a demonstrat nicio diferență semnificativă în populația ușoară / moderată.Studiul Okumus [47] a arătat reduceri semnificativ mai mari ale feritinei în ziua 10 de urmărire pentru ivermectină versus control. Studiile Chaccour [35] și Ahmed [46] nu au arătat nicio diferență semnificativă în numărul de feritină între ivermectină și martor. Elgazzar [36] a arătat diferențe semnificative în dimerul d între ivermectină și martor atât la populațiile ușoare / moderate, cât și la cele severe. Okumus [47] a prezentat diferențe semnificative în dimerul d în ziua 5, în timp ce Chaccour [35] nu a găsit diferențe semnificative în dimerul d între ivermectină și martor, dar cu o dimensiune mai mică a eșantionului.

Efecte asupra eliminării virale

Au fost utilizate trei obiective diferite pentru a analiza clearance-ul viral: procentul de pacienți nedetectabili într-o zi stabilită (Tabelul 3A), numărul de zile de la randomizare la negativitate (Tabelul 3B),și alte măsuri, cum ar fi valorile ciclului de timp (Ct) și corelațiile doză-răspuns (Tabelul 3C). Studiile Kirti [43] și Okumus [47] au inclus analiza încărcăturii virale numai la un subgrup de pacienți. Efectele ivermectinei asupra clearance-ului viral au fost, în general, mai mici atunci când s-a administrat o singură zi. Mai multe studii nu au arătat niciun efect semnificativ statistic al ivermectinei asupra clearance-ului viral [28, 29, 34]. Cele trei studii randomizând pacienții la doze sau durate diferite de ivermectină au arătat efecte aparente dependente de doză asupra clearance-ului viral. În primul rând, în studiul Babalola (n = 60) [48], doza de 0,4 mg / kg a arătat tendințe de eliminare virală mai rapidă decât doza de 0,2 mg / kg. În al doilea rând, în studiul Mohan (n = 125) [28], doza de 0,4 mg / kg de ivermectină a condus la un procent numeric mai mare de pacienți cu clearance viral în ziua a cincea decât doza de 0,2 mg / kg. Al treilea,în studiul Ahmed (n = 72) [46], tratamentul cu ivermectină timp de cinci zile a condus la un procent mai mare de pacienți cu clearance viral în ziua 13 comparativ cu o zi de tratament. În cele din urmă, în Krolewiecki (n = 45) [50], corelațiile PK / PD au arătat un clearance viral semnificativ mai rapid pentru pacienții cu expuneri la PK peste 160ng / mL.

Efectul ivermectinei asupra clearance-ului viral a fost cel mai pronunțat în studiile randomizate care au evaluat doze de până la cinci zile de ivermectină folosind doze de 0,4 mg / kg. La aceste doze, au existat efecte semnificative statistic asupra clearance-ului viral în toate cele patru studii randomizate. Într-o meta-analiză a clearance-ului viral cu subgrupuri de durată a dozei, au existat diferențe semnificative în timp până la clearance-ul viral în favoarea ivermectinei (Diferența medie -3,00 zile [IÎ 95% -4,96, -1,03]; p = 0,003, Figura 1A ].Într-o analiză de sensibilitate, excluzând studiile cu risc ridicat de prejudecată, s-au observat efecte similare ale ivermectinei la timp cu clearance-ul viral [Figura suplimentară 2]. Mai mult, într-o altă analiză, ivermectina a prezentat un clearance viral îmbunătățit în ziua 7 (Risc relativ 1,35 [95% CI 1,05-1,75]; p = 0,02, Figura 1B].

Efecte asupra recuperării clinice și duratei spitalizării

Definițiile recuperării clinice au variat între studii , așa cum se arată în Tabelul 4. În Tabelul 4A, trei dintre cele șase studii au arătat un timp semnificativ mai rapid până la recuperarea clinică a ivermectinei comparativ cu martorul. metaanaliza recuperării clinice cu subgrupuri de durată a dozei,au existat diferențe semnificative în timp până la recuperarea clinică în favoarea ivermectinei (Diferența medie -1,58 zile [95% CI -2,80, -0,35]; p = 0,01, Figura 1C]. În plus, ivermectina a arătat o îmbunătățire cu 29% a recuperării clinice în o analiză cu subgrupuri de durată a dozei (RR 1,29 [IÎ 95% 1,12-1,47]; p = 0,0003, Figura 1D]. Ivermectina a demonstrat o durată mai mică de spitalizare comparativ cu martorul (Diferența medie -4,27 zile [IÎ 95% -8,60- 0,06]; p = 0,05, Figura 1E). Ivermectina nu a fost asociată cu un risc mai mic de spitalizare comparativ cu martorul (RR 0,40 [IC 95% 0,14-1,08]; p = 0,07, Figura 1F). Cu toate acestea, această analiză a implicat doar patru studii la 704 de participanți. Într-o analiză de sensibilitate, incluzând orice spitalizare în decurs de 12 ore de la randomizare, au existat semnificativ mai puține spitalizări comparativ cu controlul (RR 0,32 [95% CI 0.13-0.80]; p = 0,01, Figura suplimentară 3).

Efectele asupra supraviețuirii

11 studii randomizate au raportat că cel puțin o persoană a murit după randomizare și a fost inclusă în analiză (Tabelul 5). Pe parcursul acestor 11 studii la 2127 de pacienți, au existat 35/1064 (3%) decese în brațele cu ivermectină, comparativ cu 93/1063 (9%) decese în brațele de control. Într-o analiză combinată utilizând ponderarea inversă a varianței, ivermectina a arătat o reducere cu 56% a mortalității (RR 0,44 [95% CI 0,25-0,77]; p = 0,004, Figura 1G). Heterogenitatea a fost moderată, I2 = 43%. A existat o îmbunătățire cu 70% a supraviețuirii în subgrupul de participanți ușori / moderate (RR 0,30 [IC 95% 0,15-0,58]; p = 0,0004). Numărul total de decese a fost mic, analiza sa bazat pe 128 de decese și nu a existat nicio diferență semnificativă între ivermectină și martor în subgrupul sever (0,58 [IÎ 95% 0,25-1,32]; p = 0,19).Rezultate consistente au fost observate într-o analiză, excluzând studiile cu risc ridicat de prejudecată (RR 0,45 (IÎ 95% 0,24-0,82); p = 0,01, Figura suplimentară 4). Când au fost incluse doar studii cu risc scăzut de prejudecată, acest rezultat a fost, de asemenea, menținut (RR 0,31 [IÎ 95% 0,10-0,90]; p = 0,03, Figura suplimentară 5). O analiză suplimentară a subgrupului a rezultatului mortalității cu studii separate prin doză-durată, orbire și grup de control a arătat un beneficiu de supraviețuire consistent și nu s-au găsit diferențe semnificative de subgrup (Figurile Suplimentare 6, 7 și 8). A fost efectuată o analiză a sensibilității la o singură ieșire și niciun studiu unic nu a avut un efect substanțial asupra dimensiunii globale a efectului (Tabelul suplimentar 4). Un grafic de pâlnie pentru rezultatul mortalității nu a arătat efecte semnificative ale prejudecății publicării: efectele tratamentului au fost similare în studii de dimensiuni diferite, p = 0.618 (Figura suplimentară 9).

Ivermectina nu a fost asociată cu un risc mai mic de ventilație mecanică (RR 0,97 [IC 95% 0,57-1,67]; p = 0,92, Figura 1H]. Cu toate acestea, această estimare s-a bazat pe cinci studii efectuate pe 641 de participanți, incluzând doar 49 de evenimente. revizuirea și meta-analiza a 24 RCT/ ECA (n = 3328) au arătat că tratamentul cu ivermectină reduce markerii inflamatori, realizează clearance-ul viral mai rapid și îmbunătățește supraviețuirea în comparație cu SOC. Efectele ivermectinei asupra clearance-ului viral au fost mai puternice pentru doze mai mari și durate mai mari de tratament. Aceste efecte au fost observate într-o gamă largă de RCT/ECA efectuate în mai multe țări diferite. Rezultatele acestei analize au apărut în cadrul reuniunilor echipei internaționale a proiectului Ivermectin în perioada decembrie 2020 – mai 2021.Echipe independente de cercetare desfășurau testele în 16 țări și au convenit să împărtășească datele lor, care erau adesea nepublicate, pentru a accelera viteza de raportare și pentru a asigura că cercetarea fragmentată, răspândită în întreaga lume, ar putea contribui la învățarea globală. Clearance-ul viral a fost evaluat prin teste de reacție în lanț polimerazică (PCR) în toate studiile. Am inclus doar studii clinice randomizate în această meta-analiză. Cele 24 RCT/ECA incluse au fost concepute și realizate independent, cu rezultate combinate în mai 2021. Cu toate acestea, fiecare studiu individual a fost mic și a inclus o gamă largă de tipuri de populație. Definițiile de recuperare clinică au diferit între studii și nu au existat diferențe semnificative în ceea ce privește supraviețuirea la participanții severi.

Obiective secundare

Obiective secundare pentru unele RCT/ECR au inclus biomarkeri de severitate a bolii.Unele dintre acestea oferă dovezi pentru un mecanism antiinflamator de acțiune al ivermectinei la pacienții infectați cu SARS-CoV-2. Metaanalizele anterioare au demonstrat că nivelurile ridicate de CRP, feritină, dimer d și limfocitopenie sunt legate de severitatea COVID-19 și de hiperinflamarea [51, 52]. Studiile asupra antagoniștilor receptorilor IL-6 s-au dovedit a reduce nivelul CRP și dimerul d la pacienții cu COVID-19 [5].

Ivermectina poate avea, de asemenea, un rol în prevenirea pe termen scurt a infecției cu SARS-CoV-2, sugerată de studii pilot [53, 54]. Acest beneficiu potențial trebuie validat și în studii randomizate mai mari.

Mecanismul de acțiune

În momentul scrierii, lipsurile de cunoștințe împiedică o concluzie solidă cu privire la mecanismul de acțiune al ivermectinei. S-a propus că efectele antivirale cu spectru larg ale Ivermectinei sunt legate de impactul său asupra căii NF-κB și prin legarea la celula gazdă importin α / β1 heterodimer, proteine ​​de transport nuclear responsabile de intrarea nucleară a încărcăturilor și aceste efecte în rândul său, de asemenea, preveni replicarea virală. După cum sa discutat în introducere, estimările actuale in vitro EC50 (2,2 μ, 2,4 μM și 2,8 μM în funcție de testul genetic analizat prin RT-qPCR) sunt încă de 35 de ori mai mari decât concentrațiile plasmatice după dozarea orală normală.Chiar și dozele de 8,5 ori mai mari decât cele recomandate de FDA 200 μg / kg de 1,7 mg / kg ating doar concentrații plasmatice de 0,28 μM [55]. Biodisponibilitatea crescută în starea de hrănire și concentrațiile mai mari observate în țesutul pulmonar comparativ cu plasma este încă sub rezultatele EC50 publicate curent. Cu toate acestea, rezultatele EC50 pot varia foarte mult în funcție de metodologia de laborator; linia celulară, metodele de cuantificare virală, tulpina virusului cultivat și Multiplicitatea infecției utilizate. Acesta este un fenomen stabilit: polimorfismele virale ale gripei au demonstrat o variație de 5 ori în EC50 a diferitelor teste de neuraminidază care au analizat susceptibilitatea izolatelor de câmp ale virusului gripal împotriva oseltamivirului [56]. În mod specific în SARS-CoV-2, EC50 pentru medicamentele reutilizate anterior au variat semnificativ. Remdesivir, acum licențiat pentru SARS-CoV-2, a efectuat>De 10 ori mai bine în celulele A549 augmentate hACE2 (0.115 μM) decât Vero E6 (1.28μM) [57]. întrucât alte exemple de medicamente reutilizate, cum ar fi sofosbuvirul, au demonstrat o variație de peste 10 ori a EC50 atunci când sunt utilizate în celulele Vero E6 față de HUH7 [58]. În consecință, EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și susceptibil de a se modifica în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și să poată fi modificată în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.EC50 demonstrat până acum pentru ivermectină împotriva SARS-CoV-2 ar trebui interpretat cu prudență, deoarece este puțin probabil să fie o valoare stabilită și susceptibil de a se modifica în funcție de metodologia de laborator utilizată. Testele in vitro pentru ivermectină trebuie repetate pentru diferite tipuri de celule utilizând diferite măsuri de activitate.
Limitări

O limitare cheie a acestei meta-analize este comparabilitatea datelor, cu studii diferite în ceea ce privește dozarea, durata tratamentului și criteriile de includere. Mai mult, standardul de îngrijire utilizat în brațul de control a diferit între studii. În această meta-analiză, studiile care au utilizat controale active precum hidroxiclorochina sau lopinavir / ritonavir au fost combinate împreună cu cele care au utilizat placebo sau îngrijire standard. Cu toate acestea, lopinavir / ritonavir și hidroxiclorochina nu au arătat niciun beneficiu general sau vătămare în studiile randomizate și meta-analize mari. [7, 59-61] Mai mult, analize suplimentare în această lucrare care separă studiile pe subgrupuri de îngrijire standard / placebo și control activ nu au arătat nicio diferență semnificativă între grupuri. O altă limitare este că ivermectina a fost administrată în asociere cu doxiciclina în trei studii.Este posibil ca studiile individuale să nu aibă puterea de a detecta efectele tratamentului asupra unor obiective rare, cum ar fi supraviețuirea. Măsurile de rezultat nu au fost standardizate; clearance-ul viral a fost măsurat în majoritatea studiilor, dar în momente de timp diferite și cu praguri diferite ale ciclului PCR. Fiabilitatea testelor PCR în scopuri de cuantificare a făcut obiectul unei dezbateri de fond. Majoritatea studiilor au fost efectuate la populații cu infecție ușoară / moderată, iar unele studii au exclus pacienții cu comorbidități multiple. Pentru studiile deschise, există un risc de părtinire în evaluarea obiectivelor subiective, cum ar fi recuperarea clinică și externarea la spital. Cu toate acestea, riscul este mai mic pentru obiectivele finale obiective, cum ar fi clearance-ul viral și supraviețuirea. Am încercat să controlăm prejudecățile de publicare contactând fiecare echipă de cercetare care efectuează testele direct.Acest lucru a generat mai multe rezultate decât ar fi evident dintr-un sondaj de studii clinice publicate numai, dar înseamnă că multe dintre studiile incluse nu au fost evaluate de colegi. Revizuirea și publicarea ECR durează în general trei până la șase luni. A devenit o practică obișnuită pentru studiile clinice ale tratamentelor cheie COVID-19 care trebuie evaluate din pre-tipăriri, cum ar fi studiile OMS SOLIDARITATE, RECUPERARE și REMAP-CAP [4,5,7].


Aceste RCT au fost efectuate într-o gamă largă de țări, adesea în condiții de resurse reduse și sisteme de sănătate supraîncărcate. În prezent sunt în curs de desfășurare ECA mai mari în Spania, America de Sud, Africa și America de Nord, cu rezultate de la alți 5000 de participanți așteptați în vara anului 2021 (Tabelul suplimentar 5). În ciuda limitărilor, această analiză sugerează o doză și un impact dependent de durată de ivermectină asupra ratei clearance-ului viral. Aceste studii au evaluat o gamă largă de dozare a ivermectinei, de la 0,2 mg / kg timp de 1 zi la 0,6 mg / kg timp de 5 zile. Această gamă largă de doze a permis o estimare a dependenței de doză de clearance-ul viral, dar reduce numărul pacienților incluși cărora li s-a administrat în mod constant aceeași doză pentru aceeași durată. Doza maximă eficientă de ivermectină nu este încă clară, iar noile studii clinice evaluează doze mai mari,până la 1,2 mg / kg timp de 5 zile. Beneficiul de supraviețuire de 56% observat în această meta-analiză se bazează pe 128 de decese, în 11 studii clinice diferite. Acesta este un număr total mai mic de decese decât procesul RECUPERARE, care a condus la aprobarea dexametazonei și se bazează pe 1592 de decese. Cu toate acestea, beneficiul de supraviețuire observat de 56% în ivermectină este mai puternic decât pentru alte medicamente reutilizate, necesitând să se demonstreze o dimensiune mai mică a eșantionului. Rezultatele emergente ale mortalității din studii mai ample de ivermectină vor necesita o evaluare atentă și pot schimba concluziile din analiza actuală. Mai multe alte medicamente reutilizate s-au dovedit promițătoare în studiile timpurii mai mici, de exemplu sofosbuvir / daclatasvir, colchicină și remdesivir, dar beneficiul nu a fost văzut mai târziu în studiile mai mari

.Această meta-analiză a 24 studii clinice randomizate cu brate control RCT / ECA la 3328 de pacienți a arătat o îmbunătățire a supraviețuirii cu 56%, un timp mai rapid până la recuperarea clinică și semne ale unui efect dependent de doză al clearance-ului viral la pacienții cărora li s-a administrat ivermectină versus tratament de control. Acest beneficiu trebuie validat în studii de confirmare mai mari.


Mulțumiri
Dorim să mulțumim întregului personal clinic, echipelor de cercetare și pacienților care au participat la aceste studii.
Finanțare: Fundația apei de ploaie
Conflicte de interese potențiale: Niciunul dintre autori nu a declarat un conflict de interese
Declarație de consimțământ al pacientului: Toate studiile clinice incluse în această meta-analiză au fost aprobate de comitetele etice locale și toți pacienții au semnat consimțământul informat

referinte si tabele si figuri in pdf

Vitamina C în tratamentul COVID-19

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8065688/

Abstract

Vitamina C este un nutrient esențial care servește ca antioxidant și joacă un rol major ca co-factor și modulator al diferitelor căi ale sistemului imunitar. Efectul său terapeutic în timpul infecțiilor a fost un subiect de dezbatere, cu rezultate contradictorii în studiile infecțiilor respiratorii și la pacienții cu boli critice. Această revizuire cuprinzătoare a avut ca scop rezumarea dovezilor actuale privind utilizarea vitaminei C în prevenirea sau tratamentul pacienților cu infecție SARS-CoV2, pe baza publicațiilor disponibile în perioada ianuarie 2020 – februarie 2021. În general, 21 de publicații au fost incluse în această revizuire, constând în de rapoarte de cazuri și serii de cazuri, studii observaționale și unele studii clinice. În multe dintre publicații, datele au fost incomplete, iar în majoritatea studiilor clinice rezultatele sunt încă în așteptare.Nu s-au găsit studii privind prevenirea COVID-19 cu supliment de vitamina C. Deși unele observații clinice au raportat o stare medicală îmbunătățită la pacienții cu COVID-19 tratați cu vitamina C, datele disponibile din studiile controlate sunt rare și neconcludente. Pe baza contextului teoretic prezentat în acest articol și a unor studii preliminare încurajatoare, rolul vitaminei C în tratamentul pacienților cu infecție cu SARS-CoV-2 ar trebui investigat în continuare.rolul vitaminei C în tratamentul pacienților cu infecție cu SARS-CoV-2 ar trebui investigat în continuare.rolul vitaminei C în tratamentul pacienților cu infecție cu SARS-CoV-2 ar trebui investigat în continuare.Cuvinte cheie: acid ascorbic, SARS-CoV-2, antioxidant, reglare imunăMergi la:

1. Introducere

Vitamina C (acid ascorbic) este o vitamină solubilă în apă care joacă un rol major ca antioxidant și ca co-factor al diferitelor căi biosintetice din sistemul imunitar. Este un nutrient esențial care nu poate fi sintetizat de corpul uman [ 1]. Efectul său antioxidant este derivat din capacitatea de a dona electroni și, astfel, de a proteja moleculele de deteriorarea oxidativă. Pe lângă importanța sa în menținerea barierei epiteliale a pielii, vitamina C are roluri majore în funcția și reglarea sistemului imunitar. Leucocitele și neutrofilele acumulează vitamina C intracelular, în funcție de disponibilitatea plasmatică. La neutrofile, vitamina C influențează procesul de chemotaxie, precum și fagocitoza microbilor. În plus, datorită capacității sale antioxidante și de eliminare, vitamina C protejează neutrofilele și fagocitele de daunele care apar după explozia lor oxidativă și, de asemenea, activează o cascadă dependentă de caspază care promovează apoptoza programată și inhibă necroza [ 2 , 3]]. Efect similar de protecție împotriva stresului oxidativ se observă și la limfocite. Alte influențe ale vitaminei C asupra reglării inflamatorii implică modularea factorului de transcripție nucleară kappa B (NFkB) și atenuarea producției de citokine pro-inflamatorii [ 4 ].

Deficitul de vitamina C și sindromul său clinic scorbut sunt asociate cu susceptibilitatea la infecții, în special infecții ale căilor respiratorii și pneumonie. În timpul infecției, rolul antioxidant al vitaminei C poate fi cel mai important, deoarece stresul oxidativ este crescut [ 5 ]. Cerința sporită de antioxidanți și consumul de către leucocite ar putea explica reducerea nivelurilor de vitamina C observate în timpul infecțiilor în general, în timpul infecțiilor pulmonare în special [ 6 , 7 ] și la pacienții cu boli critice [ 8 , 9 ]. Dincolo de efectul antioxidant, funcțiile benefice ale vitaminei C în timpul pneumoniei acționează prin căi de semnalizare a suprimării inflamației și îmbunătățirea imunoreglării [10 ].

Utilizarea suplimentelor cu vitamina C pentru prevenirea sau scurtarea duratei infecțiilor tractului respirator și a răcelii obișnuite au fost dezbătute timp de decenii, cu rezultate contradictorii în diferite studii [ 11 , 12 ]. O revizuire cuprinzătoare a Cochrane a concluzionat că o anumită reducere a duratei și severității răcelii obișnuite poate fi observată în studiile regulate de suplimentare, fără efect consecvent în studiile terapeutice [ 13].]. Persoanele cu stres fizic extrem pot merita o atenție specială în ceea ce privește beneficiile suplimentării cu vitamina C. În ceea ce privește pneumonia, datele privind suplimentarea orală sunt rare și se bazează în principal pe studii și observații mici. O recenzie recentă Cochrane și meta-analiza pe această temă au concluzionat că dovezile actuale sunt insuficiente pentru a susține efectul benefic al suplimentării cu vitamina C asupra prevenirii și tratamentului pneumoniei și că sunt necesare studii mai mari de înaltă calitate [ 14 ].

Spre deosebire de efectele ușoare și controversate ale suplimentării orale cu vitamina C, o administrare intravenoasă de doze mari de vitamina C poate duce la niveluri plasmatice mai ridicate prin ocolirea limitelor transportatorilor intestinali. Mai multe studii de administrare intravenoasă cu doze mari de vitamina C au arătat rezultate mixte în ceea ce privește rezultatele clinice și de laborator în diferite situații, inclusiv pacientul cu sepsis sever în unitățile de terapie intensivă (UCI), pacienții cu leziuni pulmonare acute și sindromul de detresă respiratorie acută (ARDS) ) [ 15 , 16 , 17]. O revizuire sistematică și meta-analiză a tratamentului intravenos cu vitamina C la pacienții cu afecțiuni critice, publicată în 2017, a demonstrat rezultate favorabile în ceea ce privește economisirea vasopresorilor și într-o nevoie redusă de ventilație mecanică, fără a afecta mortalitatea generală [ 18 ]. O revizuire sistematică mai recentă și meta-analiză nu au arătat niciun efect semnificativ al tratamentului intravenos cu vitamina C la pacienții cu afecțiuni critice în ceea ce privește episoadele de infecție, durata șederii în UCI și durata ventilației mecanice, dar o tendință ușoară spre reducerea mortalității [ 19 ] . Dimpotrivă, s-a constatat o reducere a duratei ventilației mecanice într-o metaanaliză recentă diferită [ 20 ].

Pe baza acestei baze teoretice și a experienței anterioare de utilizare a vitaminei C la pacienții cu boli critice și la pacienții cu infecții respiratorii și care se confruntă cu povara imensă a morbidității și mortalității secundare pandemiei CoronaVirus Disease 19 (COVID-19) la nivel mondial, un mare interes este prezent în posibilul rol benefic al tratamentului cu vitamina C în cadrul infecției cu sindrom respirator acut sever Coronavirus 2 (SARS-CoV2). În ultimul an au apărut mai multe publicații, care raportează tratamentul cu vitamina C la pacienții cu COVID-19 în diferite condiții. Majoritatea publicațiilor au raportat cazuri individuale sau serii mici de cazuri; unele au efectuat studii observaționale, în timp ce studiile clinice sunt rare, multe studii în curs de desfășurare sunt încă în așteptarea rezultatelor.Prezentăm prin prezenta o revizuire cuprinzătoare care rezumă datele disponibile în literatura de specialitate despre experiența cu tratamentul cu vitamina C la pacienții cu infecție SARS-CoV2.Mergi la:

2. Material și metode

În această revizuire cuprinzătoare a literaturii, două baze de date electronice (PubMed și EMBASE) au fost căutate de la 1 ianuarie 2020 până la 15 februarie 2021 folosind următoarea strategie de căutare: („acid ascorbic” SAU „vitamina C” SAU „vitamina C” SAU „vit C” SAU „L-ascorbic”) ȘI („coronavirus” SAU „virus corona” SAU „COVID” SAU „COVID19” SAU „COVID 19” SAU „COVID-19” SAU „SARS-CoV2”). Doi autori (MM și AGM) au efectuat căutarea și au examinat independent toate studiile identificate în bazele de date. În cazurile de discrepanțe în identificarea studiului, toate studiile eligibile au fost incluse după revizuirea autorilor.

Toate tipurile de studiu au fost incluse dacă au fost publicate în limba engleză, populația studiului a constat în pacienți umani (copii sau adulți) cu infecție cu SARS-CoV-2, iar vitamina C a fost utilizată fie ca intervenție terapeutică, fie profilactică. Din fiecare studiu inclus, au fost extrase următoarele informații: titlul, numele autorului și anul publicării, țara studiului, datele demografice ale pacienților și condițiile clinice inițiale, doza de vitamina C și durata terapiei, rezultatele și concluziile. Selecția studiului este prezentată într-o schemă PRISMA dinfigura 1.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nutrients-13-01172-g001.jpg

figura 1

Organigrama PRISMA.Mergi la:

3. Rezultate

Căutarea inițială a studiului a dus la 153 de studii. După citirea titlurilor și rezumatelor și eliminarea duplicatelor ( n = 50), procesul de selecție a condus la includerea a 21 de studii. Șase au fost raportate de caz, trei au fost serii de cazuri, trei au fost studii retrospective observaționale, unul a fost un studiu transversal, unul a fost un studiu clinic de fază 1, patru au fost studii clinice randomizate (ECA) și trei au fost ECC în curs de desfășurare. În timp ce majoritatea studiilor s-au concentrat asupra efectelor terapeutice ale vitaminei C, doar un articol a raportat efectele sale asupra prevenirii COVID-19. Țările în care au fost efectuate studiile incluse au fost SUA ( n = 8) și China ( n = 7), urmate de Iran ( n = 2), Pakistan ( n = 2), Italia (n = 1) și Tunisia ( n = 1). În toate studiile și rapoartele menționate anterior, numărul total de pacienți cu infecție cu SARS-CoV-2 care au primit vitamina C a fost de 568. În 14 studii pacienții erau în stare critică, iar decesul a avut loc la 9 pacienți. Cu toate acestea, pentru unele studii au fost disponibile date incomplete. Nu s-au găsit studii care să raporteze utilizarea vitaminei C pentru prevenirea COVID-19.

3.1. Rapoarte de caz și serie de cazuri

Mai multe publicații cu un singur caz și cu mai multe cazuri au raportat o stare clinică îmbunătățită după tratamentul cu vitamina C, în principal în durata redusă a ventilației mecanice și a spitalizării sau în recuperarea mai timpurie a simptomelor.

Într-un raport de caz, o femeie în vârstă de 74 de ani din SUA cu COVID-19 ARDS a primit vitamina C mai întâi ca doză orală de 1 g de două ori pe zi (timp de 6 zile), iar mai târziu ca doză mare intravenoasă (IV) ( doză: 11 g / zi sub formă de perfuzie continuă, timp de 10 zile) datorită dezvoltării ARDS și șocului septic [ 21 ]. În decurs de 5 zile, starea clinică a pacientului s-a îmbunătățit și a reușit să înțărceze ventilația mecanică.

O serie de cazuri din SUA a raportat administrarea de vitamina C IV (doză: 1 g la fiecare 8 ore, timp de 3 zile) la 17 pacienți care au testat pozitiv SARS-CoV-2 (vârsta medie 64 ± 14 ani; M: F = 10 : 7) [ 22 ]. Tratamentul cu vitamina C a fost început la o medie de 3 zile (interval 0-11) după internarea în spital și 8 zile (interval 3-18) după debutul simptomelor. Autorii au raportat o scădere semnificativă a nivelurilor de feritină și dimer D și o tendință de scădere a fracției de inspirație necesară oxigen (FiO 2 ) după administrarea vitaminei C.

Un singur raport de caz din China a raportat un pacient bărbat tânăr (34 de ani) sănătos anterior, fără comorbidități cu simptome asociate COVID-19 (tuse uscată, oboseală, apetit slab și febră subiectivă) care a primit vitamina C (doză: 3 g o dată pe zi) împreună cu tratamente antivirale și antimicrobiene [ 23 ]. Dupa doua saptamani de tratament combinat, simptomele pacientului și SpO 2 îmbunătățit și a fost considerat clinic vindecat.

Într-un alt raport de caz unic din China, vitamina C (doză: 200 mg de 3 ori / zi, pe cale orală) a fost administrată cu glicirizinat de diammoniu oral (o moleculă tradițională chineză asemănătoare unui steroid) la o pacientă de sex feminin (66 de ani) cu COVID sever -19 – dificultăți de respirație și febră persistentă [ 24 ]. Istoricul ei a fost deosebit, deoarece nu a avut niciodată rezultate pozitive ale testului PCR, dar boala ei a fost confirmată prin testul anticorpilor după recuperare. Într-o săptămână, toate simptomele ei severe au fost rezolvate și s-a vindecat complet.

Într-o serie de cazuri retrospective chineze de 12 pacienți cu COVID sever ( n = 6, vârsta mediană 56 ani (IQR 32-65)) sau critic (n = 6; vârsta mediană 63 ani (IQR 60-82)) pneumonie [ 25 ], doza mare de vitamina C a fost administrată în decurs de 24 de ore după agravarea bolii. Intervalul mediu de la primul simptom la inițierea vitaminei C a fost de 3,5-8 zile în grupul sever și de 5-19 zile în cel critic, în timp ce doza mediană de vitamina C a fost respectiv 162,7 mg / kg / zi (71,1-328,6) și 178,6 mg / kg / zi (133,3-350,6). Administrarea de vitamina C a fost asociată cu o scădere semnificativă a numărului de proteine ​​C reactive, limfocite și celule T CD4 +, precum și o îmbunătățire a PaO 2 / FiO 2 și scorul de evaluare a insuficienței organice (SOFA), care a fost mai bun în grupul sever comparativ cu cel critic.

În plus, utilizarea vitaminei C (doză: 3 g / zi) la doi pacienți cu infecție SARS-CoV-2 și sindrom de scurgere capilară pulmonară și care au avut un rezultat bun a fost descrisă într-un studiu de caz din Tunisia 26 ]. 

Pe de altă parte, alte studii nu au găsit niciun rezultat pozitiv asociat cu administrarea de vitamina C. Două rapoarte de cazuri diferite din SUA au raportat mortalitatea la pacienții cu afecțiuni critice care au fost tratați și cu vitamina C. Într-un raport de caz [ 27]], un pacient de sex masculin în vârstă de 29 de ani cu COVID-19 a dezvoltat pneumonie complicată de ARDS sever și insuficiență multi-organică. A primit tratament cu vitamina C împreună cu terapia prin inhalare și măsuri de susținere, dar starea sa s-a înrăutățit în ciuda acestor terapii și a murit. În mod similar, într-un alt raport de caz, o femeie în vârstă de 77 de ani a primit doză mare de vitamina C (6 g de 2 ori pe zi, apoi 1 g / zi – FOARTE PUTIN!!!) împreună cu tratamente antivirale și alte tratamente [ 28 ]. Pacientul a dezvoltat insuficiență de organ și a murit în ciuda acestor eforturi.

Un efect advers asociat cu administrarea intravenoasă de doză mare de vitamina C (doză: 200 mg / kg / zi, timp de 96 de ore) a fost raportat într-un studiu italian pe doi pacienți cu sepsis asociat COVID-19 [ 29]. Pacienții au dezvoltat o leziune tubulară acută (ATI) și nefropatie oxalată după 2 și 8 zile de tratament. Primul pacient a fost un bărbat de 50 de ani care a primit o doză mare de vitamina C (doză totală: 112 g) care nu a reușit să prevină șocul septic. El a dezvoltat o leziune renală acută, dar starea respiratorie sa îmbunătățit și a fost ulterior extubată și externată acasă. Celălalt pacient a fost un bărbat de 71 de ani (doză totală: 160 g) care a dezvoltat o insuficiență renală care necesită înlocuire renală prin hemodializă. Cu toate acestea, starea respiratorie a pacientului s-a îmbunătățit și a fost externat acasă. Ambele probe de biopsie renală ale pacienților au prezentat ATI extins cu cristale de oxalat de calciu și, conform autorilor, cea mai probabilă cauză a hiperoxaluriei a fost administrarea de vitamina C, prin conversia acidului ascorbic în oxalat.

3.2. Studii observaționale

Într-un studiu retrospectiv efectuat în SUA [ 30 ], din 102 pacienți admiși la serviciul de terapie intensivă cu COVID-19, 73 de pacienți au primit suplimente cu vitamina C și zinc (71,6%; 36 afro-americani, 24 hispanici, 5 caucazieni) . Rezultatele acestui studiu au arătat o mortalitate globală ridicată și nicio modificare a supraviețuirii globale a pacienților tratați cu suplimente de vitamina C și zinc.

În schimb, un studiu retrospectiv american pe 79 de pacienți cu pneumonie COVID-19 care necesită ventilație mecanică a constatat că pacienții tratați cu vitamina C au un risc scăzut de mortalitate (OR = 0,39, IÎ 95% 0,20-0,77) [ 31 ].

Există studii observaționale suplimentare care raportează utilizarea obișnuită a vitaminei C în cohorte mari, fără a furniza date privind rezultatele acestor pacienți. Un studiu retrospectiv chinez pe 596 de pacienți cu COVID-19 [ 32 ] a raportat un total de 95 de subiecți tratați cu vitamina C, mai frecvent în rândul pacienților cu boli cardiovasculare decât fără (23,3% față de 11,8%). Cu toate acestea, nu au fost furnizate date privind rezultatul clinic al grupului tratat. Un alt studiu transversal chinez pe 58 de pacienți cu COVID-19 [ 33 ] a raportat administrarea de vitamina C la un total de 40 de pacienți, dar nu au fost furnizate informații despre rezultatul asociat acestei terapii.

3.3. Studii clinice

Într-un studiu clinic de fază 1 efectuat în Iran [ 34 ], cinci pacienți (M: F = 2: 3, vârsta medie 62,8 ± 16 ani) cu pneumonie COVID-19 în stadiul final (nivel scăzut de conștiință și / sau suferință respiratorie) li s-a administrat o combinație de albastru de metilen-vitamina C (doză: 1500 mg / kg-N-acetil cisteină ca terapie compasională. În timp ce patru pacienți și-au îmbunătățit atât simptomele respiratorii, cât și saturația de oxigen și, în consecință, au fost externate la o medie de 10 (4-23) zile, un pacient a întrerupt terapia din cauza limitărilor neașteptate ale preparatului medicamentos și a decedat în a doua zi.

Un mic ECA deschis deschis efectuat în Pakistan [ 35 ] a comparat efectul a 1,5 g vitamina C IV la fiecare 6 ore timp de 5 zile plus lopinavir / ritonavir și hidroxiclorochină orală vs. Covid19 infecție. Autorii nu au găsit nicio diferență în durata șederii în terapia intensivă ( p   > 0,05), rata de intubație ( p   > 0,05) și rata mortalității (trei cazuri în fiecare braț, p   > 0,05) între cele două grupuri. Pe de altă parte, temperatura corpului a fost mai mică (36,8 ± 0,5 vs. 37,2 ± 0,7, p = 0,001) și SatO 2 mai mare (90,5 [88,0-92,0] vs. 88,0 [80,0-91,0], p= 0,014) la pacienții cărora li s-a administrat vitamina C în comparație cu grupul martor. Cu toate acestea, durata spitalizării a fost mai mare (8,5 zile față de 6,5 zile, p = 0,028) la pacienții tratați cu vitamina C decât la cei fără.

Într-un RCT multicentric efectuat în China [ 36 ], 56 de pacienți cu infecție severă cu SARS-CoV-2 au fost randomizați pentru a primi fie placebo, fie doză mare de vitamina C (doză: 12 g / 50 ml la fiecare 12 H timp de 7 zile, 12 mL / h). Nu s-a găsit nicio diferență în ceea ce privește zilele invazive fără ventilație mecanică în 28 de zile și mortalitatea de 28 de zile, în timp ce grupul cu vitamina C a raportat o creștere a PaO 2 / FiO 2 (229 față de 151 mmHg, IC 95% 33 la 122) și niveluri mai scăzute de IL-6 în ziua 7 (19,4 vs. 158,0, IC 95% -301,7 până la -29,8). În plus, mortalitatea ICU a pacienților severi cu scor SOFA ≥ 3 a fost îmbunătățită după administrarea vitaminei C (HR = 0,22, IC 95% 0,1-0,9).

Într-un ECA deschis deschis efectuat în Pakistan [ 37 ] la 150 de pacienți cu infecție severă COVID-19, brațul de control ( n = 75) a primit o terapie standard (antipiretice, dexametazona și antibiotice profilactice) în timp ce brațul intervențional ( n = 75) ) a primit terapia standard si în plus vitamina C IV (doză: 50 mg / kg / zi). Ultimul grup a devenit lipsit de simptome mai devreme (7,1 ± 1,8 vs. 9,6 ± 2,1 zile) și a raportat o durată mai mică de spitalizare (8,1 ± 1,8 vs. 10,7 ± 2,2 zile) comparativ cu grupul de control, în timp ce nu s-a găsit nicio diferență semnificativă în nevoia de ventilație mecanică și mortalitate.

Într-un alt ECA multicentric deschis deschis efectuat în SUA [ 38 ], 214 pacienți cu infecție SARS-CoV-2 gestionată în ambulatorii au primit repartizarea acidului ascorbic (8000 mg), gluconat de zinc (50 mg), ambii agenți, sau standard de îngrijire timp de zece zile. Studiul a fost oprit devreme pentru inutilitate, deoarece puterea condiționată a fost <30% pentru cele trei grupuri de tratament comparativ cu placebo.

Caracteristicile și constatările cheie ale studiilor încheiate, atât observaționale, cât și intervenționale, sunt date în tabelul 1.

tabelul 1

Caracteristicile și constatările studiilor observaționale și intervenționale încheiate care investighează efectul vitaminei C la pacienții cu infecție SARS-CoV-2.

Primul autor, anul și țaraPopulațiaDesign de studiuExpunere / Intervenție cu dozareRezultateDescoperiri cheie
Capone S. și colab., SUA, 2020 [ 30 ]102 pacienți
(vârsta medie 63 de ani) afectați de SARS-CoV-2 și gestionați de
echipa de terapie intensivă
Observațional, retrospectivSuplimentarea
vitaminei C (plus zinc). Posologia nu este specificată
Supraviețuirea generală72% au primit
suplimente cu
vitamina C și zinc. Nu s-a observat nicio
asociere între
vitamina C și
supraviețuirea generală
Krishnana S. și colab., SUA, 2020 [ 31 ]152 de pacienți
(vârsta mediană de 68 de ani) afectați de SARS-CoV-2,
care necesită ventilație mecanică
Observațional, retrospectivSuplimentarea vitaminei C. Posologia nu este specificatăSupraviețuirea generală52% au primit suplimentarea cu vitamina C. Supraviețuirea a fost mai mare la pacienții tratați cu vitamina C (65%, față de 43%, p = 0,007)
Li J. și colab., China, 2020 [ 32 ]596 pacienți (vârsta medie 56 ani) afectați de SARS-CoV-2, evaluați la spitalObservațional, retrospectivSuplimentarea vitaminei C. Posologia nu este specificatăPrognosticul pacienților cu și fără boli cardiovasculare16% au primit vitamina C. Pacienții cu boli cardiovasculare au primit vitamina C mai frecvent (23% față de 12%, p <0,001) decât pacienții fără. Nu au fost disponibile date privind prognosticul legat de suplimentarea cu vitamina C
Liu XH și colab., China, 2020 [ 33 ]58 de pacienți (vârsta mediană de 29 de ani) au fost internați la spital cu o infecție cu SARS-CoV-2Observațional, retrospectivSuplimentarea vitaminei C. Posologia nu este specificatăClinical characteristics69% received vitamin C. No data about the association between vitamin C and clinical outcomes were available
Alamdari DH et al., Iran, 2020 [34]5 patients (mean age 63 years) admitted to ICU for respiratory distress due to SARS-CoV-2 infectionPhase-I clinical trialAdministration of vitamin C (1500 mg/kg) both oral and intravenousRespiratory symptoms and safetyFour patients showed improvement both in respiratory symptoms and oxygen saturation after vitamin C administration. The patients were discharged in 10 (4–23) days. One patient discontinued the therapy due to limitations of the drug preparation and expired on the second day of admission
JamaliMoghadamSiahkali S. et al., Pakistan, 2020 [35]A total of 60 patients with a severe SARS-CoV-2 infection: 30 patients (mean age 58 years) received lopinavir/rito- navir and hydroxychloroquine plus vitamin C and 30 (mean age 61 years) only lopinavir/rito- navir and hydroxychloroquineRandomized open-label clinical trialAdministration of intravenous vitamin C (1.5 g every six hours, total 6 g daily)The main outcomes were: decrease in mortality, length of hospitalization, and number of patients admitted to ICU. Secondary outcomes were: increase in SpO2 and improvements in vital signs and overall wellbeingPatients managed with and without vitamin C did not differ for any of the outcomes, except for body temperature (36.8 ± 0.5 vs. 37.2 ± 0.7, respectively, p = 0.001) and SpO2 (90.5 [88.0–92.0] vs. 88.0 [80.0–91.0], respectively p = 0.014) on third day of hospitalization. On the contrary, length of hospitalization was higher in patients managed with vitamin C (8.5 days vs. 6.5 days, p = 0.028)
Zang J. et al., China, 2021 [36]56 patients (mean age 67 years) with a SARS-CoV-2 infection admitted to intensive careRandomized,
controlled, clinical trial
Administration of intravenous vitamin C (12 g every 12 h, total 24 g daily) for 7 daysThe main outcome was invasive mechanical ventilation-free days in 28 days. Secondary outcomes were 28-day mortality, organ failure severity, and interleukin-6 levelsPatients managed with and without vitamin C showed no difference in terms of invasive mechanical ventilation-free days in 28 days and 28-day mortality. A rise in the PaO2/FiO2 (229 vs. 151 mmHg, 95% CI 33 to 122) and lower levels of IL-6 on day 7 (19.42 vs. 158.00, 95% CI −301.72 to −29.79), lower ICU mortality (Hazard Ratio = 0.22, 95% CI 0.1–0.9) in patients with severe multiorgan score failure were observed in patients managed with vitamin C.
Kumari P. et al., Pakistan, 2020 [37]A total of 150 patients admitted for a SARS-CoV-2 infection: 75 (mean age 52 years) were managed with vitamin C and 75 (mean age 53 years) withoutRandomized controlled trialAdministration of intravenous vitamin C (50 mg/kg/day). Length of the intervention not specifiedThe endpoints were: number of days before symptoms disappearance, length of hospital stay, need for ventilation and mortalityPatients managed with vitamin C were symptom-free earlier (7.1 ± 1.8 vs. 9.6 ± 2.1 days, p < 0.0001)) and had a shorter duration of hospitalization (8.1 ± 1.8 vs. 10.7 ± 2.2 days, <0.0001) compared to patients managed without vitamin C. No difference was observed in the need for mechanical ventilation and mortality
Thomas S. et al., USA, 2021 [38]Un total de 214 pacienți ambulatori cu infecție cu SARS-CoV-2: 48 (vârsta medie 46 ani) au fost tratați cu vitamina C, 50 (vârsta medie 42 ani) cu îngrijirea standard, 58 (vârsta medie 44 ani) cu zinc și 58 (vârsta medie 49 de ani) cu vitamina C și zincTest randomizat factorial deschisAdministrarea de: (1) vitamina C (8000 mg de 2-3 ori pe zi), (2) 50 mg de gluconat de zinc, (3) atât vitamina C, cât și zincRezultatul principal a fost numărul de zile pentru a obține o reducere cu 50% a simptomelor. Rezultatele secundare au fost: zile necesare pentru rezolvarea simptomelor, simptome cumulate ale scorului de severitate în ziua 5, spitalizări, medicamente prescrise adjuvant, mortalitate și siguranțăStudiul a fost încheiat din lipsă de beneficii după analiza intermediară

Deschideți într-o fereastră separată

3.4. studii clinice în curs de desfasurare

Trei ECA mari sunt încă în desfășurare, iar datele privind asocierea dintre administrarea vitaminei C și rezultatele pacienților sunt încă în așteptare. Un studiu clinic multicentric, dublu-orb, [ 39 ] efectuat în SUA la 829 de participanți, a randomizat pacienții să primească fie hidroxiclorochină, fie acid ascorbic (doză: 500 mg timp de 3 zile, apoi 250 mg timp de 11 zile pe cale orală) ca profilaxia post-expunere pentru prevenirea SARS-COV2 la adulții expuși la virus. Deși studiul s-a încheiat în octombrie 2020, rezultatele sale nu au fost publicate până acum. În mod similar, într-un studiu clinic randomizat, cu un singur orb, cu două brațe (1: 1), în paralel, cu studii clinice [ 40] efectuate în Iran la pacienții cu terapie intensivă cu COVID-19, grupul de tratament a primit vitamina A (25.000 UI pe zi), vitamina D (600.000 UI o dată), vitamina E (300 UI de două ori pe zi), vitamina B și vitamina C (doză: 500 mg, de patru ori pe zi) timp de 7 zile, în timp ce grupul de control nu a primit nici suplimente, nici placebo. De la începutul acestui studiu, în aprilie 2020, nu au fost publicate rezultate. În plus, un studiu chinez [ 41 ] multicentric prospectiv randomizat controlat cu placebo a recrutat până acum 56 de participanți cu COVID-19 pentru a primi aleatoriu 12 g de vitamina C IV (diluată în 50 ml de apă sterilă, repetată la fiecare 12 ore, total doza 24 g / zi) vs. placebo de 50 ml apă sterilă, timp de 7 zile. Ultima actualizare a avut loc în octombrie 2020, iar rezultatele acestui studiu nu sunt încă publicate.Mergi la:

4. Discutie

Această revizuire a urmărit să rezume cunoștințele actuale privind tratamentul cu vitamina C la pacienții cu COVID-19, pe baza publicațiilor disponibile de anul trecut.

Deși fundalul teoretic asupra rolului important al vitaminei C în reglarea imunitară în timpul infecțiilor este profund, efectul terapeutic al tratamentului cu vitamina C în infecțiile respiratorii și pacienții cu probleme critice este încă controversat. Utilitatea tratamentului cu vitamina C la pacienții cu COVID19 este încă în curs de investigare la nivel mondial.

Așa cum este detaliat în această revizuire, există mai multe rapoarte ale pacienților cu COVID-19 care au fost tratați cu vitamina C în diferite condiții și au experimentat îmbunătățiri clinice după administrarea administrării de vitamina C. Cu toate acestea, majoritatea publicațiilor descrise în această revizuire sunt observaționale, multe dintre ele sunt rapoarte de cazuri și serii de cazuri mici, care exclud capacitatea de a asocia orice efect benefic în mod specific tratamentului cu vitamina C. Aceste rapoarte ar trebui abordate ca observații clinice, deoarece cauzalitatea nu a putut fi susținută între administrarea de vitamina C și îmbunătățirea stării medicale a pacienților. Cu toate acestea, unele dintre studiile clinice preliminare au arătat rezultate încurajatoare în rândul grupurilor de intervenție care utilizează doză mare de vitamina C, așa cum s-a menționat în această revizuire. Rezultatele ECR în curs sunt încă în așteptare,și sunt necesare cercetări suplimentare de înaltă calitate pentru a sprijini beneficiul potențial al vitaminei C în tratamentul pacienților cu infecție cu SARS-CoV-2. Datele privind un posibil efect al vitaminei C împotriva infecției cu SARS-CoV-2 la copii nu sunt disponibile până în prezent. În plus, nu există dovezi care să susțină suplimentarea de rutină cu vitamina C a persoanelor sănătoase pentru prevenirea COVID-19.

În prezent, lipsesc dovezile care susțin utilizarea terapeutică a vitaminei C la pacienții cu COVID-19 sever și nu s-ar putea da recomandări pe această bază. Având în vedere fiziopatologia și contextul teoretic, împreună cu rapoartele preliminare și studiile menționate anterior, rolul vitaminei C în tratamentul pacienților cu infecție cu SARS-CoV-2 ar trebui investigat în continuare.Mergi la:

Contribuțiile autorului

GPM și AG-M. a conceptualizat studiul. MM și AG-M. a efectuat căutarea literaturii. GPM și MM au extras datele. Toți autorii au interpretat rezultatele, au scris manuscrisul și l-au aprobat așa cum au fost trimise. Toți autorii au citit și au acceptat versiunea publicată a manuscrisului.Mergi la:

Finanțarea

Această cercetare nu a primit finanțare externă.Mergi la:

Declarația comitetului de revizuire instituțională

Nu se aplică.Mergi la:

Declarație de consimțământ informat

Nu se aplică.Mergi la:

Declarație privind disponibilitatea datelor

La cererea rezonabilă a autorului corespunzător.Mergi la:

Conflicte de interes

Autorii nu declară niciun conflict de interese.Mergi la:

Note de subsol

Nota editorului: MDPI rămâne neutru în ceea ce privește revendicările jurisdicționale din hărțile publicate și afilierile instituționale.Mergi la:

Referințe

1. Linster CL, Van Schaftingen E. Vitamina C. Biosinteza, reciclarea și degradarea la mamifere. FEBS J. 2007; 274 : 1-22. doi: 10.1111 / j.1742-4658.2006.05607.x. [ PubMed ] [ CrossRef ] [ Google Scholar ]2. Cerullo G., Negro M., Parimbelli M., Pecoraro M., Perna S., Liguori G., Rondanelli M., Cena H., D’Antona G. The Long History of Vitamin C: From Prevention of the Răceală obișnuită la ajutor potențial în tratamentul COVID-19. Față. Immunol. 2020; 11 : 2036. doi: 10.3389 / fimmu.2020.574029. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]3. Vissers MCM, deficitul de ascorbat RP Wilkie are ca rezultat afectarea apoptozei și clearance-ului neutrofilelor și este asociat cu reglarea în sus a factorului inductibil de hipoxie 1α J. Leukoc. Biol. 2007; 81 : 1236–1244. doi: 10.1189 / jlb.0806541. [ PubMed ] [ CrossRef ] [ Google Scholar ]4. Carr AC, Maggini S. Vitamina C și funcția inmune. Nutrienți. 2017; 9 : 1211. doi: 10.3390 / nu9111211. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]5. Hemilä H. Vitamina C și infecțiile. Nutrienți. 2017; 29 : 339. doi: 10.3390 / nu9040339. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]6. Bakaev VV, Duntau AP Acid ascorbic în serul sanguin al pacienților cu tuberculoză pulmonară și pneumonie. Int. J. Tuberc. Disemie pulmonară. 2004; 8 : 263–266. [ PubMed ] [ Google Scholar ]7. Hemilä H. Vitamina C și răceala obișnuită. Fr. J. Nutr. 1992; 67 : 3–16. doi: 10.1079 / BJN19920004. [ PubMed ] [ CrossRef ] [ Google Scholar ]8. Carr AC, Rosengrave PC, Bayer S., Chambers S., Mehrtens J., Shaw GM Hypovitaminosis C și deficiența vitaminei C la pacienții cu afecțiuni critice, în ciuda aporturilor enterale și parenterale recomandate. Crit. Îngrijire. 2017; 21 : 300. doi: 10.1186 / s13054-017-1891-y. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]9. Schorah CJ, Downing C., Piripitsi A., Gallivan L., Al-Hazaa AH, Sanderson MJ, Bodenham A. Concentrații totale de vitamina C, acid ascorbic și acid dehidroascorbic în plasmă la pacienții cu afecțiuni critice. A.m. J. Clin. Nutr. 1996; 63 : 760–765. doi: 10.1093 / ajcn / 63.5.760. [ PubMed ] [ CrossRef ] [ Google Scholar ]10. Li R., Guo C., Li Y., Qin Z., Huang W. Ținte terapeutice și mecanisme de semnalizare a activității vitaminei C împotriva sepsisului: un studiu bioinformatic. Scurt Bioinf. 2020 doi: 10.1093 / bib / bbaa079. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]11. Pauling L. Semnificația dovezilor despre acidul ascorbic și răceala obișnuită. Proc. Natl. Acad. Știință. STATELE UNITE ALE AMERICII. 1971; 68 : 2678–2681. doi: 10.1073 / pnas.68.11.2678. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]12. Dykes MH, Meier P. Acid ascorbic și răceala obișnuită. Evaluarea eficacității și toxicității sale. JAMA. 1975; 231 : 1073–1079. doi: 10.1001 / jama.1975.03240220051025. [ PubMed ] [ CrossRef ] [ Google Scholar ]13. Hemilä H., Chalker E. Vitamina C pentru prevenirea și tratarea răcelii obișnuite. Baza de date Cochrane Syst. Rev. 2013 doi: 10.1002 / 14651858.CD000980.pub4. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]14. Padhani ZA, Moazzam Z., Ashraf A., Bilal H., Salam RA, Das JK, Bhutta ZA Supliment de vitamina C pentru prevenirea și tratamentul pneumoniei. Baza de date Cochrane Syst. Rev. 2020; 27 doi: 10.1002 / 14651858.CD013134.pub2. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]15. Syed AA, Knowlson S., Sculthorpe R., Farthing D., DeWilde C., Farthing CA, Larus TL, Martin E., Brophy DF, Gupta S., și colab. Studiu de siguranță de fază I a acidului ascorbic intravenos la pacienții cu sepsis sever. J. Transl. Med. 2014; 12 : 32. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]16. Fowler AA, III, Truwit JD, Hite RD, Morris PE, DeWilde C., Priday A., Fisher B., Thacker LR, II, Natarajan R., Brophy DF și colab. Efectul perfuziei cu vitamina C asupra insuficienței organelor și a biomarkerilor de inflamație și leziuni vasculare la pacienții cu septicemie și insuficiență respiratorie acută severă: studiul clinic randomizat CITRIS-ALI. JAMA. 2019; 322 : 1261–1270. doi: 10.1001 / jama.2019.11825. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]17. Wei X.-B., Wang Z.-H., Liao X.-L., Guo W.-X., Wen J.-Y., Qin T.-H., Wang S.-H. Eficacitatea vitaminei C la pacienții cu sepsis: o meta-analiză actualizată. Euro. J. Pharmacol. 2020; 868 : 172889. doi: 10.1016 / j.ejphar.2019.172889. [ PubMed ] [ CrossRef ] [ Google Scholar ]18. Zhang M., Suplimentarea cu vitamina C Jativa DF la bolnavii critici: o revizuire sistematică și meta-analiză. SAGE Open Med. 2018; 6 doi: 10.1177 / 2050312118807615. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]19. Langlois PL, Manzanares W., Adhikari NA-O., Lamontagne F., Stoppe CA-O., Hill A., Heyland DK Vitamin C Administration to the Critically Boils: A Systematic Review and Meta-Analysis. JPEN. 2019; 43 : 335-346. doi: 10.1002 / jpen.1471. [ PubMed ] [ CrossRef ] [ Google Scholar ]20. Hemilä H., Chalker E. Vitamina C poate reduce durata ventilației mecanice la pacienții cu boli critice: O analiză meta-regresie. J. Terapie intensivă. 2020; 8 : 15. doi: 10.1186 / s40560-020-0432-y. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]21. Khan HMW, Parikh N., Megala SM, Predeteanu GS, Waqas Khan HM, Parikh N., Megala SM, Predeteanu GS Recuperare precoce neobișnuită a unui pacient critic COVID-19 după administrarea de vitamina C. intravenoasă Am. J. Reprezentant de caz 2020; 21 : 1–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]22. Hiedra R., Lo KB, Elbashabsheh M., Gul F., Wright RM, Albano J., Azmaiprashvili Z., Patarroyo Aponte G. Utilizarea vitaminei C IV pentru pacienții cu COVID-19: un studiu observațional cu un singur centru . Expert Rev. Anti-Infect. Ther. 2020; 18 : 1259–1261. doi: 10.1080 / 14787210.2020.1794819. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]23. Chen Y., Chen W., Zhou J., Sun C., Lei Y. Cavitate pulmonară mare în raportul cazului pacientului vindecat COVID-19. Ann. Palliat. Med. 2020; 9 doi: 10.21037 / apm-20-452. [ PubMed ] [ CrossRef ] [ Google Scholar ]24. Ding H., Deng W., Ding L., Ye X., Yin S., Huang W. Acid gliciretinic și derivații săi ca medicament alternativ potențial pentru ameliorarea simptomelor la pacienții COVID-19 nehospitalizați. J. Med. Virol. 2020; 92 : 2200-2204. doi: 10.1002 / jmv.26064. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]25. Zhao B., Ling Y., Li J., Peng Y., Huang J., Wang Y., Qu H., Gao Y., Li Y., Hu B., și colab. Aspecte benefice ale dozei mari de vitamina C intravenoasă la pacienții cu pneumonie covid-19 în stare gravă: un studiu de caz retrospectiv. Ann. Palliat. Med. 2020; 9 : 1-11. doi: 10.21037 / apm-20-1387. [ PubMed ] [ CrossRef ] [ Google Scholar ]26. Bahloul M., Ketata W., Lahyeni D., Mayoufi H., Kotti A., Smaoui F., Kallel N., Daoud E., Bouaziz M., Kammoun S. Sindromul de scurgere capilară pulmonară după virusul COVID-19 infecţie. J. Med. Virol. 2020 doi: 10.1002 / jmv.26152. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]27. Deliwala SS, Ponnapalli A., Seedahmed E., Berrou M., Bachuwa G., Chandran A. Un bărbat de 29 de ani cu un caz fatal de sindrom de detresă respiratorie acută covid-19 (Carduri) și indus de ventilator leziuni pulmonare (vili) Am. J. Reprezentant de caz 2020; 21 : 1–6. doi: 10.12659 / AJCR.926136. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]28. Douedi S., Miskoff J. Novel coronavirus 2019 (COVID-19) Medicină. 2020; 99 : e20207. doi: 10.1097 / MD.0000000000020207. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]29. Fontana F., Cazzato S., Giovanella S., Ballestri M., Leonelli M., Mori G., Alfano G., Ligabue G., Magistroni R., Cenacchi G., și colab. Nefropatie oxalată cauzată de administrarea excesivă de vitamina C la 2 pacienți cu COVID-19. Rinichi Int. Rep. 2020; 5 : 1815–1822. doi: 10.1016 / j.ekir.2020.07.008. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]30. Capone S., Abramyan S., Ross B., Rosenberg J., Zeibeq J., Vasudevan V., Samad R., Gerolemou L., Pinelis E., Gasperino J., și colab. Caracterizarea pacienților cu boală critică COVID-19 la un spital din Brooklyn Safety-Net. Cureus. 2020; 12 doi: 10.7759 / cureus.9809. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]31. Krishnan S., Patel K., Desai R., Sule A., Paik P., Miller A., ​​Barclay A., Cassella A., Lucaj J., Royster Y., și colab. Comorbidități clinice, caracteristici și rezultate ale pacienților ventilați mecanic în statul Michigan cu pneumonie SARS-CoV-2. J. Clin. Anestezie. 2020; 67 : 110005. doi: 10.1016 / j.jclinane.2020.110005. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]32. Li J., Guo T., Dong D., Zhang X., Chen X., Feng Y., Wei B., Zhang W., Zhao M., Wan J. Definirea riscului de deces al bolilor de inimă în COVID- 19 infecție. QJM. 2020 doi: 10.1093 / qjmed / hcaa246. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]33. Liu X.-H., Lu S.-H., Chen J., Xia L., Yang Z.-G., Charles S., Yang Y., Lin Y., Lu H.-Z. Caracteristicile clinice ale cazurilor COVID-19 importate în străinătate în Shanghai, China. Emerg. Microbii infectează. 2020; 9 : 1230–1232. doi: 10.1080 / 22221751.2020.1766383. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]34. Alamdari DH, Moghaddam AB, Amini S., Keramati MR, Zarmehri AM, Alamdari AH, Damsaz M., Banpour H., Yarahmadi A., Koliakos G. Aplicarea albastru de metilen -vitamină C-N-acetil cisteină pentru tratament a bolnavilor cu COVID-19 bolnavi critici, raportul unui studiu clinic de fază I. Euro. J. Pharmacol. 2020; 885 : 173494. doi: 10.1016 / j.ejphar.2020.173494. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]35. JamaliMoghadamSiahkali S., Zarezade B., Koolaji S., SeyedAlinaghi S., Zendehdel A., Tabarestani M., Sekhavati Moghadam E., Abbasian L., Dehghan Manshadi SA, Salehi M., și colab. Siguranța și eficacitatea dozei mari de vitamina C la pacienții cu COVID-19: un studiu clinic randomizat deschis. Euro. J. Med. Rez. 2021; 26 : 20. doi: 10.1186 / s40001-021-00490-1. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]36. Zhang J., Rao X., Li Y., Zhu Y., Liu F., Guo G., Luo G., Meng Z., De Backer D., Xiang H., și colab. Test pilot al dozei mari de vitamina C la pacienții cu COVID-19 bolnavi în stare critică. Ann. Terapie intensivă. 2021; 11 : 3-14. doi: 10.1186 / s13613-020-00792-3. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]37. Kumari P., Dembra S., Dembra P., Bhawna F., Gul A., Ali B., Sohail H., Kumar B., Memon MK, Rizwan A. Rolul vitaminei C ca terapie adjuvantă în COVID -19. Cureus. 2020; 12 : 10-13. doi: 10.7759 / cureus.11779. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]38. Thomas S., Patel D., Bittel B., Wolski K., Wang Q., Kumar A., ​​Il’Giovine ZJ, Mehra R., McWilliams C., Nissen SE și colab. Efectul suplimentării cu doză mare de zinc și acid ascorbic față de îngrijirea obișnuită asupra duratei și reducerii simptomelor la pacienții ambulatori cu infecție cu SARS-CoV-2: studiul clinic randomizat COVID A la Z. JAMA Netw. Deschis. 2021; 4 : e210369. doi: 10.1001 / jamanetworkopen.2021.0369. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]39. Barnabas RV, Brown E., Bershteyn A., Miller RS, Wener M., Celum C., Wald A., Chu H., Wesche D., Baeten JM Eficacitatea hidroxiclorochinei pentru profilaxia post-expunere pentru prevenirea acutelor severe sindrom respirator coronavirus 2 (SARS-CoV-2) infecție la adulții expuși bolii coronavirus (COVID-19): un rezumat structurat al unui protocol de studiu pentru un randomis. Încercări. 2020; 21 : 475. doi: 10.1186 / s13063-020-04446-4. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]40. Beigmohammadi MT, Bitarafan S., Hoseindokht A., Abdollahi A., Amoozadeh L., Mahmoodi Ali Abadi M., Foroumandi M. Impactul suplimentelor de vitamine A, B, C, D și E asupra îmbunătățirii și ratei mortalității în Pacienți cu terapie intensivă cu coronavirus-19: un rezumat structurat al unui protocol de studiu pentru un studiu controlat randomizat. Încercări. 2020; 21 : 614. doi: 10.1186 / s13063-020-04547-0. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]41. Liu F., Zhu Y., Zhang J., Li Y., Peng Z. Doza mare de vitamina C intravenoasă pentru tratamentul COVID-19 sever: Protocol de studiu pentru un studiu controlat randomizat multicentric. BMJ Open. 2020; 10 doi: 10.1136 / bmjopen-2020-039519. [ Articol gratuit PMC ] [ PubMed ] [ CrossRef ] [ Google Scholar ]


Articolele de la Nutrients sunt furnizate aici prin amabilitatea Institutului de Publicare Digitală Multidisciplinară (MDPI)

Vitamina C intravenoasă cu doză mare pentru prevenirea agravării bolii a pneumoniei COVID-19 moderate. O tendință retrospectivă potrivită înainte-după studiu

www.frontiersin.orgBing Zhao  , www.frontiersin.orgMin Liu  , Ping Liu  , Yibing Peng 4 , Jun Huang 5 , www.frontiersin.orgMengjiao Li 1 , www.frontiersin.orgYihui Wang 1 , www.frontiersin.orgLiLi Xu 1 , www.frontiersin.orgSilei Sun 1 , www.frontiersin.orgXing Qi 1 , Yun Ling 6 , www.frontiersin.orgJian Li 7 , Wenhong Zhang 8 , Enqiang Mao 1 * și Jieming Qu 9 *

  • 1 Departamentul de Urgență al Spitalului Ruijin, Școala de Medicină a Universității Jiao Tong din Shanghai, Shanghai, China
  • 2 Departamentul de Gastroenterologie, Centrul Clinic de Sănătate Publică din Shanghai, Shanghai, China
  • 3 Departamentul Tuberculozei, Centrul Clinic de Sănătate Publică din Shanghai, Universitatea Fudan, Shanghai, China
  • 4 Departamentul de Medicină de Laborator, Spitalul Ruijin, Școala de Medicină Universitatea Shanghai Jiaotong, Shanghai, China
  • 5 Institutul de Hipertensiune din Shanghai, Shanghai, China
  • 6 Departamentul de Boli Infecțioase, Centrul Clinic de Sănătate Publică din Shanghai, Shanghai, China
  • 7 Centrul de cercetare clinică din spitalul Ruijin, Școala de Medicină Universitatea Shanghai Jiao Tong, Shanghai, China
  • 8 Departamentul de Boli Infecțioase al Spitalului Shanghai Huashan, Universitatea Fudan, Shanghai, China
  • 9 Departamentul de Medicină pentru Respirație și Critică al Spitalului Ruijin, Școala de Medicină a Universității Jiao Tong din Shanghai, Shanghai, China

Context: pandemia bolii Coronavirus 2019 (COVID-19) continuă să aibă un impact asupra mai multor țări din întreaga lume și se dezvoltă în continuare opțiuni de tratament eficiente. În acest studiu, investigăm potențialul de doză mare de vitamina C intravenoasă (HDIVC) în prevenirea agravării moderate a bolii COVID-19.

Metode: În acest studiu clinic retrospectiv înainte și după caz, comparăm rezultatul și cursurile clinice ale pacienților cu pacienți cu COVID-19 moderate care au fost tratați cu un protocol HDIVC (injecție intravenoasă de vitamina C, 100 mg / kg / zi, 1 g / h, timp de 7 zile de la admitere) într-o perioadă de o lună (între 18 martie și 18 aprilie 2020, grup HDIVC) cu un grup de control tratat fără protocolul HDIVC în ultimele două luni (18 ianuarie – 18 martie , 2020). Pacienții din cele două grupuri au fost asortate într-un raport 1: 1 în funcție de vârstă și sex.

Rezultate: HDIVC și grupurile de control au cuprins fiecare 55 de pacienți. Pentru rezultatele primare, a existat o diferență semnificativă în numărul de pacienți care au evoluat de la tipul moderat la sever între cele două grupuri (HDIVC: 4/55 vs. control: 12/55, risc relativ [RR] = 0,28 [0,08, 0,93], P = 0,03). Comparativ cu grupul de control, a existat o durată mai scurtă a sindromului de răspuns inflamator sistemic (SIRS) ( P = 0,0004) în prima săptămână și apariția SIRS mai mică (2/21 vs 10/22, P = 0,0086) în ziua 7 (6) –7 zile după admitere). În plus, grupul HDIVC a avut niveluri mai scăzute de proteine ​​C reactive ( P = 0,005) și un număr mai mare de celule T CD4 + din ziua 0 (la admitere) până în ziua 7 ( P= 0,04). ” Nivelurile indicatorilor de coagulare, incluzând timpul de tromboplastină parțială activată și dimerul D, au fost, de asemenea, îmbunătățite în HDIVC comparativ cu grupul de control din ziua 7.

Concluzie: HDIVC poate fi benefic în limitarea agravării bolii în stadiul incipient al pneumoniei COVID-19, care poate fi legată de îmbunătățirile sale asupra răspunsului inflamator, a funcției imune și a funcției de coagulare. Sunt necesare alte studii controlate randomizate pentru a spori aceste constatări.

Nota traducatorului: obserbati ca doza perfuzata a fost foarte MICA comparativ cu cat se perfuzeaza in cancer sau cat a fost perfuzat in China in covid (aprox 24 grame pe zi China covid19/ 30- 50 grame pe zi cancer)

Introducere

Boala potențial fatală, boala coronavirusului 2019 (COVID-19), a provocat o pandemie mondială din decembrie 2019 ( Mahase, 2020 ; Spinelli și Pellino, 2020 ). Până la 10 septembrie 2020, SARS-CoV-2 afectase peste 200 de țări, rezultând peste 28 de milioane de cazuri confirmate și peste 900.000 de decese confirmate. În afară de corticosteroizi pentru COVID-19 sever și critic, puțini agenți s-au dovedit a fi definitiv eficienți în conformitate cu cele mai recente linii directoare ale Organizației Mondiale a Sănătății ( Anonim, 2020 ). În funcție de gravitate, COVID-19 este clasificat în tip ușor, moderat, sever și critic în conformitate cu orientările Comisiei Naționale de Sănătate și Planificare Familială din Republica Populară Chineză (Comisia Națională de Sănătate și Planificare Familială din Republica Populară Chineză, 2020 ).

Tipul sever se caracterizează în principal prin deteriorarea funcției respiratorii și progresia rapidă a leziunilor radiologice, în timp ce tipul critic necesită în plus ventilație mecanică și este însoțit de șoc sau insuficiență multiplă a organelor. Se raportează că aceste două tipuri sunt asociate cu o rată a mortalității de până la 66% ( Wu și colab., 2020 ). Una dintre cheile pentru îmbunătățirea prognosticului COVID-19 este prevenirea agravării bolii, mai ales atunci când severitatea bolii variază de la moderat, până la sever, la tip critic.

S-a sugerat că doza mare de vitamina C intravenoasă (HDIVC) exercită efecte benefice asupra diferitelor boli critice în studiile la animale și clinice ( Oudemans-van Straaten și colab., 2014 ). În studiul CITRIS-ALI ( Fowler și colab., 2019 ) s-a demonstrat că reducerea mortalității pe toate cauzele pe 28 de zile (29,8 vs 46,3%, P = 0,01) prin sepsis , iar acest rezultat a fost recent reanalizat de Hemilä și Chalker ( 2020) care au dezvăluit dovezi mai puternice atunci când analiza este limitată la cele patru zile în care a fost administrată vitamina C (mortalitate, 4,8 vs 22,9%, P = 0,0007). Dimpotrivă, un alt studiu recent, ACT, a constatat că o combinație de vitamina C, corticosteroizi și tiamină nu a exercitat niciun efect benefic asupra funcției organelor (Moskowitz și colab., 2020 ). Motivul administrării HDIVC în tratamentul pacienților cu COVID-19, așa cum am speculat, se bazează pe capacitatea sa de a elimina în mod eficient creșterea speciilor reactive de oxigen și răspunsul inflamator necontrolat care rezultă și disfuncția organelor. În plus, s-a demonstrat că vitamina C are proprietăți potențiale de îmbunătățire a imunității, care pot ajuta la îmbunătățirea limfopeniei, principala caracteristică a COVID-19 care este asociată cu severitatea ( Wang și colab., 2020 ). Administrarea HDIVC în COVID-19 a primit deja multă atenție ( Carr și Rowe, 2020 ; Cerullo și colab., 2020). În acest studiu retrospectiv înainte-după caz, am investigat dacă HDIVC ar putea preveni agravarea bolii de la tipul moderat la tipul sever și efectul său asupra răspunsului inflamator, funcției imune și funcției organelor.

Metode

Proiectarea studiului și participanții

Acest studiu a fost o retrospectivă electronică bazată pe dosarul de sănătate, înainte și după studiu clinic asociat cu cazurile. A fost efectuată în conformitate cu Declarația modificată de la Helsinki (revizuită în 2013) și aprobată de Comitetul de Etică Instituțională al Spitalului Ruijin, Școala de Medicină a Universității Shanghai Jiao Tong și a fost înregistrată retrospectiv în Registrul de urmări clinice din China (ChiCTR2000033050 ). Acest studiu a fost realizat la Centrul Clinic de Sănătate Publică din Shanghai. Din 18 martie 2020, am început să folosim protocolul HDIVC în tratamentul pacienților cu COVID-19. Pentru a investiga efectul HDIVC în prevenirea agravării bolii, am examinat pacienții internați în perioada 18 martie 2020 – 18 aprilie 2020 care au acceptat tratamentul HDIVC. Criteriile de includere pentru grupul HDIVC au fost:

1) Pacienți cu COVID-19 cu un diagnostic de tip moderat la internare; 2) vârsta> 18 ani; 3) paciente care nu erau însărcinate și nu prezentau tumori maligne. Diagnosticul și clasificarea severității au urmat liniile directoare ale Comisiei Naționale de Sănătate și Planificare Familială din Republica Populară Chineză ( Comisia Națională de Sănătate și Planificare Familială din Republica Populară Chineză, 2020). Pentru grupul de control, am examinat retrospectiv pacienții care au fost internați în cele două luni anterioare (între 17 ianuarie 2020 și 17 martie 2020) în conformitate cu aceleași criterii ca și cei din grupul HDIVC. Acești pacienți nu primiseră protocolul HDIVC Potrivirea scorului de propensitate a fost efectuată pentru a minimiza impactul potențialilor confundanți și a prejudecății de selecție între 2 grupuri de pacienți. Un scor de înclinație pentru fiecare pacient a fost calculat prin modelare de regresie logistică și s-au asortat covariabile de vârstă și sex. O potrivire 1: 1 a fost utilizată pentru a selecta pacienții din cele 2 grupuri, cu lățimea etrierului setată la 0,1 pentru deviația standard ( Figura 1 ).FIGURA 1

FIGURA 1 . Diagrama de studiu. HDIVC, doză mare de vitamina C intravenoasă; COVID-19, boala coronavirusului 2019.

Colectare de date

Datele au fost colectate dintr-o evidență medicală electronică și revizuite de doi medici instruiți. Perioada de observare a fost prima săptămână după internare. Informațiile sau datele au fost colectate în principal la admitere („Ziua 0”), 3-4 zile („Ziua 3”) și 6-7 zile („Ziua 7”) după admitere. Au fost obținute informații privind vârsta, sexul, greutatea corporală, bolile coexistente și epidemiologia. Definiția sindromului de răspuns inflamator sistemic (SIRS) a fost descrisă anterior ( Kaukonen și colab., 2015 ). De asemenea, au fost colectate date privind nivelurile serice ale proteinei C-reactive (CRP), viteza de sedimentare a eritrocitelor (VSH) și apariția și durata SIRS. În plus, date privind indicatorii imuni, inclusiv numărul de celule T CD4 + , CD8 +Au fost colectate celule T și limfocite. Indicatori ai funcției organelor, inclusiv lactat dehidrogenază (LDH), bilirubină totală (TB), alanină transaminază (ALT), timp de tromboplastină parțială activată (APTT), creatin kinază (CK), troponină cardiacă I ​​(cTNI) și niveluri pre-albumină au fost, de asemenea, înregistrate.

Rezultatul principal a fost agravarea bolii, definită ca o progresie a severității bolii de la tipul moderat la admitere la tipul sever în decurs de o săptămână de la internare. Simptomele clinice de tip ușor nu sunt severe, fără pneumonie la examinarea imagistică. Tipul moderat se caracterizează prin simptome și constatări imagistice legate de pneumonie. Tipul sever este diagnosticat dacă a fost îndeplinit oricare dintre următoarele criterii: 1) frecvența respiratorie ≥30 cicluri / minut; 2) în stare de repaus, saturația oxigenului arterial (SaO2) ≤93%; presiunea parțială arterială a oxigenului / fracția de oxigen inspirat ≤300 mmHg; 3) imagistica pulmonară arată leziuni care au progresat cu mai mult de 50% în decurs de 24-48 de ore. Tipul critic este diagnosticat dacă a fost îndeplinit oricare dintre criteriile următoare: 1) pacientul necesită ventilație mecanică; 2) apare șocul;3) combinație cu alte insuficiențe de organe care necesită monitorizare și tratament ICU. Rezultatele secundare au inclus indicatori pentru răspunsul inflamator, funcția imună, funcția organelor și timpul până la sarcina virală negativ (Tabel suplimentar S1 ).

Protocol de tratament

Toți pacienții au primit tratament pe baza liniilor directoare ale Comisiei Naționale de Sănătate și Planificare Familială din Republica Populară Chineză ( Comisia Națională de Sănătate și Planificare Familială din Republica Populară Chineză, 2020 ) și de consensul experților din Shanghai privind tratamentul cuprinzător al COVID-19 ( Grupul de experți din Shanghai privind tratamentul clinic al bolilor cu coronavirus nou, 2020). Protocolul HDIVC pentru COVID-19 moderat a constat dintr-o injecție intravenoasă de vitamina C (acid ascorbic) la o doză de 100 mg / kg / zi și o rată de 1 g / h timp de 7 zile, începând cu momentul admiterii. Alte terapii asociate au inclus terapia antivirală, susținerea nutriției, heparina cu greutate moleculară mică (dacă dimerul D a depășit valoarea normală), antibioticele în cazurile de infecții bacteriene suspectate, susținerea oxigenului tubului nazal, dacă este necesar, și / sau răcirea fizică și tratament medical (antiinflamatoare nesteroidiene sau glucocorticoizi) dacă temperatura corpului a fost peste 38 ° C.

Analize statistice

Variabilele continue au fost prezentate ca mediane și interval intercuartil (IQR, prezentat între paranteze pătrate) și comparate folosind testul U Mann-Whitney, sau raportate ca medie cu deviație standard și comparate utilizând testul t conform tipului de distribuție. Variabilele categorice au fost comparate folosind testul exact al lui Fisher. Ecuațiile generalizate de estimare (GEE) au fost efectuate pentru a investiga diferența de markeri inflamatori, funcția imună și funcția organelor între HDIVC și grupurile de control. Toate analizele statistice au fost efectuate folosind SAS v. 9.2 (SAS Institute Inc., Statele Unite) și GraphPad prisma 8.0 (versiunea 8.2.0). Valorile P pe două fețe mai mici de 0,05 au fost considerate semnificative statistic.

Rezultate

Caracteristicile pacienților

Așa cum arată Figura 1 , 238 de pacienți, internați între 18 martie 2020 și 18 aprilie 2020, au fost selectați retrospectiv și 55 de pacienți au îndeplinit criteriile de incluziune pentru grupul HDIVC. Între 17 ianuarie 2020 și 17 martie 2020, 593 de pacienți internați la Centrul de Sănătate Publică din Shanghai Clinic au fost selectați în scopul potrivirii. O sută șaptezeci și opt de pacienți diagnosticați cu COVID-19 moderat la internare au fost selectați pentru a se potrivi pacienților din grupul HDIVC într-un raport 1: 1 în funcție de vârstă și sex. Cincizeci și cinci de pacienți au fost incluși în grupul de control. Caracteristicile pacienților au fost similare între HDIVC și grupurile de control ( Tabelul 1). Principalele terapii asociate în primele săptămâni de la internare au inclus terapie antivirală, antibiotice, heparină cu greutate moleculară mică și glucocorticoizi. Nu s-a găsit nicio diferență semnificativă în terapii între cele două grupuri.TABELUL 1

TABELUL 1 . Caracteristicile pacienților cu COVID-19.

Efectul dozei mari de vitamina C intravenoasă asupra rezultatului primar

Rezultatul principal este de a investiga dacă HDIVC ar putea preveni agravarea bolii. Toți pacienții înscriși au fost diagnosticați cu COVID-19 moderat la internare (ziua 0). După cum a arătat Figura 2 , la sfârșitul perioadei de observație (Ziua 7), 4 pacienți din grupul HDIVC și 12 din grupul de control au suferit agravarea bolii cu un diagnostic final de COVID-19 sever sau critic (risc relativ [RR]) 95% interval confidențial [CI] = 0,28 [0,08, 0,93], P = 0,03). IQR este afișat între paranteze drepte.FIGURA 2

FIGURA 2 . Efectul HDIVC asupra prevenirii agravării bolii. Au fost comparate numărul pacienților care au prezentat agravarea bolii în HDIVC și grupul de control (4/55 vs 12/55, RR = 0,28 [0,08, 093], P = 0,03). HDIVC, doză mare de vitamina C intravenoasă; COVID-19, boala coronavirusului 2019; RR, risc relativ; CI, interval confidențial.

Efectul dozei mari de vitamina C intravenoasă asupra rezultatelor secundare

După cum arată tabelul 2 , apariția SIRS în ziua 0 a fost similară între cele două grupuri (HDIVC: 21 / 55vs. Control: 22/55; RR = 0,93 [0,43-1,93], P = 0,86). În ziua 7, au existat mai puțini pacienți cu SIRS în grupul HDIVC ( N = 2/21) decât grupul martor ( N = 10/22, RR = 0,13 [0,02-0,68], P = 0,0086). Dintre pacienții cu SIRS la internare, durata SIRS a fost analizată în continuare și am constatat că pacienții care au acceptat protocolul HDIVC au prezentat un timp semnificativ mai scurt de SIRS (2 [1, 3], zile) decât cei care nu au (6 [1, 7], zile, P= 0,0004). Nu a existat nicio diferență semnificativă în nivelurile serice de CRP între grupul HDIVC și grupul de control în ziua 0 și ziua 3. Cu toate acestea, în ziua 7, nivelurile de CRP au fost semnificativ mai mici în grupul HDIVC decât în ​​grupul de control (0,5 [0,5 , 0,6] vs 0,5 [0,5, 7,7], mg / L, P = 0,005). Un alt indicator inflamator, VSH, nu a arătat nicio diferență semnificativă între cele două grupuri.MASA 2

TABELUL 2 . Efectul HDIVC asupra răspunsului inflamator.

După cum arată tabelul 3 , pentru pacienții cu deficit de limfocite T CD4 + (<410 / μL) la internare, HDIVC a exercitat un efect semnificativ de îmbunătățire (334 [191,9, 409,3] față de 151 [43,5, 240] P = 0,04), dar nu pentru pacienții cu deficiențe de CD8 + (190 / μL) și limfocite la internare. Nu a existat un efect evident al HDIVC asupra numărului de celule T CD4 + , numărului de celule T CD8 + și numărului de limfocite în ziua 3 și ziua 7 pentru întreaga populație de studiu ( tabelul suplimentar S2 ).TABELUL 3

TABELUL 3 . Efectul HDIVC asupra recuperării deficienței funcției imune.

După cum se arată în Tabelul 4 , nivelurile de dimeri D din grupul HDIVC (0,3 [0,2, 0,4], μg / ml) au fost mai mici decât cele din grupul martor (0,4 [0,2, 0,7], μg / ml, P = 0,05). APTT în grupul HDIVC (secunde) a fost semnificativ mai scurt decât cel din grupul de control în ziua 3 (37,7 [35,2, 39,3] vs 40,1 [36,8, 44,2], secunde, P = 0,02) și ziua 7 (36,9 (34,9, 38,9) ) vs 40,8 (36,5, 43,5), secunde, P = 0,02). Alți indicatori ai funcției organelor, inclusiv LDH, TB, ALT, D-Dimer, APTT, cTNI și CK-MB, au fost în limitele normale în ziua 0 și nu au prezentat modificări evidente în niciunul dintre cele două grupuri în ziua 3 și ziua 7.TABELUL 4

TABELUL 4 . Efectul HDIVC asupra funcțiilor organelor.

Nu s-a observat nicio diferență semnificativă în timpul realizării încărcăturii virale negative a tamponului nazofaringian ( figurile 3A, B ) și a scaunului ( figurile 3C , D ) între grupul HDIVC și grupul martor.FIGURA 3

FIGURA 3 . Efectul HDIVC asupra timpului până la încărcarea cu acid nucleic negativ. Probabilitatea globală negativă de tampon nazofaringian (A) și scaun (C) la admitere între HDIVC și grupurile de control au fost comparate și nu s-a găsit nicio diferență semnificativă. Timpul până la acidul nucleic negativ a fost comparat între HDIVC și grupurile martor pentru tampon nazofaringian (B) , mediană [IQR], zile, 14 [8, 21] vs 13 [7, 21], P = 0,79) și pentru scaun (D ) , mediană [IQR], zile, 12 [7, 17] vs 13 [10, 20], P = 0,12). HDIVC, doză mare de vitamina C intravenoasă; COVID-19, boala coronavirusului 2019. IQR, interval interquartil.

Discuţie

În acest studiu retrospectiv, am constatat că după aplicarea protocolului HIDVC începând cu 23 martie 2020, mai puțini (4/55 vs 12/55, RR = 0,28 [0,08, 0,93], P = 0,03) pacienți cu COVID-19 moderat internarea a evoluat la tipul sever în timpul săptămânii după internare. Acești pacienți au demonstrat, de asemenea, o durată SIRS mai scurtă și un nivel mai scăzut al CRP. Pacienții cu deficit de celule T CD4 + la internare care au acceptat HDIVC au arătat o capacitate mai bună de recuperare a numărului de celule T CD4 + decât cei care nu au primit HDIVC. Indicatorii funcției de coagulare, inclusiv APTT și dimerul D, au fost îmbunătățiți în grupul HDIVC comparativ cu grupul de control.

Conform raportului recent ( Chiscano-Camón și colab., 2020 ), nivelul vitaminei C este aproape nedetectabil la pacienții cu COVID-19 cu afecțiune severă sau critică. Un alt studiu recent a raportat, de asemenea, niveluri plasmatice scăzute de vitamina C la pacienții cu COVID-19, iar non-supraviețuitorii au avut jumătate din nivelul plasmatic al supraviețuitorilor ( Arvinte și colab., 2020). Prin urmare, aplicarea timpurie a HIDVC poate ajuta la recuperarea rapidă a nivelului său și poate obține beneficiile așa cum am observat. Am constatat diferențe evidente în rezultatul primar, agravarea bolii, între cele două grupuri. Această constatare implică efectul HDIVC în prevenirea agravării bolii. Acest lucru a fost parțial consecvent cu efectul de reducere a mortalității HDIVC asupra sepsisului cu sindrom de detresă respiratorie acută raportat de Folwer (studiu CITRIS-ALI) ( Fowler și colab., 2019 ) și Hemilä și colab. (reanaliza studiului CITRIS-ALI) ( Hemilä și Chalker, 2020 ).

Recent, Zhang și colab. (2021)a raportat că HDIVC (12 g la fiecare 12 ore, 7 zile) nu a reușit să îmbunătățească zilele invazive fără ventilație mecanică în 28 de zile (rezultatul primar). În comparație cu studiul nostru, pacienții înscriși în studiul lor au avut o severitate mai mare a bolii și durata de la debutul simptomului până la administrarea HDIVC (mediană [IQR], 17 [11-25], zile) din studiul lor a fost mai lungă decât a noastră (grup de control: 3 [2-7], grup HDIVC: 4 [2-6], zile). Prin urmare, se speculează că aplicarea timpurie a HDIVC în mod obișnuit în COVID-19, mai ales atunci când există un risc potențial de agravare a bolii, poate avea beneficii. Trebuie remarcat faptul că proiectarea studiului nostru a fost o comparație între două grupuri de pacienți înainte și după inițierea protocolului HDIVC. Am potrivit strict cele două grupuri, iar cealaltă terapie nu a prezentat nicio diferență semnificativă,dar pe măsură ce înțelegerea și gestionarea COVID-19 se îmbunătățește, rezultatele pot fi mai bune în timpul administrării HDIVC decât în ​​ultimele două luni. Prin urmare, studiile controlate randomizate de înaltă calitate sunt justificate pentru prevenirea agravării bolii utilizând HDIVC.

SIRS, caracterizat prin eliberarea unor cantități uriașe de citokine pro-inflamatorii, inclusiv factor de necroză tumorală-α, interleukină-1β, interleukină-6 și interferon-γ denumite „furtună de citokine”, a fost raportat a fi corelat cu o mortalitate mai mare în sepsis sever ( Kaukonen și colab., 2015 ). Furtuna de citokine este considerată o caracteristică importantă în primele etape ale COVID-19 ( Fink-Neuboeck și colab., 2016 ). Relevanța furtunii de citokine pentru COVID-19 este încă în dezbatere și sunt în curs mai multe studii clinice (NCT04306705, NCT04322773) pentru a investiga rolul său potențial ca țintă terapeutică ( Sinha și colab., 2020). Deși nu am arătat în mod direct efectul HDIVC asupra citokinelor, am demonstrat durata mai scurtă a SIRS și prevalența SIRS mai mică în HDIVC comparativ cu grupul de control în prima săptămână după internare. Nivelurile serice de CRP sunt de obicei utilizate pentru a urmări și monitoriza răspunsul inflamator cauzat de infecție datorită perioadei sale de înjumătățire scurtă de 19 ore ( Williams și colab., 2019 ). Nivelurile CRP s-au dovedit a fi reduse rapid de HDIVC (200 mg / kg / zi) într-un studiu anterior înainte-după într-o cohortă de pacienți cu sepsis ( Fowler și colab., 2014 ). În acest studiu, am constatat că nivelurile CRP din grupul HDIVC au fost semnificativ mai mici decât cele din grupul de control. Prin urmare, am concluzionat că HDIVC ar putea fi benefic pentru inhibarea răspunsului inflamator la pacienții cu COVID-19.

S- a raportat că o reducere a limfocitelor, în special în subgrupul de celule T CD4 + , se corelează cu severitatea COVID-19 ( Xu și colab., 2020 ). SARS-CoV-2 infectează și ucide celulele limfocitare T. Acest lucru s-ar putea datora inhibării creșterii și apoptozei celulelor hematopoietice prin producerea de anticorpi autoimuni ( Yang și colab., 2004 ) sau anumite citokine ( Channappanavar și colab., 2014 ). În studiul nostru, 12 din 55 de pacienți din grupul HDIVC și 18 din 55 de pacienți din grupul de control au avut deficit de celule T CD4 + la internare. Limfocitele, în special limfocitele T, au fost studiate pe larg în contextul biologiei vitaminei C ( van Gorkom și colab., 2018 ). Ambele in vitroși studiile in vivo au arătat că vitamina C este esențială pentru dezvoltarea, maturarea și proliferarea limfocitelor T funcționale, iar reglarea epigenetică a expresiei genice este unul dintre mecanismele de bază ( Manning și colab., 2013 ). Am arătat la pacienții cu deficit de celule T CD4 + la internare, creșterea CD4 + a fost mai evidentă în grupul HDIVC decât în ​​grupul de control. Această constatare ar putea implica proprietatea imunitară a HDIVC în tratamentul COVID-19.

Coagulopatia este o caracteristică comună a infecției cu SARS-CoV-2 și o creștere a nivelului dimerului D este cea mai frecventă constatare ( Iba și colab., 2020a ), care apare în 43% din cazurile non-severe ( Guan și colab., 2020 ). S-a raportat că nivelurile mai ridicate ale produsului de dimer D și fibrină, timpul de protrombină mai lung și APTT mai lungi se corelează cu severitatea bolii ( Cheng, 2020). În studiul nostru, valorile APTT și dimer D au fost, de asemenea, în intervalul normal la admitere și am constatat că APTT a fost mai scurt în HDIVC decât în ​​grupul de control în ziua 3, precum și în ziua 7, și nivelul D -Dimerul a fost mai mic în grupul HDIVC decât în ​​grupul martor în ziua 7. Acest lucru a confirmat efectul benefic al HDIVC asupra tulburărilor de coagulare. Această constatare s-ar putea explica prin faptul că vitamina C exercită un efect îmbunătățitor asupra leziunilor endoteliale ( Barabutis și colab., 2017 ), care promovează formarea cheagurilor microvasculare și angiopatia în pneumonia COVID-19 ( Iba și colab., 2020b ).

Concluzie

În această retrospectivă înainte-după studiu, am constatat că mai puțini pacienți cu pneumonie COVID-19 au suferit agravarea bolii după aplicarea HDIVC. S- au găsit diferențe semnificative între durata SIRS, nivelul CRP, recuperarea celulelor T CD4 + și funcțiile de coagulare între HDIVC și grupurile de control. Aceste rezultate implică faptul că HDIVC poate avea un rol în prevenirea agravării bolii, posibil datorită îmbunătățirii răspunsului inflamator, a funcției imune și a funcției de coagulare. Oricum, aceste observații necesită evaluare în studiile clinice prospective.

Acest studiu a fost realizat în conformitate cu Declarația modificată de la Helsinki (revizuită în 2013) și aprobată de consiliul de etică instituțional al Spitalului Ruijin, Școala de Medicină a Universității Shanghai Jiao Tong. Consimțământul oral a fost obținut de la fiecare pacient participat .; Consimțământul pentru publicare; Toți autorii au aprobat publicația .; Disponibilitatea datelor suport; Toate datele sunt pe deplin disponibile fără restricții .; Interese concurente; Autorii declară că nu au interese concurente.

Declarație privind disponibilitatea datelor

Contribuțiile inițiale prezentate în studiu sunt incluse în articol / Material suplimentar , întrebări suplimentare pot fi direcționate către autorii corespunzători.

Declarație de etică

Studiile care au implicat participanți umani au fost revizuite și aprobate de Spitalul Ruijin, școala de medicină a Universității Shanghai Jiaotong. Pacienții / participanții și-au furnizat consimțământul informat în scris pentru a participa la acest studiu.

Contribuțiile autorului

BZ a conceput ipoteza și a scris manuscrisul. ML și PL au contribuit la colectarea datelor. YP, JH, ML, YW, LX și XQ au furnizat date de sprijin și au contribuit cu contribuția intelectuală. YL și JL contribuie la analiza statistică. WZ și EM au conceput ipoteza, au furnizat date de sprijin, au contribuit cu contribuții intelectuale și au revizuit manuscrisul. Toți autorii au citit și au aprobat manuscrisul final.

Finanțarea

Al doilea lot de proiecte științifice și tehnologice cheie de urgență ale Comitetului municipal de știință și tehnologie din Shanghai (20411950300/20411950301). Proiectul de cercetare clinică al spitalului Ruijin afiliat la Școala de Medicină a Universității Shanghai Jiao Tong (2018CR004) la EM. Fundația Națională pentru Științe Naturale din China (81870311) către JH.

Conflict de interese

Autorii declară că cercetarea a fost efectuată în absența oricărei relații comerciale sau financiare care ar putea fi interpretată ca un potențial conflict de interese.

Mulțumiri

Mulțumim întregului personal al Centrului Clinic de Sănătate Publică din Shanghai pentru efortul lor mare în tratamentul pacienților cu pneumonie COVID-19.

Material suplimentar

Materialul suplimentar pentru acest articol poate fi găsit online la: https://www.frontiersin.org/articles/10.3389/fphar.2021.638556/full#supplementary-material .

Abrevieri

HDIVC, doză mare de vitamina C intravenoasă; SARS-CoV-2, sindrom respirator acut sever coronavirus 2; COVID-19, boala coronavirusului 2019; SIRS, sindrom de răspuns inflamator sistemic; CRP, proteină C-reactivă; APTT, timp de tromboplastină parțială activat; ROS, specii reactive de oxigenază; VSH, viteza de sedimentare a eritrocitelor; LDH, lactat dehidrogenază (LDH); TB, bilirubină totală; ALT, transaminază alanină; CK, creatin kinază; cTNI, troponină cardiacă I; IQR, gama interquartile; RR, risc relativ; CI, interval confidențial; Aprobarea etică și consimțământul de participare.

Referințe

Anonim (2020). Actualizare la ghidul viu OMS privind drogurile pentru covid-19. Bmj 371, m4779. doi: 10.1136 / bmj.m4779

PubMed Abstract | Text integral CrossRef | Google Scholar

Arvinte, C., Singh, M. și Marik, PE (2020). Nivelurile serice de vitamina C și vitamina D într-o cohortă de pacienți cu COVID-19 bolnavi în greutate dintr-o unitate de terapie intensivă a spitalului comunitar nord-american în mai 2020: un studiu pilot. Med. Drug Discov. 8, 100064. doi: 10.1016 / j.medidd.2020.100064

PubMed Abstract | Text integral CrossRef | Google Scholar

Barabutis, N., Khangoora, V., Marik, PE și Catravas, JD (2017). Hidrocortizonul și acidul ascorbic previn sinergic și repară disfuncția barierei endoteliale pulmonare indusă de lipopolizaharide. Piept 152 (5), 954-962. doi: 10.1016 / j.chest.2017.07.014

PubMed Abstract | Text integral CrossRef | Google Scholar

Carr, AC și Rowe, S. (2020). Rolul emergent al vitaminei C în prevenirea și tratamentul COVID-19. Nutrienti 12 (11), 3286. doi: 10.3390 / nu12113286

Text integral CrossRef | Google Scholar

Cerullo, G., Negro, M., Parimbelli, M., Pecoraro, M., Perna, S., Liguori, G., și colab. (2020). Istoria lungă a vitaminei C: de la prevenirea răcelii obișnuite la potențialul de ajutor în tratamentul COVID-19. Față. Immunol. 11, 574029. doi: 10.3389 / fimmu.2020.574029

PubMed Abstract | Text integral CrossRef | Google Scholar

Channappanavar, R., Zhao, J. și Perlman, S. (2014). Răspunsul imun mediat de celule T la coronavirusurile respiratorii. Immunol. Rez. 59 (1-3), 118-128. doi: 10.1007 / s12026-014-8534-z

PubMed Abstract | Text integral CrossRef | Google Scholar

Cheng, RZ (2020). Poate doza intravenoasă timpurie și mare de vitamina C să prevină și să trateze boala coronavirusului 2019 (COVID-19) ?. Med. Drug Discov. 5, 100028. doi: 10.1016 / j.medidd.2020.100028

PubMed Abstract | Text integral CrossRef | Google Scholar

Chiscano-Camón, L., Ruiz-Rodriguez, JC, Ruiz-Sanmartin, A., Roca, O. și Ferrer, R. (2020). Nivelurile de vitamina C la pacienții cu sindrom de detresă respiratorie acută asociat SARS-CoV-2. Crit. Care 24 (1), 522. doi: 10.1186 / s13054-020-03249-y

PubMed Abstract | Text integral CrossRef | Google Scholar

Fink-Neuboeck, N., Lindenmann, J., Bajric, S., Maier, A., Riedl, R., Weinberg, AM, și colab. (2016). Impactul clinic al interleukinei 6 ca biomarker predictiv în diagnosticul precoce al sindromului de răspuns inflamator sistemic postoperator după o intervenție chirurgicală toracică majoră: un studiu clinic prospectiv. Chirurgie 160 (2), 443-453. doi: 10.1016 / j.surg.2016.04.004

PubMed Abstract | Text integral CrossRef | Google Scholar

Fowler, AA, Syed, AA, Syed, AA, Knowlson, S., Sculthorpe, R., Farthing, D., și colab. (2014). Studiu de siguranță de fază I a acidului ascorbic intravenos la pacienții cu sepsis sever. J. Transl Med. 12, 32. doi: 10.1186 / 1479-5876-12-32

PubMed Abstract | Text integral CrossRef | Google Scholar

Fowler, AA, Truwit, JD, Hite, RD, Morris, PE, DeWilde, C., Priday, A., și colab. (2019). Efectul perfuziei de vitamina C asupra insuficienței organelor și a biomarkerilor de inflamație și leziuni vasculare la pacienții cu sepsis și insuficiență respiratorie acută severă. Jama 322 (13), 1261–1270. doi: 10.1001 / jama.2019.11825

PubMed Abstract | Text integral CrossRef | Google Scholar

Guan, WJ, Ni, ZY, Hu, Y., Liang, WH, Ou, CQ, He, JX și colab. (2020). Caracteristicile clinice ale bolii coronavirus 2019 în China. N. Engl. J. Med. 382 (18), 1708-1720. doi: 10.1056 / NEJMoa2002032

PubMed Abstract | Text integral CrossRef | Google Scholar

Hemilä, H. și Chalker, E. (2020). Reanaliza efectului vitaminei C asupra mortalității în studiul CITRIS-ALI: constatări importante respinse în raportul studiului. Față. Med. 7, 590853. doi: 10.3389 / fmed.2020.590853

Text integral CrossRef | Google Scholar

Iba, T., Levy, JH, Connors, JM, Warkentin, TE, Thachil, J. și Levi, M. (2020a). Caracteristicile unice ale coagulopatiei COVID-19. Crit. Care 24 (1), 360. doi: 10.1186 / s13054-020-03077-0

Text integral CrossRef | Google Scholar

Iba, T., Levy, JH, Levi, M., Connors, JM și Thachil, J. (2020b). Coagulopatia bolii coronavirus 2019. Crit. Care Med. Publicați înainte de tipărire (9), 1358–1364. doi: 10.1097 / ccm.0000000000004458

PubMed Abstract | Text integral CrossRef | Google Scholar

Kaukonen, K.-M., Bailey, M., Pilcher, D., Cooper, DJ și Bellomo, R. (2015). Criteriile sindromului de răspuns inflamator sistemic în definirea sepsisului sever. N. Engl. J. Med. 372 (17), 1629–1638. doi: 10.1056 / NEJMoa1415236

PubMed Abstract | Text integral CrossRef | Google Scholar

Mahase, E. (2020). Covid-19: OMS declară pandemie din cauza „nivelurilor alarmante” de răspândire, severitate și inacțiune. Bmj 368, m1036. doi: 10.1136 / bmj.m1036

PubMed Abstract | Text integral CrossRef | Google Scholar

Manning, J., Mitchell, B., Appadurai, DA, Shakya, A., Pierce, LJ, Wang, H., și colab. (2013). Vitamina C favorizează maturarea celulelor T. Antioxidant. Redox Signaling 19 (17), 2054–2067. doi: 10.1089 / ars.2012.4988

Text integral CrossRef | Google Scholar

Moskowitz, A., Huang, DT, Hou, PC, Gong, J., Doshi, PB, Grossestreuer, AV, și colab. (2020). Efectul acidului ascorbic, corticosteroizilor și tiaminei asupra leziunilor organelor în șocul septic. Jama 324 (7), 642-650. doi: 10.1001 / jama.2020.11946

PubMed Abstract | Text integral CrossRef | Google Scholar

Comisia Națională de Sănătate și Planificare Familială din Republica Populară Chineză (2020). Ghid pentru diagnosticul și tratamentul SARS-CoV-2 . Ednul 7. Disponibil de pe: http://www.nhc.gov.cn/yzygj/s7653p/202003/46c9294a7dfe4cef80dc7f5912eb1989.shtml (4 martie 2020).

Oudemans-van Straaten, HM, Man, AMS-d. Și de Waard, MC (2014). Vitamina C revizuită. Crit. Care 18 (4), 460. doi: 10.1186 / s13054-014-0460-x

PubMed Abstract | Text integral CrossRef | Google Scholar

Grupul de experți din Shanghai privind tratamentul clinic al bolilor cu coronavirus nou (2020). Consensul experților cu privire la tratamentul cuprinzător al bolilor coronavirusului din Shanghai în 2019. Chin. J. Infectează. Dis. 2020, 38. doi: 10.3760 / cma.j.issn.1000-6680.2020

Text integral CrossRef | Google Scholar

Sinha, P., Matthay, MA și Calfee, CS (2020). Este o „furtună de citokine” relevantă pentru COVID-19 ?. Intern JAMA. Med. 180 (9), 1152–1154. doi: 10.1001 / jamainternmed.2020.3313

PubMed Abstract | Text integral CrossRef | Google Scholar

Spinelli, A. și Pellino, G. (2020). Pandemia COVID-19: perspective asupra unei crize care se desfășoară. Fr. J. Surg. 107 (7), 785–787. doi: 10.1002 / bjs.11627

PubMed Abstract | Text integral CrossRef | Google Scholar

van Gorkom, G., Klein Wolterink, R., Van Elssen, C., Wieten, L., Germeraad, W. și Bos, G. (2018). Influența vitaminei C asupra limfocitelor: o privire de ansamblu. Antioxidanți 7 (3), 41. doi: 10.3390 / antiox7030041

Text integral CrossRef | Google Scholar

Wang, D., Hu, B., Hu, C., Zhu, F., Liu, X., Zhang, J., și colab. (2020). Caracteristici clinice ale a 138 de pacienți spitalizați cu pneumonie nouă infectată cu coronavirus în 2019 în Wuhan, China. Jama 323 (11), 1061-1069. doi: 10.1001 / jama.2020.1585

PubMed Abstract | Text integral CrossRef | Google Scholar

Williams, AM, Ladva, CN, Leon, JS, Lopman, BA, Tangpricha, V., Whitehead, RD, și colab. (2019). Modificări ale concentrațiilor de biomarkeri serici ai micronutrienților și inflamației după o provocare la norovirus uman. A.m. J. Clin. Nutr. 110 (6), 1456–1464. doi: 10.1093 / ajcn / nqz201

PubMed Abstract | Text integral CrossRef | Google Scholar

Wu, C., Chen, X., Cai, Y., Xia, J. a., Zhou, X., Xu, S., și colab. (2020). Factorii de risc asociați cu sindromul de detresă respiratorie acută și deces la pacienții cu boală coronavirus 2019 pneumonie în Wuhan, China. Intern JAMA. Med. 180 (7), 934–943. doi: 10.1001 / jamainternmed.2020.0994

PubMed Abstract | Text integral CrossRef | Google Scholar

Xu, B., Fan, C.-y., Wang, A.-l., Zou, Y.-l., Yu, Y.-h., He, C., și colab. (2020). Imunitatea suprimată mediată de celulele T la pacienții cu COVID-19: un studiu retrospectiv clinic în Wuhan, China. J. Infectează. 81 (1), e51 – e60. doi: 10.1016 / j.jinf.2020.04.012

Text integral CrossRef | Google Scholar

Yang, M., Li, CK, Li, K., Hon, KL, Ng, MH, Chan, PK și colab. (2004). Constatări hematologice la pacienții cu SARS și posibile mecanisme (revizuire). Int. J. Mol. Med. 14 (2), 311-315.

PubMed Abstract | Google Scholar

Zhang, J., Rao, X., Li, Y., Zhu, Y., Liu, F., Guo, G., și colab. (2021). Test pilot al dozei mari de vitamina C la pacienții cu COVID-19 bolnavi în stare critică. Ann. Terapie intensivă 11 (1), 5. doi: 10.1186 / s13613-020-00792-3

PubMed Abstract | Text integral CrossRef | Google Scholar

Cuvinte cheie: COVID-19, vitamina C, terapie, răspuns inflamator, agravarea bolii

Citație: Zhao B, Liu M, Liu P, Peng Y, Huang J, Li M, Wang Y, Xu L, Sun S, Qi X, Ling Y, Li J, Zhang W, Mao E și Qu J (2021) Doza de vitamina C intravenoasă pentru prevenirea agravării bolii a pneumoniei COVID-19 moderate. O tendință retrospectivă potrivită înainte-după studiu. Față. Farmacol. 12: 638556. doi: 10.3389 / fphar.2021.638556

Primit: 07 decembrie 2020; Acceptat: 25 februarie 2021;
Publicat: 22 aprilie 2021.

Editat de:Rafael Maldonado , Universitatea Pompeu Fabra, Spania

Revizuite de:Margreet CM Vissers , Universitatea din Otago, Noua Zeelandă
Harri Hemila , Universitatea din Helsinki, Finlanda

Drepturi de autor © 2021 Zhao, Liu, Liu, Peng, Huang, Li, Wang, Xu, Sun, Qi, Ling, Li, Zhang, Mao și Qu. Acesta este un articol cu ​​acces liber distribuit în conformitate cu condițiile Creative Commons Attribution License (CC BY). Utilizarea, distribuirea sau reproducerea în alte forumuri este permisă, cu condiția ca autorul (autorii) original (i) și deținătorul (autorii) drepturilor de autor să fie creditați și dacă publicația originală din această revistă este citată, în conformitate cu practica academică acceptată. Nu este permisă nicio utilizare, distribuție sau reproducere care nu respectă acești termeni.

* Corespondență: Enqiang Mao, maoeq@yeah.net ; Jieming Qu, jmqu0906@163.com

 Acești autori au contribuit în mod egal la această lucrare

Declinare de responsabilitate: Toate revendicările exprimate în acest articol sunt numai cele ale autorilor și nu reprezintă în mod necesar cele ale organizațiilor afiliate ale acestora sau ale editorului, ale editorilor și ale recenzorilor. Orice produs care poate fi evaluat în acest articol sau revendicare care poate fi făcut de producătorul său nu este garantat sau aprobat de editor.

https://www.frontiersin.org/articles/10.3389/fphar.2021.638556/full

DRAMATIC. 3,964 decese post-vaccin în Europa și 162,610 de vătămări provocate de vaccinurile Covid, conform bazei de date EudraVigilance a Agenției Europeană a Medicamentelor

EudraVigilance – baza de date europeană a rapoartelor despre reacțiile și decesele provocate de vaccinurile împotriva COVID-19, a înregistrat 3,964 de decese care au avut loc în urma vaccinurilor Covid și 162,610 de vătămări. Raportul a fost întocmit până la data de 13 martie, 2021.
EudraVigilance este conceput ca un sistem pentru colectarea rapoartelor despre reacțiile adverse suspectate. Aceste rapoarte sunt utilizate pentru evaluarea beneficiilor și riscurilor medicamentelor în timpul dezvoltării lor, dar și pentru monitorizarea siguranței acestora în urma autorizării lor în Spațiul Economic European (SEE). EudraVigilance datează din 2001 dar a fost lansat abia în 2012 de către Agenția Europeană a Medicamentelor pentru a oferi acces public la rapoartele despre reacțiile adverse la medicamente.Rezultatele sunt transmise electronic către EudraVigilance de autoritățile naționale de reglementare a medicamentelor și de către companiile farmaceutice care dețin licențe pentru producerea medicamentelor, potrivit vaccineimpact.com.
Raportul a înregistrat reacțiile ca urmare a vaccinurilor: PFIZER-BIONTECH (TOZINAMERAN), MRNA MODERNA (CX-024414) și ASTRAZENECA (CHADOX1 NCOV-19). Există, totodată, date pentru al patrulea vaccin împotriva noului virus, serul JANSSEN (AD26.COV2.S), dar care nu sunt prezentate în acest studiu.
Reacțile totale ale vaccinului ARNm Tozinameran (cod BNT162B2, Comirnaty) de la BioNTech/Pfizer: 2.540 de decese și 102.100 leziuni până la data de 13.03.2021.
Reacțiile totale provocate de vaccinul mARN ARNm-1273 (CX-024414) de la Moderna: 973 decese și 5.939 de leziuni până la 13.03.2021.ADVERTISEMENT
Reacțiile totale provocate de vaccinul AZD1222 (CHADOX1NCOV-19) de la Oxford/AstraZeneca: 451 decese și 54.571 vătămări până la 13.03.2021.
Pentru cazurile de reacții adverese înregistrate de vaccinul produs de BioNTechPfizer, raportul amănunțit arată astfel:  

-7.604 Tulburări ale sângelui și ale sistemului limfatic inclusiv 15 decese-4636 Tulburări cardiace inclusiv 276 decese-22 Tulburări congenitale, familiale și genetice incl. 2 decese-2.683 Tulburări la nivelul urechii și labirintului-52 Tulburări endocrine-2.941 Tulburări oculare incl. 2 decese-23.074 Tulburări gastrointestinale incl. 125 de deceseADVERTISEMENThttps://4b876eb45ebba0cc0f44ef6c2f9d53bc.safeframe.googlesyndication.com/safeframe/1-0-38/html/container.html-72.072 Tulburări generale și condiții la locul de administrare incl. 957 decese-102 Tulburări hepatobiliare incl. 12 decese-1.928 Tulburări ale sistemului imunitar incl. 11 decese-6.020 Infecții și infestări incl. 275 decese-2.198 Leziuni, otrăviri și complicații procedurale incl. 32 de decese-4.565 Investigații incl. 111 decese-1.567 Tulburări de metabolism și nutriție incl. 49 de decese-37.365 Tulburări musculo-scheletice și ale țesutului conjunctiv incl. 22 decese-55 Neoplasme benigne, maligne și nespecificate (inclusiv chisturi și polipi) incl. 3 decese-44.993 Tulburări ale sistemului nervos incl. 185 de morți-81 Sarcina, puerperiul și condițiile perinatale incl. 2 decese-57 Probleme legate de produs-3.742 Tulburări psihiatrice incl. 28 de decese-525 Tulburări renale și urinare incl. 37 de decese-545 Tulburări ale sistemului reproductiv și ale sânilor-8.788 Tulburări respiratorii, toracice și mediastinale incl. 294 decese-10.808 Tulburări ale pielii și ale țesutului subcutanat incl. 18 decese-229 Circumstanțe sociale incl. 6 decese-69 Proceduri chirurgicale și medicale incl. 4 decese-4.820 Tulburări vasculare incl. 74 de decese
Pentru reacțiile adeverse înregistrate de vaccinul produs de Moderna, raportul arată asftel:

-330 Tulburări ale sângelui și ale sistemului limfatic incl. 9 decese-501 Tulburări cardiace incl. 96 de decese-1 Tulburări congenitale, familiale și genetice-116 Tulburări ale urechii și labirintului6 Tulburări endocrine-181 Tulburări oculare incl. 2 decese-1.283 Tulburări gastrointestinale incl. 40 de decese-4.198 Tulburări generale și condiții la locul de administrare incl. 393 decese-21 Tulburări hepatobiliare-219 Tulburări ale sistemului imunitar incl. o moarte-515 Infecții și infestări incl. 57 de decese-236 Leziuni, otrăviri și complicații procedurale incl. 16 decese-411 Investigații incl. 36 decese-165 Tulburări de metabolism și nutriție incl. 18 decese-1.727 Tulburări musculo-scheletice și ale țesutului conjunctiv incl. 23 de decese-12 Neoplasme benigne, maligne și nespecificate (incl. Chisturi și polipi) incl. 3 decese-2.324 Tulburări ale sistemului nervos incl. 111 decese-15 Sarcina, puerperiul și afecțiunile perinatale-4 Probleme legate de produs-271 Tulburări psihiatrice incl. 14 decese-93 Tulburări renale și urinare incl. 10 decese-34 Tulburări ale aparatului de reproducere și ale sânului incl. o moarte-817 Tulburări respiratorii, toracice și mediastinale incl. 93 de decese-740 Tulburări ale pielii și ale țesutului subcutanat incl. 11 decese-48 Circumstanțe sociale incl. 3 decese-40 Proceduri chirurgicale și medicale incl. 4 decese-368 Tulburări vasculare incl. 32 de decese
Pentru reacțiile înregistrate de vaccinul produs de Oxford/AstraZeneca:

-1.180 Tulburări ale sângelui și ale sistemului limfatic incl. 11 decese-2.080 Tulburări cardiace incl. 63 de decese-17 Tulburări congenitale, familiale și genetice-1.237 Tulburări la nivelul urechii și a labirintului-41 Tulburări endocrine-1.977 Tulburări oculare incl. 1 moarte-17.491 Tulburări gastrointestinale incl. 15 decese-42.367 Tulburări generale și condiții la locul de administrare incl. 198 de decese-32 Tulburări hepatobiliare incl. 1 moarte-578 Tulburări ale sistemului imunitar-3.340 Infecții și infestări incl. 46 de decese-853 Leziuni, otrăviri și complicații procedurale incl. 2 decese-2.384 Investigații incl. 3 decese-2.676 Tulburări de metabolism și nutriție incl. 5 decese-22.858 Tulburări musculo-scheletice și ale țesutului conjunctiv incl. 4 decese-19 Neoplasme benigne, maligne și nespecificate (incl. Chisturi și polipi) incl. 2 decese-32.490 Tulburări ale sistemului nervos incl. 41 de decese-22 Sarcina, puerperiul și afecțiunile perinatale-11 Probleme legate de produs-3.105 Tulburări psihiatrice incl. 3 decese-560 Tulburări renale și urinare incl. 4 decese-266 Tulburări ale sistemului reproductiv și ale sânilor-4.293 Tulburări respiratorii, toracice și mediastinale incl. 33 de decese-6.815 Tulburări ale pielii și ale țesutului subcutanat incl. 2 decese-99 circumstanțe sociale incl. 2 decese-138 Proceduri chirurgicale și medicale incl. 4 decese-1.656 Tulburări vasculare incl. 11 decese
Aceste informații publice sunt finanțate de Agenția Europeană pentru Medicamente, precizează sursa citată

Student de 24 de ani, găsit mort în apartamentul său la 10 zile de la vaccinarea cu AstraZeneca

Soț și soție din Prahova, morți la doar câteva ore distanță, după vaccin. Fiica celor doi, în stare gravă la ATI

Soții Dulgheru din satul Minieri, comuna prahoveană Filipeștii de Pădure, au murit la un interval de câteva ore la spitalul județean de urgență, după ce au fost vaccinați împotriva coronavirusului. Cei doi au avut simptome de COVID înainte de imunizare, însă au considerat că sunt răciți și au luat tratament pentru răceală. Fiica celor doi este în stare gravă la ATI.

Femeia de 66 de ani și bărbatul de 71 de ani au avut simptome asociate COVID-19 dar au considerat că sunt răciți și nu au mers la spital.

Pe data de 3 martie au mers însă la Câmpina pentru a se vaccina. Imediat după vaccinul Pfizer, femeia a leșinat chiar la spital. Medicii au stabilizat-o, iar după o oră și jumătate, a fost trimisă acasă. Din acel moment, starea ei s-a înrăutățit. Aceasta nu a mai mâncat până pe 6 martie, când familia a chemat ambulanța.

Femeia a fost dusă la Spitalul Județean din Ploiești, unde a ajuns pe secția de Terapie Intensivă. La fel și bărbatul acesteia, a cărei stare de sănătate s-a deteriorat rapid.

Din păcate, femeia a murit pe data de 18 martie, iar soțul ei, pe 19 martie

Contactat de presa locală, IPJ Prahova a confirmat decesul celor doi, menționând, însă, o moarte naturală. Pe certificatul de deces al femeii, însă, la cauză, este trecută insuficiență cardio-respiratorie severă, disfuncție multiplă de organe, bronhopneumonie cu SARS-CoV-2 și alte boli, dar nu severe, iar la soțul acesteia, insuficiență cardio-respiratorie severă, bronhopneumonie cu SARS-CoV-2 și cardiopatie ischemică. 

Fiica celor doi, în stare gravă la ATI

Fiica celor doi este, de asemenea, la Terapie Intensivă, iar starea acesteia nu este una tocmai bună, fiind imunizată cu serul AstraZeneca.

”Totul a pornit înainte de a face vaccinul, au fost răciți. Mi-au spus că urmează să meargă să facă vaccinul, aveau încredere foarte mare în vaccin și doreau să îl facă. Probabil din cauză că au avut virusul cu cel puțin o săptămână înainte, probabil asta a fost și una din cauze. 

Ei au considerat că sunt răciți, au luat un tratament pentru răceală, iar în data de 3 au mers să facă vaccinul la spitalul din Câmpina, dar acolo datele s-au schimbat dramatic, mama leșinând acolo, imediat după vaccin. A trebuit să stea vreo oră și jumătate acolo, până și-a revenit să poată pleca acasă. Dar din momentul acela mama nu a mai mâncat. Deci din data de 3 până în data de 6. Situația s-a înrăutățit, firește, și în data de 6 am chemat ambulanța. Și tot atunci au plecat și la Spitalul de Urgență. Au fost duși la Județean, după care au fost transferați la Boli Infecțioase. Au stat o zi sau două acolo, și după aceea înapoi la Terapie Intensivă. 

Prima care a decedat a fost mama, în data de 18, la ora 16.40, iar tata în data de 19, la 06:00.

Sora mea se află în momentul de față la Terapie Intesivă, într-o stare destul de gravă”, a povestit fiul cuplului pentru observatorulprahovean.ro.

A fost demarată o anchetă

”În urma apariției în spațiul public a informației conform căreia „doi prahoveni, soț și soție, au murit de covid, iar fiica lor este la terapie intensivă. Ei au fost imunizați cu prima doză din vaccinul Pfizer, respectiv AstraZeneca“, domnul prefect al județului Prahova, Cristian Ionescu, s-a autosesizat și a solicitat Direcției de Sănătate Publică Prahova, prin adresa nr. 4628/2021, și Colegiului Medicilor Prahova, prin adresa nr. 4629/2021 , demararea, în regim de urgență, a unei anchete. 

Rezultatele cercetărilor și măsurile dispuse, dacă va fi cazul, vor fi prezentate public în momentul în care vor fi transmise de către instituțiile menționate”, se arată într-un comunicat al Prefecturii Prahova.

Doctorița-minune Flavia Groșan a ieșit cu MASCA JOS și în aplauzele susținătorilor de la audierile Colegiului Medicilor din Bihor. „Masca nu face bine, de ce să ne blocăm ce ne-a lăsat Dumnezeu?”. Miza atacului împotriva Flaviei Groșan: Protocolul morții

Medicul Flavia Groșan, care a provocat emulație în spațiul public, după ce a vorbit despre tratamentul-minune cu care a vindecat peste 1.000 bolnavi de COVID, a fost aplaudată azi de susținători și a primit flori, atunci când a ajuns și a plecat de la Colegiul Medicilor Bihor, unde a fost audiată. Peste 100 de persoane s-au adunat astăzi în fața Colegiului Medicilor Bihor în semn de susținere pentru medicul Flavia Groșan, chemată la audieri.

Chemată să dea cu subsemnatul la Colegiul Medicilor din Bihor, doctorița-minune Flavia Groșan contra-atacă: ”Voi, cei care muriți de grija mea, haideți în cabinetul meu să vă arăt cum salvez oameni!” GRUPUL FACEBOOK a depășit 100.000 de membri 

UPDATE: Potrivit unui site local, președinta Colegiului Medicilor Bihor, dr. Carmen Pantiș, a anunțat,după audierea doctoriței Flavia Groșan că aceasta nu primește nicio sancțiune pentru declarațiile pe care le-a făcut în spațiul public. „Doamna doctor va continua să își trateze pacienții exact cum a făcut-o până acum. Comisia de etică și deontologie nu poate să dea nicio sancțiune.”, a precizat dr. Carmen Pantiș.

Declarațiile destul de bâlbâite ale doctoriței Pantiș pot fi vizionate mai jos, într-o filmare locală.
ADVERTISING

Doctorița-minune a apărut prima oară în presă în ziarul Național, unde a afirmat că „în spitale se fac greșeli uriașe și că protocolul COVID omoară, de fapt, bolnavii”. Ziarista Claudia Marcu, cea care a prezentat-o opiniei publice în premieră, afirmă și azi în Național că Miza atacurilor împotriva Flaviei Groșan este „Protocolul morții!”: „Nu faptul că medicul Flavia Groșan are propria schemă de tratament pentru tratarea cu succes a Covidului a deranjat sistemul. Schema poate fi combătută relativ simplu, iar această sarcină a revenit medicilor sugrumați de invidie. Ceea ce a cutremurat din temelii sistemul este contestarea protocolului din spitale, care fabrică morți pe bandă rulantă.”, afirmă jurnalista.

Luni, când a ajuns la Colegiul Medicilor Bihor, medicul Groșan purta mască de protecție, însă aceasta nu îi acoperea gura, așa cum prevăd măsurile din pandemie, precizează cu malițiozitate Antena 3. Ei bine, la ieșire masca a fost dată jos, sub bărbie, de-a binelea!

„Mă uit în spate și nu-mi este rușine cu ce am făcut”, a spus dr. Flavia Groșan, luni, la intrarea la Colegiul Medicilor.

Potrivit șefului Colegiului Medicilor, dr. Flavia Groșan, fostă directoare a vechiului Spital TBC la mijlocul anilor 2000, ulterior angajată a Spitalului Municipal din Marghita, „s-a retras din sistemul sanitar public în urmă cu aproximativ patru ani, iar de atunci deține un cabinet privat în Oradea”.

În plus, președintele Colegiului Medicilor Bihor subliniază că afirmațiile doctoriței Groșan despre caracterul periculos al terapiei cu oxigen din spitale sunt periculoase și „aberante”:

„Da, este o aberație să spui că oxigenul vatămă creierul, că produce edeme cerebrale, știind că pacienților care beneficiază de terapie cu oxigen nu li se administrează oxigen în stare pură”.

Doctorița Flavia Groșan, pneumolog, susține că tratează COVID-ul ca pe o pneumonie atipică, cu antibiotic, chiar și prin telefon sau online, ca să nu-i pună pe drumuri pe cei bolnavi rău.

Reclamația în cazul dr. Groșan a fost depusă de un alt medic din București, care a fost „deranjat” de faptul că aceasta a criticat protocolul din București.

De asemenea, doctorița Flavia Groșan a mai declarat că statul în casă și masca scad imunitatea: „Masca nu face bine, de ce ne blocăm orificiile lăsate de Dumnezeu?”

Dr. Flavia Groșan afirmă că nu înțelege de ce trebuie să purtăm mască de protecție împotriva COVID.

„Eu zic că lockdownul nu face bine, eu zic că masca nu face bine. Eu aș fi mers pe varianta englezească cu imunizarea de turmă. Am fi scăpat Eu vorbeam și cu pacienții, Dumnezeu a lăsat orificiile astea, de ce le blocăm? Tot întreb… ne-a scăzut imunitatea în ultimul hal, de aceea nu mai știm ce e gripă, ce e viroză, ce e COVID. Nu mai știm nimic. Imunitatea noastră e prăbușită. Statul în casă, masca și aici am ajuns…”, a spus dr. Flavia Groșan.

BÂLBÂIELILE DOCTORIȚEI PANTIȘ: https://www.youtube.com/embed/zLUr4GaRG9g

VIDEO Antena 3 de la ieșirea DOCTORIȚEI GROȘAN:

Dr. Monica Pop, despre schema de tratament a medicului Flavia Groşan: „Este foarte bine adaptată. Este extraordinar ceea ce face”

Medicul Monica Pop a declarat în exclusivitate în cadrul emisiunii „Sinteza Zilei” de la Antena 3 că schema de tratament a medicului pneumolog Flavia Groşan este foarte bine adaptată şi laudă demensul şi rezultatele obţinute cu pacienţii vindecaţi cu succes de COVID-19.

Colegiul Medicilor s-a autosesizat după ce în presă au apărut mai multe articole, în ultimele zile, despre un medic pneumolog care susţine că ar face minuni și ar vindeca bolnavi de COVID cu o schemă proprie de tratament şi medicamente ieftine.

Medicul Monica Pop a declarat în exclusivitate în cadrul emisiunii „Sinteza Zilei” de la Antena 3 că schema de tratament a medicului pneumolog Flavia Groşan este foarte bine adaptată şi laudă demensul şi rezultatele obţinute cu pacienţii vindecaţi cu succes de COVID-19

„Mi se pare o schemă de tratament foarte bine adaptată şi este foarte asemănătoare cu ceea ce folosește domnul doctor Alexie în Statele Unite. Sunt convinsă că bolnavii dacă era o asimptomatici nu ar fi ajuns la cabinetul medicului pentru că nu aveau de ce, iar ceilalți probabil că nu au ajuns la ATI pentru că există doamna doctor.

„Mie mi se pare absolut extraordinar ceea ce face”

„Mie mi se pare absolut extraordinar ceea ce face. Schema de tratament nu este atipică, este o schemă de tratament foarte asemănătoare cu ceea ce fac ceilalţi colegi.

Numai că există niște atitudini pe care eu nu le înțeleg, care vin fie de la ziarişti, sau de la colegi medici. Eu nu am auzit până acum să facă o reclamație un medic împotriva altui medic, doar dacă s-au bătut sau dacă au avut atitudine unul față de altul. Eu nu am mai auzit așa ceva Eu știu că reclamațiile la Colegiul Medicilor se fac de către pacienții nemulțumiți, și nici întru în caz de către un mediu.

„Reclamaţiile la colegiul medicilor ajung după un an după anchete. Aceasta reclamaţie a ajuns imediat”

Al doilea lucru care ne dă de gândit. Eu știu despre doamna doctor Carmen Pantiș președinta Colegiului de acolo, că este un om foarte serios. Cum este posibil ca o reclamație, care de obicei ajunge după un an, pentru că sunt multe reclamații, aici nu s-a întâmplat nimic rău din câte știu eu. Sunt reclamații unde s-au întâmplat lucruri grele și cu toate astea ajung târziu, pentru că se face o anchetă se vorbește cu pacienții.

„Orice fel de tratament de avangardă care dă rezultate trebuie multiplicat”

Aici au pus pe masă Colegiului tema aceasta imediat. Mi se pare absolut inadmisibil și e de neînţeles. Ceea ce face doamna doctor este un lucru absolut extraordinar și o cred că într-o pandemie în care există o boală despre care nu știm mai nimic, pentru că asta este realitatea, nu se știe mare lucru despre ea, orice fel de tratament de avangardă care dă rezultate trebuie multiplicat și în nici un caz nu trebuie criticat.

Așa a fost și cu ivermectina, uitați-va că în Statele Unite și în alte țări se folosește schema de tratament. Niciun medic din lumea asta nu este obligat să trateze după un protocol fix”, a mai spus medicul Monica Pop.

https://www.antena3.ro/actualitate/sanatate/dr-monica-pop-schema-tratament-covid-flavia-grosan-596322.html