Arhive

cancer san cu metastaze cerebrale – remisie cu boswellia serrata (tamaie)

Pacienta oncologica se prezinta la urgenta cu dureri de cap. cu un an inainte fusese diagnosticata cu cancer de san, HER2+, stadiu 1 si facuse tratament cu trastuzamab. I se face analiza markerilor tumorali si un CT la cap si i se descopera metastaze cerebrale. Incepe tratamentul cu capecitabina si radioterapie insa nu apare nici o imbunatatire in urmatoarele 2 saptamani. I se recomanda sa ia si tamaie/boswellia serrata (3x800mg/zi) si dupa 10 saptamani de tratament, metastazele au disparut si ramane in remisie in urmatorii 4 ani.

Restricție calorică și nutrițională pentru a spori eficacitatea chimioterapiei pentru leucemia limfoblastică acută: studiul IDEAL

Puncte cheie

  • Integrarea restricției calorice în inducția B-ALL este fezabilă, reduce creșterea grăsimii în excesul de greutate și îmbunătățește răspunsul bolii la tratament.
  • Insulina și adiponectina sunt identificate ca potențiali biomarkeri ai chimiosensibilității B-ALL care justifică investigații suplimentare.

Mergi la:

Abstract

A fi supraponderal sau obez (OW / OB) în timpul inducerii leucemiei limfoblastice acute cu celule B (ALL-B) este asociat cu chimiorezistență, cuantificat prin boala reziduală minimă (MRD). Am emis ipoteza că restricțiile calorice și nutritive din dietă / exerciții fizice ar putea reduce câștigurile din masa grasă (FM) și pot reduce MRD postinducție. Studiul Îmbunătățirea dietei și exercițiului în ALL (IDEAL) a înscris pacienți cu vârsta cuprinsă între 10 și 21 de ani, nou diagnosticați cu B-ALL (n = 40), în comparație cu un control istoric recent (n = 80). Concepute pentru a atinge deficite calorice ≥20% în timpul inducției, pentru a reduce aportul de grăsimi / sarcina glicemică și pentru a crește activitatea, punctele finale ale IDEAL au fost câștigul FM (primar), MRD ≥0,01% și aderența / fezabilitatea. Biologia integrată a explorat biomarkerii fiziologiei OW / OB. Intervenția IDEALĂ nu a redus semnificativ modificarea mediană a FM față de valoarea inițială (+5.1% [intervalul interquartilei [IQR], 15,8] vs + 10,7% [IQR, 16,0];P = .13), dar analiza stratificată a arătat beneficii la cei OW / OB (+ 1.5% [IQR, 6.6] vs + 9.7% [IQR, 11.1]; P = .02). După luarea în considerare a factorilor de prognostic, intervenția IDEAL a redus semnificativ riscul MRD (odds ratio, 0,30; 95% interval de încredere, 0,09-0,92; P= .02). Studiul a depășit pragurile de aderare (≥75% din dieta generală) și de fezabilitate (≥80% vizite finalizate). Biologia integrată a constatat că intervenția IDEAL a crescut adiponectina circulantă și a redus rezistența la insulină. Intervenția IDEALĂ a fost fezabilă, a scăzut creșterea grăsimii la cei OW / OB și a redus boala reziduala minima MRD. Acesta este primul studiu efectuat în orice tumoră malignă hematologică pentru a demonstra potențialul beneficiu al restricției calorice prin dietă / exerciții pentru a spori eficacitatea chimioterapiei și a îmbunătăți răspunsul la boală. Un studiu prospectiv, randomizat, este justificat pentru validare. Aceste studii au fost înregistrate la www.clinicaltrials.gov ca # NCT02708108 (studiu IDEAL) și # NCT01317940 (control istoric).\

Rezumat vizual

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansuri ADV2020004018absf1.jpg

Blood Adv. 2021 13 aprilie; 5 (7): 1853–1861.Publicat online 2021 apr 1. 

doi:  10.1182 / bloodadvances.2020004018 PMCID: PMC8045487 PMID: 33792627

Etan Orgel , Celia Framson , Rubi Buxton , Jiyoon Kim , Gang Li , Jonathan Tucci , David R. Freyer , Weili Sun , Matthew J. Oberley , Christina Dieli-Conwright , 8 și Steven D. Mittelman 5

Informații despre autor

 Note despre articol 

Informații privind drepturile de autor și licență 

Disclaimer

Date asociate

Materiale suplimentare\

Introducere

Excesul de greutate și obezitatea sunt din ce în ce mai recunoscute ca contribuind semnificativ la incidența cancerului, recidiva și supraviețuirea pacientului. 1– 3 Impactul advers al obezității asupra rezultatului cancerului a fost bine descris pentru leucemia limfoblastică acută cu celule B (ALL; B-ALL), 4– 8 cele mai frecvente malignități pediatrice. Mai mult decât atât, obezitatea preexistentă este asociată cu un risc crescut de a dezvolta B-ALL în timpul copilăriei 9, în care până la 40% dintre copii și adolescenți încep tratamentul ALL cu supraponderalitate sau obezitate (OW / OB). 9 , 10 Chimioterapia prelungită cu glucocorticoizi și comportamentul sedentar în prima lună de terapie (inducție) agravează în continuare această problemă, provocând creșteri rapide ale grăsimilor. 10 , 11 Fiind obez în timpul tratamentului pentru Institutul Național al Cancerului (NCI) / Roma cu risc ridicat de B-ALL (HR-ALL) conferă un risc cu 50% mai mare de recidivă și supraviețuire mai slabă la copii și adulți. 5 , 7Studiile preclinice care demonstrează chimiorezistența mediată de adipocite în B-ALL au adăugat dovezi biologice pentru a susține aceste asociații. 12– 16 Influența adversă a obezității începe din momentul diagnosticului; pacienții OW / OB la diagnostic prezintă un risc mai mult de două ori mai mare pentru boala reziduală minimă persistentă (MRD) la sfârșitul inducției (EOI). 17 Deoarece eradicarea timpurie a celulelor B-ALL cuantificate prin MRD este un semn distinctiv al chemosensibilității în B-ALL și cel mai puternic predictor al recăderii și supraviețuirii, 18 , 19 această constatare este deosebit de îngrijorătoare.

Cu toate acestea, datele recente sugerează că impactul negativ al OW / OB asupra tuturor rezultatelor poate fi reversibil. O analiză secundară a datelor studiilor clinice din cadrul grupului oncologic pentru copii (COG) a arătat că pacienții obezi care au devenit nonobezi în timpul tratamentului au avut un risc redus de recidivă. 20 Grupul nostru a testat acest efect într-un model preclinic și a constatat că trecerea șoarecilor obezi la o dietă cu conținut scăzut de calorii și grăsimi concomitent cu chimioterapia a îmbunătățit în mod similar supraviețuirea. 21 Aceste observații implică faptul că o intervenție care vizează obezitatea ar putea inversa efectele sale negative. Restricția calorică și privarea de combustibili cheie (de exemplu, glucoză, acizi grași) au fost identificate ca căi prin care chimiorezistența indusă de obezitate și / sau progresia tumorii pot fi inversate. 22Cu toate acestea, eficacitatea acestei abordări pentru îmbunătățirea răspunsului la boală nu a fost încă demonstrată în niciun cancer pediatric sau hematologic. 23 Îmbunătățirea chimiosensibilității celulelor maligne fără intensificarea dozelor este crucială pentru a spori eficacitatea chimioterapiei fără a crește povara vindecării din cauza toxicității legate de tratament.

Din aceste date, am emis ipoteza că inducerea unui deficit caloric concomitent cu restricția macronutrienților plus exercițiul fizic ar scădea creșterea grăsimii în timpul inducției, inversa fiziologia supraponderală și, prin urmare, ar îmbunătăți chemosensibilitatea B-ALL, evidențiată de reducerea MRD. Așa cum am constatat anterior că pacienții care încep terapia cu lean adipozității semnificativ , de asemenea , a câștigat și fiziologie excesului de greutate, 11 am emis ipoteza în continuare că ambele OW / OB si slaba pacientii ar putea beneficia de o astfel de intervenție. Pentru a testa acest lucru, am efectuat un studiu controlat de dovadă de principiu, non-randomizat, care vizează fiziologia supraponderală și aportul nutrițional la copiii mai mari și adolescenții nou diagnosticați cu HR-ALL (îmbunătățirea dietei și exercițiul în studiul ALL [IDEAL]).Mergi la:

Metode

Populația de pacienți

Pacienții cu vârsta cuprinsă între 10 și 21 de ani, nou diagnosticați cu NCI / Roma HR-ALL de novo și au început tratamentul cu un regim de inducere a 4 medicamente în stil COG la 2 centre academice regionale au fost eligibili pentru înscrierea în studiul IDEAL. Pacienții cu HR-ALL <10 ani (de exemplu, care prezintă un număr de celule albe din sânge [WBC] de 50 × 10 3 / μL) au fost excluși pentru a maximiza rolul autoeficacității și implicarea pacienților în dietă și intervenția de efort . 24 , 25 Detaliile stratificării riscului de COG și chimioterapia de inducție pentru HR-ALL au fost descrise anterior. 26 , 27 Pacienți cu sindrom Down, indicele de masă corporală (IMC) <percentila 10 (sau IMC <18,5 la pacienții ≥20 ani), 28disfuncția intestinală preexistentă sau cei incapabili să efectueze intervenția (de exemplu, bolnavi critici la prezentare) au fost excluși. Procesul IDEAL a fost deschis acumularii din mai 2016 până în martie 2019. Controlul istoric a fost stabilit de la pacienții B-ALL consecutivi neselectați tratați între ianuarie 2008 și martie 2014 cu același regim de inducție în stil COG și care îndeplinesc criteriile de eligibilitate aplicabile. Cel mai recent subset al controlului istoric (2011-2014) a fost înscris într-un studiu prospectiv al compoziției corpului în timpul terapiei ALL. Acest studiu predecesor a inclus terapia postinductivă cu vitamina D 29 ; cu toate acestea, datele privind compoziția corporală a masei grase (FM) și a masei slabe (LM) incluse în controlul istoric au fost obținute exclusiv din faza de inducție a pre-vitaminei D, numai de observare a studiului.11 Consimțământul informat a fost obținut și documentat de la toți subiecții înainte de înscriere. Atât procesul actual, cât și cel precedent au fost aprobate de către comitetele de revizuire instituționale ale spitalelor.

Proiectarea studiului și punctele finale

Studiul IDEAL a fost un studiu prospectiv, non-randomizat, controlat, cu punctul final principal al modificării procentuale în FM în timpul inducției. Punctele finale secundare au fost EOI MRD și fezabilitatea și respectarea intervenției. Intervenția a fost efectuată numai în timpul fazei de inducție de 4 săptămâni (Figura 1 suplimentară). După cum am arătat anterior că modificarea procentului IMC în timpul inducției nu se corelează cu modificarea FM și LM, compoziția corpului 11 a fost măsurată la diagnostic și la EOI în studiul IDEAL și controlul istoric utilizând standardul de aur al întregului corp, cu energie duală absorptiometria cu raze X (DXA) așa cum s-a descris anterior (densitometrul fasciculului ventilatorului în modul matrice [Delphi W; Hologic Inc, Waltham, MA]). 11MRD în măduvă a fost măsurată prin citometrie în flux într-un laborator certificat COG utilizând un panou standardizat de anticorpi și strategii ierarhice de gating pentru a stabili o populație imunofenotipică „diferită de cea normală”. 18 MRD + a fost definită folosind un prag de ≥0.010% per contemporan B-ALL stratificare a riscului 18și MRD detectabil ca ≥0.000%. Fezabilitatea a fost definită ca completarea a ≥80% din vizitele săptămânale de studiu pentru pacienții care primesc chimioterapie de inducție. Aderența a fost definită ca ≥75% la intervenția prescrisă, evaluată de dietetician și auto-raportată pentru exerciții. Biologia integrată a evaluat biomarkerii a 4 mecanisme teoretizate pentru chimiorezistența B-ALL indusă de obezitate: factori de creștere, adipokine (citokine asociate adipocitelor), inflamație și sensibilitate la insulină. Atât pentru studiul IDEAL, cât și pentru controlul istoric, biomarkerii de imagistică și de laborator trebuiau obținuți înainte de începerea chimioterapiei, acolo unde este posibil. Toți biomarkerii au trebuit colectați înainte de începerea intervenției și ambii biomarkeri și imagistica au fost obligați să apară în 96 de ore de la începerea chimioterapiei (protocol suplimentar de încercare).

Intervenție IDEALĂ

Intervenția IDEALĂ a fost concepută pentru a induce un deficit caloric de ≥20%, împărțit în mod egal între aportul redus de calorii și creșterea cheltuielilor energetice.(activitate fizica) Necesarul estimat de energie al pacientului a fost calculat utilizând ecuația Schofield pentru rata metabolică bazală ajustată pentru un factor de activitate de 1,3. 30 , 31Intervenția a început cât mai devreme posibil după inițierea chimioterapiei și înainte de ziua de inducție 4. Vizitele de studiu au fost integrate în vizitele săptămânale de rutină pentru chimioterapie în clinica ambulatorie sau în cadrul internării (Figura suplimentară 1). Aspectele generale ale intervenției au inclus (1) evaluarea preferințelor pacientului pentru a individualiza dieta și alegerile de exercițiu, (2) includerea familiei în educație și (3) întărirea săptămânală folosind tehnici de intervievare motivațională.

Prescripțiile de educație, dietă și exerciții sunt rezumate în tabelul 1și furnizate în detaliu în protocolul suplimentar Trial. Dieteticianul din studiu a efectuat planificarea meniului individualizat cu schimburi de alimente, așa cum este descris de Schenk și colab. 32 Dieta a fost întărită la vizitele săptămânale și cu apeluri telefonice la intervale opționale. Aportul alimentar a fost înregistrat folosind înregistrări alimentare de 3 zile și rechemări de 24 de ore. Nutrienții au fost calculați utilizând baza de date pentru alimente și nutrienți a Departamentului Agriculturii din SUA (USDA) pentru studii dietetice. 33Nivelurile de glucoză au fost monitorizate de către furnizori în timpul inducției ca standard de îngrijire, cu insulină prescrisă în mod obișnuit pentru hiperglicemie indusă de steroizi (glucoză în repaus alimentar, ≥126; postprandial, ≥200); datele privind utilizarea insulinei au fost extrase din înregistrările de tratament ca o măsură relevantă clinic a rezistenței la insulină și a eșecului celulelor β. Un fiziolog și fizioterapeut (PT) a proiectat intervenția de exerciții aerobice și de rezistență utilizând echivalentul metabolic al sarcinilor (MET) pentru a cuantifica exercițiile moderate până la viguroase pentru un „meniu” personalizat de activități. PT a evaluat funcția și puterea motorului la momentul inițial și săptămânal folosind testul Bruininks-Oseretsky de competență motorie, ediția a doua (BOT-2). 34Pe baza evaluărilor săptămânale ale performanței, prescripția pentru exerciții fizice a fost ajustată folosind MET pentru fiecare activitate pentru a menține efortul obiectivului. Un pedometru Fitbit Flex 2 a fost furnizat pentru a măsura activitatea acasă. Datele Fitbit au fost extrase central folosind Fitabase (SmallSteps Labs, LLC).

Tabelul 1.

Rezumatul intervenției IDEALE

Intervenție IDEALĂ
Tema educațieiAbordare
 Beneficii de dietă și exerciții fizice în timpul inducției Integrat în conferința medicului și evaluarea dietei (prin RD) și a activității (prin PT)
 Selecția alimentelor și controlul porțiilor My Plate (USDA), semafor, meniuri individualizate cu recomandări de porțiuni
 Exercițiu sigur în timpul chimioterapiei Instrucțiuni, demonstrații și tehnici de către PT în timpul vizitelor
Intervenția dieteiObiectivul zilnic de aport
 Deficitul caloric * ≥10%
 Proteină ≥20% din totalul caloriilor
 Gras <25% din totalul caloriilor
 Carbohidrați <55% din totalul caloriilor
 Sarcină glicemică scăzută  <100/2000 kcal
 Progresie Obiectiv caloric ± 5% săptămânal
Intervenție de exercițiuObiective
 Cheltuieli calorice * ≥10%
 Frecvență Zilnic
 Intensitate  Efort moderat
 Timp Sesiuni de 15-30 de minute (200 min / săptămână)
 Tip Exercițiu aerob + antrenament de rezistență
 Locație Acasă §
 Progresie Așa cum este tolerat

RD, dietetician înregistrat.* Estimat din necesarul de energie estimat calculat; vezi „Metode”. Calculat folosind indicele glicemic pentru alimentele consumate, prag ajustat pentru aportul real de calorii. Calculat pentru fiecare dintr-un meniu de activități comune folosind MET.§ Continuarea internării pentru cei spitalizați în timpul inducției.

Biomarkeri integrati ai fiziologiei OW / OB

Plasma a fost colectată de la fiecare pacient la diagnostic și la EOI pentru a măsura factorii de creștere, citokine și adipokine. Testele Luminex au fost utilizate pentru a măsura interleukina 1β (IL-1β), IL-6, IL-10 și factorul de necroză tumorală α (EMD Millipore) și a leptinei, insulinei, a factorului de creștere asemănător insulinei [IGF] care leagă proteina 3 ( IFGBP-3), factorul de activare a celulelor B (BAFF) și proteina de legare a acizilor grași 4 (sisteme de cercetare și dezvoltare). Adiponectina totală / Acrp30, IGF-1 totală și IGF-1 liberă au fost măsurate utilizând teste individuale imunosorbente legate de enzime (sisteme R&D). Nivelurile rezultate în afara limitei de detectare a testului în ambele direcții au fost incluse în mod conservator în analiză la limita de detectare. Toate analizele citokinelor au fost efectuate de către Immune Assessment Core de la UCLA, urmând instrucțiunile producătorului.

metode statistice

Normele populației ajustate în funcție de vârstă / sex au fost utilizate pentru a defini starea greutății: OW / OB (IMC ≥85%) 28 față de slab (IMC, 10% până la 84,9%). Pentru pacienții cu vârsta ≥20 de ani, categoriile au fost definite utilizând criterii pentru adulți (IMC ≥25 și IMC 18,5-24,9, respectiv). Mărimea eșantionului a fost determinată în funcție de punctul final principal al modificării în FM față de valoarea inițială, comparativ între cohorta IDEAL și controlul istoric, pe baza unui eșantion t , cu două fețe, ttest cu 5% eroare de tip I și cel puțin 90% putere pentru a detecta o diferență de 2,5 puncte procentuale în schimbarea FM între cele 2 cohorte. Modificarea procentuală în FM a fost calculată pentru fiecare pacient, ajustată pentru FM de bază. În plus față de analiza primară pentru diferențele generale, datorită diferențelor probabile de comportament și răspuns la intervenția IDEAL, analizele sub-grup exploratorii post-hoc au examinat modificarea FM stratificată de pacienții care erau OW / OB față de cei slabi. Pentru a analiza punctul final secundar al MRD, au fost construite modele liniare generalizate care utilizează regresia logistică binară, inclusiv indicatori prognostici demografici și tradiționali (vârstă, număr inițial WBC, categorie de risc citogenetic, sex, etnie). Pentru a evalua o influență potențială a perioadei de tratament asupra punctului final al MRD între controlul istoric și cohorta IDEAL,MRD a fost analizată cu interacțiunea cohortei și anul diagnosticului. Toate testele statistice au fost efectuate ca teste pe 2 fețe, cu excepția testelor unilaterale determinate a priori pentru punctul final MRD, cu semnificația stabilită laP <.05. Fezabilitatea și aderența au fost calculate ca medie pentru cohortă în general și pe componente de intervenție. Analizele citokinelor au fost analizate cu abordări parametrice sau neparametrice, după cum s-a considerat adecvat. Toate analizele au fost efectuate folosind R ( www.r-project.org ).Mergi la:

Rezultate

Populația de studiu

Studiul IDEAL a înrolat 40 de pacienți cu HR-ALL nou diagnosticat. Dintre acestea, 36 din 40 au fost evaluate de DXA pentru punctul final principal, 38 din 40 pentru MRD și 39 din 40 pentru aderență și fezabilitate (vezi CONSORT; Figura 2 suplimentară). Controlul istoric a inclus 80 de pacienți tratați consecutiv pentru comparație, dintre care 36 au fost înrolați în studiul de compoziție corporală cu rezultate DXA pereche pre / postinducție. Așa cum se arată în tabel 2, nu a existat nicio diferență în ceea ce privește vârsta, sexul sau prezentarea WBC în comparație cu martorii; studiul IDEAL a inclus mai puțini pacienți hispanici, deși 15% dintre pacienții IDEAL nu au raportat etnia. Comparația compoziției corpului între cohorte a demonstrat că cohorta IDEAL a avut un procent mai mare de IMC și FM la momentul inițial, deși diferențele în FM au fost limitate în principal la cele OW / OB la diagnostic (Tabelul 1 suplimentar). Cohorta IDEAL a fost, de asemenea, înclinată spre caracteristici biologice nefavorabile (tabel 2). Mai exact, mai puțini pacienți în IDEAL au demonstrat dublă trisomie (4 și 10) și au fost identificați mai mulți pacienți cu caracteristici prognostice citogenetice adverse cunoscute (48% vs 10%). Creșterea biologiei adverse s-a datorat în primul rând implementării screeningului pentru cromozomii Philadelphia (cum ar fi Ph) ca LLA ca boală cu risc mai mare în 2016 (tabelul suplimentar 2). 35 , 36 În ciuda screening-ului pentru genetică asemănătoare Ph-ului, chimioterapia de inducție a rămas constantă între cohorte, incluzând nicio terapie specifică adăugată în timpul intervenției de studiu pentru cei cu LLA Ph-like. Examinarea efectului de timp nu a arătat nicio influență a anului de diagnostic asupra ratelor de MRD pozitive sau detectabile ( P = .60 și P= .47, respectiv). Comparația caracteristicilor de prezentare din subsetul DXA și subseturile de biomarkeri a arătat modele similare cohortei părinte (tabelele suplimentare 3 și 4).

tabel 2.

Descrierea cohortei

CaracteristicăProces IDEAL, nr. (%) sau medie ± SDControl istoric, nr. (%) sau medie ± SDP
Total40 (100)80 (100)n / A
Vârstă, y
 Media ± SD15,0 ± 3,014,7 ± 2,5.72
 10-14.919 (48)46 (58).34
 ≥1521 (52)34 (42)
Sex
 Femeie16 (40)37 (46).56
 Masculin24 (60)43 (54)
Etnie
 Nu hispanic8 (20)14 (18).002
 Hispanic26 (65)66 (83)
 Nu a fost raportat6 (15)0 (0)
WBC, × 10 3 / μL
 Media ± SD56 ± 11750 ± 93.54
 <5031 (77)57 (71).52
 ≥509 (23)23 (29)
Citogenetica *
 Neutru18 (45)61 (76)<.001
 Favorabil3 (7)10 (13)
 Advers19 (48)8 (10)
 Necunoscut0 (0)1 (1)
Boala SNC 
 CNS126 (65)62 (78).32
 CNS212 (30)16 (20)
 CNS32 (5)2 (2)
Categoria IMC
 A se sprijini14 (35)45 (56).09
 Supraponderal6 (15)9 (11)
 Obezi20 (50)26 (33)
IMC percentilă79,5 ± 27,367,2 ± 32,8.03
Compoziția corpului 
 Masă grasă, kg25,2 ± 14,118,4 ± 11,3.04
 % Gras32,7 ± 9,627,8 ± 9,0.02
 Masă slabă, kg45,3 ± 14,739,5 ± 12,5.11
 % A se sprijini64,4 ± 9,268,9 ± 8,5.02

Deschideți într-o fereastră separată

SNC, sistemul nervos central; CNS1, fără celule blastice în lichidul cefalorahidian (LCR); CNS2, <5 WBC / μL CSF cu celule blastice; CNS3, ≥5 WBC / μL CSF cu celule blastice sau semne de implicare a SNC; n / a, nu se aplică; SD, deviație standard.* Citogenetica clasificată utilizând stratificarea riscului COG; vezi „Metode”. Implicarea SNC conform criteriilor COG. Compoziția corpului evaluată de DXA în subsetul controlului istoric.

Eficacitate pentru a preveni creșterea grăsimii

În ansamblu, nu a existat nicio diferență semnificativă în modificarea FM față de valoarea inițială de preinducție la cei care au primit intervenția IDEAL față de controlul istoric DXA (schimbare mediană, + 5,1% [interval intercuartiliu [IQR], 15,8) vs + 10,7% [IQR, 16,0 ]; P = .13). Pacienții care au aderat la intervenția dietetică, așa cum sunt definiți prin protocol, au câștigat cel mai mic nivel FM (schimbare mediană, + 2,4% [IQR, 13,7]). Cu toate acestea, în analiza de subgrup exploratorie stratificată după IMC la diagnostic (Figura 1A), Pacienții OW / OB IDEAL au câștigat semnificativ mai puțin FM decât controalele OW / OB (schimbare mediană, + 1,5% [IQR, 6,6] față de + 9,7% [IQR, 11,1]; P = 0,02), deși nu a fost prezentă nicio diferență pentru cei slabi la diagnostic față de controalele istorice (schimbare mediană, + 20,5% [IQR, 23,6] vs + 11,0% [IQR, 18,6]; P = 0,19). Dintre cei care au început terapia OW / OB în studiul IDEAL, 36% (8 din 22) au pierdut FM în timpul inducției, comparativ cu 25% (4 din 16) din OW / OB în controalele istorice ( P = .42). Intervenția IDEALĂ nu a împiedicat pierderea LM comparativ cu controlul istoric în niciunul dintre grupurile IMC (modificări mediane, slabă -11,6% [IQR, 9,1] vs -13,8% [IQR, 16,9], P = 0,83; OW / OB – 13,1% [IQR, 11,0] vs -15,9 [IQR, 10,1], P =, 95) (Figura 1B).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansuri ADV2020004018f1.jpg

Figura 1.

Modificarea FM și LM în timpul inducției. În comparație cu controalele istorice, modificarea FM față de valoarea inițială (A) a scăzut la cei OW / OB (IMC ≥85%) la diagnostic în cohorta IDEAL, dar nu la cei slabi (IMC <85%). Modificarea LM față de valoarea inițială (B) nu a fost semnificativ diferită pentru niciunul dintre grupuri. * Semnificativ la 2 fețe P <.05.

Eficacitate pentru reducerea EOI MRD

Prevalența MRD EOI stratificată în funcție de categoria IMC este prezentată în Figura 2. Analiza multivariabilă a demonstrat că intervenția IDEAL a fost asociată cu un risc semnificativ redus de pozitivitate MRD EOI după contabilizarea covariabilelor confundante (raportul cotei [OR], 0,30; interval de încredere 95% [IC 95%], 0,09-0,92; P unilateral = .02) (Tabelul 3). Intervenția IDEAL a redus, de asemenea, riscul de MRD detectabil (> 0,000%) comparativ cu controalele istorice (OR, 0,16; IC 95%, 0,04-0,52; P unilateral = 0,002) (Tabelul suplimentar 5). Pacienții cu OW / OB sau WBC inițial mai mare au rămas cu un risc mai mare de MRD EOI. Nu a existat nicio interacțiune semnificativă între IMC și intervenția în model ( P = .60). Datorită diferențelor de clasificare a riscului de LLA de tip Ph între cohorte (Tabelul 2 suplimentar), analiza de sensibilitate a fost efectuată aplicând clasificarea de risc comună de la controlul istoric (AALL08B1 26 ) la ambele studii (adică fără test de tip Ph). Acest model a demonstrat un beneficiu de protecție similar al intervenției IDEAL asupra pozitivității EOI MRD (SAU, 0,30; IC 95%, 0,09-0,84; P unilateral= .01). Reducerea riscului de MRD prin intervenția IDEAL a fost, de asemenea, semnificativă în toate modelele la pragul mai conservator pe 2 fețe de P <.05.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansurile ADV2020004018f2.jpg

Figura 2.

MRD la EOI. Prevalența MRD ≥0,01% la EOI în cohorta IDEAL comparativ cu controalele istorice și stratificată prin inițierea IMC. În studiul IDEAL, 24 din 38 (63%) evaluabile pentru MRD la EOI au fost OW / OB comparativ cu 35 din 80 (44%) în controlul istoric.

Tabelul 3.

Analiza multivariabilă a intervenției IDEALE și EOI MRD ≥ 0,01%

CovariabilSAUIC 95%P
Vârsta ≥15 ani1.100,44-2,79.42
IMC la diagnostic, OW / OB3.401.23-10.13.01 *
WBC la diagnostic, × 10 3 / μL1,011.00-1.02.01 *
Citogenetica
 Favorabil
 Advers0,940,27-3,17.46
Etnie
 Hispanic0,700,19-2,65.29
 Nu a fost raportat
Genul masculin1,530,57-4,17.20
IDEALintervenţie0,300,09-0,92.02 *

Toate valorile P sunt unilaterale; vezi „Metode”.

MRD, boală reziduală minimă în măduva osoasă.* De asemenea, semnificativ la testul pe 2 fețe P <.05. Variabila informează modelul, dar prezice perfect rezultatul (toți pacienții favorabili au fost MRD <0,01%).

Aderența și fezabilitatea

Intervenția IDEAL a fost integrată cu succes în chimioterapia de inducție, cu 86,5% (339 din 392) din toate vizitele de studiu așteptate finalizate. Dintre cei 39 de pacienți cu evaluări ulterioare, respectarea medie a dietei a fost de 82,1% (IC 95%, 77,7-86,5). În special, 92% dintre pacienți (36 din 39) au obținut un bilanț caloric negativ pe tot parcursul inducției. Aderența la fiecare componentă a dietei a depășit pragurile, cu excepția aportului de grăsimi (Figura 3 suplimentară). În schimb, respectarea medie a exercițiilor prescrise a fost de 31,2% (IC 95%, 19,5-43,0). Datele Fitbit au demonstrat că 59% (23 din 39) au respectat monitorizarea activității Fitbit pentru ≥50% din inducție (zile urmărite definite ca orice activitate). Pașii medieni pe zi în zilele urmărite au fost de 1530 pași pe zi (IQR, 1306 pași pe zi).

Biologie integrată

Concentrațiile de citokine au fost analizate la diagnostic (n = 39) și la EOI (n = 36) la pacienții IDEAL și la eșantioane bancare din controlul istoric (n = 28). La diagnostic, leptina a fost pozitivă (Rho 0,70; P <0,001) și adiponectina invers (Rho = -0,28; P = 0,03) corelată cu FM. Raportul adiponectină-leptină (A / L), un marker al sensibilității la insulină, a fost asociat invers cu FM la diagnostic (Rho = -0,66; P <0,001). După inducție, leptina nu s-a modificat semnificativ, dar adiponectina și raportul A / L corespunzător au fost mai mari în cohorta IDEAL decât martorii (Figura 3), indicând o sensibilitate mai mare la insulină cu o mai mică disfuncție adipocitară în cohorta IDEALĂ. În mod corespunzător, 32% dintre pacienții slabi (7 din 22) din controlul istoric DXA au necesitat insulină pentru gestionarea hiperglicemiei, comparativ cu 0% dintre pacienții slabi (0 din 14) în studiul IDEAL ( P = .02). Nu a existat nicio diferență în cerințele de insulină în grupul OW / OB care a primit IDEAL (43%; 10 din 23) față de controalele OW / OB (29%, 6 din 21; P = .24). La cei care nu au primit insulină exogenă, nivelurile de insulină circulante au fost mai mici la EOI în cohorta IDEAL vs martori (n = 25 vs 17, 413 pg / mL [IQR, 395] vs 678 pg / mL [IQR, 303]; P =. 02). Interesant este că în MRD pacienți, raporturile A / L au fost mai mari la EOI în IDEAL vs martori (2,68 [IQR, 4,49] vs 1,32 [IQR, 2,37]; P = 0,09), dar nu la pacienții cu MRD + (1,52 [IQR, 1,02] vs 1,2 [ IQR, 1,65]; P =, 45). Asocierea pre / postcomparări a citokinelor a găsit o stare antiinflamatorie generală în ambele cohorte, cu dovezi suplimentare pentru o sensibilitate îmbunătățită la insulină în IDEAL versus martori (Figura suplimentară 4).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este avansurile ADV2020004018f3.jpg

Figura 3.

Raportul A / L la EOI. Raportul A / L este o măsură sensibilă pentru sensibilitatea la insulină și adipocite sănătoase. Raportul A / L la EOI a fost mai mare atât pentru pacienții slabi, cât și pentru pacienții cu OW / OB tratați în studiul IDEAL în comparație cu controlul istoric. ** Semnificativ la P -2-fețe <<01.Mergi la:

Discuţie

Studiul IDEAL este primul studiu prospectiv pentru testarea restricției calorice și nutrienților plus exerciții fizice ca modalitate terapeutică pentru îmbunătățirea eficacității chimioterapiei și a răspunsului la boală în caz de malignitate hematologică. Studiul IDEAL a dovedit că este fezabil să se integreze acest tip de intervenție cu mai multe fațete în chimioterapia de inducție. Deși intervenția nu a demonstrat un câștig de grăsime redus semnificativ în cohorta generală față de controlul istoric, analizele post hoc stratificate prin IMC au demonstrat diferențe în efectul intervenției la pacienții OW / OB vs slabi. Intervenția IDEAL a redus cu succes creșterea grăsimii la pacienții OW / OB, dar nu și la cei slabi la diagnostic. Cel mai important, intervenția IDEAL a redus riscul apariției MRD EOI la toți pacienții, indiferent de inițierea IMC și după luarea în considerare a caracteristicilor prognostice. În special,acest efect a fost prezent în ciuda numărului mai mic de pacienți din cohorta IDEAL având LLA cu caracteristici biologice cu risc mai mic. Reducerea MRD a fost confirmată și într-o analiză de sensibilitate utilizând aceleași criterii de risc biologic pentru ambele cohorte. Deși toți pacienții au beneficiat astfel de intervenție, riscul pentru MRD a rămas ridicat la cei care erau OW / OB în raport cu omologii lor slabi, în concordanță cu experiența noastră din trecut. Deși studiul nu a fost conceput pentru a evalua supraviețuirea pe termen lung, reducerea cu succes a MRD are ramificații clinice semnificative. MRD rămâne cel mai puternic predictor la nivel de pacient al rezultatului slab37 și, prin urmare, este utilizat în mod obișnuit pentru a ghida intensificarea terapiei, imunoterapia și / sau transplantul de celule hematopoietice, toate acestea adăugând cost și comorbiditate. 38– 40 Astfel, reducerea chimiorezistenței și a MRD în populația HR-ALL scade ambele morbiditate și potențial îmbunătățește supraviețuirea.

Este remarcabil faptul că câștigul în FM a scăzut doar la pacienții cu OW / OB. Aderența la dietă a fost excelentă, cu deficite calorice și obiective de macronutrienți atinse la aproape toți pacienții, inclusiv în grupul slab. Este posibil ca adipocitele și FM-ul corespunzător să răspundă diferit la restricția calorică la pacienții OW / OB față de pacienții slabi. 41 , 42 Deoarece comportamentul sedentar a fost, de asemenea, omniprezent, cu pași medii înregistrați pe zi mai puțin de percentila a cincea pentru copii și adolescenți, 43 poate fi necesar un exercițiu îmbunătățit pentru a restabili flexibilitatea metabolică la pacienții cu FM refractară IDEAL. 42Dincolo de efectele sale asupra FM, inactivitatea fizică în prima lună a contribuit probabil și la pierderea semnificativă a masei musculare constatată în ambele cohorte. Pierderea LM în studiul IDEAL a fost similară cu cea constatată în controalele istorice, indicând faptul că restricția calorică din IDEAL nu a agravat pierderea LM și că chiar și nivelurile scăzute de exercițiu au contracarat orice efect catabolic al restricției calorice. Cu toate acestea, pierderea LM este deosebit de problematică în timpul terapiei ALL. LM este asociat cu densitatea minerală osoasă și, prin urmare, diminuarea LM ar putea exacerba pierderea osoasă dramatică observată în timpul inducerii de la chimioterapia ALL. 44 Procesul succesor planificat al IDEAL va explora aceste întrebări într-un mod aleatoriu, abordând direct comportamentul sedentar și rafinând intervenția exercițiului pentru a promova pierderea FM și menținerea LM.

Am emis ipoteza că IDEAL va reduce FM și, prin urmare, va reduce protecția adipocitelor pentru TOATE celulele. 12 Alternativ, reducerea FM ar putea îmbunătăți profilurile farmacocinetice ale chimioterapiei. 12 , 16 , 45 Cu toate acestea, îmbunătățirea observată a MRD nu a fost legată de aceste modificări ale FM, sugerând că fiziopatologia nu este strict mediată de țesutul adipos în sine. Obezitatea moderează, de asemenea, o varietate de căi de semnalizare intracelulară asociate cancerului implicate în chimiorezistență. 46 , 47Dintre căile potențiale testate în studiu, am identificat calea insulină-glucoză și adipokina adiponectină ca potențiali mediatori cheie ai chimiorezistenței și eficacității IDEAL. Insulina stimulează semnalizarea intracelulară fosfatidilinozitol-3-kinază (PI3K) / AKT, o cale cunoscută și vizabilă implicată în TOATE chimiorezistența. 48 , 49În ciuda cohortei IDEAL care a început tratamentul cu FM mai mare decât cohorta de control istorică, intervenția IDEAL a îmbunătățit sensibilitatea la insulină, fapt demonstrat de creșterea raportului plasmatic A / L, eliminarea necesității de insulină exogenă la pacienții slabi, insulina circulantă mai mică și scăderea BAFF în comparație cu comenzi. Într-un studiu care a testat o formă severă de post intermitent la femeile cu cancer de sân, niveluri mai scăzute de insulină au fost observate în mod similar la cei care au respectat postul cu răspuns îmbunătățit al bolii. 50Deși cu o abordare dietetică diferită și o populație de cancer, aceasta adaugă sprijin rolului presupus al insulinei în chimiorezistență și potențialul modificărilor dietetice de a influența răspunsul bolii la nivelul tumorilor. Interesant, în studiul IDEAL, scăderea insulinei a fost însoțită de creșteri marcate ale adiponectinei. Adiponectina poate contribui separat la îmbunătățirea eficacității chimioterapiei, deoarece inhibă direct și indirect fosforilarea PI3K / AKT și ținta mecanicistă din aval a semnalizării rapamicinei prin protein kinaza activată cu 5 ‘adenozin monofosfat. 51 Aceste constatari sprijini continuarea studiilor de insulină în definirea mecanismului de eficacitate de interventie ideală și nou identifică adiponectina ca un potential biomarker al ALL chemosensitivitate.

Există câteva limitări inerente unui proces de fază incipientă. În primul rând, ca studiu cu un singur braț, IDEAL a încorporat un control istoric nerandomizat pentru comparație. Cu toate acestea, regimurile de inducție statică și ratele de MRD în timpul acestei ere de tratament au minimizat posibilele prejudecăți. Identificarea ulterioară a LLA-ului Ph ca grup de prognostic advers a complicat analiza riscului de bază pentru punctul final al MRD. Pentru a aborda acest lucru, diferențele biologice au fost ajustate pentru toate analizele multivariabile pentru MRD, iar rezultatele pozitive au fost reproduse în analiza de sensibilitate utilizând clasificarea de risc mai veche. De asemenea, observăm că aderența slabă la componenta de exercițiu a fost predominantă și a fost agravată și de inactivitatea fizică. Deoarece exercițiul fizic este o provocare pentru pacienți, acest lucru poate sprijini potențialul beneficiu doar de restricția calorică dietetică.Contribuția relativă la eficacitate a fiecărei componente va necesita o explorare suplimentară într-un studiu mai mare, randomizat. În cele din urmă, recunoaștem că cohorta noastră a inclus pacienți cu rate ridicate de obezitate, etnie hispanică și a inclus doar terapie HR-ALL în stil COG. Agenții de chimioterapie pentru inducerea HR-ALL sunt, de asemenea, relativ conservați în rândul consorțiilor internaționale și au fost chiar adoptați de mulți consorții adulți.7 Cu toate acestea, testarea intervenției IDEAL într-un cadru mai larg este acum justificată. Un studiu prospectiv randomizat, stratificat de TOATE biologia și obezitatea, va fi realizat în cadrul Consorțiului Terapeutic Progrese în Considerația Leucemiei și Limfomului Copilului pentru a valida aceste constatări într-un cadru național de consorțiu. Studiul IDEAL oferă dovada principiului fezabilității și plauzibilității biologice a ruperii legăturii dintre fiziologia supraponderală și biologia tumorii pentru a îmbunătăți eficacitatea chimioterapiei, răspunsul la boală și supraviețuirea în LLA: toate fără morbiditate sau mortalitate adăugate.Mergi la:

Material suplimentar

Versiunea full-text a acestui articol conține un supliment de date.Faceți clic aici pentru fișier de date suplimentare. (1,0M, pdf)Mergi la:

Mulțumiri

Autorii recunosc Richard Sposto pentru contribuția biostatistică la planificarea și proiectarea studiilor, Katie Villabroza pentru coordonarea cercetării clinice și operațiunea studiilor, precum și pacienții și familiile care s-au oferit voluntar să participe la studiile de cercetare.

Această lucrare a fost susținută de Fundația Gabrielle’s Angel pentru cercetarea cancerului și parțial de Institutele Naționale de Sănătate, Institutul Național al Cancerului (subvenții R01 CA201444 [SDM], P30 CA-16042 [GL], UL1TR000124-02 [GL] și P50 CA211015 [GL]) și Centrul Național pentru Avansarea Științelor Translaționale (acordă UL1TR001855 și UL1TR000130) prin intermediul Institutului de Științe Clinice și Translaționale din California de Sud (SC CTSI).

Conținutul este exclusiv responsabilitatea autorilor și nu reprezintă neapărat opiniile oficiale ale Institutelor Naționale de Sănătate.Mergi la:

Note de subsol

Protocolul studiului clinic care detaliază intervenția este disponibil integral în Date suplimentare care însoțesc versiunea online a publicației. Datele individuale agregate sau neidentificate ale participanților care susțin punctele finale primare și secundare vor fi puse la dispoziția autorului corespunzător la cererea rezonabilă și după stabilirea unui acord de acces la date aprobat, pentru o perioadă de 3 ani de la data publicării.Mergi la:

Autor

Contribuție: Toți autorii au participat la proiectarea studiului, interpretarea rezultatelor și revizuirea manuscrisului, au dat aprobarea finală a manuscrisului și sunt de acord să răspundă pentru toate aspectele lucrării legate de acuratețea sau integritatea sa; JK și GL au efectuat analizele statistice; iar EO și SDM au conceput conceptul de încercare și au scris prima versiune a manuscrisului.

Dezvăluirea conflictului de interese: EO a servit într-un consiliu consultativ pentru Servier Pharmaceuticals în afara domeniului acestei activități. Ceilalți autori nu declară interese concurente.

Corespondență: Etan Orgel, Spitalul pentru Copii din Los Angeles, Cancer and Blood Disease Institute, 4650 Sunset Blvd, MS # 54, Los Angeles, CA 90027; e-mail: ude.csu.alhc@legroe .Mergi la:

Referințe

1. Larsson SC, Wolk A. Supraponderalitatea și obezitatea și incidența leucemiei: o meta-analiză a studiilor de cohortă . Int J Rac . 2008; 122 ( 6 ): 1418-1421. [ PubMed ] [ Google Scholar ]2. Calle EE, Rodriguez C, Walker-Thurmond K, Thun MJ. Supraponderalitatea, obezitatea și mortalitatea cauzată de cancer într-o cohortă de adulți din SUA studiată prospectiv . N Engl J Med . 2003; 348 ( 17 ): 1625-1638. [ PubMed ] [ Google Scholar ]3. Lauby-Secretan B, Scoccianti C, Loomis D, Grosse Y, Bianchini F, Straif K; Grupul de lucru al Agenției Internaționale pentru Cercetarea Cancerului. Grăsime corporală și cancer – punctul de vedere al Grupului de lucru IARC . N Engl J Med . 2016; 375 ( 8 ): 794-798. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]4. Orgel E, Genkinger JM, Aggarwal D, Sung L, Nieder M, Ladas EJ. Asocierea indicelui masei corporale și a supraviețuirii în leucemia pediatrică: o meta-analiză . Sunt J Clin Nutr . 2016; 103 ( 3 ): 808-817. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]5. Butturini AM, Dorey FJ, Lange BJ și colab. . Obezitatea și rezultatul în leucemia limfoblastică acută pediatrică . J Clin Oncol . 2007; 25 ( 15 ): 2063-2069. [ PubMed ] [ Google Scholar ]6. Egnell C, Ranta S, Banerjee J, și colab. . Impactul indicelui de masă corporală asupra recăderii la copiii cu leucemie limfoblastică acută tratați conform protocoalelor de tratament nordic . Eur J Haematol . 2020; 105 ( 6 ): 797-807. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]7. Stock W, Luger SM, Advani AS și colab. . Un regim pediatric pentru adolescenți mai în vârstă și adulți tineri cu leucemie limfoblastică acută: rezultate ale CALGB 10403 . Sânge . 2019; 133 ( 14 ): 1548-1559. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]8. Butturini A, Vignetti M, Gubbiotti S, și colab. . Obezitatea prezice independent supraviețuirea fără evenimente (EFS) la adulții cu leucemie limfoblastică acută BCR-ABL-negativă (LLA): o analiză retrospectivă a două studii GIMEMA [rezumat] . Sânge . 2005; 106 ( 11 ). Rezumat 1828. [ Google Scholar ]9. Ghosh T, Richardson M, Gordon PM, Ryder JR, Spector LG, Turcotte LM. Indicele de masă corporală asociat cu riscul de leucemie limfoblastică acută cu celule B cu risc ridicat al copilăriei și adolescenților: un raport al grupului oncologic pentru copii . Cancer Med . 2020; 9 ( 18 ): 6825-6835. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]10. Withycombe JS, Smith LM, Meza JL și colab. . Schimbarea greutății în timpul tratamentului cu inducere a leucemiei limfoblastice acute din copilărie prezice obezitatea: un raport al Grupului de oncologie pentru copii . Cancer de sânge Pediatr . 2015; 62 ( 3 ): 434-439. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]11. Orgel E, Mueske NM, Sposto R, Gilsanz V, Freyer DR, Mittelman SD. Limitări ale indicelui de masă corporală pentru evaluarea compoziției corpului datorită obezității sarcopenice în timpul terapiei cu leucemie . Limfom Leuk . 2018; 59 ( 1 ): 138-145. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]12. Orgel E, Sea JL, Mittelman SD. Mecanisme prin care obezitatea influențează supraviețuirea în urma leucemiei limfoblastice acute . J Natl Cancer Inst Monogr . 2019; 2019 ( 54 ): 152-156. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]13. Behan JW, Yun JP, Proektor MP și colab. . Adipocitele afectează tratamentul leucemiei la șoareci . Cancer Res . 2009; 69 ( 19 ): 7867-7874. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]14. Ehsanipour EA, Sheng X, Behan JW și colab. . Adipocitele provoacă rezistența celulelor leucemice la L-asparaginază prin eliberarea de glutamină . Cancer Res . 2013; 73 ( 10 ): 2998-3006. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]15. Pramanik R, Sheng X, Ichihara B, Heisterkamp N, Mittelman SD. Țesutul adipos atrage și protejează celulele leucemiei limfoblastice acute de chimioterapie . Leuk Res . 2013; 37 ( 5 ): 503-509. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]16. Sheng X, Parmentier JH, Tucci J și colab. . Adipocitele sechestrează și metabolizează daunorubicina chimioterapeutică . Mol Cancer Res . 2017; 15 ( 12 ): 1704-1713. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]17. Orgel E, Tucci J, Alhushki W, și colab. . Obezitatea este asociată cu leucemie reziduală după terapia de inducție pentru leucemia limfoblastică acută precursor B în copilărie . Sânge . 2014; 124 ( 26 ): 3932-3938. [ PubMed ] [ Google Scholar ]18. Borowitz MJ, Wood BL, Devidas M și colab. . Semnificația prognostică a bolii reziduale minime în B-ALL cu risc ridicat: un raport din studiul grupului oncologic pentru copii AALL0232 . Sânge . 2015; 126 ( 8 ): 964-971. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]19. Borowitz MJ, Devidas M, Hunger SP și colab. ; Grupul de Oncologie pentru copii. Semnificația clinică a bolii reziduale minime în leucemia limfoblastică acută din copilărie și relația acesteia cu alți factori de prognostic: un studiu de grup oncologic pentru copii . Sânge . 2008; 111 ( 12 ): 5477-5485. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]20. Orgel E, Sposto R, Malvar J, și colab. . Impactul asupra supraviețuirii și toxicității în funcție de durata extremelor de greutate în timpul tratamentului pentru leucemie limfoblastică acută pediatrică: un raport al Grupului oncologic pentru copii . J Clin Oncol . 2014; 32 ( 13 ): 1331-1337. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]21. Tucci J, Alhushki W, Chen T, Sheng X, Kim YM, Mittelman SD. Trecerea la o dietă cu conținut scăzut de grăsimi îmbunătățește rezultatul leucemiei limfoblastice acute la șoarecii obezi . Cancer Metab . 2018; 6 ( 1 ): 15. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]22. Lettieri-Barbato D, Aquilano K. Împingerea limitelor terapiei împotriva cancerului: jocul nutrienților . Front Oncol . 2018; 8 : 148. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]23. O’Flanagan CH, Smith LA, McDonell SB, Hursting SD. Când mai puțin poate fi mai mult: restricția calorică și răspunsul la terapia cancerului . BMC Med . 2017; 15 ( 1 ): 106. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]24. Walpole B, Dettmer E, Morrongiello BA, McCrindle BW, Hamilton J. Interviuri motivaționale pentru a spori autoeficacitatea și a promova pierderea în greutate la adolescenții supraponderali și obezi: un studiu controlat randomizat . J Pediatr Psychol . 2013; 38 ( 9 ): 944-953. [ PubMed ] [ Google Scholar ]25. Iannotti RJ, Schneider S, Nansel TR și colab. . Autoeficacitatea, așteptările rezultatelor și autogestionarea diabetului la adolescenții cu diabet de tip 1 . J Dev Behav Pediatr . 2006; 27 ( 2 ): 98-105. [ PubMed ] [ Google Scholar ]26. Hunger SP, Loh ML, Whitlock JA și colab. ; COG Comitetul pentru leucemie limfoblastică acută. Planul 2013 al Grupului de Oncologie pentru copii pentru cercetare: leucemie limfoblastică acută . Cancer de sânge Pediatr . 2013; 60 ( 6 ): 957-963. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]27. Larsen EC, Devidas M, Chen S și colab. . Dexametazona și doza mare de metotrexat îmbunătățesc rezultatul pentru copii și adulți tineri cu leucemie limfoblastică acută B cu risc crescut: un raport din studiul grupului oncologic pentru copii AALL0232 . J Clin Oncol . 2016; 34 ( 20 ): 2380-2388. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]28. Kuczmarski R, Ogden C, Grummer-Strawn L, și colab. . Diagrame de creștere CDC: Statele Unite. Date avansate din statistici vitale și de sănătate . Hyattsville, MD: Centrul Național pentru Statistici de Sănătate; 2000. [ PubMed ] [ Google Scholar ]29. Orgel E, Mueske NM, Sposto R și colab. . Un studiu controlat randomizat care testează un regim de vitamina D optimizat pentru aderență pentru a atenua modificarea oaselor la adolescenții tratați pentru leucemie limfoblastică acută . Limfom Leuk . 2017; 58 ( 10 ): 2370-2378. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]30. Necesități de energie și proteine. Raportul unei consultări comune a experților FAO / OMS / UNU . Reprezentant tehnic al Organelor Mondiale pentru Sănătate . 1985; 724 : 1-206. [ PubMed ] [ Google Scholar ]31. Iezuit C, Dillon C, Compher C, Lenders CM; Consiliul Director al Societății Americane pentru Nutriție Parenterală și Enterală (ASPEN). Liniile directoare clinice ASPEN: sprijin nutrițional al pacienților pediatrici spitalizați cu obezitate . JPEN J Parenter Enteral Nutr . 2010; 34 ( 1 ): 13-20. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]32. Schenk JM, Neuhouser ML, Lin DW, Kristal AR. O intervenție dietetică pentru a obține modificări dietetice rapide și complexe pentru studii care investighează efectele dietei asupra țesuturilor colectate în timpul procedurilor chirurgicale invazive . J Am Diet Conf . Univ . 2009; 109 ( 3 ): 459-463. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]33. Serviciul de cercetare agricolă al Departamentului Agriculturii din SUA (USDA). Grupul de cercetare a sondajelor alimentare: Baza de date despre alimente și nutrienți pentru studii dietetice 2013-2014 . http://www.ars.usda.gov/nea/bhnrc/fsrg . Accesat la 18 septembrie 2019.34. Deitz JC, Kartin D, Kopp K. Review of the Bruininks-Oseretsky Test of Motor Proficiency, Second Edition (BOT-2) . Phys Occup Ther Pediatr . 2007; 27 ( 4 ): 87-102. [ PubMed ] [ Google Scholar ]35. Tasian SK, Loh ML, Hunger SP. Leucemie acută limfoblastică asemănătoare cromozomului Philadelphia . Sânge . 2017; 130 ( 19 ): 2064-2072. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]36. Chen IM, Harvey RC, Mullighan CG și colab. . Modelarea rezultatelor cu CRLF2, IKZF1, JAK și boala reziduală minimă în leucemia limfoblastică acută pediatrică: un studiu al grupului oncologic pentru copii . Sânge . 2012; 119 ( 15 ): 3512-3522. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]37. Berry DA, Zhou S, Higley H și colab. . Asocierea bolii reziduale minime cu rezultatul clinic în leucemia limfoblastică acută la copii și adulți: o meta-analiză . JAMA Oncol . 2017; 3 ( 7 ): e170580. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]38. Rețeaua națională cuprinzătoare de cancer (NCCN). NCCN Guidelines: Clinical Practice Guidelines in Oncology: Acute Lymphoblastic Leucemia (Adult and AYA), version1.2020 . Disponibil la: www.nccn.org . Accesat la 20 mai 2020.39. Athale UH, Gibson PJ, Bradley NM, Malkin DM, Hitzler J; Grupul de lucru POGO MRD. Boală reziduală minimă și leucemie infantilă: recomandări standard de îngrijire din partea Grupului de lucru pentru MRD Pediatric Oncology Group din Ontario . Cancer de sânge Pediatr . 2016; 63 ( 6 ): 973-982. [ PubMed ] [ Google Scholar ]40. Hucks G, Rheingold SR. Călătoria către terapia cu celule T CAR: experiența pediatrică și a adulților tineri cu B-ALL recidivant sau refractar . Blood J Cancer . 2019; 9 ( 2 ): 10. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]41. Aydin C, Jarema KA, Phillips PM, Gordon CJ. Restricție calorică la tulpinile slabe și obeze de șobolan de laborator: efecte asupra compoziției corpului, metabolismului, creșterii și sănătății generale . Exp Physiol . 2015; 100 ( 11 ): 1280-1297. [ PubMed ] [ Google Scholar ]42. Rynders CA, Blanc S, DeJong N, Bessesen DH, Bergouignan A. Comportamentul sedentar este un factor determinant al inflexibilității metabolice . J Fiziol . 2018; 596 ( 8 ): 1319-1330. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]43. Barreira TV, Schuna JM Jr., Mire EF și colab. . Pași normativi / zi și valori de cadență de vârf pentru copii și adolescenți din Statele Unite: sondaj național de examinare a sănătății și nutriției 2005-2006 . J Pediatr . 2015; 166 ( 1 ): 139-143. [ PubMed ] [ Google Scholar ]44. Orgel E, Mueske NM, Wren TA și colab. . Lezarea precoce a osului cortical și spongios din chimioterapia de inducție pentru adolescenți și adulți tineri tratați pentru leucemie limfoblastică acută . Bone . 2016; 85 : 131-137. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]45. Behan JW, Avramis VI, Yun JP, Louie SG, Mittelman SD. Obezitatea indusă de dietă modifică farmacocinetica vincristinei din sânge și țesuturile șoarecilor . Farmacol Res . 2010; 61 ( 5 ): 385-390. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]46. Chen J. Căi de semnal multiple în cancerul asociat obezității . Obes Rev . 2011; 12 ( 12 ): 1063-1070. [ PubMed ] [ Google Scholar ]47. Longo VD, Fontana L. Restricția caloriilor și prevenirea cancerului: mecanisme metabolice și moleculare . Trends Pharmacol Sci . 2010; 31 ( 2 ): 89-98. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]48. Barrett D, Brown VI, Grupp SA, Teachey DT. Direcționarea axei de semnalizare PI3K / AKT / mTOR la ​​copiii cu afecțiuni maligne hematologice . Medicamentele pediatre . 2012; 14 ( 5 ): 299-316. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Bertacchini J, Heidari N, Mediani L, și colab. . Direcționarea rețelei PI3K / AKT / mTOR pentru tratamentul leucemiei . Cell Mol Life Sci . 2015; 72 ( 12 ): 2337-2347. [ PubMed ] [ Google Scholar ]50. de Groot S, Lugtenberg RT, Cohen D și colab. ; Grupul olandez de cercetare a cancerului de sân (BOOG). Dieta care mimează postul, ca adjuvant la chimioterapia neoadjuvantă pentru cancerul de sân, în studiul multicentric randomizat de fază 2 DIRECT . Nat Commun . 2020; 11 ( 1 ): 3083. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]51. Vansaun MN. Căi moleculare: semnalizarea adiponectinei și a leptinei în cancer . Clin Cancer Res . 2013; 19 ( 8 ): 1926-1932. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]


Articolele de la Blood Advances sunt furnizate aici prin amabilitatea Societății Americane de Hematologie

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8045487/

Impactul unei intervenții dietetice ketogene în timpul radioterapiei asupra compoziției corpului: IV. Rezultatele finale ale studiului KETOCOMP pentru pacienții cu cancer rectal

Clin Nutr

  •  2021 iulie; 40 (7): 4674-4684. doi: 10.1016 / j.clnu.2021.05.015. Epub 2021 31 mai.

Rainer J Klement 1,  Petra S Koebrunner 2,  Detlef Meyer 3,  Ștefan cancelar 3,  Reinhart A Sweeney 4Afilieri extinde

Abstract

Context și obiective: Obezitatea și masa musculară scăzută sunt asociate cu rezultate mai slabe ale pacienților cu cancer colorectal. Am efectuat un studiu controlat pentru a studia impactul unei diete ketogene (KD) bazată pe alimente naturale versus o dietă standard nespecificată (SD) asupra compoziției corpului la pacienții cu cancer rectal supuși radioterapiei.

Metode: Pacienții cu cancer rectal nemetastazat au fost alocați fie grupului KD (N = 24), fie SD (N = 25) în timpul radioterapiei. Compoziția corpului a fost măsurată săptămânal prin analiza bioimpedanței și analizată folosind modele cu efecte mixte liniare. Răspunsul patologic la pacienții supuși tratamentului neoadjuvant a fost evaluat în momentul intervenției chirurgicale.

Rezultate: Un total de 18 KD și 23 de pacienți cu SD au finalizat studiul și au fost eligibili pentru analiză. Grupul SD nu a experimentat modificări remarcabile în niciun parametru al compoziției corpului. În schimb, pacienții din grupul KD au pierdut cantități semnificative de greutate corporală și masă grasă, în medie 0,5 și 0,65 kg / săptămână (p <0,0001). A existat o pierdere rapidă a apei intracelulare în concordanță cu glicogenul intramuscular inițial și epuizarea apei, dar țesutul muscular scheletic a fost conservat. Răspunsurile tumorale patologice au fost oarecum mai mari în grupul KD, cu un grad mediu de regresie Dworak mai mare (p = 0,072) și un procent mai mare de răspunsuri aproape complete (yT0N0 sau yT1N1) (43 față de 15%, p = 0,116) care aproape a atins statistic semnificație în analiza intenției de a trata (50% față de 14%, p = 0,018).

Concluzii: La pacienții cu cancer rectal supuși radioterapiei curative, un KD a redus semnificativ greutatea corporală și masa de grăsime, păstrând în același timp masa musculară scheletică. Am putea demonstra o tendință pentru KD care contribuie sinergic la răspunsul patologic al tumorii, o constatare în conformitate cu datele preclinice care justifică confirmarea viitoare în studii mai ample.

Înregistrare proces: identificator ClinicalTrials.gov: NCT02516501 , înregistrat la 06 august 2015.

Cuvinte cheie: aminoacizi; Analiza bioimpedanței; Corpuri cetonice; Nutriție; Răspuns patologic.

Declarație privind conflictul de interese

Conflict de interese RJK a primit un onorariu de la compania vitaflo pentru a susține o discuție despre obiectivele și rezultatele preliminare ale studiului KETOCOMP. RJK, PSK și RAS urmează ocazional un KD. Nu există alte conflicte de interese potențiale, în special niciun conflict financiar de interese. Companiile care furnizează probe de produse pentru acest studiu nu au avut nicio influență asupra proiectării, colectării datelor și analizei și niciunul dintre autori nu are nicio relație de afaceri cu aceștia.

Itraconazol și rezistența la mai multe medicamente: efecte posibile asupra ratei de remisie și a supraviețuirii fără boli în leucemia acută

G Vreugdenhil 1,  JM Raemaekers ,  BJ van Dijke ,  BE de PauwAfilieri extinde

Abstract

S-a raportat că Itraconazolul, un agent antifungic triazolic, inversează rezistența la medicamente împotriva daunorubicinei în leucemia acută. Într-o subanaliză dintr-un studiu dublu-orb, controlat cu placebo, care a examinat efectele itraconazolului asupra prevenirii infecțiilor fungice la pacienții neutropenici, am studiat efectele itraconazolului asupra ratei de remisie și a supraviețuirii fără boli la pacienții cu limfoblastic acut (LLA) și leucemie mielogenă acută (LMA) care primesc scheme de tratament de inducție a remisiunii care conțin daunorubicină (DNR). Unsprezece pacienți cu LLA și 17 LAM au primit itraconazol și 12 pacienți cu LLA și 25 de LAM au primit placebo. Dintre pacienții cu LMA, rata de remisie a fost ușor mai mare în grupul cu itraconazol, în timp ce supraviețuirea fără boală a fost mai mare la TOȚI pacienții cărora li s-a administrat itraconazol.La pacienții cu LMA, DFS a fost comparabilă în ambele grupuri, dar numărul pacienților cu risc crescut din grupul cu itraconazol a fost mai mare. Aceste rezultate preliminare pot sugera un rol pentru itraconazol în inversarea rezistenței la mai multe medicamente. Cu toate acestea, sunt necesare studii mai mari pentru a justifica aceste constatări și pentru a le corela cu efectele sale in vitro asupra rezistenței la mai multe medicamente.

Referințe

  1. Agenți antimicrobieni Chemother. 1984 oct; 26 (4): 527-34 – PubMed

Impactul Itraconazolului după chimioterapia de primă linie asupra supraviețuirii pacienților cu cancer de tract biliar metastatic

HIROSHI TSUBAMOTO , TAKASHI SONODA , SHINICHI IKUTA , SATOSHI TANI , KAYO INOUE și NAOKI YAMANAKACercetare anticancer septembrie 2015, 35 (9) 4923-4927;

Abstract

Scop: Am evaluat eficacitatea și siguranța itraconazolului după chimioterapie de primă linie la pacienții cu cancer metastatic al tractului biliar (BTC). Pacienți și metode: Am analizat retrospectiv datele de la pacienții cu BTC diagnosticați histologic cu metastaze la distanță care au primit una sau mai multe linii de chimioterapie și chimioterapie ulterioară cu itraconazol.

Rezultate: Dintre 28 de pacienți înrolați, 26 (93%) au primit docetaxel (35 mg / m 2 ), gemcitabina (1000 mg / m 2) și carboplatină (ASC4) în ziua 1 și soluție orală de itraconazol (400 mg) în zilele −2 până la 2, repetată la fiecare 2 săptămâni. Doi pacienți au primit docetaxel plus itraconazol împreună cu irinotecan. Au fost observate două răspunsuri complete și 14 răspunsuri parțiale, cu o rată de răspuns de 57%. Supraviețuirea globală mediană a fost de 12,0 luni. Pe parcursul a 160 de cicluri, 21 (75%) și 17 (61%) pacienți au avut neutropenie de grad 3/4 și, respectiv, trombocitopenie. Doi pacienți (7%) au prezentat neutropenie febrilă. 

Concluzie: Chimioterapia combinată cu itraconazol după chimioterapia de primă linie este promițătoare pentru pacienții cu BTC metastatic.

Cancerul tractului biliar (BTC) include cancerul care apare din vezica biliară, căile biliare și ampula lui Vater. Incidența BTC este relativ rară și variază în funcție de regiunea geografică și de grupul etnic rasial. În Japonia, 11.345 de pacienți au fost diagnosticați recent în 2010 ( 1 ), iar incidența este de aproximativ 10 ori mai mare decât în ​​Marea Britanie. Prognosticul bolii nerezecabile, recurente sau metastatice este slab. O combinație de gemcitabină și cisplatină sau oxaliplatină este considerată regimul standard de primă linie ( 2 , 3). Nu există dovezi suficiente pentru a recomanda chimioterapia de linia a doua, deși au fost raportate unele beneficii ale chimioterapiei de linia a doua. Nu au existat studii randomizate care să investigheze chimioterapia de linia a doua pentru BTC. Cu toate acestea, 63 din 410 (15%) pacienți din studiul ABC-02 din Marea Britanie și 63 din 84 (75%) pacienți din studiul japonez BT22 au primit chimioterapie de linia a doua, iar supraviețuirea mediană globală (OS) a fost similară în cele două studii (11,7 și respectiv 11,2 luni) ( 2 , 4 ). O revizuire sistematică a studiilor de fază II și a analizelor retrospective a relevat un SO mediu de 7,2 luni după chimioterapia de linia a doua ( 5 ).

Itraconazolul, un agent antifungic obișnuit, este un inhibitor puternic al glicoproteinei P (P-gp; caseta de legare a ATP sub-familia B membru 1, rezistență multiplă la medicamente 1), care joacă un rol critic în chimiorezistență ( 6 , 7 ). Itraconazolul inhibă, de asemenea, semnalele de arici (Hh) în celulele stem canceroase (CSC) ( 8 ). Din 2008, am tratat pacienții cu BTC utilizând chimioterapie combinată cu itraconazol și, în acest document, raportăm studiul nostru explorator retrospectiv care a avut ca scop evaluarea eficacității și toxicității regimurilor care conțin itraconazol pentru tratamentul BTC refractar.

Pacienți și metode

Am analizat retrospectiv dosarele medicale ale pacienților cu BTC confirmată histologic care au avut un istoric de progresie în timpul sau după chimioterapia anterioară și care au primit ulterior chimioterapie în asociere cu itraconazol. Toți pacienții au acordat consimțământul scris în scris, iar protocolul de tratament a fost aprobat de Consiliul de revizuire instituțională (nr. IRB: 2007-0302).

Protocol de tratament. Regimurile citotoxice care conțin docetaxel au fost administrate în asociere cu itraconazol. O soluție orală de itraconazol a fost administrată la 400 mg / zi în zilele −2 până la 2, la fiecare 2 săptămâni. S-au făcut modificări ale dozei pentru a menține numărul scăzut al globulelor albe din sânge (WBC) și al numărului de trombocite între 1.000-1.500 / mm 3 și , respectiv, 30.000-50.000 / mm 3 . Factorul de stimulare a coloniilor de granulocite (G-CSF) a fost administrat în conformitate cu recomandările producătorului până la recuperarea numărului de globule neutre și de neutrofile absolute. Regimul a fost continuat până la progresia bolii sau până când au fost utilizate alte regimuri citotoxice cu itraconazol pentru a preveni neuropatia periferică indusă de chimioterapie.

Eficacitatea a fost evaluată în conformitate cu criteriile de evaluare a răspunsului în tumorile solide (RECIST), versiunea 1.1. OS a fost definit ca timpul de la prima administrare de itraconazol până la deces. Evenimentele adverse au fost clasificate în conformitate cu Criteriile comune de toxicitate ale Institutului Național al Cancerului, versiunea 4.0. Analizele statistice au fost efectuate pe distribuțiile observate ale SO utilizând metoda Kaplan-Meier. Toate analizele au fost efectuate folosind XLSTAT 2014 (Addinsoft, Paris, Franța).

Rezultate

Caracteristicile pacienților.Toți pacienții au fost direcționați către instituția noastră de la spitale terțiare, iar 20 (71%) au fost direcționați după progresie în timpul chimioterapiei anterioare. În perioada ianuarie 2008 – august 2013, 28 de pacienți cu BTC metastatic au fost tratați concomitent cu chimioterapie și itraconazol. Conform criteriilor RECIST 1.1, toți pacienții au avut metastaze la distanță și 19 (68%) au avut metastaze multiple de organe. Optsprezece (64%) pacienți au suferit anterior două sau mai multe linii de chimioterapie. Douăzeci și trei (82%) de pacienți au avut boală progresivă în timpul chimioterapiei anterioare și 18 (64%) au început regimuri care conțin itraconazol în termen de 30 de zile de la ultima dată a chimioterapiei anterioare. Stenturile pentru conducte biliare au fost plasate la șase (21%) pacienți înainte de tratamentul chimioterapiei cu itraconazol. Caracteristicile pacienților sunt rezumate în Tabelul I.

Regimurile conțineau docetaxel, gemcitabină și carboplatină plus itraconazol (DGC plus itraconazol) la 25 de pacienți și docetaxel și irinotecan plus itraconazol la doi pacienți. Numărul mediu de cicluri a fost de 6 (interval = 2-17). Douăzeci și cinci de pacienți (89%) au întrerupt regimul citotoxic inițial cu itraconazol în șase cicluri. Cinci (18%) pacienți au prezentat progresia bolii în timpul regimului inițial. Detaliile regimului DGC plus itraconazol au fost raportate anterior ( 9 ). Pe scurt, dozelor inițiale de docetaxel intravenos, carboplatin, gemcitabină și au fost de 35 mg / m 2 (ziua 1), aria de sub curba de 4 mg min -1 ml -1 (ziua 1) și 1000 mg / m 2 (zi 1), respectiv.

Eficacitatea chimioterapiei combinate cu itraconazol. În timpul unei mediane de șase cicluri de chimioterapie cu itraconazol, au fost observate două răspunsuri complete și 14 răspunsuri parțiale ( Tabelul II ), obținând o rată de răspuns la chimioterapie de 57% [95% interval de încredere (IC) = 39-75%). După inducerea chimioterapiei combinate cu itraconazol, patru pacienți au fost supuși unei intervenții chirurgicale primare și trei au fost supuși radioterapiei. OS median a fost de 12,0 luni (IC 95% = 9,1-24,6 luni), cu date de la cinci pacienți cenzurați ( Figura 1 ).

Toxicități. În timpul administrării a 160 de cicluri, toți pacienții au primit G-CSF ( Tabelul III ). Nouăsprezece (68%), 21 (75%) și 17 (61%) pacienți au avut anemie de grad 3/4, respectiv neutropenie și, respectiv, trombocitopenie. Nouăsprezece (68%) au necesitat transfuzie de globule roșii ambalate atunci când nivelul lor de hemoglobină a scăzut la <8,0 g / dl. Niciun pacient nu a necesitat o transfuzie de trombocite. Doi (7%) pacienți au prezentat neutropenie febrilă. Niciun pacient nu a avut neuropatie periferică senzorială de gradul 2 sau mai mult. Nu au existat decese legate de tratament.

Tabelul I.

Caracteristicile pacienților (n = 28).

Discuţie

Aici am demonstrat că administrarea unei combinații de chimioterapie cu itraconazol a fost sigură și eficientă pentru tratamentul pacienților cu BTC metastatic refractar, mai mult de jumătate dintre pacienți demonstrând un răspuns. OS median a fost de 12,0 luni (IC 95% = 9,1-24,6 luni), ceea ce a fost favorabil comparativ cu cel al controalelor istorice. O revizuire sistematică a relevat un SO mediu după chimioterapia de linia a doua a fost de 7,2 luni (IC 95% = 6,2-8,2 luni) ( 5 ).

Tabelul II.

Răspunsul tumorii la chimioterapia combinată cu itraconazol (n = 28).

Tabelul III.

Toxicități pe parcursul a 160 de cicluri de chimioterapie combinată cu itraconazol (n = 28).

Protocolul actual de adăugare a itraconazolului la chimioterapia citotoxică s-a bazat în principal pe rapoartele anterioare, indicând faptul că itraconazolul a îmbunătățit efectul taxanilor prin inhibarea P-gp ( 6 , 7 ). După expunerea la agenți citotoxici, tumorile reziduale adăpostesc CSC ( 10 ). Conceptul de CSC-uri, sau celule care inițiază tumori, a fost propus pentru a explica metastaza și recurența după expunerea la chimioterapie. CSC-urile se caracterizează prin auto-reînnoire, multi-diferențiere și chimiorezistență și au fost izolate de diferite tipuri de cancer, inclusiv colangiocarcinom ( 11 ). CSC-urile au fost, de asemenea, asociate cu tranziția epitelială-mezenchimală, care joacă un rol esențial în invazia tumorii ( 12). Tumorile reziduale bogate în CSC pretratate supraexprimă P-gp ( 13 , 14 ). Itraconazolul are cea mai mare afinitate în rândul agenților anti-fungici, care servesc ca substraturi pentru P-gp ( 15 ), iar rezistența celulelor canceroase pretratate sau CSC la docetaxel poate fi inversată cu tratamentul cu itraconazol ( 7 , 16 ).

Figura 1.

Figura 1.

Analiza Kaplan – Meier a supraviețuirii globale (OS) după chimioterapie cu itraconazol (n = 28). OS este prezentat de linia continuă, în timp ce liniile de încredere de 95% sunt indicate prin linii punctate. OS median a fost de 12,0 luni (interval de încredere de 95% = 9,1-24,6 luni).

În 2010, Kim și colab. a raportat că itraconazolul a inhibat calea de semnalizare Hh în CSC și în celulele canceroase (89. Calea de semnalizare Hh joacă un rol cheie în embriogeneză și este reactivată în diferite tipuri de cancer ( 17 ). Expresia Smoothend (Smo) a fost detectată în aproximativ 70% din specimenele de cancer pancreatic ( 18 ), iar calea de semnalizare Hh a fost studiată pe larg în cancerul pancreatic. Inhibarea semnalizării Hh de către ciclopamină a redus auto-reînnoirea CSC pancreatice și a inversat chemoresistance ( 19 ). modelul murin al cancerului pancreatic, inhibitorul Hh AZD8542 a prevenit creșterea tumorii și metastazele prin afectarea microambientului tumorii din jur ( 20). O analiză recentă intermediară a unui studiu de fază II cu un singur braț la pacienții cu cancer pancreatic netratat a arătat că antagonistul Smo vismodegib în combinație cu gemcitabină plus nab-paclitaxel a avut o eficacitate favorabilă cu toxicități acceptabile ( 21 ). Itraconazolul inhibă calea de semnalizare Hh ( 22 ). Am administrat agenți citotoxici cu itraconazol la 38 de pacienți cu cancer pancreatic refractar și am găsit o eficacitate favorabilă în comparație cu controalele istorice ( 23 ).

Li și colab. a confirmat activarea căii de semnalizare Hh în cancerul de vezică biliară; 76 (82%) și 66 (70%) specimene au exprimat Hh sonic și respectiv Gli1, iar starea de expresie a fost corelată cu factorii prognostici cunoscuți și OS ( 24 ). Matsushita și colab. a raportat că ciclopamina și Smo siRNA au inhibat proliferarea, iar Smo siRNA a inhibat tranziția epitelială-mezenchimală și invazia in vitro ( 25 ). Kisslich și colab. a demonstrat inhibarea creșterii celulelor BTC in vitro folosind ciclopamină și inhibitorul de transcripție Hh Gant-61 și un efect citotoxic sinergic a fost evident în combinație cu cisplatină ( 26 ).

Din 2013, mai multe studii au raportat beneficiul clinic al itraconazolului pentru diferite tipuri de cancer, inclusiv cancerul de prostată, plămân, piele, ovarian, sân și pancreatic ( 9 , 23 , 27 – 31 ). S-a raportat că adăugarea de itraconazol la agenții citotoxici a îmbunătățit OS într-un studiu prospectiv, randomizat, de fază II privind tratamentul de linia a doua a cancerului pulmonar cu celule mici și într-o analiză retrospectivă multivariată a cancerului ovarian refractar ( 28 , 30 ) . Regimurile citotoxice în asociere cu itraconazol trebuie studiate în continuare, având în vedere eficacitatea, toxicitățile și conformitatea în practica zilnică.

Modificarea dozei în prezentul studiu a fost complicată și solicitată pentru o monitorizare atentă. Pe baza rezultatelor promițătoare ale DGC plus itraconazol la pacienții cu cancer de sân sau ovarian refractar ( 9 , 30 , 31 ), am lansat un studiu de fază II al docetaxelului combinat, gemcitabinei și itraconazolului pentru malignitatea ginecologică utilizând o modificare simplificată a dozei și continuarea până la protocol de progresie a bolii (UMIN000013951).

Limitările prezentului studiu includ dimensiunea redusă a eșantionului, natura observațională și retrospectivă și protocolul complicat de modificare a dozei. Cu toate acestea, constatările de aici sunt încurajatoare pentru pacienții cu BTC refractar, deoarece chimioterapia combinată cu itraconazol a demonstrat eficacitate favorabilă cu toxicitate acceptabilă după chimioterapia de primă linie pentru BTC metastatic refractar la tratament. Mai mult, itraconazolul nu este un medicament scump și ar fi accesibil pacienților din țările mai puțin dezvoltate și poate reduce costurile medicale în țările dezvoltate.

Note de subsol

  • Conflicte de interesAutorii declară că nu există conflicte de interese financiare cu privire la acest studiu.
  • Primit pe 4 mai 2015.
  • Revizuirea a primit 9 iunie 2015.
  • Acceptat la 11 iunie 2015.
  • Copyright © 2015 Institutul Internațional de Cercetare Anticancer (Dr. John G. Delinassios), Toate drepturile rezervate

Referințe

  1.  
    1. Ministerul Sănătății, Muncii și Asistenței Sociale din Japonia
    ( 2012 ) Rezultatul investigației statistice . http://www.mhlw.go.jp/toukei/saikin/hw/jinkou/kakutei12/index.html [În japoneză]. Ultima accesare la 18 ianuarie 2015 . Google Scholar
  2.  
    1. C Valle J ,
    2. Wasan H ,
    3. Palmer DH ,
    4. Cunningham D ,
    5. Anthoney A ,
    6. Maraveyas A ,
    7. Madhusudan S ,
    8. Iveson T ,
    9. Hughes S ,
    10. Pereira SP ,
    11. Roughton M ,
    12. Bridgewater J ,
    13. ABC-02 Investigatori de proces
    : Cisplatină plus gemcitabină versus gemcitabină pentru cancerul tractului biliar . N Engl J Med 362 : 1273 – 1281 , 2010 . CrossRef PubMed Google Scholar
  3.  
    1. Sharma A ,
    2. Dwary AD ,
    3. Mohanti BK ,
    4. Deo SV ,
    5. Pal S ,
    6. Sreenivas V ,
    7. Raina V ,
    8. Shukla NK ,
    9. Thulkar S ,
    10. Garg P ,
    11. Chaudhary SP
    : Cea mai bună îngrijire de susținere comparativ cu chimioterapia pentru cancerul de vezică biliară nerezecabil: un studiu controlat randomizat . J Clin Oncol 28 : 4581 – 4586 , 2010 . Text complet abstract / GRATUIT Google Scholar
  4.  
    1. Okusaka T ,
    2. Nakachi K ,
    3. Fukutomi A ,
    4. Mizuno N ,
    5. Ohkawa S ,
    6. Funakoshi A ,
    7. Nagino M ,
    8. Kondo S ,
    9. Nagaoka S ,
    10. Funai J ,
    11. Koshiji M ,
    12. Nambu Y ,
    13. Furuse J ,
    14. Miyazaki M ,
    15. Nimura Y
    : Gemcitabină singură sau în asociere cu cisplatină la pacienții cu cancer al tractului biliar: un studiu comparativ multicentric în Japonia . Br J Cancer 103 : 469 – 474 , 2010 . CrossRef PubMed Google Scholar
  5.  
    1. Lamarca A ,
    2. Hubner RA ,
    3. David Ryder W ,
    4. Valle JW
    : Chimioterapia de linia a doua în cancerul biliar avansat: o revizuire sistematică . Ann Oncol 25 : 2328 – 2338 , 2014 . Text complet abstract / GRATUIT Google Scholar
  6.  
    1. Shirakawa K ,
    2. Takara K ,
    3. Tanigawara Y ,
    4. Aoyama N ,
    5. Kasuga M ,
    6. Komada F ,
    7. Sakaeda T ,
    8. Okumura K
    : Interacțiunea docetaxelului („Taxotere”) cu glicoproteina P umană . Jpn J Cancer Res 90 : 1380 – 1386 , 1999 . CrossRef Google Scholar
  7.  
    1. Takara K ,
    2. Tanigawara Y ,
    3. Komada F ,
    4. Nishiguchi K ,
    5. Sakaeda T ,
    6. Okumura K
    : Aspecte farmacocinetice celulare ale efectului de inversare a itraconazolului asupra rezistenței de medicamente anticanceroase P-glicoproteina-mediată . Biol Pharm Bull 22 : 1355 – 1359 , 1999 . PubMed Google Scholar
  8.  
    1. Kim J ,
    2. Tang JY ,
    3. Gong R ,
    4. Kim J ,
    5. Lee JJ ,
    6. Clemons KV ,
    7. Chong CR ,
    8. Chang KS ,
    9. Fereshteh M ,
    10. Gardner D ,
    11. Reya T ,
    12. Liu JO ,
    13. Epstein EH ,
    14. Stevens DA ,
    15. Beachy PA
    : Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii arici și creșterea cancerului . Cancer Cell 17 : 388 – 399 , 2010 . CrossRef PubMed Google Scholar
  9.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii la pacienții cu carcinom ovarian clar sau recidivant . Anticancer Res 34 : 2007 – 2014 , 2014 . Text complet abstract / GRATUIT Google Scholar
  10.  
    1. Zhou BB ,
    2. Zhang H ,
    3. Damelin M ,
    4. Geles KG ,
    5. Grindley JC ,
    6. Dirks PB
    : Celule care inițiază tumorile: provocări și oportunități pentru descoperirea medicamentelor împotriva cancerului . Nat Rev Drug Discov 8 : 806 – 823 , 2009 . CrossRef PubMed Google Scholar
  11.  
    1. Wang M ,
    2. Xiao J ,
    3. Shen M ,
    4. Yahong Y ,
    5. Tian R ,
    6. Zhu F ,
    7. Jiang J ,
    8. Du Z ,
    9. Hu J ,
    10. Liu W ,
    11. Qin R
    : Izolarea și caracterizarea celulelor de colangiocarcinom extrahepatic tumorigen cu proprietăți asemănătoare celulelor stem . Int J Cancer 128 : 72 – 81 , 2011 . PubMed Google Scholar
  12.  
    1. Xie G ,
    2. Yao Q ,
    3. Liu Y ,
    4. Du S ,
    5. Liu A ,
    6. Guo Z ,
    7. Soare A ,
    8. Ruan J ,
    9. Chen L ,
    10. Voi C ,
    11. Yuan Y
    : Tranziția epitelial-mezenchimală indusă de IL-6 promovează generarea de celule stem asemănătoare cancerului de sân analog culturilor mammosferice . Int J Oncol 40 : 1171 – 1179 , 2012 . PubMed Google Scholar
  13.  
    1. Hong SP ,
    2. Wen J ,
    3. Bang S ,
    4. Parcul S ,
    5. Cântecul SY
    : Celulele CD44-pozitive sunt responsabile pentru rezistența la gemcitabină în celulele cancerului pancreatic . Int J Cancer 125 : 2323 – 2331 , 2009 . CrossRef PubMed Google Scholar
  14.  
    1. Yao J ,
    2. Un Y ,
    3. Wie JS ,
    4. Ji ZL ,
    5. Lu ZP ,
    6. Wu JL ,
    7. Jiang KR ,
    8. Chen P ,
    9. Xu ZK ,
    10. Miao Y
    : Ciclopamina revine la chimiorezistență dobândită și reglează în jos markerii celulelor stem canceroase în liniile de celule pancreatice . Swiss Med Wkly 141 : w13208 , 2011 . PubMed Google Scholar
  15.  
    1. Kethireddy S ,
    2. Anzi D
    : Farmacocinetica SNC a agenților antifungici . Expert Opin Drug Metab Toxicol 3 : 573 – 581 , 2007 . CrossRef PubMed Google Scholar
  16.  
    1. Iida N ,
    2. Takara K ,
    3. Ohmoto N ,
    4. Nakamura T ,
    5. Kimura T ,
    6. Wada A ,
    7. Hirai M ,
    8. Sakaeda T ,
    9. Okumura K
    : Efectele de inversare a medicamentelor antifungice asupra rezistenței multidrog în celulele HeLa care supraexprimă MDR1 . Biol Pharm Bull 24 : 1032 – 1036 , 2001 . CrossRef PubMed Google Scholar
  17.  
    1. Berman DM ,
    2. Karhadkar SS ,
    3. Maitra A ,
    4. Montes De Oca R ,
    5. Gerstenblith MR ,
    6. Briggs K ,
    7. Parker AR ,
    8. Shimada Y ,
    9. Eshleman JR ,
    10. Watkins DN ,
    11. Beachy PA
    : Cerință răspândită pentru stimularea ligandului Hedgehog în creșterea tumorilor tractului digestiv . Nature 425 : 846 – 851 , 2003 . CrossRef PubMed Google Scholar
  18.  
    1. Thayer SP ,
    2. di Magliano MP ,
    3. Heiser PW ,
    4. Nielsen CM ,
    5. Roberts DJ ,
    6. Lauwers GY ,
    7. Qi YP ,
    8. Gysin S ,
    9. Fernández-del Castillo C ,
    10. Yajnik V ,
    11. Antoniu B ,
    12. McMahon M ,
    13. Warshaw AL ,
    14. Hebrok M
    : Ariciul este un mediator timpuriu și târziu al tumorigenezei cancerului pancreatic . Nature 425 ( 6960 ): 851 – 856 , 2003 . CrossRef PubMed Google Scholar
  19.  
    1. Huang FT ,
    2. Zhuan-Sun YX ,
    3. Zhuang YY ,
    4. Wei SL ,
    5. Tang J ,
    6. Chen WB ,
    7. Zhang SN
    : Inhibarea semnalizării arici deprimă auto-reînnoirea celulelor stem ale cancerului pancreatic și inversează chimiorezistența . Int J Oncol 41 : 1707 – 1714 , 2012 . PubMed Google Scholar
  20.  
    1. Hwang RF ,
    2. Moore TT ,
    3. Hattersley MM ,
    4. Scarpitti M ,
    5. Yang B ,
    6. Devereaux E ,
    7. Ramachandran V ,
    8. Arumugam T ,
    9. Ji B ,
    10. CD Logsdon ,
    11. Brown JL ,
    12. Godin R
    : Inhibarea căii arici vizează stroma asociată tumorii în cancerul pancreatic . Mol Cancer Res 10 : 1147 – 1157 , 2012 . Text complet abstract / GRATUIT Google Scholar
  21.  
    1. De Jesus-Acosta A ,
    2. O’Dwyer PJ ,
    3. Ramanathan DD ,
    4. Von Hoff DD ,
    5. Maitra A ,
    6. Rasheed A ,
    7. Zheng L ,
    8. Rajeshkumar NV ,
    9. Le DT ,
    10. Hoering A ,
    11. Bolejack V ,
    12. Yabuuchi S ,
    13. Laheru DA
    : Un studiu de fază II a vismodegibului, un inhibitor al căii arici, combinat cu gemcitabină și nab-paclitaxel la pacienții cu adenocarcinom ductal pancreatic netratat . J Clin Oncol 32 ( supl 3 ): abstr 25 , 2014 . Google Scholar
  22.  
    1. Kim J ,
    2. Aftab BT ,
    3. Tang JY ,
    4. Kim D ,
    5. Lee AH ,
    6. Rezaee M ,
    7. Kim J ,
    8. Chen B ,
    9. Regele EM ,
    10. Borodovsky A ,
    11. Riggins GJ ,
    12. Epstein EH Jr. . ,
    13. Beachy PA ,
    14. Rudin CM
    : Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți . Cancer Cell 23 : 23 – 34 , 2013 . CrossRef PubMed Google Scholar
  23.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Ikuta S ,
    4. Tani S ,
    5. Inoue K ,
    6. Yamanaka N
    : Chimioterapie combinată cu itraconazol pentru tratarea cancerului pancreatic metastatic în linia a doua sau în condiții suplimentare . Anticancer Res în presă . Google Scholar
  24.  
    1. Li J ,
    2. Wu T ,
    3. Lu J ,
    4. Cao Y ,
    5. Cântecul N ,
    6. Yang T ,
    7. Dong R ,
    8. Yang Y ,
    9. Zang L ,
    10. Du X ,
    11. Wang S
    : Dovezi imunohistochimice ale valorii prognostice a componentelor căii arici în carcinomul vezicii biliare primare . Surg Today 42 : 770 – 775 , 2012 . CrossRef PubMed Google Scholar
  25.  
    1. Matsushita S ,
    2. Onishi H ,
    3. Nakano K ,
    4. Nagamatsu I ,
    5. Imaizumi A ,
    6. Hattori M ,
    7. Oda Y ,
    8. Tanaka M ,
    9. Katano M
    : Calea de semnalizare arici este o potențială țintă terapeutică pentru cancerul vezicii biliare . Cancer Sci 105 : 272 – 280 , 2014 . PubMed Google Scholar
  26.  
    1. Kiesslich T ,
    2. Mayr C ,
    3. Wachter J ,
    4. Bach D ,
    5. Fuereder J ,
    6. Wagner A ,
    7. Alinger B ,
    8. Pichler M ,
    9. Di Fazio P ,
    10. Ocker M ,
    11. Berr F ,
    12. Neureiter D
    : Calea ariciului activat este o țintă potențială pentru intervenția farmacologică în cancerul tractului biliar . Mol Cell Biochem 396 : 257 – 268 , 2014 . PubMed Google Scholar
  27.  
    1. Antonarakis ES ,
    2. Heath EI ,
    3. Smith DC ,
    4. Rathkopf D ,
    5. Blackford AL ,
    6. Danila DC ,
    7. Regele S ,
    8. Frost A ,
    9. Ajiboye AS ,
    10. Zhao M ,
    11. Mendonca J ,
    12. Kachhap SK ,
    13. Rudek MA ,
    14. Carducci MA
    : Refacerea itraconazolului ca tratament pentru cancerul de prostată avansat: un studiu de fază II randomizat necomparativ la bărbații cu cancer de prostată metastatic rezistent la castrare . Oncolog 18 : 163 – 173 . doi: 10.1634 / teoncolog. 2012-314 , 2013 . Text complet abstract / GRATUIT Google Scholar
  28.  
    1. Rudin CM ,
    2. Brahmer JR ,
    3. Juergens RA ,
    4. Hann CL ,
    5. Ettinger DS ,
    6. Sebree R ,
    7. Smith R ,
    8. Aftab BT ,
    9. Huang P ,
    10. Liu JO
    : Studiu de fază 2 a pemetrexedului și a itraconazolului ca terapie de linia a doua pentru cancerul pulmonar non-scuamos metastazat cu celule mici . J Thorac Oncol 8 : 619 – 623 , 2013 . PubMed Google Scholar
    1. Kim DJ ,
    2. Kim J ,
    3. Spaunhurst K ,
    4. Montoya J ,
    5. Khodosh R ,
    6. Chandra K ,
    7. Fu T ,
    8. Gilliam A ,
    9. Molgo M ,
    10. Beachy PA ,
    11. Tang JY
    : Studiu deschis, explorator, de fază II, a itraconazolului oral pentru tratamentul carcinomului bazocelular . J Clin Oncol 32 : 745 – 751 , 2014 . Text complet abstract / GRATUIT Google Scholar
  29.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii pacienților cu cancer ovarian refractar . Anticancer Res 34 : 2481 – 2487 , 2014 . Text complet abstract / GRATUIT Google Scholar
  30.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Inoue K
    : Impactul itraconazolului asupra supraviețuirii pacienților puternic pre-tratați cu cancer de sân triple-negativ . Anticancer Res 34 : 3839 – 3844 , 2014 . Text complet abstract / GRATUIT Google Scholar

Impactul Itraconazolului asupra supraviețuirii pacienților puternic pre-tratați cu cancer de sân triplu-negativ

HIROSHI TSUBAMOTO , TAKASHI SONODA și KAYO INOUECercetare anticancer iulie 2014, 34 (7) 3839-3844;

Abstract

Context / Scop: Pacienții cu cancer mamar triple-negativ recurent (TNBC) au prognoze slabe și opțiuni de tratament limitate, mai ales după progresia în timpul chimioterapiei anterioare. Prezentul studiu a avut ca scop determinarea impactului itraconazolului cu chimioterapie la acești pacienți.

Pacienți și metode: Dosarele medicale ale pacienților recurente cu TNBC care au primit itraconazol cu ​​chimioterapie între 2008 și 2012 au fost revizuite retrospectiv.

Rezultate: Treisprezece pacienți care au progresat în timpul chimioterapiei anterioare (12 cu metastaze ale organelor viscerale) au fost înrolați. Toți pacienții au primit docetaxel, carboplatină și gemcitabină cu itraconazol. În plus, 3 pacienți cu revărsat pleural și 2 cu cancer mamar inflamator au primit bevacizumab. Fără neutropenie febrilă, transfuzie de trombocite,sau a fost observată moartea cauzată de chimioterapie în timpul tratamentului cu itraconazol.

Rata de răspuns, supraviețuirea mediană fără progresie și supraviețuirea globală mediană au fost 62% (interval de încredere 95% (IC): 35-88%), 10,8 luni (IC 95%: 7,6-15,3 luni) și 20,4 luni (95 % CI: 13,1-41,4 luni), respectiv.

Concluzie: Chimioterapia cu itraconazol este promițătoare pentru pacienții cu TNBC puternic pre-tratați.

Cancerul de sân triple-negativ (TNBC) este un subgrup eterogen de cancer de sân, caracterizat prin exprimarea scăzută atât a receptorilor estrogeni, cât și a celor de progesteron și lipsa supraexprimării receptorului-2 al factorului de creștere epidermică umană ( 1 , 2 ). TNBC reprezintă aproximativ 10-15% din toate cazurile de cancer de sân ( 3 , 4 ) și este asociat cu un prognostic slab din cauza opțiunilor limitate de tratament. Regimurile pe bază de platină sunt adesea selectate pentru a trata TNBC datorită caracteristicilor moleculare similare ale bolii cu cancerul de sân ereditar legat de BRCA1 ( 5 , 6). Un regim citotoxic de carboplatină și gemcitabină a fost administrat în brațul de control al unui studiu randomizat de fază II, iar adăugarea de iniparib a prelungit supraviețuirea globală (OS) a pacienților cu TNBC metastatic; cu toate acestea, un studiu ulterior de fază III nu a reușit să demonstreze eficacitatea iniparib ( 7 , 8 ). Combinarea bevacizumab cu un taxan sau alți agenți chimioterapeutici standard a îmbunătățit în mod semnificativ supraviețuirea fără progresie (SFP) într-o a doua linie (RIBBON-2) ( 9 ), dar nu a reușit să îmbunătățească sistemul de operare. Prin urmare, este urgent necesară o descoperire terapeutică, în special pentru boala refractară.

P-glicoproteina (P-gp, cunoscută și sub numele de rezistență la mai multe medicamente-1 sau sub-familie B casetă care se leagă la ATP [ABCB] -1) a fost studiată pe larg în cancerul de sân pentru rolul său în depășirea rezistenței la taxani ( 10 , 11 ) . La sfârșitul secolului al XX-lea, s-a demonstrat că itraconazolul, un agent antifungic comun, inversează rezistența mediată de P-gp asociată cu taxani într-o manieră dependentă de concentrație in vitro ( 12 , 13 ). Recent a fost raportat potențialul său de inhibare a căii de semnalizare a angiogenezei și a ariciului în celulele stem canceroase ( 14 , 15). Din 2013, beneficiul clinic al itraconazolului a fost documentat în studii prospective de cancer de prostată, cancer pulmonar cu celule mici (NSCLC) și carcinom cu celule bazale, precum și în studiile noastre retrospective despre cancerul ovarian recurent ( 16 – 20 ). Prezentul studiu retrospectiv explorator și-a propus să evalueze eficacitatea itraconazolului la pacienții puternic pre-tratați cu TNBC.

Pacienți și metode

Am analizat retrospectiv dosarele medicale ale pacienților cu TNBC confirmat histologic care au primit chimioterapie în asociere cu itraconazol la spitalele Kohnan între 2008 și 2012. Organele viscerale cu metastaze au inclus plămânii, creierul și ficatul, dar pacienții cu metastaze ale osului sau ganglionilor limfatici au fost exclus. Toți pacienții au acordat consimțământul scris în scris, iar studiul a fost aprobat de Consiliul de revizuire instituțională (3-2-2007).

Când s-a administrat același regim, numărul regimurilor a fost înregistrat ca 1. Intervalul fără tratament a fost calculat de la ultima dată a chimioterapiei anterioare până la prima dată a chimioterapiei cu itraconazol. Intervalul fără taxan a fost calculat de la ultima dată de administrare a taxanului până la prima dată de chimioterapie cu itraconazol.

Tabelul I.

Date demografice ale pacienților (N = 13).

Evenimentele adverse din timpul primei administrări concomitente de itraconazol și chimioterapie au fost clasificate în conformitate cu criteriile comune de toxicitate ale Institutului Național al Cancerului, versiunea 4.0. Eficacitatea a fost evaluată în conformitate cu criteriile de evaluare a răspunsului în tumorile solide (RECIST), versiunea 1.1 ( 21 ). Supraviețuirea fără progresie (SFP a fost definită ca timpul de la prima administrare de itraconazol până la data progresiei bolii determinate obiectiv sau deteriorarea stării de sănătate. OS a fost definit ca timpul de la prima administrare de itraconazol până la deces.

Analizele statistice au fost efectuate pe distribuțiile observate de PFS și OS utilizând metoda Kaplan – Meier. Toate analizele au fost efectuate folosind XLSTAT 2014 (Addinsoft, Paris, Franța).

Rezultate

Caracteristicile pacienților. Între 2008 și 2012, 13 pacienți recurenti cu TNBC au fost tratați concomitent cu chimioterapie și itraconazol. Pacienții au fost îndrumați de la spitalele terțiare după progresie în timpul a 2 sau mai multe linii de chimioterapie. Rapoartele patologice referitoare la spitale au fost revizuite pentru a verifica diagnosticul. Toți pacienții au primit anterior antracicline și taxani, inclusiv paclitaxel săptămânal la 10 pacienți (77%), docetaxel la 7 (54%) și nab-paclitaxel la 1 (8%). Niciunul dintre pacienți nu a primit bevacizumab sau eribulină. Toți pacienții au avut un interval fără tratament mai mic de 3 luni și 4 au fost direcționați de la spitalele terțiare după progresie în timpul administrării anterioare a taxanului ( Tabelul I ).

Tabelul II.

Rata de răspuns asociată chimioterapiei cu itraconazol.

Regimuri cu itraconazol. Un regim citotoxic constând din docetaxel, carboplatină și gemcitabină a fost administrat în combinație cu itraconazol. Dozele inițiale de docetaxel intravenos, carboplatină și gemcitabină au fost de 35 mg / m 2 (ziua 1), suprafața sub curba de 4 mg x min / ml (ziua 1), respectiv 1000 mg / m 2 (ziua 1) . O soluție orală de itraconazol a fost administrată la o doză zilnică de 400 mg (zile -2 până la 2). Acest regim a fost repetat la fiecare 2 săptămâni. O modificare a dozei pentru carboplatină și docetaxel în ciclul următor a fost luată în considerare, dacă este necesar, pentru menținerea numărului de celule albe din sânge (globule albe) și trombocite ale pacienților în intervalul 1.000-1.500 / mm 3 și respectiv 30.000-50.000 / mm 3 ( 19). Au fost fixate dozele de gemcitabină și itraconazol. După 6 cicluri, docetaxel a fost trecut la vinorelbină sau irinotecan pentru a preveni neuropatia periferică indusă de chimioterapie. Factorul de stimulare a coloniilor de granulocite (G-CSF) a fost administrat în conformitate cu recomandările producătorului de pe eticheta medicamentului până la recuperarea numărului WBC și a numărului absolut de neutrofile (ANC). În plus față de agenții citotoxici și itraconazol, bevacizumab a fost administrat la 15 mg / kg la fiecare 4 săptămâni la 3 pacienți cu revărsat pleural și 2 cu cancer mamar inflamator.

Eficacitate. Ratele de răspuns ale pacienților care au primit chimioterapie în asociere cu itraconazol au fost de 62% (interval de încredere 95% [CI], 35-88%) conform criteriilor RECIST 1.1 ( Tabelul II ). PFS median după inițierea chimioterapiei și itraconazolului a fost de 10,8 luni (IC 95%, 7,6-15,3 luni), cu date despre 3 pacienți cenzurați ( Figura 1 ). OS median după chimioterapie și itraconazol a fost de 20,4 luni (IC 95%: 13,1-41,4 luni), cu date despre 3 pacienți cenzurați ( Figura 2 ).

Figura 1.

Figura 1.

Supraviețuirea fără progresie (SFP) după chimioterapie cu itraconazol. PFS mediană a fost de 10,8 luni (interval de încredere de 95%, 7,6-15,3 luni).

Figura 2.

Figura 2.

Supraviețuirea globală (OS) după chimioterapie cu itraconazol. OS median a fost de 20,4 luni (interval de încredere de 95%, 13,1-41,4 luni).

Toxicități. În timpul tratamentului combinatoriu cu chimioterapie și itraconazol, toți pacienții au primit G-CSF, iar numărul lor de WBC și ANC s-au recuperat în decurs de 5 zile. Niciunul dintre pacienți nu a prezentat neutropenie febrilă sau nu a necesitat transfuzie de trombocite. Toți pacienții au primit transfuzie de globule roșii la pachet atunci când nivelurile de hemoglobină au scăzut sub 8,0 g / dl. În timpul tratamentului combinator cu chimioterapie și itraconazol nu a apărut nicio deces legată de tratament.

Discuţie

Scopul principal al chimioterapiei pentru boala refractară la pacienții puternic pre-tratați cu cancer de sân metastatic este paliația simptomelor și menținerea calității vieții. Într-un studiu de control randomizat de fază III (EMBRACE) ( 22 ), monoterapia cu eribulină a îmbunătățit sistemul de operare al pacienților studiați, toți primind 2 sau mai multe scheme de chimioterapie anterioare pentru boli avansate sau recurente și au progresat în decurs de 6 luni de la ultima chimioterapie . OS median a fost de 13,1 luni. În acest studiu, 18% dintre pacienții înrolați aveau TNBC. Fundalul investigației noastre este similar cu cel al studiului menționat mai sus, cu excepția proporției pacienților cu TNBC. TNBC, un subgrup eterogen de cancer mamar cu prognostic slab datorită opțiunilor limitate de tratament, împărtășește multe caracteristici moleculare cu cele ereditareCancer de sân legat de BRCA1 . Disfuncția BRCA este asociată cu o sensibilitate ridicată la platină ( 23 , 24 ). Într-un studiu recent (CALGB 40603), carboplatina ca chimioterapie neoadjuvantă a îmbunătățit rata de răspuns patologic complet la pacienții cu TNBC ( 25 ); cu toate acestea, nu s-a observat niciun beneficiu de supraviețuire în cazurile de TNBC avansate sau metastatice ( 26 , 27 ). Într-o analiză subgrup a studiului RIBBON-2 ( 9), adăugarea de bevacizumab la chimioterapia de linia a doua a îmbunătățit SFP, dar nu și OS la pacienții cu TNBC. În acest studiu, 74% dintre pacienții înrolați care au primit terapie care conține bevacizumab au avut metastaze viscerale și 67% au avut un interval fără tratament de> 6 luni. OS mediu lor a fost de 17,9 luni. OS median de 20,4 luni în studiul nostru a fost, prin urmare, favorabil, având în vedere fondul mai slab al pacientului.

Cancerul mamar inflamator este extrem de agresiv și are cel mai slab rezultat de supraviețuire dintre toate subtipurile de cancer mamar. Cancerul inflamator de sân prezintă adesea niveluri ridicate de expresie a factorilor angiogenici, cum ar fi factorul de creștere endotelial vascular (VEGF) și, prin urmare, agenții anti-angiogenici care vizează VEGF au fost în centrul studiilor clinice ( 28 – 32 ). În studiul nostru, 2 pacienți au primit bevacizumab cu chimioterapie și itraconazol, deși studiile recente au indicat un efect modest al terapiei cu bevacizumab. În plus, deoarece VEGF-A joacă un rol critic în dezvoltarea revărsatului pleural ( 33 – 35 ), 3 pacienți cu revărsat pleural au primit, de asemenea, bevacizumab.

Rezistența ar putea apărea simultan pentru agenții terapeutici chiar și atunci când nu au fost utilizați în chimioterapia anterioară și diferă de agenții anteriori în structura chimică sau modul de acțiune. Pentru a îmbunătăți eficacitatea chimioterapiei, mecanismele de rezistență care implică sistemul de eflux mediat de P-gp au fost studiate pe larg. Toppmeyer și colab. a raportat că din 35 de pacienți cu cancer mamar cu boală refractară la paclitaxel care au primit paclitaxel cu biricodar (VX-710), 4 (11%) au obținut un răspuns parțial ( 36 ). Când valspodar (PSC 833), un modulator P-gp de a doua generație, a fost administrat cu paclitaxel la 34 de pacienți cu cancer de sân metastatic, au răspuns doar 7 (21%) ( 37). Până în prezent, nici biricodar, nici valspodar nu au fost raportate într-un studiu clinic de fază III cu cancer de sân. Cu toate acestea, valspodar a fost investigat într-un studiu de fază III al chimioterapiei de primă linie pentru cancerul ovarian. Comparativ cu regimul standard de paclitaxel si carboplatina, doza de paclitaxel in acest studiu a fost redus de la 175 mg / m 2 până la 80 mg / m 2 , atunci când este administrat în asociere cu valspodar. O astfel de reducere a dozei de agenți citotoxici a fost necesară datorită interacțiunilor medicament-medicament care implică inhibarea citocromului P450, familia 3, subfamiliei A (CYP3A). Cu toate acestea, adăugarea de valspodar la regimurile standard de chimioterapie nu a îmbunătățit SFP sau OS, dar a crescut numărul de evenimente adverse ( 38). Inhibitorul P-gp de generația a treia, tariquidar (XR9576), a oferit specificitate și potență sporită ( 39 ). Docetaxel poate fi administrat în siguranță la 75 mg / m 2 la fiecare 3 săptămâni , în asociere cu tariquidar ( 40 ). Cu toate acestea, până în prezent, conceptul de inversare a rezistenței la medicamente a eșuat în studiile clinice de fază III.

Efectul antitumoral al itraconazolului a fost raportat în studiile clinice începând cu 2013. Într-o analiză prospectivă a itraconazolului ca agent unic, pacienții cu cancer de prostată rezistent la castrare care au primit 600 mg itraconazol pe zi au prezentat o SFP prelungită comparativ cu cei care au primit 200 mg pe zi (11,9 vs. 35,9 săptămâni). Într-un studiu translațional prospectiv al carcinomului bazocelular, itraconazolul a scăzut zona tumorii, împreună cu proliferarea celulară redusă și activitatea căii Hedgehog18 ). Eficacitatea itraconazolului administrat în asociere cu chimioterapie a fost raportată și la pacienții cu NSCLC și cancer ovarian. Într-un studiu randomizat de fază II, terapia concomitentă cu itraconazol și pemetrexed a avut un SO îmbunătățit comparativ cu terapia fără itraconazol (32vs. 8 luni, raportul de pericol = 0,194, p = 0,012) ( 17 ). În diferite studii retrospective pentru cancerul ovarian, am raportat un SO prelungit la pacienții cărora li s-a administrat itraconazol cu ​​chimioterapie. În carcinomul recurent cu celule limpezi ( 19 ), care este cunoscut pentru rezistența sa la chimioterapie, pacienții care au primit chimioterapie cu itraconazol au prezentat OS prelungit comparativ cu controalele istorice sau cei care nu au primit itraconazol ( p = 0,006). Pentru pacienții cu cancer ovarian recurent care au avut rezistență la platină și au progresat în timpul chimioterapiei anterioare20 ), OS (supravietuirea globala) al celor care au primit chimioterapie cu și fără itraconazol au fost de 642 și respectiv 139 de zile (raport de risc = 0,27, p= 0,006). Prezentul studiu a arătat un rezultat mai favorabil decât cele raportate anterior pentru pacienții cu tratamente puternice cu TNBC, ceea ce este în concordanță cu investigațiile publicate de itraconazol în alte tumori solide.

Prezentul nostru studiu are anumite limitări, inclusiv dimensiunea redusă a eșantionului și natura observațională. Datele au fost reunite retrospectiv de la un singur Institut. Regimul citotoxic administrat în asociere cu itraconazol a fost un triplet de docetaxel, carboplatină și gemcitabină, care a fost neobișnuit pentru pacienții tratați puternic. Modificarea dozei a fost complicată și toți pacienții au primit G-CSF și au primit transfuzii de globule roșii, deși niciunul nu a avut neutropenie febrilă sau transfuzie de trombocite. Sunt necesare investigații suplimentare privind eficacitatea, toxicitatea și conformitatea pentru regimurile citotoxice administrate cu itraconazol, precum și pentru doza de itraconazol. Cu toate acestea, rezultatele noastre sunt încurajatoare pentru pacienții puternic tratați cu TNBC datorită eficacității și toxicității limitate a itraconazolului. În plus,itraconazolul nu este un medicament scump și, prin urmare, utilizarea acestuia ar putea fi accesibilă pentru pacienții din țările în curs de dezvoltare și ar putea reduce costurile tratamentului pentru cei din țările dezvoltate.

Note de subsol

  • Conflicte de interesAutorii nu au conflicte de interese financiare de dezvăluit.
  • Primit pe 25 martie 2014.
  • Revizuirea a primit 23 mai 2014.
  • Acceptat pe 26 mai 2014.
  • Copyright © 2014 Institutul Internațional de Cercetare Anticancer (Dr. John G. Delinassios), Toate drepturile rezervate

Referințe

  1.  
    1. Gluz O ,
    2. Liedtke C ,
    3. Gottschalk N ,
    4. Pusztai L ,
    5. Nitz U ,
    6. Harbeck N
    : Cancer de sân triplu negativ – starea actuală și direcțiile viitoare . Ann Oncol 20 : 1913 – 1927 , 2009 . Text complet abstract / GRATUIT Google Scholar
  2.  
    1. Lehmann BD ,
    2. Bauer JA ,
    3. Chen X ,
    4. Sanders ME ,
    5. Chakravarthy AB ,
    6. Shyr Y ,
    7. Pietenpol JA
    : Identificarea subtipurilor de cancer mamar triple-negativ uman și a modelelor preclinice pentru selecția terapiilor vizate . J Clin Invest 121 : 2750 – 2767 , 2011 . CrossRef PubMed Google Scholar
  3.  
    1. Dent R ,
    2. Trudeau M ,
    3. Pritchard KI ,
    4. Hanna WM ,
    5. Kahn HK ,
    6. Sawka CA ,
    7. Lickley LA ,
    8. Rawlinson E ,
    9. Sun P ,
    10. Narod SA
    : Cancerul de sân triple-negativ: caracteristici clinice și modele de recurență . Clin Cancer Res 13 : 4429 – 4434 , 2007 . Text complet abstract / GRATUIT Google Scholar
  4.  
    1. Badve S ,
    2. Dabbs DJ ,
    3. Schnitt SJ ,
    4. Baehner FL ,
    5. Decker T ,
    6. Eusebi V ,
    7. Fox SB ,
    8. Ichihara S ,
    9. Jacquemier J ,
    10. Lakhani SR ,
    11. Palacios J ,
    12. Rakha EA ,
    13. Richardson AL ,
    14. Schmitt FC ,
    15. Tan PH ,
    16. Tse GM ,
    17. Weigelt B ,
    18. Ellis IO ,
    19. Reis-Filho JS
    : Cancere de sân bazale și triple-negative: o analiză critică cu accent pe implicațiile pentru patologi și oncologi . Mod Pathol 24 : 157 – 167 , 2011 . CrossRef PubMed Google Scholar
  5.  
    1. Esteller M ,
    2. Silva JM ,
    3. Dominguez G ,
    4. Bonilla F ,
    5. Matias-Guiu X ,
    6. Lerma E ,
    7. Bussaglia E ,
    8. Prat J ,
    9. Harkes IC ,
    10. Repasky EA ,
    11. Gabrielson E ,
    12. Schutte M ,
    13. Baylin SB ,
    14. Herman JG
    : Hipermetilare promotor și inactivare BRCA1 în tumorile sporadice de sân și ovare . J Natl Cancer Inst 92 : 564 – 569 , 2000 . Text complet abstract / GRATUIT Google Scholar
  6.  
    1. Turner NC ,
    2. Reis-Filho JS ,
    3. Russell AM ,
    4. Springall RJ ,
    5. Ryder K ,
    6. Steele D ,
    7. Savage K ,
    8. Gillett CE ,
    9. Schmitt FC ,
    10. Ashworth A ,
    11. Tutt AN
    : Disfuncție BRCA1 în cancerul de sân sporadic bazal . Oncogene 26 : 2126 – 2132 , 2007 . CrossRef PubMed Google Scholar
  7.  
    1. O’Shaughnessy J ,
    2. Osborne C ,
    3. Pippen JE ,
    4. Yoffe M ,
    5. Patt D ,
    6. Rocha C ,
    7. Koo IC ,
    8. Sherman BM ,
    9. Bradley C
    : Iniparib plus chimioterapie în cancerul de sân metastatic triplu negativ . N Engl J Med 364 : 205 – 214 , 2011 . CrossRef PubMed Google Scholar
  8.  
    1. O’Shaughnessy J ,
    2. Schwartzberg LS ,
    3. Danso MA ,
    4. Rugo HS ,
    5. Miller K ,
    6. Yardley DA ,
    7. Carlson RW ,
    8. Finn RS ,
    9. Charpentier E ,
    10. Freese M ,
    11. Gupta S ,
    12. Blackwood-Chirchir A ,
    13. Winer EP
    : Un studiu randomizat de fază III a iniparibului (BSI-201) în combinație cu gemcitabină / carboplatină (G / C) în cancerul de sân metastatic triplu negativ (TNBC) . J Clin Oncol 29 : 2011 ( supl ; abstr 1,007) , 2011 . Google Scholar
  9.  
    1. Brufsky A ,
    2. Valero V ,
    3. Tiangco B ,
    4. Dakhil S ,
    5. Brize A ,
    6. Rugo HS ,
    7. Rivera R ,
    8. Duenne A ,
    9. Bousfoul N ,
    10. Yardley DA
    : Terapia a doua linie care conține bevacizumab la pacienții cu cancer mamar triplu negativ: analiza subgrupului studiului RIBBON-2 . Breast Cancer Res Treat 133 : 1067 – 1075 , 2012 . CrossRef PubMed Google Scholar
  10.  
    1. Nobili S ,
    2. Landini I ,
    3. Mazzei T ,
    4. Mini E
    : Depășirea rezistenței multidrog tumorale folosind medicamente capabile să se sustragă glicoproteinei P sau să exploateze expresia acesteia . Med Res Rev 32 : 1220 – 1262 , 2012 . CrossRef PubMed Google Scholar
  11.  
    1. Murray S ,
    2. Briasoulis E ,
    3. Linardou H ,
    4. Bafaloukos D ,
    5. Papadimitriou C
    : Rezistența la taxani în cancerul de sân: mecanisme, biomarkeri predictivi și strategii de eludare . Cancer Treat Rev 38 : 890 – 903 , 2012 . CrossRef PubMed Google Scholar
  12.  
    1. Shirakawa K ,
    2. Takara K ,
    3. Tanigawara Y ,
    4. Aoyama N ,
    5. Kasuga M ,
    6. Komada F ,
    7. Sakaeda T ,
    8. Okumura K
    : Interacțiunea docetaxelului („Taxotere”) cu glicoproteina P umană . Jpn J Cancer Res 90 : 1380 – 1386 , 1999 . CrossRef Google Scholar
  13.  
    1. Takara K ,
    2. Tanigawara Y ,
    3. Komada F ,
    4. Nishiguchi K ,
    5. Sakaeda T ,
    6. Okumura K
    : Aspecte farmacocinetice celulare ale efectului de inversare a itraconazolului asupra rezistenței de medicamente anticanceroase P-glicoproteina-mediată . Biol Pharm Bull 22 : 1355 – 1359 , 1999 . PubMed Google Scholar
  14.  
    1. Chong CR ,
    2. Xu J ,
    3. Lu J ,
    4. Bhat S ,
    5. Sullivan DJ Jr. . ,
    6. Liu JO
    : Inhibarea angiogenezei de către medicamentul antifungic itraconazol . ACS Chem Biol 2 : 263 – 270 , 2007 . CrossRef PubMed Google Scholar
  15.  
    1. Kim J ,
    2. Tang JY ,
    3. Gong R ,
    4. Kim J ,
    5. Lee JJ ,
    6. Clemons KV ,
    7. Chong CR ,
    8. Chang KS ,
    9. Fereshteh M ,
    10. Gardner D ,
    11. Reya T ,
    12. Liu JO ,
    13. Epstein EH ,
    14. Stevens DA ,
    15. Beachy PA
    : Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii arici și creșterea cancerului . Cancer Cell 17 : 388 – 399 , 2010 . CrossRef PubMed Google Scholar
  16.  
    1. Antonarakis ES ,
    2. Heath EI ,
    3. Smith DC ,
    4. Rathkopf D ,
    5. Blackford AL ,
    6. Danila DC ,
    7. Regele S ,
    8. Frost A ,
    9. Ajiboye AS ,
    10. Zhao M ,
    11. Mendonca J ,
    12. Kachhap SK ,
    13. Rudek MA ,
    14. Carducci MA
    : Refacerea itraconazolului ca tratament pentru cancerul de prostată avansat: un studiu de fază II randomizat necomparativ la bărbații cu cancer de prostată metastatic rezistent la castrare . Oncolog 18 : 163 – 173 , 2013 . Text complet abstract / GRATUIT Google Scholar
  17.  
    1. Rudin CM ,
    2. Brahmer JR ,
    3. Juergens RA ,
    4. Hann CL ,
    5. Ettinger DS ,
    6. Sebree R ,
    7. Smith R ,
    8. Aftab BT ,
    9. Huang P ,
    10. Liu JO
    : Studiu de fază 2 a pemetrexedului și itraconazolului ca terapie de linia a doua pentru cancerul pulmonar non-celular cu celule mici, metastazate . J Thorac Oncol 8 : 619 – 623 , 2013 . PubMed Google Scholar
  18.  
    1. Kim DJ ,
    2. Kim J ,
    3. Spaunhurst K ,
    4. Montoya J ,
    5. Khodosh R ,
    6. Chandra K ,
    7. Fu T ,
    8. Gilliam A ,
    9. Molgo M ,
    10. Beachy PA ,
    11. Tang JY
    : Etichetă deschisă, exploratorie, fază II, studiu de Itraconazol oral pentru tratamentul carcinomului bazocelular . J Clin Oncol 32 : 745 – 751 , 2014 . Text complet abstract / GRATUIT Google Scholar
  19.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. și colab
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii la pacienții cu carcinom ovarian clar sau recidivant . Anticancer Res 34 : 2007 – 2014 , 2014 . . Text complet abstract / GRATUIT Google Scholar
  20.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii pacienților cu cancer ovarian refractar . Anticancer Res 34 : 2481 – 2488 , 2014 . Text complet abstract / GRATUIT Google Scholar
  21.  
    1. Eisenhauer EA ,
    2. Therasse P ,
    3. Bogaerts J ,
    4. Schwartz LH ,
    5. Sargent D ,
    6. Ford R ,
    7. Dancey J ,
    8. Arbuck S ,
    9. Gwyther S ,
    10. Mooney M ,
    11. Rubinstein L ,
    12. Shankar L ,
    13. Dodd L ,
    14. Kaplan R ,
    15. Lacombe D ,
    16. Verweij J
    : Noi criterii de evaluare a răspunsului în tumorile solide: ghid RECIST revizuit (versiunea 1.1) . Eur J Cancer 45 : 228 – 247 , 2009 . CrossRef PubMed Google Scholar
  22.  
    1. Cortes J ,
    2. O’Shaughnessy J ,
    3. Loesch D ,
    4. Blum JL ,
    5. Vahdat LT ,
    6. Petrakova K ,
    7. Chollet P ,
    8. Manikas A ,
    9. Diéras V ,
    10. Delozier T ,
    11. Vladimirov V ,
    12. Cardoso F ,
    13. Koh H ,
    14. Bougnoux P ,
    15. Dutcus CE ,
    16. Seegobin S ,
    17. Mir D ,
    18. Meneses N ,
    19. Wanders J ,
    20. Douăzeci C ,
    21. EMBRACE (Studiul cancerului de sân metastatic Eisai care evaluează alegerea medicului versus E7389) anchetatori
    : Monoterapia cu Eribulin versus tratamentul la alegerea medicului la pacienții cu cancer de sân metastatic (EMBRACE): un studiu randomizat de fază 3 deschis . Lancet 377 : 914 – 923 , 2011 . CrossRef PubMed Google Scholar
  23.  
    1. Oonk AM ,
    2. van Rijn C ,
    3. Smits MM ,
    4. Mulder L ,
    5. Laddach N ,
    6. Savola SP ,
    7. Wesseling J ,
    8. Rodenhuis S ,
    9. Imholz AL ,
    10. Buzele EH
    : Corelate clinice ale „BRCAness” în cancerul de sân triple-negativ la pacienții care primesc chimioterapie adjuvantă . Ann Oncol 23 : 2301 – 2305 , 2012 . Text complet abstract / GRATUIT Google Scholar
  24.  
    1. Foulkes WD ,
    2. Smith IE ,
    3. Reis-Filho JS
    : Cancer de sân triple-negativ . N Engl J Med 363 : 1938 – 1948 , 2010 . CrossRef PubMed Google Scholar
  25.  
    1. Sikov WM ,
    2. Berry DA ,
    3. Perou CM ,
    4. și colab
    Impactul adăugării de carboplatină (Cb) și / sau bevacizumab (B) la paclitaxel săptămânal neoadjuvant (P) urmată de AC densă în doză asupra ratelor de răspuns complet patologic (pCR) în cancerul de sân triplu negativ (TNBC): CALGB 40603 ( Alliance) Simpozionul privind cancerul de sân din San Antonio: S5-01 , 2013 . Google Scholar
  26.  
    1. Staudacher L ,
    2. Cottu PH ,
    3. Diéras V ,
    4. Vincent-Salomon A ,
    5. Guilhaume MN ,
    6. Escalup L ,
    7. Dorval T ,
    8. Beuzeboc P ,
    9. Mignot L ,
    10. Pierga JY
    : Chimioterapie pe bază de platină în cancerul de sân metastatic triplu negativ: experiența Institut Curie . Ann Oncol 22 : 848 – 856 , 2011 . Text complet abstract / GRATUIT Google Scholar
  27.  
    1. Liu M ,
    2. Mo QG ,
    3. Wei CY ,
    4. Qin QH ,
    5. Huang Z ,
    6. El J
    : Chimioterapie pe bază de platină în cancerul de sân triplu negativ: O meta-analiză . Oncol Lett 5 : 983 – 991 , 2013 . PubMed Google Scholar
  28.  
    1. Kleer CG ,
    2. van Golen KL ,
    3. Merajver SD
    : Biologia moleculară a metastazelor cancerului de sân. Cancerul mamar inflamator: sindrom clinic și determinanți moleculari . Cancerul de sân Res 2 : 423 – 429 , 2000 . CrossRef PubMed Google Scholar
    1. Overmoyer B ,
    2. Fu P ,
    3. Hoppel C ,
    4. Radivoyevitch T ,
    5. Shenk R ,
    6. Persoane M ,
    7. Silverman P ,
    8. Robertson K ,
    9. Ziats NP ,
    10. Wasman JK ,
    11. Abdul-Karim FW ,
    12. Jesberger JA ,
    13. Duerk J ,
    14. Hartman P ,
    15. Hanks S ,
    16. Lewin J ,
    17. Dowlati A ,
    18. McCrae K ,
    19. Ivy P ,
    20. Remick SC
    : Cancerul de sân inflamator ca boală model pentru studierea angiogenezei tumorale: rezultatele unui studiu de fază IB al combinației SU5416 și doxorubicină . Clin Cancer Res 13 : 5862 – 5868 , 2007 . Text complet abstract / GRATUIT Google Scholar
    1. Wedam SB ,
    2. JA scăzut ,
    3. Yang SX ,
    4. Chow CK ,
    5. Choyke P ,
    6. Danforth D ,
    7. Hewitt SM ,
    8. Berman A ,
    9. Steinberg SM ,
    10. DJ Liewehr ,
    11. Plehn J ,
    12. Doshi A ,
    13. Thomasson D ,
    14. McCarthy N ,
    15. Koeppen H ,
    16. Sherman M ,
    17. Zujewski J ,
    18. Camphausen K ,
    19. Chen H ,
    20. Swain SM
    : Efectele antiangiogenice și antitumorale ale bevacizumab la pacienții cu cancer mamar inflamator și local avansat . J Clin Oncol 24 : 769 – 777 , 2006 . Text complet abstract / GRATUIT Google Scholar
    1. Arias-Pulido H ,
    2. Chaher N ,
    3. Gong Y ,
    4. Qualls C ,
    5. Vargas J ,
    6. Royce M
    : Factorul de creștere endotelial vascular tumoral stromal A este predictiv pentru rezultatul slab în cancerul de sân inflamator . BMC Cancer 12 : 298 , 2012 . CrossRef PubMed Google Scholar
  29.  
    1. Pierga JY ,
    2. Petit T ,
    3. Delozier T ,
    4. Ferrero JM ,
    5. Campone M ,
    6. Gligorov J ,
    7. Lerebours F ,
    8. Roché H ,
    9. Bachelot T ,
    10. Charafe-Jauffret E ,
    11. Pavlyuk M ,
    12. Kraemer S ,
    13. Bidard FC ,
    14. Viens P
    : Neoadjuvant bevacizumab, trastuzumab și chimioterapie pentru cancerul de sân inflamator primar HER2 pozitiv (BEVERLY-2): un studiu deschis, de fază 2, cu un singur braț . Lancet Oncol 13 : 375 – 384 , 2012 . CrossRef PubMed Google Scholar
  30.  
    1. Tamiya M ,
    2. Tamiya A ,
    3. Yamadori T ,
    4. Nakao K ,
    5. Asami K ,
    6. Yasue T ,
    7. Otsuka T ,
    8. Shiroyama T ,
    9. Morishita N ,
    10. Suzuki H ,
    11. Okamoto N ,
    12. Okishio K ,
    13. Kawaguchi T ,
    14. Atagi S ,
    15. Kawase I ,
    16. Hirashima T
    : Studiu de fază 2 a bevacizumab cu carboplatin-paclitaxel pentru cancer pulmonar cu celule mici, cu revărsat pleural malign . Med Oncol 30 : 676 , 2013 . PubMed Google Scholar
    1. Bradshaw M ,
    2. Mansfield A ,
    3. Peikert T
    : Rolul factorului de creștere endotelial vascular în patogeneza, diagnosticul și tratamentul revărsării pleurale maligne . Curr Oncol Rep 15 : 207 – 216 , 2013 . CrossRef PubMed Google Scholar
  31.  
    1. Kitamura K ,
    2. Kubota K ,
    3. Ando M ,
    4. Takahashi S ,
    5. Nishijima N ,
    6. Sugano T ,
    7. Toyokawa M ,
    8. Miwa K ,
    9. Kosaihira S ,
    10. Noro R ,
    11. Minegishi Y ,
    12. Seike M ,
    13. Yoshimura A ,
    14. Gemma A
    : Bevacizumab plus chimioterapie pentru cancer pulmonar avansat non-scuamos, cu celule mici, cu revărsat pleural malign . Cancer Chemother Pharmacol 71 : 457 – 461 , 2013 . PubMed Google Scholar
  32.  
    1. Toppmeyer D ,
    2. Seidman AD ,
    3. Pollak M ,
    4. Russell C ,
    5. Tkaczuk K ,
    6. Verma S ,
    7. Overmoyer B ,
    8. Garg V ,
    9. Ette E ,
    10. Harding MW ,
    11. Demetri GD
    : Siguranța și eficacitatea inhibitorului de rezistență la mai multe medicamente Incel (biricodar; VX-710) în combinație cu paclitaxel pentru cancerul de sân avansat refractar la paclitaxel . Clin Cancer Res 8 : 670 – 678 , 2002 . Text complet abstract / GRATUIT Google Scholar
  33.  
    1. Carlson RW ,
    2. O’Neill AM ,
    3. Goldstein LJ ,
    4. Sikic BI ,
    5. Abramson N ,
    6. Stewart JA ,
    7. Davidson NE ,
    8. WC din lemn ,
    9. Grupul de Oncologie Cooperativă din Est
    : Un studiu pilot de fază II a modulației valspodare a rezistenței multidrog la paclitaxel în tratamentul carcinomului metastatic al sânului (E1195): un studiu al grupului oncologic cooperativ din est . Cancer Invest 24 : 677 – 681 , 2006 . CrossRef PubMed Google Scholar
  34.  
    1. Lhommé C ,
    2. Joly F ,
    3. Walker JL ,
    4. Lissoni AA ,
    5. Nicoletto MO ,
    6. Manikhas GM ,
    7. Baekelandt MM ,
    8. Gordon AN ,
    9. Fracasso PM ,
    10. Mietlowski WL ,
    11. Jones GJ ,
    12. Dugan MH
    : Studiu de fază III al valspodar (PSC 833) combinat cu paclitaxel și carboplatină în comparație cu paclitaxel și carboplatină singuri la pacienții cu cancer de ovar epitelial în stadiul III sau cu cancer peritoneal primar în stadiul III, suboptimal descompus . J Clin Oncol 26 : 2674 – 2682 , 2008 . Text complet abstract / GRATUIT Google Scholar
  35.  
    1. Abraham J ,
    2. Edgerly M ,
    3. Wilson R ,
    4. Chen C ,
    5. Rutt A ,
    6. Bakke S ,
    7. Robey R ,
    8. Dwyer A ,
    9. Goldspiel B ,
    10. Balis F ,
    11. Van Tellingen O ,
    12. Bates SE ,
    13. Fojo T
    : Un studiu de fază I al antagonistului P-glicoproteinei tariquidar în combinație cu vinorelbina . Clin Cancer Res 15 : 3574 – 3582 , 2009 . Text complet abstract / GRATUIT Google Scholar
  36.  
    1. Kelly RJ ,
    2. Draper D ,
    3. Chen CC ,
    4. Robey RW ,
    5. Figg WD ,
    6. Piekarz RL ,
    7. Chen X ,
    8. Gardner ER ,
    9. Balis FM ,
    10. Venkatesan AM ,
    11. Steinberg SM ,
    12. Fojo T ,
    13. Bates SE
    : Un studiu farmacodinamic al docetaxelului în combinație cu antagonistul glicoproteinei P tariquidar (XR9576) la pacienții cu cancer pulmonar, ovarian și cervical . Clin Cancer Res 17 : 569 – 580 , 2011 . Text complet abstract / GRATUIT Google Scholar

Test deschis, explorator, de fază II, de Itraconazol oral pentru tratamentul carcinomului bazocelular

Daniel J. Kim , James Kim , Katrina Spaunhurst , Javier Montoya , Rita Khodosh , Kalyani Chandra …Afișați mai multe

Itraconazolul, un medicament antifungic aprobat de US Food and Drug Administration, inhibă calea de semnalizare Hedgehog (HH), un factor crucial al tumorigenezei carcinomului bazocelular (BCC) și reduce creșterea BCC la șoareci. Am evaluat efectul itraconazolului asupra căii HH și asupra dimensiunii tumorii în tumorile BCC umane.Pacienți și metode

Pacienții cu ≥ o tumoră BCC> 4 mm în diametru au fost înscriși pe două cohorte pentru a primi itraconazol oral 200 mg de două ori pe zi timp de 1 lună (cohorta A) sau 100 mg de două ori pe zi pentru o medie de 2,3 luni (cohorta B). Punctul final principal a fost modificarea biomarkerilor: proliferarea tumorii Ki67 și activitatea HH ( ARNm GLI1 ). Punctele finale secundare au inclus modificarea dimensiunii tumorii la un subgrup de pacienți cu tumori multiple.Rezultate

Au fost înrolați în total 29 de pacienți, dintre care 19 au fost tratați cu itraconazol. Tratamentul cu Itraconazol a fost asociat cu două evenimente adverse (oboseală de gradul 2 și insuficiență cardiacă congestivă de gradul 4). Itraconazolul a redus proliferarea celulară cu 45% ( P = 0,04), activitatea căii HH cu 65% ( P = 0,03) și a redus aria tumorii cu 24% (IC 95%, 18,2% până la 30,0%). Din opt pacienți cu mai multe tumori nonbiopsiate, patru au obținut un răspuns parțial și patru au avut boală stabilă. Tumorile de la pacienții de control netratați și de la cei tratați anterior cu vismodegib nu au prezentat modificări semnificative ale proliferării sau dimensiunii tumorii.

Concluzie

Itraconazolul are activitate anti-BCC la om. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului, în special în raport cu alți inhibitori ai căii

Carcinomul cu celule bazale (BCC) este cel mai frecvent diagnosticat cancer la om, cu aproximativ 2 milioane de cazuri noi în Statele Unite în fiecare an. 1 Pacienții afectați de sindromul nev de celule bazale (Gorlin), ereditar (mostenire online mendeliană la om nr. 109400) pot dezvolta sute până la mii de BCC. 2 Pacienții cu sindromul nevocelular bazal moștenesc o copie defectă a genei supresoare tumorale PTCH1 , care acționează ca un inhibitor primar al căii de semnalizare Hedgehog (HH). 3 – 5 PTCH1 mutațiilor genetice și pierderea de tip sălbatic rămase alelă apar și în sporadice BCC. 3 – 5În esență, toate BCC au activare malignă a căii de semnalizare HH, care este în mod obișnuit măsurată prin expresia unei gene țintă care codifică factorul de transcripție GLI1 . 2 – 4 Recenta aprobare din partea US Food and Drug Administration (FDA) a vismodegib, un antagonist al componentei esențiale a căii HH Smoothened (SMO), validează eficacitatea inhibării căii HH în tratamentul BCC. 6 Vismodegib este aprobat pentru BCC local avansat (inoperabil) sau metastatic, care cuprinde doar 2% din toate BCC. Majoritatea BCC pot fi tratate prin excizie chirurgicală, deși intervenția chirurgicală poate duce la cicatrici și morbiditate semnificative. 5Având în vedere incidența în creștere a BCC și tratamentul său costisitor – unul dintre cei mai mari în rândul beneficiarilor Medicare 7 – există o mare nevoie clinică nesatisfăcută de forme nechirurgicale de tratament. 8 Deși unele creme chimioterapeutice precum imiquimod și fluouracil sunt aprobate de FDA, aceste opțiuni topice sunt eficiente numai împotriva subtipului superficial al BCC, care cuprinde doar 30% din toate BCC. 9 , 10 Efectele adverse frecvente (căderea părului, pierderea în greutate, crampele musculare) ale vismodegibului îl exclud ca opțiune de tratament viabilă pentru majoritatea BCC-urilor non-avansate. 6

Am efectuat un screening al medicamentelor aprobate de FDA și am identificat itraconazolul, un agent antifungic oral utilizat pe scară largă, ca un puternic antagonist al căii HH. 11 Anterior, am demonstrat că itraconazolul suprimă carcinogeneza BCC murină autohtonă, induce necroza tumorală și reduce expresia ARNm GLI1 la șoareci. 11 Pentru a evalua mecanismul de acțiune și eficacitatea clinică a itraconazolului în BCC umană, am efectuat un studiu deschis, de dovadă a conceptului, de fază II, în două cohorte de pacienți cu BCC sporadică. Obiectivele principale ale celor două cohorte au fost de a evalua dacă inhibarea indusă de itraconazol a activității căii HH ( GLI1 ARNm) ar putea reduce proliferarea tumorii (Ki67) și dimensiunea tumorii la BCC umană și pentru a evalua dacă s-ar putea realiza reduceri semnificative ale dimensiunii tumorii cu doze mai mici de itraconazol administrate pe o durată mai lungă.PACIENTI ȘI METODEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODE <<REZULTATEDISCUŢIEREFERINȚEPacienți și tratamente

Am recrutat pacienți cu ≥ o tumoră BCC> 4 mm (cel mai lung diametru), fără comorbidități și teste normale ale funcției hepatice în decurs de 1 an înainte de înscriere. Cei care au luat medicamente care ar putea afecta tumorile BCC sau metabolismul itraconazolului (de exemplu, anticonvulsivante, corticosteroizi) și cei care nu au putut participa atât la biopsie inițială, cât și la excizia chirurgicală la aceeași instituție au fost excluși din studiu. Toți pacienții au fost măsurați AST / ALT după 1 lună de itraconazol.

Am examinat 67 de pacienți pentru eligibilitate și am înscris 29 la două site-uri; 37 de pacienți au fost excluși de la înscriere din cauza incapacității lor de a avea atât biopsie, cât și excizie în același loc. Cohorta A (Universitatea Stanford, Stanford, CA) a înrolat 25 de pacienți din aprilie 2010 până în decembrie 2010, iar cohorta B (Universidad Católica de Chile, Santiago, Chile) a înrolat patru pacienți din iulie 2010 până în septembrie 2011 (diagrama CONSORT; Fig 1). Un singur pacient a întâmpinat diagnosticul clinic pentru sindromul nevocelular bazal.

Fig. 1.Diagrama CONSORT. qPCR, reacție în lanț cantitativă a polimerazei.

În cohorta A, pacienții au primit itraconazol în comprimate de 200 mg pe cale orală de două ori pe zi, între momentul biopsiei și momentul exciziei definitive (în mod obișnuit 4 săptămâni). Scopul principal al cohortei A a fost evaluarea biomarkerilor tumorali (proliferarea Ki67 și activitatea căii HH [ GLI1mARN]) și dimensiunea tumorii se modifică după 1 lună de tratament. În cohorta B, pacienții au primit comprimate de 100 mg pe cale orală de două ori pe zi. Scopul principal al cohortei B a fost de a determina dacă o doză mai mică de itraconazol administrată pe o durată mai lungă (medie, 2,3 luni; interval, 1 până la 4 luni) ar putea realiza în continuare efecte semnificative clinic. Pacienții eligibili altfel, dar care nu doreau să ia itraconazol, au fost înrolați pe brațul de control al studiului și nu au primit tratament. Studiile paralele au fost aprobate de către comitetele de revizuire instituționale respective.

Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresie în timpul terapiei, probabil ca urmare a rezistenței secundare la vismodegib. 12 Deoarece itraconazolul antagonizează și SMO și se știe puțin despre modul în care rezistența la un medicament poate afecta eficacitatea unui alt inhibitor al SMO, cei tratați anterior cu vismodegib au fost analizați separat de pacienții naivi cu vismodegib. Prin urmare, am analizat în cele din urmă trei grupuri discrete: unul, pacienții care nu au primit nici un itraconazol; doi, pacienți cărora li s-a administrat itraconazol fără tratament anterior cu vismodegib; și trei, pacienți cărora li s-a administrat itraconazol cu ​​tratament anterior cu vismodegib.Biopsii tumorale și evaluări ale biomarkerului (cohorta A)

La momentul înscrierii, pacienții din cohorta A aveau leziuni BCC țintă (una sau două dintre cele mai reprezentative tumori) selectate pentru biopsie. Tumorile biopsiate au fost încorporate în parafină și colorate pentru Ki67 pentru a evalua proliferarea celulară. Celulele cu colorare nucleară pozitivă (indicând celule în proliferare activă) au fost numărate de Flagship Biosciences (Flagstaff, AZ) și normalizate la numărul total de nuclee prezente în BCC. Datele de proliferare celulară prezentate aici sunt exprimate ca procent de celule cu un semnal pozitiv. Pentru a evalua activitatea căii HH, probele de biopsie proaspete au fost congelate rapid, plasate în Trizol (Invitrogen, Carlsbad, CA) și omogenizate utilizând MP FastPrep 24 (MP Biomedicals, Solon, OH). ARN-ul total a fost purificat cu tuburi de fază Lock Gels (Eppendorf, Hamburg, Germania) și un kit ARN PureLink Micro (Invitrogen).ADNc a fost sintetizat cu SuperScript III Reverse Transcriptase (Invitrogen). Reacția în lanț a polimerazei în timp real a fost efectuată pe un iCycler Bio-Rad folosind iQ SyberGreen Supermix (Bio-Rad, Hercules, CA). Schimbare de oriExpresia ARNm GLI1 a fost măsurată utilizând analiza ΔΔC t , cu HPRT1 ca genă de control intern și pielea normală colectată de la pacienții cu BCC ca probe de control pentru normalizarea probelor BCC. Secvențele de primer de reacție în lanț ale polimerazei au fost:

  • GLI1 înainte: 5 ′ GAAGTCATACTCACGCCTCGAA 3 ′
  • GLI1 invers: 5 ′ CAGCCAGGGAGCTTACATACAT 3 ′
  • HPRT1 înainte: 5 ′ GGTCAGGCAGTATAATCCAAAG 3 ′
  • Revers HPRT1 : 5 ′ GGACTCCAGATGTTTCCAAAC 3 ′

În cazurile în care biopsia / excizia a avut un volum tumoral limitat, probele au fost prioritare pentru analiza proliferării celulare. Nici o tumoră nu a fost biopsiată pentru analiza biomarkerului în cohorta B, deoarece scopul său principal a fost de a evalua efectul dozei mici de itraconazol asupra dimensiunii tumorii.Măsurători ale dimensiunii tumorii

În cohorta A, 11 din 15 pacienți au avut o singură tumoare BCC. Această leziune țintă a fost biopsiată și excizată pentru analiza biomarkerului. Leziunile țintă nu au fost evaluate pentru modificarea dimensiunii tumorii, deoarece au fost biopsiate la momentul inițial. Doar patru din 15 pacienți au avut ≥ o tumoră BCC și au fost observate leziuni nedestinate (n = 42) pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial. Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. În schimb, toate tumorile de la cei patru pacienți (n = 14 BCC) din cohorta B au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 200 mg pe zi (durata medie, 2,3 luni).Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) a fost calculată de la data înscrierii până la data ultimei evaluări clinice.

Pentru fiecare pacient măsurat pentru zona tumorii, parametrii de răspuns clinici BCC validați au fost utilizați conform Skvara și colab 13 și definiți după cum urmează: răspuns complet, nu mai există dovezi vizibile ale unei leziuni în concordanță cu BCC; răspuns parțial, deși rămâne un BCC, există o scădere vizibilă a dimensiunii; și fără răspuns, BCC nu a scăzut vizibil în dimensiune. Un investigator dermatolog care a fost orbit de grupurile de tratament a efectuat toate evaluările clinice folosind fotografii făcute înainte și după tratament. Nu am utilizat criterii RECIST pentru tumorile solide, deoarece majoritatea leziunilor BCC aveau o dimensiune <10 mm, iar leziunile tumorale au fost evaluate în primul rând pentru modificările biomarkerului.Analize statistice

Ca studiu exploratoriu, am calculat că un număr minim de 27 de pacienți trebuia să fie înrolați pentru a detecta o diferență de două ori între modificarea Ki67 la pacienții netratați față de cei tratați cu itraconazol (β, 0,80; față-verso α, 0,05). Testul sumelor de rang nonparametric Mann-Whitney a fost utilizat pentru comparații nepereche, iar testul de rang semnat Wilcoxon a fost utilizat pentru comparații pereche. Toate valorile P raportate sunt pe două fețe.REZULTATEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATE <<DISCUŢIEREFERINȚEDemografia pacientului

Am înrolat 29 de pacienți cu un total de 101 tumori BCC; 19 pacienți cu un total de 90 BCC au consimțit la tratamentul cu itraconazol (cohorta A, n = 15; cohorta B, n = 4). La momentul inițial, pacienții tratați cu itraconazol și pacienții martor au fost similari ca vârstă, sex, tip BCC și localizarea tumorilor BCC ( Tabelul 1 ). Tumorile au apărut în regiunile corpului expuse în mod clasic la soare, inclusiv fața, gâtul și trunchiul. Pacienții au fost predominant bărbați mai în vârstă (vârsta medie, 60 de ani) cu subtipuri BCC nodulare. Pacienții cărora li sa administrat itraconazol au avut, în medie, aproape 5 ori mai multe tumori la momentul inițial comparativ cu cei care nu au fost tratați cu itraconazol ( P= .13). Durata medie de observare / tratament a fost de aproximativ 1 lună la pacienții martor și la pacienții tratați cu itraconazol din cohorta A (n = 76 de tumori) și 2,3 luni la pacienții tratați cu itraconazol din cohorta B (n = 14 tumori). Trei pacienți din cohorta A au fost tratați anterior cu vismodegib și au prezentat progresia bolii și au oprit vismodegibul timp de ≥ 6 luni înainte de a începe itraconazolul.

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

Tabelul 1. Caracteristici demografice și clinice ale pacienților după grupul de tratament (N = 29)

CaracteristicăControl (n = 10)Itraconazol (n = 19)
Nu.%Nu.%
Vârsta la biopsia inițială, ani
    In medie68,562.2
    Gamă53 la 8144 – 85
Sex
    Masculin8801579
    Femeie220421
Numărul total de tumori BCC prezente1190
Numărul mediu de tumori BCC per pacient1.14,77
Tip tumoră BCC *
    Nodular6432150
    Superficial4291433
    Infiltrativ214512
    Micronodular21425
Localizarea tumorii BCC
    Față6553539
    Înapoi2181719
    Umăr001314
    Gât0089
    Cufăr0067
    Picior1967
    Braţ21822
    Scalp0022
    Ureche0013
Istoria tratamentului cu vismodegib003
Durata medie a tratamentului, luni
    Pacienți cu Stanford (200 mg de două ori pe zi)1.11.0
    Pacienți din Chile (100 mg de două ori pe zi)N / A2.3

Abrevieri: BCC, carcinom bazocelular; NA, nu se aplică.

* Include numai tumorile care au fost biopsiate.Evenimente adverse legate de droguri

Doi din 19 pacienți au întrerupt tratamentul cu itraconazol din cauza efectelor adverse descrise anterior asociate cu itraconazolul. O insuficiență cardiacă congestivă de gradul 4 a apărut la un pacient care a avut o boală cardiacă nediagnosticată în urma tratamentului anterior cu adriamicină pentru limfom Hodgkin acum 20 de aniFig 1). Un al doilea pacient a întrerupt din cauza oboselii de gradul 2. Alte efecte adverse au fost ușoare și toate efectele adverse au fost reversibile la întreruperea tratamentului. Nu s-au detectat creșteri ale testării funcției hepatice (AST / ALT) la niciun pacient în timpul tratamentului.Analiza biomarkerului (numai cohorta A)

Un total de 63 de biopsii de la 22 din 25 de pacienți înscriși în cohorta A au fost disponibile pentru analiza biomarkerului ( Fig 1). Am comparat modificarea proliferării Ki67 în biopsiile luate la momentul inițial și la excizie la o lună mai târziu la pacienții tratați cu itraconazol (20 BCC) și la pacienții netratați / de control (12 BCC). Itraconazolul a scăzut proliferarea celulară cu 35% la pacienții naivi cu vismodegib în analize nepereche ( P = .079; Fig. 2De la A la 2C). În cadrul comparațiilor pacienților cu activitatea Ki67 de la momentul inițial până la excizie, itraconazolul a scăzut proliferarea celulară cu 45% la pacienții naivi cu vismodegib (n = 8; P = 0,04 în perechi ; Fig 2D). În schimb, pacienții martori și cei tratați anterior cu vismodegib nu au prezentat modificări semnificative în proliferarea celulară ( Fig 2E).

Fig 2.Cuantificarea Ki67 și analiza tumorilor de carcinom bazocelular (BCC). (A) Analiza nepereche a tumorilor individuale de la pacienții martor și pacienții tratați cu itraconazol. Colorarea Ki67 a tumorilor BCC la momentul inițial și excizia de la pacienții de control (B) și (C) pacienți naivi cu vismodegib tratați cu itraconazol. Colorarea pozitivă (maro) indică proliferarea nucleelor; colorarea negativă (albastră) nu indică activitate proliferativă. Analiza pereche a pacientului Ki67 medii în rândul pacienților (D) naivi cu vismodegib și (E) pacienți de control tratați cu itraconazol.

Pentru analiza căii de semnalizare HH, un total de 24 de biopsii au fost colectate de la pacienții tratați cu itraconazol și analizați pentru nivelurile de ARNm GLI1 . Într-o analiză nepereche, itraconazolul a scăzut ARNm GLI1 cu 65% în tumorile de la pacienții naivi cu vismodegib comparativ cu valoarea inițială ( P = 0,028; Fig 3A). Examinând numai tumori asociate de la patru pacienți (naivi cu vismodegib), itraconazolul a scăzut ARNm GLI1 cu 45% în tumori după o lună, comparativ cu valoarea inițială ( Fig 3B). Tumorile de la pacienții cu tratament anterior cu vismodegib nu au demonstrat o scădere semnificativă a expresiei ARNm GLI1 . Alte studii clinice BCC nu au demonstrat, de asemenea, nicio modificare a expresiei ARNm GLI1 la pacienții tratați cu placebo sau pacienții de control. 14 , 15

Fig 3.Niveluri de expresie a ARNm GLI1 în tumorile de carcinom bazocelular de la pacienții tratați cu itraconazol timp de 1 lună. Unii pacienți au primit anterior tratament cu vismodegib și nu au mai răspuns la vismodegib. (A) Analiza nepereche a nivelurilor de ARNm GLI1 din tumorile inițiale și tumorile excizate după tratamentul cu itraconazol. Ca martor, ARNm GLI1 a fost evaluat pe pielea normală nontumorală. ARNm GLI1 a scăzut cu 65% la pacienții naivi cu vismodegib tratați cu itraconazol de la momentul inițial până la excizie ( P = .028). (B) În analiza asociată a tumorilor de la aceiași pacienți, itraconazolul a scăzut expresia GLI1 cu 45% după o lună numai la pacienții naivi cu vismodegib.Modificări ale dimensiunii tumorii și răspunsul clinic (cohorte A și B)

Itraconazolul a redus dimensiunea tumorii și a favorizat reepitelizarea în tumorile BCC a opt din cei 29 de pacienți naivi cu vismodegib ( Fig 4). În cohorta A, patru pacienți au avut> o tumoră BCC, iar aceste leziuni nedestinate au fost observate pentru modificarea dimensiunii tumorii, deoarece acestea nu au fost biopsiate la momentul inițial (n = 43). Aria tumorii a fost evaluată cu etriere care măsurau cele mai lungi diametre perpendiculare înainte și după 1 lună de itraconazol 200 mg de două ori pe zi. La cei patru pacienți din cohorta B, toate cele 14 tumori BCC au fost evaluate pentru modificarea dimensiunii tumorii folosind etriere înainte și după tratamentul cu itraconazol 100 mg de două ori pe zi (durata medie, 2,3 luni). Niciuna dintre tumorile cohortei B nu a fost biopsiată pentru analiza biomarkerului, deoarece scopul cohortei B a fost de a evalua o doză mai mică de itraconazol pentru o durată mai lungă. Modificarea procentuală a zonei tumorale de la ambele cohorte (opt pacienți în total cu 57 de tumori) este prezentată în Figura 5. În medie, tumorile de la pacienții naivi cu vismodegib au scăzut cu 24% (IÎ 95%, 18,2% până la 30,0%) după tratamentul cu itraconazol ( Fig 5). Mai mult, reducerile medii ale tumorilor la pacienții din cohorta B au fost comparabile cu cele ale cohortei A ( P = .435). Această constatare sugerează că administrarea alternativă de itraconazol (doze mai mici pe o durată mai lungă) poate realiza în continuare reduceri semnificative clinic.

Fig 4.Reducerea sau reepitelizarea tumorilor de carcinom bazocelular (BCC) de către itraconazol la pacienții fără vismodegib. (A) Tumoră BCC nodulară pe picior de la înrolare până în ziua 25. (B) Tumoră BCC infiltrativă pe umăr de la înrolare până în ziua 28. (C) Vedere laterală și (D) laterală a tumorii BCC nodulare pe frunte de la înrolare până în ziua 59.

Fig 5.Modificarea procentuală a zonei tumorale pentru 57 de tumori de carcinom bazocelular (BCC) de la opt pacienți tratați cu itraconazol. În timpul tratamentului cu itraconazol, aria tumorii a scăzut în medie cu 24% (IC 95%, 18,2% până la 30,0%). În cohorta A, patru pacienți au avut mai multe tumori BCC, iar leziunile nedestinate au fost disponibile pentru măsurarea dimensiunii tumorii. Aria tumorii a fost aproximată prin înmulțirea celor mai lungi diametre perpendiculare ale tumorilor, măsurate cu etriere. Tumorile nonbiopsiate au fost evaluate pentru modificarea zonei tumorale la momentul inițial și după 4 săptămâni. În cohorta B, tumorile BCC nu au fost evaluate pentru biomarkeri; au fost evaluați numai pentru modificarea dimensiunii clinice la momentul inițial (după biopsia inițială care confirmă diagnosticul BCC) și după tratamentul cu itraconazol 200 mg în medie 2,3 luni.Procentul de modificare a zonei a fost calculat de la data înscrierii până la data ultimei evaluări clinice.

În ciuda reducerii generale a dimensiunii, niciuna dintre tumorile BCC nu a dispărut complet cu tratamentul cu itraconazol după o medie de 1,1 luni (cohorta A, n = 43 tumori) și 2,3 luni (cohorta B, n = 14 tumori). Patru pacienți au prezentat răspuns parțial și patru au prezentat o boală stabilă folosind liniile directoare descrise anterior. 16 În evaluările clinice, nici pacienții de control, nici pacienții cu antecedente de tratament cu vismodegib nu au prezentat modificări ale dimensiunii tumorii

În acest studiu de dovadă a conceptului, am demonstrat prima utilizare off-label, după cunoștințele noastre, a unui medicament aprobat de FDA pentru tratamentul BCC care vizează activitatea căii HH. Itraconazolul poate reduce dimensiunea tumorii BCC prin inhibarea căii de semnalizare HH după 1 lună de tratament. Aceste rezultate oferă baza pentru studii mai mari de durată mai lungă pentru a măsura eficacitatea clinică a itraconazolului.

Ca un studiu exploratoriu de fază II, scopul principal al acestui studiu a fost de a determina dacă itraconazolul la doze prescrise în mod obișnuit de 200 până la 400 mg zilnic ar putea reduce proliferarea tumorii și calea HH în BCC umane după o lună. Doar patru pacienți din cohorta B au fost tratați timp de> 1 lună și, prin urmare, nu avem rezultate privind eficacitatea clinică anti-BCC a itraconazolului pe o perioadă mai lungă de tratament. Mai mult, nu putem compara în mod direct eficacitatea pe termen scurt a itraconazolului cu cea a vismodegibului, primul inhibitor de HH aprobat de FDA care a prezentat o rată de răspuns de 40% la pacienții cu BCC avansat local tratați timp de> 10 luni. 6Itraconazolul pare să aibă o utilitate clinică mai mică în comparație cu vismodegib ca tratament de primă linie, deoarece concentrația inhibitoare jumătate maximă a itraconazolului este de 100 × mai puțin puternică in vitro comparativ cu vismodegib, iar itraconazolul reduce calea HH cu 65% după 1 lună, spre deosebire de Reducere de 90% cu vismodegib. 15 Itraconazolul poate fi eficient ca terapie de linia a doua, deoarece itraconazolul acționează asupra SMO într-un loc distinct de ciclopamină și vismodegib. 11 După cum se demonstrează prin teste de semnalizare in vitro, 17eficacitatea itraconazolului este dependentă de doză, iar studiile viitoare ar trebui să examineze dacă dozele mai mari de itraconazol administrate pe perioade mai lungi de tratament pot aborda eficacitatea observată cu vismodegib și alți antagoniști SMO. Cu toate acestea, administrarea cronică a itraconazolului ar putea avea, de asemenea, efecte adverse și toxicitate suplimentare, care nu au fost observate în acest studiu exploratoriu, deși au fost raportate tratamente pe termen lung cu 600 până la 900 mg pe zi, cuprinse între 3 și 16 luni, cu toxicități controlabile. 18 , 19

Studiul nostru are mai multe limitări. În primul rând, a fost limitată de mărimea eșantionului, deoarece am înrolat doar 29 de pacienți; cu toate acestea, mulți pacienți au avut mai multe tumori, iar acest studiu a evaluat 101 BCC. În al doilea rând, toți, cu excepția unuia dintre pacienții din acest studiu, au avut BCC non-avansat și niciunul nu a avut boală metastatică; astfel, rezultatele noastre nu pot fi comparate cu rata globală de răspuns de 40% observată cu vismodegib la pacienții cu BCC avansat sau metastatic. 6În al treilea rând, am avut doar trei pacienți care au prezentat progresia cu vismodegib și nu au efectuat analize de secvențiere pentru a determina mecanismul de rezistență la medicamente vismodegib. Astfel, nu am putut testa în mod direct dacă itraconazolul ar putea fi o opțiune viabilă ca tratament de linia a doua după eșecul vismodegibului. În al patrulea rând, am evaluat doar eficacitatea pe termen scurt a itraconazolului și este necesară administrarea cronică pentru a compara eficacitatea și toxicitatea itraconazolului în raport cu vismodegib. Viitoare studii clinice randomizate sunt necesare pentru a determina eficacitatea itraconazolului la o gamă mai largă de pacienți cu sarcini variate ale bolii, o eficacitate diferențială potențială în tumorile rezistente la vismodegib versus tumorile naive cu vismdoegib și posibilitatea dacă un dublu atac anti-SMO ar fi da rezultate superioare.Rezultatele noastre preclinice sugerează că o dublă inhibare anti-SMO reduce creșterea tumorii mai eficient decât itraconazolul sau ciclopamina în monoterapie.11

Recent, terapia combinatorie cu trioxid de arsen (ATO), aprobată de FDA pentru leucemia promielocitară acută, s-a dovedit a fi eficientă în BCC murin și medullobloastomul rezistent la vismodegib. 20 ATO acționează ca un antagonist HH prin prevenirea traficului ciliar și destabilizarea GLI2, un factor de transcripție în aval de SMO. 17 Tratamentul combinat cu itraconazol și ATO s-ar putea dovedi deosebit de benefic în tumorile BCC rezistente 21 la antagoniștii SMO, cum ar fi vismodegib, care imită și concurează pentru legarea cu ciclopamina. 20 Presupunând că BCC rezistente la vismodegib se comportă similar cu meduloblastomul, 22 , 23 terapia combinată cu itraconazol-ATO poate depăși rezistența rezultată dinMutații SMO și amplificări GLI2 , deoarece itraconazolul inhibă SMO printr-un mecanism distinct de ciclopamină, 11 și ATO inhibă factorii de transcripție GLI . În acest scop, am inițiat un studiu al combinației de itraconazol și ATO la pacienții cu BCC metastatice pentru care vismodegib a eșuat (clinictrials.gov NCT01791894).© 2014 de Societatea Americană de Oncologie Clinică

Vezi editorialul însoțitor la pagina 720

Susținut de Stanford Clinical and Translational Science Institute (SPARK) și Damon Runyon Clinical Investigator Award (JYT).

Prezentat parțial la reuniunea anuală a Asociației Americane pentru Cercetarea Cancerului, Orlando, FL, 2-6 aprilie 2011.

Dezvăluirile autorilor despre posibilele conflicte de interese și contribuțiile autorilor se găsesc la sfârșitul acestui articol.

Informații despre studiile clinice: NCT01108094.DIVULGAREA AUTORILOR PRIVIND POTENȚIALELE CONFLICTE DE INTERES

Deși toți autorii au completat declarația de divulgare, următorii autor (i) și / sau membrii apropiați ai familiei unui autor au indicat un interes financiar sau de altă natură care este relevant pentru subiectul examinat în acest articol. Anumite relații marcate cu „U” sunt cele pentru care nu s-a primit nicio compensație; acele relații marcate cu „C” au fost compensate. Pentru o descriere detaliată a categoriilor de divulgare sau pentru mai multe informații despre politica ASCO privind conflictele de interese, vă rugăm să consultați Declarația de divulgare a autorului și secțiunea Dezvăluiri de potențiale conflicte de interese din Informații pentru contribuabili.

Ocuparea forței de muncă sau poziția de conducător: Niciun Consultant sau Rol consultativ: Jean Y. Tang, Genentech (C) Proprietate de acțiuni: Niciun Onorariu: Niciun Finanțare pentru cercetare: Niciun Mărturie de expert: Niciun Brevete, Redevențe și Licențe: Niciun Alt Remunerație: Nici unulCONTRIBUȚIILE AUTORULUI

Concepție și design: Philip A. Beachy, Jean Y. Tang

Sprijin financiar: Philip A. Beachy, Jean Y. Tang

Sprijin administrativ: Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Furnizarea de materiale de studiu sau pacienți: Jean Y. Tang

Colectarea și asamblarea datelor: Daniel J. Kim, Katrina Spaunhurst, Javier Montoya, Rita Khodosh, Kalyani Chandra, Teresa Fu, Anita Gilliam, Monserrat Molgo, Philip A. Beachy, Jean Y. Tang

Analiza și interpretarea datelor: Daniel J. Kim, James Kim, Katrina Spaunhurst, Philip A. Beachy, Jean Y. Tang

Scriere manuscrisă: Toți autorii

Aprobarea finală a manuscrisului: Toți autoriiREFERINȚEAlegeÎnceputul paginiiAbstractINTRODUCEREPACIENTI ȘI METODEREZULTATEDISCUŢIEREFERINȚE <<

1.DL Miller , MA Weinstock : Cancer de piele nonmelanom în Statele Unite: Incidență J Am Acad Dermatol 30: 774 – 778 , 1994 Crossref , Medline ,  Google Scholar
2.MR Gailani , SJ Bale , DJ Leffell , etal: Defecte de dezvoltare în sindromul Gorlin legate de o genă suppresivă tumorală putativă pe cromozomul 9 Celula 69: 111 – 117 , 1992 Crossref , Medline ,  Google Scholar
3.H Hahn , C Wicking , PG Zaphiropoulous , etal: Mutații ale omologului uman al Drosophila patch-uri în sindromul nevoid carcinom bazocelular Celula 85: 841 – 851 , 1996 Crossref , Medline ,  Google Scholar
4.RL Johnson , AL Rothman , J Xie , etal: Omolog om al patchei, o genă candidată pentru sindromul nevului cu celule bazale Știință 272: 1668 – 1671 , 1996 Crossref , Medline ,  Google Scholar
5.EH Epstein : Carcinoame bazocelulare: Atacul ariciului Nat Rev Cancer 8: 743 – 754 , 2008 Crossref , Medline ,  Google Scholar
6.A Sekulic , MR Migden , AE Oro , etal: Eficacitatea și siguranța vismodegibului în carcinomul bazocelular avansat N Engl J Med 366: 2171 – 2179 , 2012 Crossref , Medline ,  Google Scholar
7.TS Housman , SR Feldman , PM Williford , etal: Cancerul de piele este printre cele mai costisitoare dintre toate tipurile de cancer de tratat pentru populația Medicare J Am Acad Dermatol 48: 425 – 429 , 2003 Crossref , Medline ,  Google Scholar
8.E de Vries , M Louwman , M Bastiaens , etal: Creșteri rapide și continue ale ratelor de incidență a carcinomului bazocelular în sud-estul Țărilor de Jos din 1973 J Invest Dermatol 123: 634 – 638 , 2004 Crossref , Medline ,  Google Scholar
9.H Gollnick , CG Barona , RG Frank , etal: Rata de recurență a carcinomului bazocelular superficial după tratamentul cu cremă imiquimod 5%: Încheierea unui studiu de urmărire pe termen lung de 5 ani în Europa Eur J Dermatol 18: 677 – 682 , 2008 Medline ,  Google Scholar
10.K Gross , L Kircik , G Kricorian : 5% cremă 5-fluorouracil pentru tratamentul carcinomului bazocelular superficial mic: Eficacitate, tolerabilitate, rezultat cosmetic și satisfacția pacientului Dermatol Surg 33: 433 – 439 , 2007 discuție 440 Medline ,  Google Scholar
11.J Kim , JY Tang , R Gong , etal: Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii Hedgehog și creșterea cancerului Celula cancerului 17: 388 – 399 , 2010 Crossref , Medline ,  Google Scholar
12.RL Yauch , GJ Dijkgraaf , B Alicke , etal: Mutația netezită conferă rezistență la un inhibitor al căii Hedgehog în meduloblastom Știința 326: 572 – 574 , 2009 Crossref , Medline ,  Google Scholar
13.H Skvara , F Kalthoff , JG Meingassner , etal: Tratamentul topic al carcinoamelor bazocelulare în sindromul carcinomului bazocelular nevoidic cu un inhibitor netezit J Invest Dermatol 131: 1735 – 1744 , 2011 Crossref , Medline ,  Google Scholar
14.DD Von Hoff , PM LoRusso , CM Rudin , etal: Inhibarea căii arici în carcinomul bazocelular avansat N Engl J Med 361: 1164 – 1172 , 2009 Crossref , Medline ,  Google Scholar
15.JY Tang , JM Mackay-Wiggan , M Aszterbaum , etal: Inhibarea căii arici la pacienții cu sindromul nevului bazocelular N Engl J Med 366: 2180 – 2188 , 2012 Crossref , Medline ,  Google Scholar
16.GJ Dijkgraaf , B Alicke , L Weinmann , etal: inhibarea moleculei mici a GDC-0449 mutanți refractari neteziți și mecanisme din aval de rezistență la medicamente Cancer Res 71: 435 – 444 , 2011 Crossref , Medline ,  Google Scholar
17.J Kim , JJ Lee , J Kim , etal: Arsenicul antagonizează calea Hedgehog prin prevenirea acumulării ciliare și reducerea stabilității efectorului transcripțional Gli2 Proc Natl Acad Sci SUA 107: 13432 – 13437 , 2010 Crossref , Medline ,  Google Scholar
18.K Takagi , A Yoshida , T Yamauchi , etal: Tratamentul cu succes al spondilodiscitei Aspergillus cu doze mari de itraconazol la un pacient cu leucemie mielogenă acută Leucemie 15: 1670 – 1671 , 2001 Crossref , Medline ,  Google Scholar
19.PK Sharkey , MG Rinaldi , JF Dunn , et al: doze mari de itraconazol în tratamentul micozelor severe Antimicrob Agents Chemother 35: 707 – 713 , 1991 CrossRef , Medline ,  Google Academic
20.J Kim , BT Aftab , JY Tang , etal: Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți Celula cancerului 23: 23 – 34 , 2013 Crossref , Medline ,  Google Scholar
21.AL Chang , AE Oro : Evaluarea inițială a creșterii tumorale după vismodegib în carcinomul bazocelular avansat Arch Dermatol 148: 1324 – 1325 , 2012 Crossref , Medline ,  Google Scholar
22.CM Rudin , CL Hann , J Laterra , etal: Tratamentul meduloblastomului cu inhibitor al căii arici GDC-0449 N Engl J Med 361: 1173 – 1178 , 2009 Crossref , Medline ,  Google Scholar
23.S Buonamici , J Williams , M Morrissey , etal: Interferența cu rezistența la antagoniști neteziți prin inhibarea căii PI3K în medulloblastom Sci Transl Med 2: 51ra70 , 2010 Crossref , Medline ,  Google Scholar

Impactul chimioterapiei combinate cu Itraconazol asupra supraviețuirii pacienților cu cancer ovarian refractar

HIROSHI TSUBAMOTO , TAKASHI SONODA , MASAAKI YAMASAKI și KAYO INOUECercetare anticancer mai 2014, 34 (5) 2481-2487;

Abstract

Context: După progresia în timpul chimioterapiei, cancerul ovarian persistent răspunde rar la agenții citotoxici. Am evaluat utilizarea itraconazolului adjuvant pentru tratarea cancerului ovarian refractar.

Pacienți și metode: Dosarele medicale ale pacienților cu cancer ovarian au fost revizuite retrospectiv pentru a selecta cei cu antecedente de administrare de platină și taxan, progresie clinică în termen de șase luni de la ultima administrare de platină, continuarea chimioterapiei după prima progresie în timpul chimioterapiei.

Rezultate: Dintre 55 de pacienți, itraconazol în asociere cu chimioterapie a fost administrat la 19 pacienți. Supraviețuirea mediană fără progresie (SFP) a fost de 103 zile și 53 de zile pentru chimioterapie cu și fără itraconazol, respectiv (p = 0,014). Supraviețuirea globală mediană corespunzătoare a fost de 642 zile și respectiv 139 de zile (p = 0.006). Raportul de risc pentru SFP a fost de 0,24 (p = 0,002) și pentru supraviețuirea globală a fost de 0,27 (p = 0,006) pentru terapia cu itraconazol.

Concluzie: Itraconazolul adjuvant este promițător pentru pacienții cu cancer ovarian refractar.

Cancerul ovarian este o cauză importantă de deces legat de cancer în rândul femeilor. Conform statisticilor globale din 2012 privind cancerul, peste 238.000 de femei s-au estimat că au avut un diagnostic de carcinom ovarian epitelial (EOC) ( 1)). În majoritatea cazurilor, pacienții prezintă EOC avansat și inițial răspund la chimioterapie pe bază de platină, constând de obicei din carboplatină și paclitaxel. Cu toate acestea, majoritatea femeilor suferă de recădere și ulterior nu răspund la chimioterapie. În raportul nostru anterior, eficacitatea chimioterapiei continue a fost evaluată la pacienții cărora li s-a administrat chimioterapie cu platină și taxan, au prezentat progresie clinică în decurs de șase luni de la ultima lor doză de platină și progresie în timpul chimioterapiei ulterioare (R1). Rata de răspuns (RR) la chimioterapia citotoxică convențională a fost de 7,1%, iar supraviețuirea globală (OS) a fost de numai 168 zile ( 2 ). Prin urmare, pacienții care au avut o boală progresivă în timpul chimioterapiei sau boala refractară, au fost considerați că au răspuns slab la chimioterapia ulterioară.

Rezistența dobândită la medicamentele împotriva cancerului observată în cazurile de cancer ovarian nu este pe deplin înțeleasă. Cu toate acestea, taxanii au fost presupuși a fi transportați de glicoproteina P (P-gp, cunoscută și sub numele de rezistență multidrog-1 sau caseta care leagă ATP sub-familia B membru ABCB-1), iar expresia P-gp este un marker pentru chimioterapie rezistență și prognostic în cancerul ovarian ( 3 – 5 ). La sfârșitul secolului al XX-lea, s-a demonstrat că itraconazolul, un agent antifungic comun, inversează rezistența mediată de P-gp asociată cu paclitaxel, docetaxel, vinblastină, daunorubicină și doxorubicină în mod dependent de concentrație in vitro ( 6). – 8). În 2007, potențialul său de inhibare a angiogenezei a fost raportat de un grup de la Johns Hopkins University School of Medicine (Baltimore, MD) ( 9 ). Aceștia au identificat itraconazolul ca un potențial medicament împotriva cancerului printre cele peste 3.000 de medicamente aprobate de Administrația SUA pentru Alimente și Medicamente. Beneficiul supraviețuirii prin adăugarea de itraconazol la chimioterapie a fost raportat recent într-un studiu clinic randomizat de fază II cu cancer pulmonar cu celule mici (NSCLC) și în studiul nostru retrospectiv al carcinomului ovarian clar recurent sau persistent, histologie potențial rezistentă la chimioterapie ( 10). , 11 ).

Pentru a evalua eficacitatea unei combinații de itraconazol și chimioterapie la pacienții cu cancer ovarian refractar, am comparat retrospectiv rezultatele chimioterapiei cu și fără itraconazol.

Pacienți și metode

Dosarele medicale ale pacienților care au avut diagnostice confirmate histologic de cancer ovarian și au primit tratament la spitalele noastre în perioada ianuarie 2004 – iunie 2013 au fost revizuite retrospectiv. Pacienții au fost incluși dacă au primit chimioterapie cu platină și taxan, au prezentat progresie clinică (simptomatică sau radiologică) în termen de șase luni de la ultima doză de platină și au continuat chimioterapia după ce boala a devenit refractară (R1). Au fost incluși cei care au progresat în timpul tratamentului de primă linie cu platină și taxan sau în timpul chimioterapiei pe bază de platină la recurență și care au continuat chimioterapia. Decizia privind continuarea chimioterapiei după R1 sau adăugarea de itraconazol s-a bazat pe un consens între medicii curenți, pacientul și familia pacientului, fără criterii fixe.Deoarece agenții vizați, inclusiv bevacizumab, nu au fost aprobați pentru tratamentul cancerului ovarian de către Ministerul Sănătății, Muncii și Bunăstării din Japonia la acel moment, niciunul dintre acești pacienți nu a primit terapie țintită și niciunul nu a fost înscris în niciun studiu clinic care să implice terapie. Acest studiu retrospectiv a fost aprobat de comisiile noastre de revizuire instituțională (nr. 1519).

Caracteristicile clinice și patologice documentate la inițierea chimioterapiei după R1 au fost revizuite. Când s-a administrat același regim, numărul regimurilor a fost înregistrat ca 1. Intervalul fără platină a fost calculat de la ultima dată de administrare a platinei până la prima dată de chimioterapie după R1. Boala refractară la platină a fost definită ca progresie clinică în timpul chimioterapiei anterioare pe bază de platină, fie în timpul primului sau oricărui regim ulterior.

Eficacitatea chimioterapiei ulterioare după R1 a fost evaluată în conformitate cu criteriile Gynecologic Cancer InterGroup (GCIG), publicate în 2011 ( 12 ). Pe scurt, la pacienții cu boală măsurabilă, a fost aplicat criteriul de evaluare a răspunsului în tumorile solide (RECIST) versiunea 1.1 ( 13)); pacienții fără boală măsurabilă au fost evaluați de nivelurile antigenului cancerului seric (CA) -125. Deoarece în practica clinică de rutină, feliile tomografice computerizate (CT) aveau o grosime de 5-10 mm, leziunile măsurabile au fost definite ca fiind cele cu diametrul ≥20 mm. Ratele de răspuns au fost comparate, utilizând un test chi-pătrat, între pacienții grupați pe baza dacă au primit itraconazol adjuvant după R1. Supraviețuirea fără progresie (SFP) a fost definită ca fiind timpul din prima zi de chimioterapie după R1 până la data recidivei determinate obiectiv sau a bolii progresive, deteriorării stării de sănătate atribuite bolii sau decesului. OS a fost definit ca timpul de la prima zi de chimioterapie după R1 până la deces din orice cauză.Curbele de supraviețuire au fost estimate utilizând metoda Kaplan – Meier și comparate între grupurile tratate cu și fără itraconazol folosind testul log-rank. S-a efectuat o analiză multivariată utilizând modelul de regresie a riscurilor proporționale Cox pentru PFS și OS după expunerea la itraconazol, în combinație cu chimioterapie, după R1, ajustând în funcție de vârstă, rasă, starea de performanță (PS) a Eastern Cooperative Oncology Group (ECOG), histologia carcinomul, numărul regimurilor anterioare și starea de sensibilitate la platină. Toate analizele statistice au fost efectuate folosind XLSTAT 2012 (Addinsoft, Paris, Franța).Starea de performanță (PS) a Grupului de oncologie cooperativă estică (ECOG), histologia carcinomului, numărul regimurilor anterioare și starea de sensibilitate la platină. Toate analizele statistice au fost efectuate folosind XLSTAT 2012 (Addinsoft, Paris, Franța).Starea de performanță (PS) a Grupului de oncologie cooperativă estică (ECOG), histologia carcinomului, numărul regimurilor anterioare și starea de sensibilitate la platină. Toate analizele statistice au fost efectuate folosind XLSTAT 2012 (Addinsoft, Paris, Franța).

Rezultate

Caracteristicile pacienților. Între ianuarie 2004 și iunie 2013, 55 de femei au fost eligibile pentru a fi incluse în analizele finale. Optsprezece pacienți (33%) au fost direcționați din alte spitale după R1; 9 (16%) aveau vârsta peste 70 de ani. Chimioterapia după R1 a fost efectuată la pacienții cu un ECOG PS de 0-3; 12 pacienți (22%) au avut un ECOG PS de 3. Carcinomul cu celule clare a reprezentat 18% din toate tipurile histologice. Optsprezece pacienți (33%) au primit mai mult de două regimuri de tratament anterioare, iar 34 (62%) au prezentat progresie în timpul unui tratament anterior pe bază de platină. După R1, 19 pacienți (35%) au primit itraconazol în asociere cu chimioterapie, iar dintre aceștia, 2 au avut anterior chimioterapie cu itraconazol. Caracteristicile generale ale pacientului sunt rezumate în Tabelul I. Regimurile administrate în asociere cu itraconazol după R1 au fost chimioterapie pe bază de docetaxel la 15 (79%) pacienți, iar chimioterapia combinată cu itraconazol a fost administrată săptămânal la 18 (95%) pacienți. O soluție orală de itraconazol a fost administrată la o doză zilnică de 400-600 mg timp de 4-5 zile (ziua -2 până la ziua 2 sau 3). Regimurile fără itraconazol au inclus monoterapie la 23 (64%) pacienți, dintre care 5 au primit doxorubicină lipozomală pegilată, 5 gemcitabină, 4 docetaxel, 4 irinotecan și 3 au primit paclitaxel.

Tabelul I.

Date demografice ale pacienților (n = 55).

Eficacitate. Un răspuns complet și nouă răspunsuri parțiale au fost observate la pacienții eligibili, obținând o RR de chimioterapie de 18% [interval de încredere 95% (IC) = 8-28%) după R1. Șase pacienți (32%) au răspuns la chimioterapie cu itraconazol, în timp ce 4 (11%) au răspuns la regimurile fără itraconazol ( p = 0,06). Dintre pacienții eligibili, perioadele medii de SFP și OS au fost de 77 de zile (IC 95% = 53-103 zile) și, respectiv, de 183 zile (IC 95% = 134-250 zile). SFP mediană pentru pacienții cu și fără itraconazol a fost de 103 zile (IC 95%> 84 zile) și 53 de zile (IC 95% = 38-88 zile), respectiv ( p = 0,014) ( Figura 1 ), în timp ce OS median corespunzător a fost de 642 zile (IC 95% = 238-1166 zile) și respectiv 139 zile (IC 95% = 89-183 zile), respectiv ( p= 0,006) ( Figura 2 ). Analiza multivariată a arătat că administrarea de itraconazol cu ​​chimioterapie a avut un impact atât asupra SFP, cât și asupra OS. Raportul de pericol pentru SFP a fost de 0,24 (IC 95% = 0,10-0,60; p = 0,002), iar pentru OS a fost 0,27 (IC 95% = 0,11-0,68; p = 0,006) cu terapie cu itraconazol ( Tabelul II ).

Tabelul II.

Factorii care influențează supraviețuirea fără progresie (SFP) și supraviețuirea globală (OS) după boală au devenit refractari (n = 55).

Discuţie

Beneficiul real al chimioterapiei pentru boala rezistentă la platină sau refractară la pacienții cu cancer ovarian este că s-a propus controlul simptomelor, menținerea calității vieții ( 14 ) și insuflarea pozitivității pacienților, permițându-le să continue chimioterapia sau să le prezinte un tratament alternativ ( 15 ). Pentru boala rezistentă la platină, doar un studiu clinic randomizat a demonstrat un beneficiu de supraviețuire asociat cu chimioterapia convențională ( 16). În acest studiu, toți pacienții au avut un ECOG PS de 0 sau 1, iar numărul regimurilor anterioare a fost mai mic de trei. În plus, doar 14% dintre pacienți au avut un istoric de boală refractară. Până de curând, studiile clinice randomizate nu au demonstrat un beneficiu de supraviețuire pentru niciun agent citotoxic sau chimioterapie combinată în boala refractară.

Pentru a îmbunătăți eficacitatea chimioterapiei, trebuie abordată rezistența intrinsecă și dobândită la medicamentele împotriva cancerului. Rezistența simultană apare și pentru agenții care nu au fost utilizați în chimioterapia anterioară și diferă în ceea ce privește structura chimică sau modul de acțiune. Unul dintre cele mai studiate mecanisme de rezistență implică sistemul de eflux mediat de P-gp ( 17 ). Într-un studiu clinic de fază II, un modulator P-gp de a doua generație, VX-710 (biricodar), a fost administrat pacienților cu cancer ovarian ( 18). Dintre cei 45 de pacienți evaluabili care au prezentat progresia bolii în timpul sau în termen de patru luni de la administrarea paclitaxelului, trei au răspuns la rechalarea cu paclitaxel și VX-710; boala la doi din cei trei indivizi a progresat în timpul terapiei lor anterioare cu paclitaxel. Un alt modulator P-gp de a doua generație, valspodar (PSC 833), a fost raportat într-un studiu de fază III a chimioterapiei de primă linie pentru cancerul ovarian. Comparativ cu chimioterapia standard , de paclitaxel si carboplatina, doza de paclitaxel a fost redusă de la 175 mg / m 2 până la 80 mg / m 2 în combinație cu valspodar. Adăugarea de valspodar la regimurile standard de chimioterapie nu a îmbunătățit durata SFP sau OS, dar a crescut numărul de evenimente adverse ( 19). Deoarece interacțiunile medicamentoase care implică citocromul P450, familia 3, inhibarea subfamiliei A (CYP3A) au necesitat reducerea dozei de medicament citotoxic, inhibitorul P-gp de generația a treia, tariquidar (XR9576), cu specificitate și potență crescută, și mai puține interacțiuni farmacocinetice a fost testat în terapia combinată. Doza de docetaxel de 75 mg / m 2 la fiecare trei săptămâni ar putea fi administrat în siguranță în combinație ( 20). Dintre 18 pacienți cu cancer ovarian, unul a avut un răspuns parțial la XR9576 și docetaxel, dar tratamentul ei anterior nu a fost descris. Cu toate acestea, două studii de fază III în NSCLC avansat, combinând tariquidar cu carboplatină / paclitaxel sau cu vinorelbină, s-au închis devreme din cauza toxicității. Conceptul de inversare a rezistenței la medicamente a fost demonstrat cu succes în studiile preclinice, dar a eșuat în studiile clinice sau nu se așteaptă să fie inclus în alte investigații clinice. Analiza exploratorie actuală a arătat impactul combinării chimioterapiei cu itraconazol asupra SO.

Pe baza unui studiu preclinic de inhibare a angiogenezei, experții de la Școala de Medicină Johns Hopkins au efectuat un studiu randomizat de fază II cu itraconazol în NSCLC ( 10 ). Terapia concomitentă cu pemetrexed și itraconazol nu a avut un PFS îmbunătățit comparativ cu terapia fără itraconazol la cei 23 de pacienți înrolați; cu toate acestea, SO a fost semnificativ mai lung în rândul pacienților cărora li sa administrat itraconazolp= 0,012). Autorii au sugerat că motivul avantajului OS asociat cu administrarea de itraconazol s-a datorat, prin urmare, efectelor anti-angiogeneză ale itraconazolului. De asemenea, au remarcat comparația dintre itraconazol și bevacizumab, un anticorp monoclonal îndreptat împotriva factorului de creștere endotelial vascular. În plus, studiul ECOG 4599 a demonstrat o îmbunătățire semnificativă statistic (2 luni) a OS (supravietuirea globala/generala) , cu toxicități mai severe (incidența deceselor legate de tratament a fost de 3,5%) atunci când a fost administrat bevacizumab21 ). Cu toate acestea, un studiu de confirmare (AVAiL) nu a demonstrat un beneficiu pentru sis ( 22). Pentru terapia orientată către EOC, bevacizumab este, de asemenea, cel mai extins agent studiat. Două studii randomizate, GOG218 și ICON7, au demonstrat SFP prelungită atunci când bevacizumab a fost administrat ca inducție de primă linie și chimioterapie de întreținere, dar nu s-a observat un beneficiu OS ( 23 , 24 ). Studiul GOG 218 a demonstrat o îmbunătățire de 3,8 luni a SFP cu încă 51 de săptămâni de tratament, un risc de 10% de hipertensiune de grad 3-4 și un risc de 2,3% de perforare gastrointestinală de grad 3 sau mai proastă, hemoragie sau formare de fistule ( 25 ). Cu toate acestea, Cohen și colab. a raportat că adăugarea de bevacizumab nu a fost rentabilă ( 26). Mai mult, în studiile randomizate pentru EOC recurent, bevacizumab nu a prelungit OS ( 27 , 28 ). Având în vedere rezultatele studiilor clinice care au implicat pacienți cu EOC și NSCLC, avantajul de supraviețuire al pacienților tratați cu itraconazol în studiul nostru și în studiul Johns Hopkins este extraordinar și nu poate fi explicat pe deplin prin efectele anti-angiogeneză ale itraconazolului atunci când este administrat în asociere cu chimioterapie. În studiul de față, pacienții care au suferit recurență după chimioterapie combinată cu itraconazol au fost tratați cu alte regimuri citotoxice și au fost reclamați cu itraconazol. În cancerul colorectal, utilizarea continuă a bevacizumab, dincolo de progresia bolii, s-a dovedit a prelungi OS ( 29 , 30). În cancerul ovarian, un studiu retrospectiv a arătat că tratamentul cu bevacizumab a prelungit SFP, dar nu și OS ( 31 ). OS favorabil în studiul actual ar putea fi asociat cu utilizarea continuă a itraconazolului, care a produs mai puține toxicități și a costat mai puțin decât bevacizumab.

Figura 1.

Figura 1.

Supraviețuirea fără progresie (SFP) după continuarea chimioterapiei cu sau fără (fără) itraconazol (ITCZ) după ce boala a devenit refractară. PFS mediană a fost de 103 zile (95% interval de încredere> 84 zile) și 53 de zile (95% interval de încredere = 38-88 zile) pentru chimioterapie cu și fără ITCZ, respectiv (p = 0,014).

Tendințele recente în dezvoltarea agenților anticanceroși s-au concentrat asupra celulelor stem canceroase (CSC) pentru a prelungi sistemul de operare sau chiar pentru a oferi un tratament. CSC sunt rezistente la medicamente ( 32 ), cu unul dintre mecanismele de chimiorezistență care implică efluxul mediat de P-gp de agenți citotoxici ( 33 ). Auto-reînnoirea, diferențierea multilineală și dezvoltarea metastatică de către CSC sunt procese asociate cu calea de semnalizare arici ( 34 ). S-au raportat că CSC-urile și calea de semnalizare a ariciului joacă roluri importante în dezvoltarea și progresia EOC ( 35 – 37). Ca rezultat, inhibitorii ariciului au fost investigați în studiile clinice. Un studiu randomizat de fază II cu saridegib (IPI-926), un derivat sintetic al ciclopaminei (11-deoxijervină), pentru tratamentul cancerului pancreatic metastatic, a fost încheiat după ce o analiză intermediară a demonstrat o rată mai favorabilă a SO în placebo-plus-gemcitabină braț ( 38 ). Un studiu randomizat de faza II cu vismodegib, aprobat pentru tratamentul carcinomului bazocelular avansat de către Administrația SUA pentru Alimente și Medicamente în 2012, a demonstrat că adăugarea sa la gemcitabină nu a îmbunătățit răspunsul, SFP sau OS la pacienții cu cancer pancreatic metastatic ( 39). ). Itraconazolul inhibă, de asemenea, calea de semnalizare a ariciului, dar o face printr-un mecanism distinct de cel al saridegibului sau al vismodegibului (40 ).

Figura 2.

Figura 2.

Supraviețuirea globală (OS) după continuarea chimioterapiei cu sau fără (fără) itraconazol (ITCZ) după ce boala a devenit refractară. OS median a fost de 642 zile (95% interval de încredere = 238-1166 zile) și 139 de zile (95% interval de încredere = 89-183 zile) pentru chimioterapie cu și fără ITCZ, respectiv (p = 0,006).

Diferite scheme citotoxice au fost administrate în asociere cu itraconazol în acest studiu retrospectiv. Până de curând, se considera că RR poate crește dacă s-au administrat terapii combinate; cu toate acestea, PFS sau OS nu s-au schimbat substanțial. Prin urmare, o investigație suplimentară asupra agenților citotoxici administrați în asociere cu itraconazol ar trebui să fie efectuată pentru a stabili mai bine toxicitățile asociate și interferența cu CYP3A și bariera hematoencefalică de către itraconazol ( 41 ). La pacienții cu leucemie, itraconazolul a fost utilizat profilactic pentru a preveni infecțiile fungice ( 42 , 43). Peste 300 de pacienți cu cancer ginecologic sau non-ginecologic recurent sau persistent au fost tratați în spitalul nostru cu chimioterapie în asociere cu itraconazol, fără decese raportate sau evenimente adverse grave. Astfel, experiența actuală limitată sugerează că terapia combinată cu itraconazol este o opțiune de tratament relativ sigură pentru boala refractară.

Studiul nostru are unele limitări. Datele au trebuit reunite retrospectiv de la diferite spitale din cauza numărului mic de pacienți eligibili, deoarece majoritatea pacienților au întrerupt chimioterapia înainte sau la R1 ( 2 ). În plus, alți factori de prognostic sau predictivi ar fi putut fi omiși în analiza multivariată. Cu toate acestea, rezultatele acestui studiu sunt încurajatoare pentru pacienții care doresc să continue chimioterapia după R1, profitând de eficacitatea și toxicitatea limitată a itraconazolului. Mai mult, itraconazolul nu este un medicament scump și, prin urmare, utilizarea acestuia ar putea fi accesibilă pentru pacienții din țările mai puțin dezvoltate și ar putea reduce costurile tratamentului în țările dezvoltate.

Note de subsol

  • Conflicte de interesAutorii nu au conflicte de interese financiare de dezvăluit.
  • Primit pe 17 ianuarie 2014.
  • Revizuirea a primit 22 februarie 2014.
  • Acceptat pe 24 februarie 2014.
  • Copyright © 2014 Institutul Internațional de Cercetare Anticancer (Dr. John G. Delinassios), Toate drepturile rezervate

Referințe

  1.  
    1. GLOBOCAN 2012
    Incidența, mortalitatea și prevalența cancerului estimată la nivel mondial în 2012 . Lyon, Franța : Organizația Mondială a Sănătății, Agenția Internațională pentru Cercetarea Cancerului ; 2013 . Actualizat în noiembrie 2013 . http://globocan.iarc.fr/Default.aspx Google Scholar
  2.  
    1. Tsubamoto H ,
    2. Ito Y ,
    3. Kanazawa R ,
    4. Wada R ,
    5. Hosoda Y ,
    6. Honda O ,
    7. Takeyama R ,
    8. Sakane R ,
    9. Wakimoto Y ,
    10. Shibahara H
    : Beneficiul chimioterapiei paliative și al înscrierii hospice la pacienții cu cancer ovarian în stadiu târziu . J Obstet Gynaecol Res [în presă] . Google Scholar
  3.  
    1. Holzmayer TA ,
    2. Hilsenbeck S ,
    3. Von Hoff DD ,
    4. Roninson IB
    : Corelați clinici ai expresiei genice MDR1 (glicoproteină P) în carcinoamele ovariene și pulmonare cu celule mici . J Natl Cancer Inst 84 : 1486 – 1491 , 1992 . Text complet abstract / GRATUIT Google Scholar
    1. van der Zee AG ,
    2. Hollema H ,
    3. Suurmeijer AJ ,
    4. Krans M ,
    5. Sluiter WJ ,
    6. Willemse PH ,
    7. Aalders JG ,
    8. de Vries EG
    : Valoarea glicoproteinei P, glutationului S-transferazei pi, c-ERBB-2 și p53 ca factori de prognostic în carcinoamele ovariene . J Clin Oncol 13 : 70 – 78 , 1995 . Text complet abstract / GRATUIT Google Scholar
  4.  
    1. Kamazawa S ,
    2. Kigawa J ,
    3. Minagawa Y ,
    4. Itamochi H ,
    5. Shimada M ,
    6. Takahashi M ,
    7. Sato S ,
    8. Akeshima R ,
    9. Terakawa N
    : Pompa de eflux celular și interacțiunea dintre cisplatină și paclitaxel în celulele cancerului ovarian . Oncologie 59 : 329 – 335 , 2000 . PubMed Google Scholar
  5.  
    1. Shirakawa K ,
    2. Takara K ,
    3. Tanigawara Y ,
    4. Aoyama N ,
    5. Kasuga M ,
    6. Komada F ,
    7. Sakaeda T ,
    8. Okumura K
    : Interacțiunea docetaxelului („Taxotere”) cu glicoproteina P umană . Jpn J Cancer Res 90 : 1380 – 1386 , 1999 . CrossRef Google Scholar
    1. Takara K ,
    2. Tanigawara Y ,
    3. Komada F ,
    4. Nishiguchi K ,
    5. Sakaeda T ,
    6. Okumura K
    : Aspecte farmacocinetice celulare ale efectului de inversare a itraconazolului asupra rezistenței de medicamente anticanceroase P-glicoproteina-mediată . Biol Pharm Bull 22 : 1355 – 1359 , 1999 . PubMed Google Scholar
  6.  
    1. Iida N ,
    2. Takara K ,
    3. Ohmoto N ,
    4. Nakamura T ,
    5. Kimura T ,
    6. Wada A ,
    7. Hirai M ,
    8. Sakaeda T ,
    9. Okumura K
    : Efectele de inversare a medicamentelor antifungice asupra rezistenței multidrog în celulele HeLa care supraexprimă MDR1 . Biol Pharm Bull 24 : 1032 – 1036 , 2001 . CrossRef PubMed Google Scholar
  7.  
    1. Chong CR ,
    2. Xu J ,
    3. Lu J ,
    4. Bhat S ,
    5. Sullivan DJ Jr. . ,
    6. Liu JO
    : Inhibarea angiogenezei de către medicamentul antifungic itraconazol . ACS Chem Biol 2 : 263 – 270 , 2007 . CrossRef PubMed Google Scholar
  8.  
    1. Rudin CM ,
    2. Brahmer JR ,
    3. Juergens RA ,
    4. Hann CL ,
    5. Ettinger DS ,
    6. Sebree R ,
    7. Smith R ,
    8. Aftab BT ,
    9. Huang P ,
    10. Liu JO
    : Studiu de faza II a pemetrexedului și a itraconazolului ca terapie de linia a doua pentru cancerul pulmonar non-scuamos metastazat cu celule mici . J Thorac Oncol 8 : 619 – 623 , 2013 . PubMed Google Scholar
  9.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii la pacienții cu carcinom ovarian clar sau recidivant . Anticancer Res [în presă] . Google Scholar
  10.  
    1. Rustin GJ ,
    2. Vergote I ,
    3. Eisenhauer E ,
    4. Pujade-Lauraine E ,
    5. Quinn M ,
    6. Thigpen T ,
    7. du Bois A ,
    8. Kristensen G ,
    9. Jakobsen A ,
    10. Sagae S ,
    11. Greven K ,
    12. Parmar M ,
    13. Friedlander M ,
    14. Cervantes A ,
    15. Vermorken J ,
    16. Intergrup de cancer ginecologic
    : Definiții pentru răspuns și progresie în studiile clinice privind cancerul ovarian care încorporează RECIST 1.1 și CA-125 convenite de Gynecological Cancer Intergroup (GCIG) . Int J Gynecol Cancer 21 : 419 – 423 , 2011 . CrossRef PubMed Google Scholar
  11.  
    1. Eisenhauer EA ,
    2. Therasse P ,
    3. Bogaerts J ,
    4. Schwartz LH ,
    5. Sargent D ,
    6. Ford R ,
    7. Dancey J ,
    8. Arbuck S ,
    9. Gwyther S ,
    10. Mooney M ,
    11. Rubinstein L ,
    12. Shankar L ,
    13. Dodd L ,
    14. Kaplan R ,
    15. Lacombe D ,
    16. Verweij J
    : Noi criterii de evaluare a răspunsului în tumorile solide: ghidul RECIST revizuit (versiunea 1.1) . Eur J Cancer 45 : 228 – 247 , 2009 . CrossRef PubMed Google Scholar
  12.  
    1. Herzog TJ ,
    2. Pothuri B
    : Cancer ovarian: un accent pe gestionarea bolii recurente . Nat Clin Pract Oncol 3 : 604 – 611 , 2006 . CrossRef PubMed Google Scholar
  13.  
    1. Doyle C ,
    2. Crump M ,
    3. Pintilie M ,
    4. Oza AM
    : Chimioterapia paliativă se paliază? Evaluarea așteptărilor, rezultatelor și costurilor la femeile care primesc chimioterapie pentru cancer ovarian avansat . J Clin Oncol 19 : 1266 – 1274 , 2001 . Text complet abstract / GRATUIT Google Scholar
  14.  
    1. Vergote I ,
    2. Finkler N ,
    3. del Campo J ,
    4. Lohr A ,
    5. Hunter J ,
    6. Matei D ,
    7. Kavanagh J ,
    8. Vermorken JB ,
    9. Meng L ,
    10. Jones M ,
    11. G Brown ,
    12. Kaye S ,
    13. Grupul de studiu ASSIST-1
    : Studiu randomizat de fază III a canfosfamidei (Telcyta, TLK286) versus doxorubicină lipozomală pegilată sau topotecan ca terapie de linia a treia la pacienții cu cancer ovarian refractar la platină sau rezistent la cancer . Eur J Cancer 45 : 2324 – 2332 , 2009 . CrossRef PubMed Google Scholar
  15.  
    1. Takara K ,
    2. Sakaeda T ,
    3. Okumura K
    : O actualizare privind depășirea rezistenței multidrog mediată de MDR1 în chimioterapia cancerului . Curr Pharm Des 12 : 273 – 286 , 2006 . CrossRef PubMed Google Scholar
  16.  
    1. Seiden MV ,
    2. Swenerton KD ,
    3. Matulonis U ,
    4. Campos S ,
    5. Rose P ,
    6. Batist G ,
    7. Ette E ,
    8. Garg V ,
    9. Fuller A ,
    10. Harding MW ,
    11. Charpentier D
    : Un studiu de fază II al inhibitorului MDR biricodar (INCEL, VX-710) și paclitaxel la femeile cu cancer ovarian avansat refractar la terapia cu paclitaxel . Gynecol Oncol 86 : 302 – 310 , 2002 . CrossRef PubMed Google Scholar
  17.  
    1. Lhommé C ,
    2. Joly F ,
    3. Walker JL ,
    4. Lissoni AA ,
    5. Nicoletto MO ,
    6. Manikhas GM ,
    7. Baekelandt MM ,
    8. Gordon AN ,
    9. Fracasso PM ,
    10. Mietlowski WL ,
    11. Jones GJ ,
    12. Dugan MH
    : Studiu de fază III al valspodarului (PSC 833) combinat cu paclitaxel și carboplatină comparativ cu paclitaxel și carboplatină singuri la pacienții cu cancer de ovar epitelial în stadiul III sau cu cancer peritoneal primar în stadiul III suboptimal . J Clin Oncol 26 : 2674 – 2682 , 2008 . Text complet abstract / GRATUIT Google Scholar
  18.  
    1. Kelly RJ ,
    2. Draper D ,
    3. Chen CC ,
    4. Robey RW ,
    5. Figg WD ,
    6. Piekarz RL ,
    7. Chen X ,
    8. Gardner ER ,
    9. Balis FM ,
    10. Venkatesan AM ,
    11. Steinberg SM ,
    12. Fojo T ,
    13. Bates SE
    : Un studiu farmacodinamic al docetaxelului în combinație cu antagonistul glicoproteinei P tariquidar (XR9576) la pacienții cu cancer pulmonar, ovarian și cervical . Clin Cancer Res 17 : 569 – 580 , 2011 . Text complet abstract / GRATUIT Google Scholar
  19.  
    1. Sandler A ,
    2. Gri R ,
    3. Perry MC ,
    4. Brahmer J ,
    5. Schiller JH ,
    6. Dowlati A ,
    7. Lilenbaum R ,
    8. Johnson DH
    : Paclitaxel-carboplatin singur sau cu bevacizumab pentru cancer pulmonar cu celule mici . N Engl J Med 355 : 2542 – 2550 , 2006 . CrossRef PubMed Google Scholar
  20.  
    1. Reck M ,
    2. von Pawel J ,
    3. Zatloukal P ,
    4. Ramlau R ,
    5. Gorbounova V ,
    6. Hirsh V ,
    7. Leighl N ,
    8. Mezger J ,
    9. Archer V ,
    10. Moore N ,
    11. Manegold C ,
    12. BO17704 Grup de studiu
    : Supraviețuirea generală cu cisplatină-gemcitabină și bevacizumab sau placebo ca terapie de primă linie pentru cancerul pulmonar non-scuamos cu celule mici: Rezultate dintr-un studiu randomizat de fază III (AVAiL) . Ann Oncol 21 : 1804 – 1809 , 2010 . Text complet abstract / GRATUIT Google Scholar
  21.  
    1. Burger RA ,
    2. Brady MF ,
    3. Bookman MA ,
    4. Fleming GF ,
    5. Monk BJ ,
    6. Huang H ,
    7. Mannel RS ,
    8. Homesley HD ,
    9. Fowler J ,
    10. Greer BE ,
    11. Boente M ,
    12. Birrer MJ ,
    13. Liang SX ,
    14. Grupul de oncologie ginecologică
    : Incorporarea bevacizumab în tratamentul primar al cancerului ovarian . N Engl J Med 365 : 2473 – 2483 , 2011 . CrossRef PubMed Google Scholar
  22.  
    1. Perren TJ ,
    2. Swart AM ,
    3. Pfisterer J ,
    4. Ledermann JA ,
    5. Pujade-Lauraine E ,
    6. Kristensen G ,
    7. Carey MS ,
    8. Beale P ,
    9. Cervantes A ,
    10. Kurzeder C ,
    11. du Bois A ,
    12. Sehouli J ,
    13. Kimmig R ,
    14. Stähle A ,
    15. Collinson F ,
    16. Essapen S ,
    17. Gourley C ,
    18. Lortholary A ,
    19. Selle F ,
    20. Mirza MR ,
    21. Leminen A ,
    22. Planta M ,
    23. Stark D ,
    24. Qian W ,
    25. Parmar MK ,
    26. Oza AM ,
    27. ICON7 Anchetatori
    : Un studiu de fază III a bevacizumab în cancerul ovarian . N Engl J Med 365 : 2484 – 2496 , 2011 . CrossRef PubMed Google Scholar
  23.  
    1. Hensley ML
    : Costuri mari pentru câștiguri mici în cancerul ovarian . J Clin Oncol 29 : 1230 – 1232 , 2011 . Text integral GRATUIT Google Scholar
  24.  
    1. Cohn DE ,
    2. Kim KH ,
    3. Resnick KE ,
    4. O’Malley DM ,
    5. Straughn JM Jr. .
    : Cu ce ​​cost are un potențial avantaj de supraviețuire al bevacizumab pentru tratamentul primar al cancerului ovarian? O analiză a rentabilității . J Clin Oncol 29 : 1247 – 1251 , 2011 . Text complet abstract / GRATUIT Google Scholar
  25.  
    1. Aghajanian C ,
    2. SV gol ,
    3. Goff BA ,
    4. Judson PL ,
    5. Teneriello MG ,
    6. Husain A ,
    7. Sovak MA ,
    8. Yi J ,
    9. Nycum LR
    : OCEANE: Un studiu randomizat, dublu-orb, controlat placebo, de fază III, cu chimioterapie cu sau fără bevacizumab la pacienții cu cancer ovarian epitelial recurent sensibil la platină, peritoneal primar sau cancer al trompelor uterine . J Clin Oncol 30 : 2039 – 2045 , 2012 . Text complet abstract / GRATUIT Google Scholar
  26.  
    1. Witteveen P ,
    2. Lortholary A ,
    3. Fehm T ,
    4. Poveda A ,
    5. Reuss A ,
    6. Havsteen H ,
    7. Raspagliesi F ,
    8. Vergote I ,
    9. Bamian A ,
    10. Pujade-Lauraine E
    Supraviețuirea generală finală rezultă din AURELIA, un studiu deschis, randomizat, de fază III, cu chimioterapie cu sau fără bevacizumab pentru cancerul ovarian recurent rezistent la platină . Congresul European al Cancerului (ECCO-ESMO-ESTRO) , rezumat 5 , 2013 . Google Scholar
  27.  
    1. Grothey A ,
    2. Sugrue MM ,
    3. Purdie DM ,
    4. Dong W ,
    5. Sargent D ,
    6. Hedrick E ,
    7. Kozloff M
    : Bevacizumab dincolo de prima progresie este asociat cu supraviețuirea generală prelungită în cancerul colorectal metastatic: rezultate dintr-un studiu observațional de cohortă (BRiTE) . J Clin Oncol 26 : 5326 – 5334 , 2008 . Text complet abstract / GRATUIT Google Scholar
  28.  
    1. Bennouna J ,
    2. Sastre J ,
    3. Arnold D ,
    4. Österlund P ,
    5. Greil R ,
    6. Van Cutsem E ,
    7. von Moos R ,
    8. Viéitez JM ,
    9. Bouché O ,
    10. Borg C ,
    11. Steffens CC ,
    12. Alonso-Orduña V ,
    13. Schlichting C ,
    14. Reyes-Rivera I ,
    15. Bendahmane B ,
    16. André T ,
    17. Kubicka S ,
    18. ML18147 Anchetatorii studiului
    : Continuarea bevacizumab după prima progresie în cancerul colorectal metastatic (ML18147): Un studiu randomizat de fază 3 . Lancet Oncol 14 : 29 – 37 , 2013 . CrossRef PubMed Google Scholar
  29.  
    1. Backes FJ ,
    2. Richardson DL ,
    3. McCann GA ,
    4. Smith B ,
    5. Salani R ,
    6. Eisenhauer EL ,
    7. Fowler JM ,
    8. Copeland LJ ,
    9. Cohn DE ,
    10. O’Malley DM
    : Ar trebui continuat bevacizumab după progresia tratamentului cu bevacizumab în cancerul ovarian recurent? Int J Gynecol Cancer 23 : 833 – 838 , 2013 . CrossRef PubMed Google Scholar
  30.  
    1. Ahmed N ,
    2. Abubaker K ,
    3. Findlay J ,
    4. Quinn M
    : Celule stem ovariene canceroase: ținte obscure pentru terapie, dar relevante pentru chimiorezistență . J Cell Biochem 114 : 21 – 34 , 2013 . CrossRef PubMed Google Scholar
  31.  
    1. Zhan Q ,
    2. Wang C ,
    3. Ngai S
    : Celulele stem ale cancerului ovarian: o nouă țintă pentru terapia cancerului . Biomed Res Int 2013 : 916819 , 2013 . Google Scholar
  32.  
    1. Comerciant AA ,
    2. Matsui W
    . Țintarea ariciului – o cale de celule stem de cancer . Clin Cancer Res 16 : 3130 – 3140 , 2010 . Text complet abstract / GRATUIT Google Scholar
  33.  
    1. Szotek PP ,
    2. Pieretti-Vanmarcke R ,
    3. Masiakos PT ,
    4. Dinulescu DM ,
    5. Connolly D ,
    6. Foster R ,
    7. Dombkowski D ,
    8. Preferă F ,
    9. Maclaughlin DT ,
    10. Donahoe PK
    : Populația laterală a cancerului ovarian definește celulele cu caracteristici asemănătoare celulelor stem și capacitatea de reacție a substanțelor care inhibă Mullerian . Proc Natl Acad Sci SUA 103 : 11154 – 11159 , 2006 . Text complet abstract / GRATUIT Google Scholar
    1. Bhattacharya R ,
    2. Kwon J ,
    3. Ali B ,
    4. Wang E ,
    5. Patra S ,
    6. Shridhar V ,
    7. Mukherjee P
    : Rolul semnalizării arici în cancerul ovarian . Clin Cancer Res 14 : 7659 – 7666 , 2008 . Text complet abstract / GRATUIT Google Scholar
  34.  
    1. Liao X ,
    2. Siu MK ,
    3. Au CW ,
    4. Wong ES ,
    5. Chan HY ,
    6. IP PP ,
    7. Ngan HY ,
    8. Cheung AN
    : Activarea aberantă a căii de semnalizare arici în cancerele ovariene: efect asupra prognosticului, invaziei și diferențierii celulare . Carcinogeneză 30 : 131 – 140 , 2009 . Text complet abstract / GRATUIT Google Scholar
  35.  
    1. Madden JI
    Rapoartele Infinity se actualizează din studiul de fază II al saridegib plus gemcitabină la pacienții cu cancer pancreatic metastatic [ Comunicat de presă Infinity Pharmaceuticals, Inc. ]. Luna ianuarie de 27 , 2012 . Disponibil la: http://phx.corporate-ir.net/phoenix.zhtml?c=121941&p=irol-newsArticle&ID=1653550&highlight . Accesat: 27 decembrie 2013 . Google Scholar
  36.  
    1. Catenacci TVP ,
    2. Bahary N ,
    3. Nattam S ,
    4. Marsh R ,
    5. Wallace JA ,
    6. Rajdev L ,
    7. Cohen DJ
    : Analiza finală a unui studiu de fază IB / fază II randomizată a gemcitabinei (G) plus placebo (P) sau vismodegib (V), un inhibitor al căii arici (Hh), la pacienții (puncte) cu cancer pancreatic metastatic (PC): A Studiul consorțiului de faza II a Universității din Chicago . J Clin Oncol ( supl 🙂 abstract 4012 , 2013 . Google Scholar
  37.  
    1. Kim J ,
    2. Aftab BT ,
    3. Tang JY ,
    4. Kim D ,
    5. Lee AH ,
    6. Rezaee M ,
    7. Kim J ,
    8. Chen B ,
    9. Regele EM ,
    10. Borodovsky A ,
    11. Riggins GJ ,
    12. Epstein EH Jr. . ,
    13. Beachy PA ,
    14. Rudin CM
    : Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți . Cancer Cell 23 : 23 – 34 , 2013 . CrossRef PubMed Google Scholar
  38.  
    1. Isoherranen N ,
    2. Kunze KL ,
    3. Allen KE ,
    4. Nelson WL ,
    5. Thummel KE
    : Rolul metaboliților itraconazol în inhibarea CYP3A4 . Drug Metab Dispos 32 : 1121 – 1131 , 2004 . Text complet abstract / GRATUIT Google Scholar
  39.  
    1. Marr KA ,
    2. Crippa F ,
    3. Leisenring W ,
    4. Hoyle M ,
    5. Boeckh M ,
    6. Balajee SA ,
    7. Nichols WG ,
    8. Musher B ,
    9. Corey L
    : Itraconazol versus fluconazol pentru prevenirea infecțiilor fungice la pacienții cărora li s-au efectuat transplanturi de celule stem alogene . Blood 103 : 1527 – 1533 , 2004 . Text complet abstract / GRATUIT Google Scholar
  40.  
    1. Maertens J ,
    2. Marchetti O ,
    3. Herbrecht R ,
    4. Cornely OA ,
    5. Flückiger U ,
    6. Frêre P ,
    7. Gachot B ,
    8. Heinz WJ ,
    9. Lass-Flörl C ,
    10. Ribaud P ,
    11. Thiebaut A ,
    12. Cordonnier C ,
    13. A treia conferință europeană privind infecțiile în leucemie
    : Liniile directoare europene pentru managementul antifungic în leucemie și beneficiarii de transplant de celule stem hematopoietice: rezumat al actualizării ECIL 3–2009 . Transplant de măduvă osoasă 46 : 709 – 718 , 2011 . CrossRef PubMed Google Scholar

Chimioterapie combinată cu Itraconazol pentru tratarea cancerului pancreatic metastatic în a doua linie sau în setarea suplimentară

HIROSHI TSUBAMOTO , TAKASHI SONODA , SHINICHI IKUTA , SATOSHI TANI , KAYO INOUE și NAOKI YAMANAKACercetare anticancer iulie 2015, 35 (7) 4191-4196;

Abstract

Context: Am evaluat chimioterapia cu itraconazol (un agent anti-fungic comun care este un inhibitor puternic al căii Hedgehog, glicoproteinei P și angiogenezei) pentru tratarea cancerului pancreatic progresiv. Pacienți și metode: Am analizat retrospectiv diagramele medicale ale pacienților cu cancer pancreatic diagnosticat histologic care au primit chimioterapie de linia I sau a doua și chimioterapie ulterioară cu itraconazol.

Rezultate: Un total de 38 de pacienți au primit docetaxel (35 mg / m 2 ), gemcitabina (1000 mg / m 2) și carboplatină (zona de sub curbă, 4 mg / min / ml) în ziua 1 și soluție orală de itraconazol (400 mg) în zilele −2 până la 2, repetată la fiecare 2 săptămâni

Au fost observate un răspuns complet și 13 răspunsuri parțiale, pentru o rată de răspuns de 37%. Opt (21%) pacienți au prezentat neutropenie febrilă. Supraviețuirea globală mediană a fost de 11,4 luni (interval de încredere de 95% = 8,5-21,2 luni). 

Concluzie: chimioterapia combinată cu itraconazol este promițătoare pentru prelungirea supraviețuirii globale, cu toxicități acceptabile în setarea a doua linie a cancerului pancreatic.

Conform statisticilor globale privind cancerul din 2012, incidența și mortalitatea estimate de cancer pancreatic (PC) au fost de 338.000 și, respectiv, 330.000 de persoane pe an ( 1 ). Majoritatea pacienților au fost diagnosticați cu PC în stadiu avansat, iar rata de supraviețuire globală (OS) pe 5 ani în Japonia a fost de doar 7% ( 2 ). Pentru chimioterapia de primă linie a PC avansat local, două studii randomizate de fază III au stabilit regimurile standard de FOLFIRINOX [5-fluorouracil (5-FU), leucovorină, irinotecan și oxaliplatină] și gemcitabină plus nab-paclitaxel ( 3 – 5); cu toate acestea, nu există un standard de îngrijire pentru pacienții a căror boală a progresat în timpul sau după chimioterapia de primă linie. Doar jumătate dintre pacienți primesc chimioterapie de linia a doua din cauza deteriorării stării lor generale, iar OS median al pacienților care au primit tratament de linia a doua este de numai 6 luni conform unui studiu clinic ( 6 ). Prin urmare, este necesară o nouă abordare a citotoxicii și a terapiei țintite.

Itraconazolul, un agent antifungic obișnuit, este un inhibitor puternic al glicoproteinei P (P-gp; caseta de legare a ATP sub-familia B membru 1, rezistență multiplă la medicamente 1), care joacă un rol critic în chimiorezistență ( 7 , 8 ). Itraconazolul inhibă, de asemenea, semnalele angiogenezei și ariciului în celulele stem canceroase (CSC) ( 9 , 10 ). Din 2008, tratăm pacienții cu PC utilizând chimioterapie combinată cu itraconazol și raportăm asupra studiului nostru explorator retrospectiv, care a avut ca scop evaluarea eficacității itraconazolului în setarea de linia a doua a PC.

Pacienți și metode

Am analizat retrospectiv înregistrările medicale ale pacienților cu PC confirmată histologic care au avut un istoric de progresie în timpul sau după chimioterapia anterioară; ulterior, au primit chimioterapie în asociere cu itraconazol la spitalul nostru. Toți pacienții au fost direcționați la instituția noastră de la spitalele terțiare după ce PC a progresat în timpul sau după chimioterapia de primă linie. Între ianuarie 2008 și aprilie 2013, 38 de pacienți cu PC recurent au fost tratați concomitent cu chimioterapie și itraconazol. Toți pacienții au acordat consimțământul scris în scris, iar protocolul de tratament a fost aprobat de Consiliul de revizuire instituțională (nr. IRB: 2007-0302).

Protocol de tratament . Un regim citotoxic format din docetaxel, gemcitabină și carboplatină (DGC) a fost administrat în combinație cu itraconazol ( 11 ). În ziua 1, doza inițială de administrare intravenoasă DGC au fost de 35 mg / m 2 , 1000 mg / m 2 și 4 mg / min / ml (aria de sub curbă), respectiv. O soluție orală de itraconazol a fost administrată la o doză zilnică de 400 mg (zile -2 până la 2). Acest regim a fost repetat la fiecare 2 săptămâni. O modificare a dozei în ciclul ulterior a fost considerată pentru a menține numărul minim de celule albe din sânge (WBC) și număr de trombocite ale pacienților în intervalele 1.000-1.500 / mm 3 și , respectiv, 30.000-50.000 / mm 3 . Când WBC conta nadir a fost <1.000 / mm 3, Doza de docetaxel a fost redusă cu 5 mg / m 2 . Pentru un număr de leucocite de nadir ≥1,500 / mm 3 , doza de docetaxel a fost crescută cu 5 mg / m 2 . Când numărul de trombocite nadir a fost <50000 / mm 3 în timpul unui ciclu, doza carboplatin în ciclul următor a fost redus cu 10%. Pentru un număr de trombocite de ≥50,000 nadir / mm 3 , doza de carboplatină a fost crescută cu 10%. Dozele de gemcitabină și itraconazol (Janssen Pharmaceutical KK, Tokyo, Japonia) au fost fixate. Factorul de stimulare a coloniilor de granulocite (G-CSF) a fost administrat în conformitate cu recomandările producătorului pe eticheta medicamentului până când s-a recuperat numărul de globule neutre și globule neutre.

Tabelul I.

Caracteristicile pacienților (N = 38).

Tabelul II.

Răspunsul tumorii la docetaxel, gemcitabină și carboplatină (DGC) plus itraconazol. Răspunsul a fost înregistrat în timpul chimioterapiei combinate (DGC plus itraconazol) care a fost repetat la fiecare 14 zile. Numărul mediu de cicluri a fost de 6 (interval = 3-11 cicluri).

Regimul a continuat până la progresia bolii sau până când au fost utilizate alte regimuri citotoxice cu itraconazol pentru a preveni neuropatia periferică indusă de chimioterapie. Numărul mediu de cicluri de DGC plus itraconazol a fost de 6 (interval = 3-11 cicluri). Toți cei 30 de pacienți care au avut un răspuns complet sau parțial sau care au obținut o boală stabilă în timpul administrării DGC plus itraconazol au primit o chimioterapie ulterioară pe bază de irinotecan în combinație cu itraconazol.

Eficacitatea a fost evaluată în conformitate cu criteriile de evaluare a răspunsului în tumorile solide (RECIST), versiunea 1.1. Supraviețuirea globală (OS) a fost definită ca timpul de la prima administrare de itraconazol până la deces. Evenimentele adverse din timpul regimului DGC plus itraconazol au fost clasificate în conformitate cu criteriile de toxicitate comune ale Institutului Național al Cancerului (NCI-CTC), versiunea 4.0.

Analizele statistice au fost efectuate pe distribuțiile observate ale SO utilizând metoda Kaplan-Meier. Toate analizele au fost efectuate folosind XLSTAT 2014 (Addinsoft, Paris, Franța).

Rezultate

Caracteristicile pacienților. Conform criteriilor RECIST 1.1, toți pacienții au avut metastaze la distanță, iar 25 (66%) pacienți au avut metastaze cu mai multe organe. Douăzeci și patru (63%) de pacienți au suferit anterior mai mult de două regimuri de chimioterapie. Pacienților și caracteristicile bolii sunt prezentate pe scurt în tabelul I .

Eficacitatea chimioterapiei combinate cu itraconazol. În timpul tratamentului cu DGC plus itraconazol, s-au observat un răspuns complet și 13 răspunsuri parțiale la pacienții eligibili ( Tabelul II ), obținându-se o rată de răspuns la chimioterapie de 37% [95% interval de încredere (IC) = 48-78%). După întreruperea DGC plus itraconazol, itraconazolul a fost administrat în asociere cu alți agenți citotoxici. Au fost observate trei răspunsuri complete și 15 parțiale în timpul celor două regimuri consecutive de DGC și chimioterapie pe bază de irinotecan în combinație cu itraconazol. Rata de răspuns a fost de 47% (IC 95% = 31-63%) ( Tabelul III). După inducerea chimioterapiei combinate cu itraconazol, patru pacienți au suferit o intervenție chirurgicală primară, unul a suferit o intervenție chirurgicală secundară de dezamăgire și cinci au fost supuși unei radioterapii. OS median a fost de 11,4 luni (IC 95% = 8,5-21,2 luni), cu date despre șapte pacienți cenzurați ( Figura 1 ). Dintre șase pacienți care au supraviețuit mai mult de 3 ani, cinci au avut ficat și alte metastaze. Un pacient a avut diseminare peritoneală cu ascită masivă în plus față de metastaze ovariene și ganglionare. Trei pacienți au suferit o intervenție chirurgicală primară, în timp ce ceilalți trei au fost supuși radioterapiei după chimioterapie cu itraconazol.

Figura 1.

Figura 1.

Analiza Kaplan – Meier a supraviețuirii globale după chimioterapie cu itraconazol (n = 38). Supraviețuirea globală mediană este de 11,4 luni (interval de încredere de 95% = 8,5-21,2 luni; curbe punctate).

Toxicități . În timpul administrării unui total de 233 de cicluri ale regimului DGC-plus-itraconazol, toți cei 38 de pacienți au primit G-CSF. Douăzeci și trei (61%) de pacienți au avut neutropenie de gradul 4, iar șapte (18%) au avut trombocitopenie de gradul 4. Opt (21%) pacienți au prezentat neutropenie febrilă, iar numărul lor absolut de neutrofile s-a recuperat după 7 zile. Douăzeci și trei (61%) de pacienți au necesitat transfuzie de globule roșii la pachet atunci când nivelul lor de hemoglobină a scăzut la <8,0 g / dl. Niciun pacient nu a necesitat transfuzie de trombocite.

Niveluri crescute de alanină aminotransferază (gradul 3 sau mai mult) au fost observate la trei pacienți (8%). Creșterea nivelului de bilirubină din sânge înainte de prima administrare de itraconazol a fost observată la șase pacienți (16%), la care nivelurile ≥2,0 până la <3,0 și 3,0 sau de mai multe ori limita superioară normală au fost observate la trei (8%) și trei ( 8%) pacienți, respectiv. Cu toate acestea, nivelurile crescute de bilirubină din sânge nu au fost observate la niciunul dintre cei 38 de pacienți înrolați în timpul administrării regimului DGC-plus-itraconazol. Nu s-a observat creșterea creatininei serice (gradul 2 sau mai mult). În plus, nu au existat decese legate de tratament în timpul regimului DGC-plus-itraconazol sau al regimurilor ulterioare pe bază de irinotecan cu itraconazol.

Tabelul III.

Răspunsul tumorii la docetaxel, gemcitabină și carboplatină (DGC) plus itraconazol urmat de alte regimuri cu itraconazol. Treizeci și cinci de pacienți au primit chimioterapie pe bază de irinotecan în asociere cu itraconazol după DGC plus itraconazol.

Discuţie

Aici am demonstrat că administrarea chimioterapiei combinate cu itraconazol a fost sigură și eficientă pentru tratarea pacienților cu PC metastatic refractar. În timpul celor două regimuri consecutive care conțin itraconazol, 47% dintre pacienți au prezentat un răspuns. Supraviețuirea globală mediană a fost de 11,4 luni (IC 95% = 8,5-21,2 luni), ceea ce a fost favorabil comparativ cu cel al unui control istoric ( 12 ).

Conceptul de adăugare a itraconazolului la chimioterapia citotoxică s-a bazat în principal pe rapoartele anterioare care indicau că itraconazolul a îmbunătățit efectul taxanilor prin inhibarea P-gp ( 7 , 8 ). În 2007, potențialul itraconazolului pentru inhibarea angiogenezei a fost raportat de un grup de la John Hopkins Medical School ( 9 ). Aceștia au identificat itraconazolul ca un potențial medicament anticancer între mai mult de 3.000 de medicamente aprobate de Administrația SUA pentru Alimente și Medicamente care au fost testate. În 2010, Kim și colab. a raportat că itraconazolul a inhibat calea de semnalizare Hedgehog în CSC și în creșterea cancerului ( 10 ). Din 2013, mai multe studii au raportat beneficiile clinice ale itraconazolului ( 11 ,13 – 15 ). Sistemul de operare îmbunătățit prin adăugarea de itraconazol la agenții citotoxici a fost raportat într-un studiu prospectiv randomizat de fază II privind tratamentul de linia a doua a cancerului pulmonar cu celule mici și într-o analiză retrospectivă multivariată a cancerului ovarian refractar; raporturile de pericol respective au fost 0,19 ( p = 0,012) și 0,27 ( p = 0,006), respectiv ( 16 , 17 ).

După expunerea la agenți citotoxici, tumorile reziduale se caracterizează prin caracteristici ale CSC ( 18 ). Celulele pancreatice rezistente la gemcitabină exprimă niveluri ridicate de markeri CSC pancreatici, iar tumorile reziduale bogate în CSC pretratate cu gemcitabină exprimă semnificativ P-gp comparativ cu alți transportori de casete care leagă ATP ( 19 , 20 ). Itraconazolul are cea mai mare afinitate în rândul agenților anti-fungici care servesc ca substraturi pentru P-gp ( 21 ). Docetaxel ca agent unic are o activitate antitumorală modestă în PC ( 22 ). Rezistența celulelor canceroase sau CSC pretratate la docetaxel poate fi inversată cu tratamentul cu itraconazol ( 7 , 23). Gemcitabina și platina au un efect sinergic cu docetaxel și au fost administrate în mai multe studii clinice ( 24 , 25 ).

Calea de semnalizare Hedgehog joacă un rol cheie în embriogeneză și este reactivată în diferite tipuri de cancer ( 26 ). Proteinele patch-uri și netezite, membre ale căii de semnalizare Hedgehog, au fost detectate la aproximativ 70% din probele umane de PC ( 27 ). CSC pancreatice prezintă reglarea în sus a căii sonice Hedgehog ( 28 ). Inhibarea semnalizării Hedgehog de către ciclopamină reduce auto-reînnoirea CSC pancreatice și inversează chimiorezistența ( 29 ). Tratamentul combinat cu ciclopamină și gemcitabină a avut un efect sinergic asupra creșterii tumorii la un model de xenogrefă ( 30 , 31). Micromediul PC are o stromă abundentă, iar calea Hedgehog este foarte activă într-un mod paracrin. Inhibitorul de semnal Hedgehog, AZD8542, a inhibat creșterea tumorii și metastazele prin afectarea micromediului înconjurător într-un model de șoarece ( 32 ).

Vismodegib este primul și singurul inhibitor oral al căii de semnalizare Hedgehog; este aprobat de Food and Drug Administration din Statele Unite pentru tratamentul carcinomului bazocelular. Un studiu randomizat de fază II pe pacienți cu PC netratat a demonstrat că o combinație de vismodegib și gemcitabină a dat o rată de răspuns de 8%, cu o supraviețuire mediană fără progresie și OS de 4,0 luni și respectiv 6,9 luni. Beneficiul clinic al adăugării de vismodegib nu a fost prezentat, deși s-a observat o încrucișare de 42% dintre pacienții din brațul gemcitabină-plus-placebo ( 33). O analiză intermediară recentă a unui studiu de fază II cu un singur braț la pacienții cu PC netratat a demonstrat că vismodegib în combinație cu gemcitabină plus nab-paclitaxel a dus la o rată de răspuns de 43% cu o supraviețuire mediană fără progresie și OS de 5,5 luni și 10 luni, respectiv. Evenimentele adverse au inclus 37,5% cu neutropenie de gradul 3 sau mai rău și 7% cu neutropenie febrilă ( 34 ). Atunci când se compară eficacitatea cu cea a gemcitabinei plus nab-paclitaxel într-un studiu randomizat de fază III ( 5 ), adăugarea de vismodegib la gemcitabină plus nab-paclitaxel poate fi eficientă. Într-un studiu clinic pentru tratamentul carcinomului bazocelular, Kim și colab.a raportat că singurul itraconazol a inhibat proliferarea celulară, expresia activității căii Hedgehog și dimensiunea tumorii. Cu toate acestea, la pacienții cu antecedente de tratament cu vismodegib nu au existat modificări semnificative în proliferare sau în dimensiunea tumorii ( 14 ), chiar dacă itraconazolul inhibă calea de semnalizare Hedgehog printr-un mecanism distinct de cel al vismodegib ( 35 ).

O expresie crescută a factorului de creștere endotelial vascular și a receptorilor săi au fost demonstrate în PC ( 36 ); cu toate acestea, anticorpul său bevacizumab, singur sau în combinație cu gemcitabină sau erlotinib, a fost ineficient în studiile clinice ( 37 , 38 ). Prin urmare, inhibarea potențială a angiogenezei poate avea un impact mai mic asupra constatărilor prezente decât blocarea semnalizării P-gp și Hedgehog de către itraconazol.

În cadrul celei de-a doua linii pentru pacienții pre-tratați cu gemcitabină, studiile de fază II au arătat promisiunea regimurilor de FOLFOX-4 (5-FU, leucovorină și oxaliplatină) și nab-paclitaxel cu un singur agent. OS median raportat a fost de 7,8 luni și respectiv 7,3 luni ( 12 , 39 ). Studiul actual a demonstrat un SO median de 11,4 luni și un IC 95% de 8,5-21,2 luni. Treizeci și cinci (92%) de pacienți au primit DGC plus itraconazol urmat de un regim pe bază de irinotecan cu itraconazol. Este probabil ca Itraconazolul să aibă o eficacitate îmbunătățită pentru chimioterapia citotoxică.

Pacienții înscriși în acest studiu au fost trimiși cu toții după ce au urmat chimioterapie de primă sau a doua linie la spitalele terțiare anterioare. S-a pus o întrebare dacă comportamentul biologic al tumorii la pacienții înrolați era diferit de cel din studiile istorice și dacă tumorile aveau o natură indolentă. Intervalul de pre-tratament (PTI) a fost calculat de la prima dată a tratamentului inițial până la prima dată a DGC plus itraconazol. Am evaluat corelația dintre PTI și eficacitatea DGC plus itraconazol. Nici rata de răspuns, nici sistemul de operare după DGC plus itraconazolul nu au fost asociate cu PTI (datele nu sunt prezentate).

Prezentul nostru studiu are unele limitări din cauza dimensiunii eșantionului și a naturii sale de observație. În plus, datele au fost reunite retrospectiv. Modificarea dozei a fost complicată și a fost solicitată pentru o monitorizare atentă. Toți pacienții au primit G-CSF și 23 (61%) pacienți au suferit transfuzii de globule roșii la pachet; cu toate acestea, niciun pacient nu a suferit transfuzie de trombocite. Răspunsul ridicat observat în acest studiu poate fi rezultatul utilizării unor agenți citotoxici triplu. Regimurile citotoxice în asociere cu itraconazol trebuie studiate în continuare în ceea ce privește eficacitatea, toxicitățile și conformitatea acestora pentru practica zilnică. Pe baza rezultatelor promițătoare ale DGC plus itraconazol la pacienții cu cancer refractar de sân sau ovarian ( 11 , 15 , 17), am lansat un studiu de fază II a unui regim constând din docetaxel, gemcitabină și itraconazol, cu modificarea simplă a dozei și continuarea până la progresia bolii pentru malignitate ginecologică (UMIN000013951). Pentru tratamentul PC, docetaxel poate fi înlocuit cu nab-paclitaxel ( 40 ). Constatările acestui studiu sunt încurajatoare pentru pacienții cu PC avansat sau refractar, deoarece aceștia pot profita de eficacitatea și toxicitatea limitată a itraconazolului. Mai mult, itraconazolul nu este un medicament scump; prin urmare, ar fi accesibil pacienților din țările mai puțin dezvoltate și ar putea reduce și costurile medicale din țările dezvoltate.

Note de subsol

  • Conflicte de interesAutorii declară că nu există conflicte financiare de interes cu privire la acest studiu.
  • Primit pe 10 aprilie 2015.
  • Revizuirea a primit 1 mai 2015.
  • Acceptat pe 4 mai 2015.
  • Copyright © 2015 Institutul Internațional de Cercetare Anticancer (Dr. John G. Delinassios), Toate drepturile rezervate

Referințe

  1.  
    1. GLOBOCAN 2012
    Incidența, mortalitatea și prevalența cancerului estimată la nivel mondial în 2012 . Lyon, Franța : Organizația Mondială a Sănătății, Agenția Internațională pentru Cercetarea Cancerului ; 2013 . Actualizat noiembrie , 2013 . http://globocan.iarc.fr/Default.aspx Google Scholar
  2.  
    1. Ministerul Sănătății, Muncii și Asistenței Sociale din Japonia
    ( 2012 ) Rezultatul investigației statistice . http://www.mhlw.go.jp/toukei/saikin/hw/jinkou/kakutei12/index.html (în japoneză). Ultima accesare la 27 noiembrie 2014 . Google Scholar
  3.  
    1. Conroy T ,
    2. Desseigne F ,
    3. Ychou M ,
    4. Bouché O ,
    5. Guimbaud R ,
    6. Bécouarn Y ,
    7. Adenis A ,
    8. Raoul JL ,
    9. Gourgou-Bourgade S ,
    10. de la Fouchardière C ,
    11. Bennouna J ,
    12. Bachet JB ,
    13. Khemissa-Akouz F ,
    14. Péré-Vergé D ,
    15. Delbaldo C ,
    16. Assenat E ,
    17. Chauffert B ,
    18. Michel P ,
    19. Montoto-Grillot C ,
    20. Ducreux M ,
    21. Groupe Tumeurs Digestives of Unicancer ,
    22. PRODIGE Intergrup
    : FOLFIRINOX versus gemcitabină pentru cancerul pancreatic metastatic . N Engl J Med 364 : 1817 – 1825 , 2011 . CrossRef PubMed Google Scholar
    1. Gourgou-Bourgade S ,
    2. Bascoul-Mollevi C ,
    3. Desseigne F ,
    4. Ychou M ,
    5. Bouché O ,
    6. Guimbaud R ,
    7. Bécouarn Y ,
    8. Adenis A ,
    9. Raoul JL ,
    10. Boige V ,
    11. Bérille J ,
    12. Conroy T
    : Impactul FOLFIRINOX comparativ cu gemcitabina asupra calității vieții la pacienții cu cancer pancreatic metastatic: rezultate din studiul randomizat PRODIGE 4 / ACCORD 11 . J Clin Oncol 31 : 23 – 29 , 2013 . Text complet abstract / GRATUIT Google Scholar
  4.  
    1. Von Hoff DD ,
    2. Ervin T ,
    3. Arena FP ,
    4. Chiorean EG ,
    5. Copilul J ,
    6. Moore M ,
    7. Seay T ,
    8. Tjulandin SA ,
    9. Ma WW ,
    10. Saleh MN ,
    11. Harris M ,
    12. Reni M ,
    13. Dowden S ,
    14. Laheru D ,
    15. Bahary N ,
    16. Ramanathan RK ,
    17. Tabernero J ,
    18. Hidalgo M ,
    19. Goldstein D ,
    20. Van Cutsem E ,
    21. Wei X ,
    22. Iglesias J ,
    23. Renschler MF
    : Supraviețuire crescută în cancerul pancreatic cu nab-paclitaxel plus gemcitabină . N Engl J Med 369 : 1691 – 1703 , 2013 . CrossRef PubMed Google Scholar
  5.  
    1. Rahma OE ,
    2. Duffy A ,
    3. DJ Liewehr ,
    4. Steinberg SM ,
    5. Greten TF
    : Tratamentul de a doua linie în cancerul pancreatic avansat: o analiză cuprinzătoare a studiilor clinice publicate . Ann Oncol 24 : 1972 – 1979 , 2013 . Text complet abstract / GRATUIT Google Scholar
  6.  
    1. Shirakawa K ,
    2. Takara K ,
    3. Tanigawara Y ,
    4. Aoyama N ,
    5. Kasuga M ,
    6. Komada F ,
    7. Sakaeda T ,
    8. Okumura K
    : Interacțiunea docetaxelului („Taxotere”) cu glicoproteina P umană . Jpn J Cancer Res 90 : 1380 – 1386 , 1999 . CrossRef Google Scholar
  7.  
    1. Takara K ,
    2. Tanigawara Y ,
    3. Komada F ,
    4. Nishiguchi K ,
    5. Sakaeda T ,
    6. Okumura K
    : Aspecte farmacocinetice celulare ale efectului de inversare a itraconazolului asupra rezistenței de medicamente anticanceroase P-glicoproteina-mediată . Biol Pharm Bull 22 : 1355 – 1359 , 1999 . PubMed Google Scholar
  8.  
    1. Chong CR ,
    2. Xu J ,
    3. Lu J ,
    4. Bhat S ,
    5. Sullivan DJ Jr. . ,
    6. Liu JO
    : Inhibarea angiogenezei de către medicamentul antifungic itraconazol . ACS Chem Biol 2 : 263 – 270 , 2007 . CrossRef PubMed Google Scholar
  9.  
    1. Kim J ,
    2. Tang JY ,
    3. Gong R ,
    4. Kim J ,
    5. Lee JJ ,
    6. Clemons KV ,
    7. Chong CR ,
    8. Chang KS ,
    9. Fereshteh M ,
    10. Gardner D ,
    11. Reya T ,
    12. Liu JO ,
    13. Epstein EH ,
    14. Stevens DA ,
    15. Beachy PA
    : Itraconazol, un antifungic utilizat în mod obișnuit, care inhibă activitatea căii arici și creșterea cancerului . Cancer Cell 17 : 388 – 399 , 2010 . CrossRef PubMed Google Scholar
  10.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii la pacienții cu carcinom ovarian clar sau recidivant . Anticancer Res 34 : 2007 – 2014 , 2014 . Text complet abstract / GRATUIT Google Scholar
  11.  
    1. Chung JW ,
    2. Jang HW ,
    3. Chung MJ ,
    4. Park JY ,
    5. Park SW ,
    6. Chung JB ,
    7. Cântecul SY ,
    8. Bang S
    : FOLFOX4 ca chimioterapie de salvare pentru cancerul pancreatic refractar la gemcitabină . Hepatogastroenterologie 60 : 363 – 367 , 2013 . PubMed Google Scholar
  12.  
    1. Antonarakis ES ,
    2. Heath EI ,
    3. Smith DC ,
    4. Rathkopf D ,
    5. Blackford AL ,
    6. Danila DC ,
    7. Regele S ,
    8. Frost A ,
    9. Ajiboye AS ,
    10. Zhao M ,
    11. Mendonca J ,
    12. Kachhap SK ,
    13. Rudek MA ,
    14. Carducci MA
    : Refacerea itraconazolului ca tratament pentru cancerul de prostată avansat: un studiu de fază II randomizat necomparativ la bărbații cu cancer de prostată metastatic rezistent la castrare . Oncolog 18 : 163 – 173 , 2013 . Text complet abstract / GRATUIT Google Scholar
  13.  
    1. Kim DJ ,
    2. Kim J ,
    3. Spaunhurst K ,
    4. Montoya J ,
    5. Khodosh R ,
    6. Chandra K ,
    7. Fu T ,
    8. Gilliam A ,
    9. Molgo M ,
    10. Beachy PA ,
    11. Tang JY
    : Studiu deschis, explorator, de fază II, a itraconazolului oral pentru tratamentul carcinomului bazocelular . J Clin Oncol 32 : 745 – 751 , 2014 . Text complet abstract / GRATUIT Google Scholar
  14.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Inoue K
    : Impactul itraconazolului asupra supraviețuirii pacienților puternic pre-tratați cu cancer de sân triple-negativ . Anticancer Res 34 : 3839 – 3844 , 2014 . Text complet abstract / GRATUIT Google Scholar
  15.  
    1. Rudin CM ,
    2. Brahmer JR ,
    3. Juergens RA ,
    4. Hann CL ,
    5. Ettinger DS ,
    6. Sebree R ,
    7. Smith R ,
    8. Aftab BT ,
    9. Huang P ,
    10. Liu JO
    : Studiu de faza II a pemetrexedului și a itraconazolului ca terapie de linia a doua pentru cancerul pulmonar non-scuamos metastazat cu celule mici . J Thorac Oncol 8 : 619 – 623 , 2013 . PubMed Google Scholar
  16.  
    1. Tsubamoto H ,
    2. Sonoda T ,
    3. Yamasaki M ,
    4. Inoue K
    : Impactul chimioterapiei combinate cu itraconazol asupra supraviețuirii pacienților cu cancer ovarian refractar . Anticancer Res 34 : 2481 – 2487 , 2014 . Text complet abstract / GRATUIT Google Scholar
  17.  
    1. Zhou BB ,
    2. Zhang H ,
    3. Damelin M ,
    4. Geles KG ,
    5. Grindley JC ,
    6. Dirks PB
    : Celule care inițiază tumorile: provocări și oportunități pentru descoperirea medicamentelor împotriva cancerului . Nat Rev Drug Discov 8 : 806 – 823 , 2009 . CrossRef PubMed Google Scholar
  18.  
    1. Hong SP ,
    2. Wen J ,
    3. Bang S ,
    4. Parcul S ,
    5. Cântecul SY
    : Celulele CD44-pozitive sunt responsabile pentru rezistența la gemcitabină în celulele cancerului pancreatic . Int J Cancer 125 : 2323 – 2331 , 2009 . CrossRef PubMed Google Scholar
  19.  
    1. Yao J ,
    2. Un Y ,
    3. Wie JS ,
    4. Ji ZL ,
    5. Lu ZP ,
    6. Wu JL ,
    7. Jiang KR ,
    8. Chen P ,
    9. Xu ZK ,
    10. Miao Y
    : Ciclopamina revine la chimiorezistență dobândită și reglează în jos markerii celulelor stem canceroase în liniile celulare ale cancerului pancreatic . Swiss Med Wkly 141 : w13208 . doi: 10.4414 / smw.2011.13208 , 2011 . PubMed Google Scholar
  20.  
    1. Kethireddy S ,
    2. Anzi D
    : Farmacocinetica SNC a agenților antifungici . Expert Opin Drug Metab Toxicol 3 : 573 – 581 , 2007 . CrossRef PubMed Google Scholar
  21.  
    1. Belli C ,
    2. Cereda S ,
    3. Reni M
    . Rolul taxanilor în cancerul pancreatic . World J Gastroenterol 18 : 4457 – 4465 , 2012 . PubMed Google Scholar
  22.  
    1. Iida N ,
    2. Takara K ,
    3. Ohmoto N ,
    4. Nakamura T ,
    5. Kimura T ,
    6. Wada A ,
    7. Hirai M ,
    8. Sakaeda T ,
    9. Okumura K
    : Efectele de inversare a medicamentelor antifungice asupra rezistenței multidrog în celulele HeLa care supraexprimă MDR1 . Biol Pharm Bull 24 : 1032 – 1036 , 2001 . CrossRef PubMed Google Scholar
  23.  
    1. Lutz MP ,
    2. Van Cutsem E ,
    3. Wagener T ,
    4. Van Laethem JL ,
    5. Vanhoefer U ,
    6. Wils JA ,
    7. Gamelin E ,
    8. Koehne CH ,
    9. Arnaud JP ,
    10. Mitry E ,
    11. Husseini F ,
    12. Reichardt P ,
    13. El-Serafi M ,
    14. Etienne PL ,
    15. Lingenfelser T ,
    16. Praet M ,
    17. Genicot B ,
    18. Debois M ,
    19. Nordlinger B ,
    20. MP Ducreux ,
    21. Organizația Europeană pentru Cercetarea și Tratamentul Cancerului Grupul Gastrointestinal
    : Docetaxel plus gemcitabină sau docetaxel plus cisplatină în carcinomul pancreatic avansat: studiu randomizat de fază II 40984 al Organizației Europene pentru Cercetarea și Tratamentul Cancerului Grupul Gastrointestinal . J Clin Oncol 23 : 9250 – 9256 , 2005 . Text complet abstract / GRATUIT Google Scholar
  24.  
    1. Xiros N ,
    2. Papacostas P ,
    3. Economopoulos T ,
    4. Samelis G ,
    5. Efstathiou E ,
    6. Kastrita E ,
    7. Kalofonos H ,
    8. Onyenadum A ,
    9. Skarlos D ,
    10. Bamias A ,
    11. Gogas H ,
    12. Bafaloukos D ,
    13. Samantas E ,
    14. Kosmidis P
    : Carboplatină plus gemcitabină la pacienții cu cancer pancreatic inoperabil sau metastatic: un studiu multicentric de fază II de către Hellenic Cooperative Oncology Group . Ann Oncol 16 : 773 – 779 , 2005 . Text complet abstract / GRATUIT Google Scholar
  25.  
    1. Berman DM ,
    2. Karhadkar SS ,
    3. Maitra A ,
    4. Montes De Oca R ,
    5. Gerstenblith MR ,
    6. Briggs K ,
    7. Parker AR ,
    8. Shimada Y ,
    9. Eshleman JR ,
    10. Watkins DN ,
    11. Plajos PA
    : Cerință răspândită pentru stimularea ligandului Hedgehog în creșterea tumorilor tractului digestiv . Nature 425 ( 6960 ): 846 – 851 , 2003 . CrossRef PubMed Google Scholar
  26.  
    1. Thayer SP ,
    2. di Magliano MP ,
    3. Heiser PW ,
    4. Nielsen CM ,
    5. Roberts DJ ,
    6. Lauwers GY ,
    7. Qi YP ,
    8. Gysin S ,
    9. Fernández-del Castillo C ,
    10. Yajnik V ,
    11. Antoniu B ,
    12. McMahon M ,
    13. Warshaw AL ,
    14. Hebrok M
    : Hedgehog este un mediator timpuriu și târziu al tumorigenezei cancerului pancreatic . Nature 425 ( 6960 ): 851 – 856 , 2003 . CrossRef PubMed Google Scholar
  27.  
    1. Li C ,
    2. Heidt DG ,
    3. Dalerba P ,
    4. Burant CF ,
    5. Zhang L ,
    6. Adsay V ,
    7. Wicha M ,
    8. Clarke MF ,
    9. Simeone DM
    : Identificarea celulelor stem ale cancerului pancreatic . Cancer Res 67 : 1030 – 1037 , 2007 . Text complet abstract / GRATUIT Google Scholar
  28.  
    1. Huang FT ,
    2. Zhuan-Sun YX ,
    3. Zhuang YY ,
    4. Wei SL ,
    5. Tang J ,
    6. Chen WB ,
    7. Zhang SN
    : Inhibarea semnalizării arici deprimă auto-reînnoirea celulelor stem ale cancerului pancreatic și inversează chimiorezistența . Int J Oncol 41 : 1707 – 1714 , 2012 . PubMed Google Scholar
  29.  
    1. Jimeno A ,
    2. Feldmann G ,
    3. Suárez-Gauthier A ,
    4. Rasheed Z ,
    5. Solomon A ,
    6. Zou GM ,
    7. Rubio-Viqueira B ,
    8. García-García E ,
    9. López-Ríos F ,
    10. Matsui W ,
    11. Maitra A ,
    12. Hidalgo M
    : Un model direct de xenogrefă a cancerului pancreatic ca platformă pentru dezvoltarea terapeutică a celulelor stem canceroase . Mol Cancer Ther 8 : 310 – 314 , 2009 . Text complet abstract / GRATUIT Google Scholar
  30.  
    1. Bahra M ,
    2. Kamphues C ,
    3. Boas-Knoop S ,
    4. Lippert S ,
    5. Esendik U ,
    6. Schüller U ,
    7. Hartmann W ,
    8. Waha A ,
    9. Neuhaus P ,
    10. Heppner F ,
    11. Pietsch T ,
    12. Koch A
    : Combinarea blocajului de semnalizare arici și chimioterapie duce la reducerea tumorii în adenocarcinoamele pancreatice . Pancreas 41 : 222 – 229 , 2012 . PubMed Google Scholar
  31.  
    1. Hwang RF ,
    2. Moore TT ,
    3. Hattersley MM ,
    4. Scarpitti M ,
    5. Yang B ,
    6. Devereaux E ,
    7. Ramachandran V ,
    8. Arumugam T ,
    9. Ji B ,
    10. CD-ul Logsdon ,
    11. Brown JL ,
    12. Godin R
    : Inhibarea căii arici vizează stroma asociată tumorii în cancerul pancreatic . Mol Cancer Res 10 : 1147 – 1157 , 2012 . Text complet abstract / GRATUIT Google Scholar
  32.  
    1. Catenacci TVP ,
    2. Bahary N ,
    3. Nattam S ,
    4. de Wilton Marsh R ,
    5. Wallace JA ,
    6. Rajdev L ,
    7. Cohen DJ ,
    8. Sleckman BG ,
    9. HJ Lenz ,
    10. Stiff PJ ,
    11. Thomas SP ,
    12. Xu P ,
    13. Henderson L ,
    14. Horiba MN ,
    15. Vannier M ,
    16. Karrison T ,
    17. Stadler WM ,
    18. Kindler HL
    : Analiza finală a unui studiu de fază IB / fază II randomizată a gemcitabinei (G) plus placebo (P) sau vismodegib (V), un inhibitor al căii arici (Hh), la pacienții (puncte) cu cancer pancreatic metastatic (PC): A Studiul consorțiului de faza II a Universității din Chicago . J Clin Oncol 31 ; suppl : abstr 4012 , 2013 . Google Scholar
  33.  
    1. De Jesus-Acosta A ,
    2. O’Dwyer PJ ,
    3. Ramanathan DD ,
    4. Von Hoff DD ,
    5. Maitra A ,
    6. Rasheed A ,
    7. Zheng L ,
    8. Rajeshkumar NV ,
    9. Le DT ,
    10. Hoering A ,
    11. Bolejack V ,
    12. Yabuuchi S ,
    13. Laheru DA
    : Un studiu de fază II a vismodegibului, un inhibitor al căii arici, combinat cu gemcitabină și nab-paclitaxel la pacienții cu adenocarcinom ductal pancreatic netratat . J Clin Oncol 32 ; supl 3 : abstr 257 , 2014 . Google Scholar
  34.  
    1. Kim J ,
    2. Aftab BT ,
    3. Tang JY ,
    4. Kim D ,
    5. Lee AH ,
    6. Rezaee M ,
    7. Kim J ,
    8. Chen B ,
    9. Regele EM ,
    10. Borodovsky A ,
    11. Riggins GJ ,
    12. Epstein EH Jr. . ,
    13. Beachy PA ,
    14. Rudin CM
    : Itraconazolul și trioxidul de arsen inhibă activarea căii arici și creșterea tumorii asociate cu rezistența dobândită la antagoniști neteziți . Cancer Cell 23 : 23 – 34 , 2013 . CrossRef PubMed Google Scholar
  35.  
    1. Chung GG ,
    2. Yoon HH ,
    3. Deputat Zerkowski ,
    4. Ghosh S ,
    5. Thomas L ,
    6. Harigopal M ,
    7. Charette LA ,
    8. Salem RR ,
    9. Tabăra RL ,
    10. Rimm DL ,
    11. Burtness BA
    : Factorul de creștere endotelial vascular, analiza FLT-1 și FLK-1 într-un microarray de țesut al cancerului pancreatic . Cancer 106 : 1677 – 1684 , 2006 . CrossRef PubMed Google Scholar
  36.  
    1. Ko AH ,
    2. Venook AP ,
    3. Bergsland EK ,
    4. Kelley RK ,
    5. Korn WM ,
    6. Dito E ,
    7. Schillinger B ,
    8. Scott J ,
    9. Hwang J ,
    10. Tempero MA
    : Un studiu de fază II a bevacizumab plus erlotinib pentru cancerul pancreatic metastatic refractar la gemcitabină . Cancer Chemother Pharmacol 66 : 1051 – 1057 , 2010 . CrossRef PubMed Google Scholar
  37.  
    1. Astsaturov IA ,
    2. Meropol NJ ,
    3. Alpaugh RK ,
    4. Burtness BA ,
    5. Cheng JD ,
    6. McLaughlin S ,
    7. Rogatko A ,
    8. Xu Z ,
    9. Watson JC ,
    10. Weiner LM ,
    11. Cohen SJ
    : Studiu biomarker în fază II și cascadă de coagulare a bevacizumab cu sau fără docetaxel la pacienții cu adenocarcinom pancreatic metastatic tratat anterior . Am J Clin Oncol 34 : 70 – 75 , 2011 . CrossRef PubMed Google Scholar
  38.  
    1. Hosein PJ ,
    2. Pastorini VH ,
    3. Gomez CM ,
    4. Macintyre J ,
    5. Zayas G ,
    6. Reis I ,
    7. Montero AJ ,
    8. Merchan JR ,
    9. Rocha Lima CM
    : Un studiu de fază II cu nab-paclitaxel (NP) la pacienții cu cancer pancreatic avansat Am J Clin Oncol 36 : 151 – 156 , 2013 . CrossRef PubMed Google Scholar
  39.  
    1. Al-Hajeili M ,
    2. Azmi AS ,
    3. Choi M
    : Nab-paclitaxel: potențial pentru tratamentul cancerului pancreatic avansat . Onco Targets Ther 7 : 187 – 192 , 2014 . PubMed Google Scholar

Pemetrexed și Itraconazol ca terapie de a doua linie pentru cancerul pulmonar fara celule mici metastatic non-scuamos

Abstract

Scop

Studiile preclinice au sugerat că agentul anti-fungic oral itraconazol inhibă în mod specific proliferarea, migrația și formarea tubului celulelor endoteliale. Itraconazolul are o activitate anti-angiogenică puternică și îmbunătățește eficacitatea chimioterapiei citotoxice în modele multiple de cancer pulmonar cu xenogrefă primară. Pe baza acestor date, am efectuat un studiu clinic exploratoriu care a evaluat eficacitatea itraconazolului cu chimioterapie citotoxică în tratamentul pacienților cu cancer pulmonar avansat.

Pacienți / metode

Studiul a înscris pacienți cu cancer pulmonar progresiv, non-scuamos, fara celule mici(non microcelular), după o terapie citotoxică anterioară pentru boala metastatică, randomizată 2: 1 până la pemetrexed 500 mg / m 2 IV zi 1 cu sau fără itraconazol 200 mg pe zi pe 21- ciclul zilei. Măsurile de rezultat au inclus procente fără progresie la 3 luni, supraviețuire fără progresie, supraviețuire generală și toxicitate observată.

Rezultate

Un total de 23 de pacienți au fost înrolați; studiul a fost oprit devreme din cauza utilizării crescânde a pemetrexed în prima linie. 67% dintre pacienți au fost fără progresie la 3 luni pe itraconazol plus pemetrexed față de 29% pe brațul de control al pemetrexed singur (p = 0,11). Supraviețuirea mediană fără progresie a fost de 5,5 luni (itraconazol) față de 2,8 luni (martor) (raport de risc (HR) = 0,399, p = 0,089). Supraviețuirea generală a fost mai lungă la pacienții cărora li s-a administrat itraconazol (mediană de 32 luni) față de control (8 luni) (HR = 0,194, p = 0,012). Nu au existat diferențe evidente de toxicitate între brațele studiate.

Concluzie

Itraconazolul este bine tolerat în asociere cu pemetrexed. În concordanță cu datele noastre preclinice, administrarea zilnică de itraconazol este asociată cu tendințe care sugerează îmbunătățirea controlului bolii la pacienții care primesc chimioterapie pentru cancer pulmonar avansat.

J Thorac Oncol. Manuscris de autor; disponibil în PMC 2014 1 mai.Publicat în forma finală editată ca:J Thorac Oncol. 2013 mai; 8 (5): 619–623.doi:  10.1097 / JTO.0b013e31828c3950PMCID: PMC3636564NIHMSID: NIHMS454909PMID: 23546045

Studiul Faza 2 Pemetrexed și Itraconazol ca terapie de a doua linie pentru cancerul pulmonar non-scuamos metastatic non-scuamos

Charles M. Rudin , MD, dr., Julie R. Brahmer , MD, Rosalyn A. Juergens , MD, dr., Christine L. Hann , MD, dr., David S. Ettinger , MD, Rosa Sebree , BS, Ruth Smith , RN , Blake T. Aftab , dr., Peng Huang , dr., Și Jun O. Liu , dr

Informații despre autor 

Informații despre drepturi de autor și licență 

Renunțare

Ultima versiune editată a editorului a acestui articol este disponibilă la J Thorac Oncol

Vedeți alte articole din PMC care citează articolul publicat.

INTRODUCERE

Cancerul pulmonar este principala cauză de deces legat de cancer în Statele Unite, fiind responsabil de mai multe decese decât cancerele de colon, sân și prostată combinate. 1 , 2 Sunt necesare tratamente mai eficiente pentru această boală. Creșterea și progresia tumorii solide depinde de angiogeneza asociată tumorii. 3 Expresia tumorii și nivelurile circulante ale factorilor angiogenici au fost corelate cu creșterea tumorală agresivă, predilecția pentru metastaze și prognosticul într-o gamă largă de tumori solide, inclusiv cancerul pulmonar cu celule mici. 4 – 6Singura terapie anti-angiogenică aprobată în prezent pentru cancerul pulmonar este anticorpul monoclonal bevacizumab, îndreptat împotriva factorului de creștere endotelial vascular (VEGF). Un studiu clinic de fază III de referință, Eastern Cooperative Oncology Group (ECOG) 4599, a randomizat 878 de pacienți cu cancer pulmonar avansat non-scuamos, cu celule mici, la un dublet standard de chimioterapie cu sau fără bevacizumab. 7 Acest studiu a demonstrat o îmbunătățire semnificativă statistic atât a supraviețuirii fără progresie, cât și a supraviețuirii globale în favoarea brațului care conține bevacizumab.

În timp ce studiul ECOG 4599 a indicat potențialul terapiei anti-angiogenice pentru a îmbunătăți rezultatul la pacienții cu tumori solide, au existat limitări majore și în aceste date. În primul rând, îmbunătățirile absolute ale supraviețuirii fără progresie și globale au fost modeste (1,7 și respectiv 2 luni). În al doilea rând, au existat toxicități semnificative atribuite bevacizumab, cu 15 decese legate de tratament pe brațul bevacizumab (vs. 2 la control; p = 0,001), inclusiv hemoptize fatale multiple. Ratele de hipertensiune, proteinurie, sângerări, neutropenie, neutropenie febrilă, trombocitopenie, hiponatremie, erupție cutanată și cefalee au fost semnificativ mai mari la bevacizumab (p <0,05 pentru fiecare). În al treilea rând, costul financiar al bevacizumab, dată fiind eficacitatea limitată și toxicitatea semnificativă, a fost văzut de mulți ca fiind excesiv,cu un raport incremental cost-utilitate comparativ numai cu chimioterapia de peste 500.000 dolari pe an de viață ajustat la calitate.8 O preocupare finală a venit dintr-un studiu „confirmator”, studiul AVAiL, care a înrolat 1.043 de pacienți randomizați la un cisplatină și gemcitabină cu sau fără bevacizumab. 9 Acest studiu nu a reușit să demonstreze o diferență statistic semnificativă în supraviețuire. 9 În rezumat, deși există dovezi puternice că angiogeneza este critică pentru creșterea tumorii, sunt necesare terapii mai puțin toxice, mai puțin prohibitive din punct de vedere al costurilor și mai eficiente.

Am efectuat un screen cu randament ridicat pentru agenții cu activitate anti-angiogenă nebănuită anterior, folosind ca test inițial inhibarea diferențială a proliferării celulelor endoteliale. 10 Itraconazolul s-a dovedit a fi printre cei mai puternici și selectivi inhibitori ai proliferării celulelor endoteliale, cu IC 50 de 0,16 μM pentru celulele endoteliale ale venei ombilicale umane și minim, dacă există efecte anti-proliferative împotriva mai multor controale non-endoteliale (IC 50 s> 100 μM). Niciunul dintre agenții antifungici înrudiți nu a avut activitate similară.

Ulterior am efectuat o serie de analize preclinice ale itraconazolului utilizând atât sisteme de model in vitro, cât și in vivo . 11Itraconazolul a inhibat proliferarea celulelor endoteliale ca răspuns la factori angiogeni cunoscuți, incluzând atât VEGF, cât și factorul de creștere a fibroblastelor (FGF) și a inhibat fosforilarea receptorilor angiogeni primari pentru acești factori. Itraconazolul a condus la o supresie dependentă de doză a migrației celulelor endoteliale mediate de VEGF și FGF și formarea tubului endotelial mediat de VEGF și FGF. Administrarea orală de itraconazol la animale purtătoare de NSCLC cu xenogrefă primară a dus la inhibarea creșterii tumorale similară cu cea obținută cu cisplatina, iar în combinație cu cisplatina a dus la suprimarea și mai accentuată a creșterii tumorii. Utilizarea itraconazolului in vivoa fost asociat cu hipoxie tumorală, după cum se arată prin inducerea expresiei tumorale specifice a HIF1α, precum și prin scăderea densității microvaselului tumoral și a zonei vasculare tumorale. 11

Luate împreună, aceste date susțin că itraconazolul poate avea o promisiune substanțială ca agent anti-angiogenic nou. Spre deosebire de bevacizumab, itraconazolul este un agent oral ieftin, fără brevet și disponibil în prezent într-o formulare generică. Itraconazolul a fost administrat în condiții de siguranță la mii de pacienți, inclusiv pacienților cărora li s-a administrat o doză mare de terapie citotoxică pentru transplant alogen de măduvă osoasă. 12

Ca prim studiu pentru evaluarea potențialei activități anticanceroase a itraconazolului împreună cu chimioterapia standard pentru pacienții cu cancer pulmonar, am inițiat un studiu randomizat al dozei standard de pemetrexed ca terapie de linia a doua pentru NSCLC non-scuamoasă, administrată cu sau fără itraconazol la o doză standard anti-fungică de 200 mg pe zi. În studiul de fază III cu 571 de pacienți, care a susținut înregistrarea pemetrexed din Statele Unite pentru administrarea produselor alimentare și a medicamentului în a doua linie pentru cancerul pulmonar metastazat cu celule mici, supraviețuirea fără evenimente la 3 luni a fost de aproximativ 40%, supraviețuirea mediană fără progresie a fost de 2,9 luni, iar supraviețuirea globală mediană a fost de 8,3 luni. 13 Am emis ipoteza că activitatea anti-angiogenică a itraconazolului ar putea duce la îmbunătățirea controlului bolii cu toxicitate suplimentară minimă la pacienții cu cancer pulmonar non-scuamos recurent și progresiv, cu celule mici.Mergi la:

METODE

Populația pacienților

Candidații eligibili pentru acest studiu ( NCT00769600 ) au fost adulții cu cancer pulmonar non-scuamos ne-scuamos confirmat histologic sau citologic, cu boală progresivă după un singur regim de chimioterapie anterior pentru boala metastatică. Pacienților cu mutație EGFR cunoscută li sa permis să primească anterior terapie orală cu inhibitori de tirozin kinază EGFR orală. Pacienții eligibili au avut un statut de performanță ECOG de ≤ 1 și au avut funcție adecvată a măduvei osoase, renale și hepatice. Pacienții au fost excluși dacă prezentau stări de sângerare subiacente sau predispozante (antecedente de trombocitopenie indusă de chimioterapie cu sângerare în decurs de 1 an, ulcer peptic activ sau esofagită / gastrită hemoragică, purpură trombocitopenică imună activă etc.).

Acest studiu a fost realizat în conformitate cu Declarația de la Helsinki și cu aprobarea comitetelor de evaluare instituțională a tuturor siturilor de studiu participante. Toți participanții au acordat consimțământul scris în scris înainte de a participa.

Design de studiu

Acesta a fost un studiu deschis, randomizat, cu două brațe, faza 2, a terapiei de linia a doua pentru cancerul pulmonar metastatic non-scuamos, cu celule mici. Pe ambele brațe, pacienții au primit doza standard și programul pemetrexed (500 mg / m 2IV în ziua 1 a unui ciclu de 21 de zile). Doar la brațul A, pacienții au primit, de asemenea, 200 mg itraconazol zilnic, începând cu ziua 1 a ciclului 1. Această doză de itraconazol a fost aleasă pentru acest studiu exploratoriu inițial pe baza așteptărilor că aceasta ar fi bine tolerată, deoarece aceasta reflectă recomandările zilnice standard de dozare pentru tratamentul prelungit al infecției fungice. Subiecții ar putea rămâne la tratament pe termen nelimitat, până la progresia bolii sau toxicitate intolerabilă. Deși acest studiu nu a fost finalizat, proiectul statistic original a solicitat un total de 112 pacienți, cu intenția de a evalua proporția pacienților în viață și fără progresie la 3 luni în fiecare braț. Ipoteza nulă bazată pe controale istorice a fost că supraviețuirea fără progresie la 3 luni ar fi de aproximativ 40%. Cu o supraviețuire țintă fără progresie de 3 luni de 60%,un design de fază II cu o etapă Fleming a dat un alfa de 0,10 (unilateral) și o putere de 0,80 folosind probabilitățile binomiale exacte ale lui A’Hern.14 , 15

Evaluări

Siguranță

Evaluările de siguranță au inclus istoricul și examinările fizice, semnele vitale, starea de performanță ECOG, evaluarea evenimentelor adverse, chimia sângelui și hemogramele complete cu diferențial. Evaluările de siguranță au fost efectuate la screening și cel puțin o dată în fiecare ciclu de terapie, de obicei în ziua 1. Severitatea evenimentelor adverse a fost clasificată în conformitate cu criteriile de terminologie comună ale Institutului Național al Cancerului pentru evenimente adverse (NCI CTCAE), versiunea 3.0. 16 Toate efectele adverse de gradul 3 sau mai mare au fost tabelate, indiferent de atribuirea medicamentului studiat. Relațiile evenimentelor adverse cu terapia (cu siguranță, probabil, probabil, puțin probabil sau fără legătură) au fost evaluate de investigatorul principal.

Eficacitate

Răspunsul tumoral a fost evaluat utilizând criteriile standard de evaluare a răspunsului în tumorile solide (RECIST) după fiecare 2 cicluri de terapie. 17 Obiectivul primar planificat a fost procentual fără progresie pe fiecare braț la 3 luni. Variabile suplimentare de eficacitate prespecificate au inclus supraviețuirea fără progresie și supraviețuirea globală evaluată prin curbele Kaplan-Meier, cu diferențe statistice evaluate prin log-rank.Mergi la:

REZULTATE

Caracteristicile pacientului și studierea dozării medicamentelor

Studiul a fost oprit devreme după ce s-au înscris un total de 23 de pacienți, din cauza acumulării lente asociate cu utilizarea din ce în ce mai frecventă a pemetrexedului ca tratament de primă linie și / sau de întreținere a pacienților cu cancer pulmonar non-scuamos metastazat cu celule mici la Johns Hopkins . Cincisprezece pacienți au fost randomizați pentru a primi pemetrexed și itraconazol, iar 8 pacienți au primit pemetrexed singur. Majoritatea pacienților aveau starea de performanță 1. Un rezumat al datelor demografice ale pacienților este prezentat întabelul 1. Toți pacienții au fost tratați cu doza și programul planificat. Cel mai frecvent motiv pentru întreruperea studiului pe ambele brațe a fost progresia bolii.

tabelul 1

Demografia pacientului

Categoria demograficăPemetrexed / Itraconazol N = 15Pemetrexed N = 8
Vârsta medie (interval)60 (49 – 75)59 (48 – 72)
Femeie, n (%)7 (47%)5 (63%)
ECOG PS, n (%)06 (40%)4 (50%)
18 (53%)4 (50%)
21 (7%)0
Istoria fumatuluiNu fumează niciodată4 (27%)3 (37%)
Fost fumator11 (73%)5 (63%)
Anul pachetului, mediană (interval)25 (0 – 80)13 (0 – 70)
Mutații driverului *KRAS3/11 (27%)3/8 (37%)
EGFR2/11 (18%)2/8 (25%)
netestat40

* Un pacient pe brațul A cu mutație CTNNB1

Siguranță și tolerabilitate

Terapia a fost bine tolerată pe ambele brațe, spectrul efectelor adverse reflectând toxicitățile cunoscute ale pemetrexedului și complicațiile legate de boli ale cancerului pulmonar avansat. Cea mai frecventă toxicitate de gradul 3 pe ambele brațe a fost limfopenia (2 din 8 pe pemetrexed și 3 din 15 pe combinație). Un pacient în combinație cu pemetrexed și itraconazol a prezentat neutropenie tranzitorie de gradul 4 care nu este asociată cu febră și leucopenie de gradul 3. Un alt pacient de pe brațul combinat a prezentat o sângerare intratumorală într-o metastază suprarenală mare în primele 30 de zile de la începerea studiului; acest lucru a fost considerat posibil legat de terapie. Toate celelalte toxicități de gradul 3 sau mai mari au fost considerate ca fiind sau puțin probabil să fie legate de terapie și sunt rezumate înmasa 2. Numărul mediu de cicluri de tratament pentru pacienții tratați cu combinația de pemetrexed și itraconazol a fost de 6 (interval, 1 – 35), iar durata medie a tratamentului a fost de 4,3 luni (interval, 1 – 26) (figura 1). Numărul mediu de cicluri de tratament pe pemetrexed singur a fost de 3,5 (interval, 1 – 13), iar durata medie a tratamentului a fost de 2,7 luni (interval, 1 – 9).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms454909f1.jpg

Deschideți într-o fereastră separatăfigura 1Durata terapiei la studiu

Fiecare bară verticală reprezintă un pacient individual aflat în studiu. Înălțimea barei reprezintă timpul de terapie, iar culoarea reprezintă răspunsul RECIST.

tabel 2

Evenimente adverse de gradul 3 sau mai mari.

ToxicitatePemetrexed / Itraconazol (N = 15)Pemetrexed (N = 8)
Gradul 3Gradul 4Gradul 3Gradul 4
Limfopenie**
Neutropenie*
Leucopenia*
Tuse11
Dispnee1
Durere1
Vertij1
Embolie pulmonară1
Sângerare intratumorală* , **

* posibil, probabil sau cu siguranță legat de terapie** a apărut după întreruperea studiului

Eficacitate

Au fost observate trei răspunsuri RECIST, toate pe brațul combinat (rata de răspuns 3/15 sau 20%) (figura 1). Durata răspunsului a variat de la aproximativ un an la peste doi ani.

Obiectivul principal al acestui studiu a fost procentual fără progresie la 3 luni, ipoteza de bază fiind că administrarea de itraconazol ar fi asociată cu o îmbunătățire a supraviețuirii fără progresie la 3 luni de la 40% la 60%. Procentul efectiv fără progresie la 3 luni a fost de 67% la combinația de pemetrexed și itraconazol și de 29% la un singur agent pemetrexed. Supraviețuirea mediană fără progresie a fost de 5,5 luni la combinația de pemetrexed și itraconazol față de 2,8 luni la un singur medicament pemetrexed (Figura 2; HR = 0,399, p = 0,089). Supraviețuirea globală medie a pacienților tratați cu pemetrexed în acest studiu a fost de 8 luni; în schimb, supraviețuirea globală mediană a pacienților tratați cu combinația de pemetrexed și itraconazol a fost de 32 de luni (Figura 3; HR = 0,194, p = 0,012).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms454909f2.jpg

Deschideți într-o fereastră separatăFigura 2Supraviețuire fără progresie

Sunt prezentate curbele Kaplan-Meier ale supraviețuirii fără progresie prin brațul de studiu.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms454909f3.jpg

Deschideți într-o fereastră separatăFigura 3Supraviețuirea generală

Sunt prezentate curbele Kaplan-Meier ale supraviețuirii fără progresie prin brațul de studiu.Mergi la:

DISCUŢIE

Terapia anti-angiogenică, ca strategie pentru tratamentul tumorilor solide, este atractivă din multe puncte de vedere: tumorile sunt hipoxice și sunt extrem de dependente de neovascularizație continuă pentru creșterea continuă, iar celulele endoteliale și elementele stromale asociate pot fi mai stabile din punct de vedere genetic și mai puțin probabil să dezvolta rezistență dobândită la terapii vizate decât celulele canceroase. Au existat succese în tratamentul anti-angiogen al cancerului folosind atât anticorpi monoclonali vizați, cât și inhibitori ai tirozin kinazei receptorilor cu molecule mici. 18 Cu toate acestea, progresul realizat până în prezent în dezvoltarea unor inhibitori puternici și durabili ai angiogenezei asociate tumorii nu a fost la înălțimea unora dintre așteptările inițial excepțional de mari. 19

Cei mai mulți agenți anti-angiogenici vizați studiați la pacienții cu cancer până în prezent sunt agenți foarte selectivi direcționați împotriva interacțiunilor cheie ligand-receptor implicate în impulsul angiogenic asociat cancerului. La fel ca acești agenți vizați molecular, itraconazolul are un efect citotoxic minim, dacă există, asupra celulelor canceroase direct, dar are o activitate inhibitoare puternică împotriva proliferării celulelor endoteliale. În timp ce mecanismul de acțiune al itraconazolului ca inhibitor selectiv al proliferării celulelor endoteliale nu a fost complet definit, acesta pare a fi un inhibitor „mai murdar”, activ împotriva stimulilor angiogeni multipli, într-o varietate de contexte. În modele multiple de xenogrefe primare de cancer pulmonar cu celule mici, eficacitatea itraconazolului oral în suprimarea creșterii tumorale a fost similară cu cea a cisplatinei. 11

Pe baza acestor date preclinice promițătoare, dar surprinzătoare, am inițiat un studiu clinic pentru a explora eficacitatea itraconazolului la pacienții tratați cu pemetrexed standard ca tratament de a doua linie pentru cancerul pulmonar metastatic non-scuamos, cu celule mici. Brațul de control al acestui studiu, pemetrexed singur, a funcționat în mod esențial așa cum era de așteptat, cu mediane de supraviețuire fără progresie și, respectiv, de 2,8 și respectiv 8 luni (comparativ cu 2,9 și 8,3 luni preconizate pe baza controlului istoric). În contrast, cohorta care a primit adăugarea de itraconazol a experimentat mediană fără progresie și supraviețuiri globale de 5,5 și respectiv 32 de luni, diferența globală de supraviețuire atingând semnificație statistică.

Există avertismente importante de luat în considerare la interpretarea acestor date. În primul rând, și mai ales, dimensiunea eșantionului este mică și, prin urmare, estimările dimensiunilor efectului sunt extrem de instabile. Studiul a fost oprit după 23 de pacienți din cauza îngrijorărilor privind fezabilitatea studiului: din ce în ce mai mult, pacienții cu stare de performanță bună și cancerul pulmonar metastazat non-scuamos, cu celule mici, diagnosticate recent în centrul nostru sunt tratați fie cu un agent țintit molecular (în cazul o mutație identificată a conducătorului auto) sau cu un dublet care conține pemetrexed; acest studiu a fost deschis numai pacienților după tratamentul cu un dublet de platină anterior, care nu a putut include pemetrexed. În prezent, lansăm un al doilea studiu randomizat de fază II a itraconazolului într-un context clinic mai fezabil.

În al doilea rând, acest studiu exploratoriu inițial nu a inclus analize corelative care documentează efectele anti-angiogenice la pacienții tratați cu itraconazol. Lucrarea noastră preclinică la modelele de xenogrefă tumorală umană a demonstrat în mod convingător inhibarea marcată a vascularizării asociate tumorii, cu rezultarea inducerii tumorale a genei HIF-1α care răspunde la hipoxie. Procesul nostru viitor va include imagistica prin rezonanță magnetică îmbunătățită prin contrast în serie pentru a evalua modificările fluxului sanguin tumoral. Acesta va fi un studiu de fază II randomizat cu 70 de pacienți în cadrul metastatic de primă linie, evaluând un regim standard de cisplatină și gemcitabină cu sau fără itraconazol, cu obiective co-primare ale ratei de răspuns și scăderea fluxului sanguin asociat tumorii.

În ciuda acestor limitări inerente, rezultatele acestui studiu sunt întru totul în concordanță cu efectele puternice ale tratamentului observate în modelarea noastră preclinică a itraconazolului în xenogrefele primare de cancer pulmonar cu celule mici. Credem că aceste noi date clinice sunt provocatoare și încurajatoare și ar trebui să determine o evaluare clinică suplimentară a itraconazolului ca un nou tratament terapeutic pentru cancerul pulmonar și alte tumori solide.

Tabelul 3

Rezumatul datelor despre rezultate

Măsura rezultatuluiPemetrexed / Itraconazol N = 15Pemetrexed N = 8
Răspuns RECIST, N (%)
 relatii cu publicul3 (20%)0
 SD8 (53%)5 (62%)
 PD2 (13%)2 (25%)
 inevitabil2 (13%)1 (12%)
Supraviețuire fără progresie
 Mediană (luni)5.52.8
 HR (valoarea p)0,399 (p = 0,089)
Supraviețuirea generală
 Mediană (luni)328
 HR (IC 95%)0,194 (p = 0,012)

Mergi la:

Mulțumiri

Recunoașterea sprijinului pentru cercetare: Institutul de cercetare medicală pentru însoțitorul de zbor și Institutele naționale de sănătate

Acest studiu a fost sustinut de subventii de la Institutul de Cercetare Medicala de Insotitor de zbor si Institutele Nationale de Sanatate (Johns Hopkins Lung Cancer SPORE; NCI P50CA058184).Mergi la:

Referințe

1. Siegel R, Naishadham D, Jemal A. Statisticile despre cancer, 2012. CA Cancer J Clin. 2012; 62 : 10–29. [ PubMed ] [ Google Scholar ]2. Jemal A, Siegel R, Xu J și colab. Statistici despre cancer, 2010. CA Cancer J Clin. 2010; 60 : 277–300. [ PubMed ] [ Google Scholar ]3. Horsman MR, Siemann DW. Efectele fiziopatologice ale agenților de țintire vasculară și implicațiile pentru combinarea cu terapiile convenționale. Cancer Res. 2006; 66 : 11520–11539. [ PubMed ] [ Google Scholar ]4. Andersen S, Donnem T, Al-Saad S și colab. Markerii angiogenici prezintă un impact pronostic ridicat asupra supraviețuirii la pacienții cu cancer pulmonar cu celule mici, care nu pot fi operați marginal, tratați cu radioterapie adjuvantă. J Thorac Oncol. 2009; 4 : 463–471. [ PubMed ] [ Google Scholar ]5. Mineo TC, Ambrogi V, Baldi A și colab. Impactul pronostic al expresiei VEGF, CD31, CD34 și CD105 și invazia vaselor tumorale după o intervenție chirurgicală radicală pentru cancerul pulmonar cu celule mici, IB-IIA. J Clin Pathol. 2004; 57 : 591-597. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]6. Seto T, Higashiyama M, Funai H și colab. Valoarea prognostică a expresiei factorului de creștere endotelial vascular și a receptorilor săi flt-1 și KDR în cancerul pulmonar non-cu celule mici în stadiul I. Cancer de plamani. 2006; 53 : 91–96. [ PubMed ] [ Google Scholar ]7. Sandler A, Gray R, Perry MC și colab. Paclitaxel-carboplatin singur sau cu bevacizumab pentru cancerul pulmonar cu celule mici. N Engl J Med. 2006; 355 : 2542–2550. [ PubMed ] [ Google Scholar ]8. Goulart B, Ramsey S. O evaluare bazată pe studii a cost-utilitate a bevacizumab și chimioterapie versus chimioterapie singură pentru cancerul pulmonar avansat cu celule mici. Valoarea sănătății. 2011; 14 : 836–845. [ PubMed ] [ Google Scholar ]9. Reck M, von Pawel J, Zatloukal P, și colab. Studiu de fază III a cisplatinei plus gemcitabinei, fie cu placebo, fie cu bevacizumab, ca terapie de primă linie pentru cancerul pulmonar non-scuamos cu celule mici: AVAil. J Clin Oncol. 2009; 27 : 1227–1234. [ PubMed ] [ Google Scholar ]10. Chong CR, Xu J, Lu J și colab. Inhibarea angiogenezei de către medicamentul antifungic itraconazol. ACS biologie chimică. 2007; 2 : 263–270. [ PubMed ] [ Google Scholar ]11. Aftab BT, Dobromilskaya I, Liu JO, și colab. Itraconazolul inhibă angiogeneza și creșterea tumorii în cancerul pulmonar cu celule mici. Cancer Res. 2011; 71 : 6764-6772. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]12. Robenshtok E, Gafter-Gvili A, Goldberg E și colab. Profilaxia antifungică la pacienții cu cancer după chimioterapie sau transplant de celule stem hematopoietice: revizuire sistematică și meta-analiză. J Clin Oncol. 2007; 25 : 5471-5489. [ PubMed ] [ Google Scholar ]13. Hanna N, Shepherd FA, Fossella FV și colab. Studiu randomizat de fază III cu pemetrexed versus docetaxel la pacienții cu cancer pulmonar cu celule mici, tratați anterior cu chimioterapie. J Clin Oncol. 2004; 22 : 1589–1597. [ PubMed ] [ Google Scholar ]14. Fleming TR. Procedură de testare multiplă cu un eșantion pentru studii clinice de fază II. Biometrie. 1982; 38 : 143–151. [ PubMed ] [ Google Scholar ]15. A’Hern RP. Tabelele de dimensiuni ale eșantionului pentru modele exacte de fază II cu o singură etapă. Stat Med. 2001; 20 : 859–866. [ PubMed ] [ Google Scholar ]16. Criterii comune de terminologie pentru evenimente adverse. Versiunea 3.0. Disponibil la: http://ctep.cancer.gov .17. Therasse P, Arbuck SG, Eisenhauer EA și colab. Noi orientări pentru evaluarea răspunsului la tratament în tumorile solide. Organizația Europeană pentru Cercetarea și Tratamentul Cancerului, Institutul Național al Cancerului din Statele Unite, Institutul Național al Cancerului din Canada. J Natl Cancer Inst. 2000; 92 : 205–216. [ PubMed ] [ Google Scholar ]18. Jayson GC, DJ Hicklin, Ellis LM. Terapia antiangiogenă – viziune în evoluție bazată pe rezultatele studiilor clinice. Nat Rev Clin Oncol. 2012; 9 : 297–303. [ PubMed ] [ Google Scholar ]19. Kolata G. Speranță în laborator: un raport special; o temere prudentă întâmpină medicamente care eradică tumorile la șoareci. Timiile din New York. 3 mai 1998; [ Google Scholar ]