Arhive etichetă | melanom

Inozitol hexafosfat plus inozitol au indus remisia completă în melanomul în stadiul IV: un raport de caz

Inozitol hexafosfat (IP6) numit și acid fitic este un carbohidrat polifosforilat care se găsește în mod natural în cereale, nuci, cereale și alimente bogate în fibre. S-a demonstrat că inhibă creșterea multor linii celulare tumorale diferite atât in vitro, cât și in vivo, cum ar fi colonul, pancreasul, ficatul, prostata și chiar melanomul. Vitamina B inozitol este un precursor al IP6 și un alt compus natural cu proprietăți anticancerigene.

Prezentăm un raport de caz al unui pacient cu melanom metastatic care a refuzat terapia alopata tradițională și a optat să încerce suplimentul contrainitol IP6 + inozitol. Spre surprinderea noastră, pacientul a obținut o remisie completă și rămâne în remisie 3 ani mai târziu.

Pe baza acestui caz și a studiilor preclinice anterioare, credem că sunt indicate cercetări suplimentare în explorarea efectelor antiproliferative și potențiale de stimulare a imunității IP6 + inozitol la pacienții cu melanom metastatic

Khurana, Sharad; Baldeo, Candice; Joseph, Richard W.

Author Information

Melanoma Research: June 2019 – Volume 29 – Issue 3 – p 322-324

doi: 10.1097/CMR.0000000000000577

https://journals.lww.com/melanomaresearch/Abstract/2019/06000/Inositol_hexaphosphate_plus_inositol_induced.15.aspx

Un studiu în faza a II-a a tamoxifenului și a melatoninei la pacienții cu tumori solide metastatice

Br J Rac . 1996 nov; 74 (9): 1466–1468.
PMCID: PMC2074765
PMID: 8912546

Abstract

Datele preliminare ar sugera că hormonul pineal, melatonina (MLT), poate spori eficacitatea anti-tumorale a tamoxifenului (TMX). Atât MLT cât și TMX au fost utilizați ca agenți unici în tratamentul paliativ al neoplasmelor metastatice, altele decât tumorile clasice dependente de hormoni, fără, însă, o eficacitate clară. Pe această bază, a fost efectuat un studiu de fază II cu TMX plus MLT la pacienți cu tumoare solidă metastatică care nu se poate trata. Studiul a cuprins 25 de pacienți cu tumori solide metastatice, altele decât cancerul de sân și cancerul de prostată (șase tumori primare necunoscute; patru melanom; patru carcinom uterin de col uterin; cinci cancer de pancreas; trei hepatocarcinom; două cancer de ovar; unul de cancer pulmonar care nu are celule mici), pentru care nu a fost disponibilă nici o altă terapie standard eficientă, din cauza condițiilor clinice precare, fără răspuns la chimioterapii anterioare și / sau tumori rezistente la chimioterapie. Ambele medicamente au fost administrate oral în fiecare zi până la progresia bolii (TMX, 20 mg zi-1 la prânz; MLT, 20 mg zi-1 seara). Trei pacienți au avut un răspuns parțial (PR) (12%; 95% limite de încredere 2-24%) (un carcinom de col uterin; un melanom; o tumoră primară necunoscută). O boală stabilă (SD) a fost realizată la alți 13 pacienți, în timp ce ceilalți nouă pacienți au progresat. Starea de performanță (PS) s-a îmbunătățit la 9/25 de pacienți, al căror scor mediu a crescut de la 50% la 70%. În sfârșit, a fost observată o supraviețuire mai mare de 1 an la 7/25 (28%) pacienți. Acest studiu în faza a II-a ar sugera că combinația neuroendocrină cu TMX plus MLT poate avea un anumit beneficiu la pacienții cu tumori solide metastatice netratabile, fie în controlul proliferării celulelor canceroase, fie în îmbunătățirea PS.

Text complet

Textul complet este disponibil ca o copie scanată a versiunii originale de imprimare. Obțineți o copie tipărită (fișier PDF) a articolului complet (576K) sau faceți clic pe o imagine de pagină de mai jos pentru a parcurge pagina cu pagină. Link-uri către PubMed sunt de asemenea disponibile pentru referințe selectate .
icon of scanned page 1466

1466
icon of scanned page 1467

1467
icon of scanned page 1468

1468

Referințe selectate

Aceste referințe sunt în PubMed. Aceasta poate să nu fie lista completă de referințe din acest articol.
  • Beutler B, Cerami A. Cachectină: mai mult decât un factor de necroză tumorală. N Engl J Med. 1987 12 februarie; 316 (7): 379–385. PubMed ] Google Scholar ]
  • Broder S, Muul L, Waldmann TA. Celule supresoare în boala neoplazică. J Natl Cancer Inst. 1978 iul; 61 (1): 5–11. PubMed ] Google Scholar ]
  • Inge TH, Hoover SK, Susskind BM, Barrett SK, Bear HD. Inhibarea răspunsurilor limfocitelor T citotoxice specifice tumorii prin transformarea factorului de creștere beta 1. Cancer Res. 1992 15 mar; 52 (6): 1386–1392. PubMed ] Google Scholar ]
  • Knabbe C, Lippman ME, Wakefield LM, Kland Flandra, Kasid A, Derynck R, Dickson RB. Dovadă că transformarea factorului de creștere-beta este un factor de creștere negativ reglat hormonal în celulele canceroase ale sânului uman. Cell. 1987 13 februarie; 48 (3): 417–428. PubMed ] Google Scholar ]
  • Lissoni P, Barni S, Crispino S, Tancini G, Fraschini F. Endocrine și efecte imunitare ale terapiei cu melatonină la pacienții cu cancer metastatic. Eur J Cancer Clin Oncol. 1989 mai; 25 (5): 789–795. PubMed ] Google Scholar ]
  • Lissoni P, Barni S, Cattaneo G, Tancini G, Esposti G, Esposti D, Fraschini F. Rezultate clinice cu hormonul pineal melatonină în cancerul avansat rezistent la terapiile antitumoare standard. Oncologie. 1991; 48 (6): 448–450. PubMed ] Google Scholar ]
  • Lissoni P, Barni S, Meregalli S, Fossati V, Cazzaniga M, Esposti D, Tancini G. Modularea terapiei endocrine a cancerului prin melatonină: un studiu de fază II a tamoxifenului, plus melatonina, la pacienții cu cancer de sân metastatic care progresează sub tamoxifen. Br J Rac. 1995 Apr; 71 (4): 854–856. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
  • Maestroni GJ, Conti A, Pierpaoli W. Melatonina pineală, rolul său fundamental imunoregulator în îmbătrânire și cancer. Ann NY Acad Sci. 1988; 521 : 140–148. PubMed ] Google Scholar ]
  • Pollak M, Costantino J, Polychronakos C, Blauer SA, Guyda H, Redmond C, Fisher B, Margolese R. Efectul tamoxifenului asupra nivelului factorului I de creștere a insulinei în serul pacienților cu cancer de sân în stadiul I. J Natl Cancer Inst. 1990 7 noiembrie; 82 (21): 1693–1697. PubMed ] Google Scholar ]
  • Regelson W, Pierpaoli W. Melatonina: un hormon antitumoral redescoperit? Relația sa cu receptorii de suprafață; metabolismul steroizilor sexuali, răspuns imunologic și factori cronobiologici în creșterea și terapia tumorii. Cancer Invest. 1987; 5 (4): 379–385. PubMed ] Google Scholar ]

Lumina soarelui și mortalitatea cauzată de cancerul de piele, de ovar, de colon, de prostată și non-melanom: un studiu controlat cazuri bazat pe certificatul de deces

Abstract

Obiective: A explora dacă mortalitatea cauzată de cancerul mamar feminin, ovarian, colon și prostată au fost asociate negativ cu expunerea la soare.

Metode : Un studiu de caz de control al mortalității bazat pe un certificat de deces a fost realizat în cinci tipuri de cancer: cancer de piele feminin, ovarian, colon, prostată și non-melanom (ca un control pozitiv) pentru a examina asociațiile cu expunerea rezidențială și ocupațională la lumina soarelui. Cazurile au fost toate decesele cauzate de aceste tipuri de cancer între 1984 și 1995 în 24 de state din Statele Unite. Controalele, care au fost frecvența de vârstă, adaptate la o serie de cazuri, au excluzat decesele cauzate de cancer și anumite boli neurologice. Regresia logistică multiplă a fost utilizată într-un model care a inclus vârsta, sexul, rasa, expunerea rezidențială la lumina soarelui (bazată pe regiune) și statutul socioeconomic, expunerea ocupațională la lumina soarelui și activitatea fizică (ultimele trei bazate pe ocupația obișnuită).

Rezultate: Expunerea rezidențială la lumina soarelui a fost asociată negativ(adica INVERS) și semnificativ cu mortalitatea cauzată de cancerul mamar, ovarian, prostatic și de colon feminin. Doar cancerul de sân și de colon feminin, de asemenea, a arătat asociații negative semnificative cu locuri de muncă cu cea mai mare expunere ocupațională la lumina soarelui (proporție (OR) 0,82 (95% interval de încredere (95% CI) 0,70 până la 0,97) pentru cancerul de sân feminin; OR 0,90 (95% CI 0,86 până la 0,94) pentru cancer de colon). Pentru ambele tipuri de cancer, asocierea negativă cu lumina soarelui ocupațional a fost cea mai mare în regiunea geografică cu cea mai mare expunere la soare și a fost independentă de activitatea fizică la locul de muncă. Cancerul de piele non-melanom, așa cum era de așteptat, a fost asociat pozitiv atât cu lumina solară (atentie LUMINA SOLARA, NU vitamina D3) rezidențială, cât și profesională.

Concluzii: În acest studiu exploratoriu, spre deosebire de mortalitatea cauzată de cancerul de piele non-melanom, mortalitatea cauzată de cancerul de sân feminin și cancerul de colon au fost asociate în mod negativ atât cu lumina solară rezidențială, cât și profesională.

Ocuparea mediului Med . 2002 Apr; 59 (4): 257–262.
PMCID: PMC1740270
PMID: 11934953

Text complet

Textul complet al acestui articol este disponibil ca PDF (157K).

Referințe selectate

Aceste referințe sunt în PubMed. Aceasta poate să nu fie lista completă de referințe din acest articol.
  • Gorham ED, Garland FC, Garland CF. Lumina soarelui și incidența cancerului de sân în URSS. Int J Epidemiol. 1990 Dec; 19 (4): 820–824. PubMed ] Google Scholar ]
  • Garland FC, Garland CF, Gorham ED, Young JF. Variația geografică a mortalității prin cancer de sân în Statele Unite: ipoteză care implică expunerea la radiații solare. Prev. Med. 1990 Nov; 19 (6): 614–622. PubMed ] Google Scholar ]
  • Lefkowitz ES, Garland CF. Lumina soarelui, vitamina D și rata de mortalitate a cancerului ovarian la femeile din SUA. Int J Epidemiol. 1994 Dec; 23 (6): 1133–1136. PubMed ] Google Scholar ]
  • Schwartz GG, Hulka BS. Este deficitul de vitamina D un factor de risc pentru cancerul de prostată? (Ipoteză). Anticancer Res. 1990 Sep-Oct; 10 (5A): 1307–1311. PubMed ] Google Scholar ]
  • Hanchette CL, Schwartz GG. Modele geografice ale mortalității prin cancer de prostată. Dovadă pentru un efect protector al radiațiilor ultraviolete. Cancer. 1992 15 decembrie; 70 (12): 2861–2869. PubMed ] Google Scholar ]
  • Garland CF, Garland FC. Lumina soarelui și vitamina D reduc probabilitatea de cancer de colon? Int J Epidemiol. 1980 Sep; 9 (3): 227–231. PubMed ] Google Scholar ]
  • Braun MM, Helzlsouer KJ, Hollis BW, Comstock GW. Cancerul de colon și metabolitul seric al vitaminei D cu 10-17 ani înainte de diagnostic. Am J Epidemiol. 1995 15 sept.; 142 (6): 608–611. PubMed ] Google Scholar ]
  • Braun MM, Helzlsouer KJ, Hollis BW, Comstock GW. Cancerul de prostată și nivelurile prediagnostice ale metaboliților serici ai vitaminei D (Maryland, Statele Unite) Cancer Causes Control. 1995 mai; 6 (3): 235–239. PubMed ] Google Scholar ]
  • Gann PH, Ma J, Hennekens CH, Hollis BW, Haddad JG, Stampfer MJ. Metabolizarea vitaminei D în circulație în legătură cu dezvoltarea ulterioară a cancerului de prostată. Biomarkeri de cancer Epidemiol Prev. 1996 Feb; 5 (2): 121–126. PubMed ] Google Scholar ]
  • Hiatt RA, Krieger N, Lobaugh B, Drezner MK, Vogelman JH, Orentreich N. Prediagnostic vitamina D și cancer de sân. J Natl Cancer Inst. 1998 18 mar; 90 (6): 461–463. PubMed ] Google Scholar ]
  • Holick MF. Factorii de mediu care influențează producția cutanată de vitamina D. Am J Clin Nutr. 1995 Mar; 61 (3 supliment): 638S – 645S. PubMed ] Google Scholar ]
  • Martínez ME, WC Willett. Calciu, vitamina D și cancer colorectal: o revizuire a dovezilor epidemiologice. Biomarkeri de cancer Epidemiol Prev. 1998 Feb; 7 (2): 163–168. PubMed ] Google Scholar ]
  • Martínez ME, Giovannucci EL, Colditz GA, Stampfer MJ, Hunter DJ, Speizer FE, Wing A, Willett WC. Calciul, vitamina D și apariția cancerului colorectal la femei. J Natl Cancer Inst. 1996 2 oct; 88 (19): 1375–1382. PubMed ] Google Scholar ]
  • John EM, Schwartz GG, Dreon DM, Koo J. Vitamina D și riscul de cancer de sân: Studiul de urmărire epidemiologică NHANES I, 1971-1975 – 1992. Studiu național de sănătate și nutriție. Biomarkeri de cancer Epidemiol Prev. 1999 mai; 8 (5): 399–406. PubMed ] Google Scholar ]
  • Janowsky EC, Lester GE, Weinberg CR, Millikan RC, Schildkraut JM, Garrett PA, Hulka BS. Asocierea între nivelurile scăzute de 1,25-dihidroxivitamina D și riscul de cancer de sân Sănătate publică Nutr. 1999 Sep; 2 (3): 283–291. PubMed ] Google Scholar ]
  • Corder EH, Guess HA, Hulka BS, Friedman GD, Sadler M, Vollmer RT, Lobaugh B, Drezner MK, Vogelman JH, Orentreich N. Vitamina D și cancer de prostată: studiu prediagnostic cu seruri stocate. Biomarkeri de cancer Epidemiol Prev. 1993 septembrie-oct; 2 (5): 467–472. PubMed ] Google Scholar ]
  • Figgs LW, Dosemeci M, Blair A. Supravegherea limfomelor non-Hodgkin din Statele Unite ale Americii prin ocupație 1984-1989: un studiu de douăzeci și patru de certificate de deces. Am J Ind Med. 1995 iunie; 27 (6): 817–835. PubMed ] Google Scholar ]
  • Freedman DM, Dosemeci M, Alavanja MC. Mortalitate prin scleroză multiplă și expunere la radiații solare rezidențiale și profesionale: studiu de caz de control bazat pe certificate de deces. Ocuparea mediului Med. 2000 iunie; 57 (6): 418–421. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
  • Keller-Byrne JE, Khuder SA, Schaub EA. Meta-analize ale cancerului de prostată și agricultură. Am J Ind Med. 1997 mai; 31 (5): 580–586. PubMed ] Google Scholar ]
  • Cerhan JR, Cantor KP, Williamson K, Lynch CF, Torner JC, Burmeister LF. Mortalitatea prin cancer în rândul fermierilor din Iowa: rezultate recente, tendințe de timp și factori de viață (Statele Unite). Cancerul provoacă controlul. 1998 mai; 9 (3): 311–319. PubMed ] Google Scholar ]
  • Blair A, Zahm SH, Pearce NE, Heineman EF, Fraumeni JF., Jr Clues la etiologia cancerului din studii efectuate de fermieri. Scand J Work Environ Health. 1992 august; 18 (4): 209–215. PubMed ] Google Scholar ]
  • Green LW. Manual pentru notarea stării socioeconomice pentru cercetarea comportamentului în sănătate. Republica Sănătate Publică 1970 sept. 85 (9): 815–827. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
  • McTiernan A, Ulrich C, Ardezie S, Potter J. Activitatea fizică și etiologia cancerului: asociații și mecanisme. Cancerul provoacă controlul. 1998 Oct; 9 (5): 487–509. PubMed ] Google Scholar ]
  • Albanes D, Blair A, Taylor PR. Activitate fizică și risc de cancer în populația NHANES I. Sănătate publică Am J. 1989 iunie; 79 (6): 744–750. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
  • OS Miettinen, Wang JD. O alternativă la raportul proporțional al mortalității. Am J Epidemiol. 1981 iul; 114 (1): 144–148. PubMed ] Google Scholar ]
  • Percy CL, Miller BA, Gloeckler Ries LA. Efectul modificărilor clasificării cancerului și exactitatea certificatelor de deces prin cancer asupra tendințelor mortalității prin cancer. Ann NY Acad Sci. 1990; 609 : 87–99. PubMed ] Google Scholar ]
  • Cooper SP, Buffler PA, Lee ES, Cooper CJ. Caracteristici de sănătate în funcție de cea mai îndelungată ocupație și industrie a ocupării forței de muncă: Statele Unite, 1980. Am J Ind Med. 1993 iul; 24 (1): 25–39. PubMed ] Google Scholar ]
  • Liu L, Deapen D, Bernstein L. Starea socioeconomică și cancerul sânului feminin și al organelor de reproducere: o comparație între populațiile rasiale / etnice din județul Los Angeles, California (Statele Unite). Cancerul provoacă controlul. 1998 august; 9 (4): 369–380. PubMed ] Google Scholar ]
  • Webb AR, Kline L, Holick MF. Influența sezonului și a latitudinii asupra sintezei cutanate a vitaminei D3: expunerea la lumina soarelui de iarnă la Boston și Edmonton nu va promova sinteza de vitamina D3 pe pielea umană. J Clin Endocrinol Metab. 1988 august; 67 (2): 373–378. PubMed ] Google Scholar ]
  • Garland C, Shekelle RB, Barrett-Connor E, Criqui MH, Rossof AH, Paul O. Vitamina D dietetică și calciu și riscul de cancer colorectal: un studiu prospectiv de 19 ani la bărbați. Lancet. 1985 Feb 9; 1 (8424): 307–309. PubMed ] Google Scholar ]
  • Bostick RM, Potter JD, Sellers TA, McKenzie DR, Kushi LH, Folsom AR. Relația de calciu, vitamina D și aportul de produse lactate cu incidența cancerului de colon în rândul femeilor în vârstă. Studiul de sănătate al femeii din Iowa. Am J Epidemiol. 1993 15 iunie; 137 (12): 1302–1317. PubMed ] Google Scholar ]
  • Kearney J, Giovannucci E, Rimm EB, Ascherio A, Stampfer MJ, Colditz GA, Aripă A, Kampman E, Willett WC. Calciu, vitamina D și alimente lactate și apariția cancerului de colon la bărbați. Am J Epidemiol. 1996 mai 1; 143 (9): 907–917. PubMed ] Google Scholar ]
  • Garland CF, Comstock GW, Garland FC, Helsing KJ, Shaw EK, Gorham ED. 25 ser-hidroxivitamină D și cancer de colon: studiu prospectiv de opt ani. Lancet. 1989 18 noiembrie; 2 (8673): 1176–1178. PubMed ] Google Scholar ]
  • Tangrea J, Helzlsouer K, Pietinen P, Taylor P, Hollis B, Virtamo J, Albanes D. Nivelurile serice de metaboliți ai vitaminei D și riscul ulterior de cancer de colon și rect la bărbații finlandezi. Cancerul provoacă controlul. 1997 iul; 8 (4): 615–625. PubMed ] Google Scholar ]
  • Reichel H, Koeffler HP, Norman AW. Rolul sistemului endocrin al vitaminei D în sănătate și boli. N Engl J Med. 1989 13 aprilie; 320 (15): 980–991. PubMed ] Google Scholar ]
  • Frampton RJ, Omond SA, Eisman JA. Inhibarea creșterii celulelor canceroase umane de către metaboliții 1,25-dihidroxivitamină D3. Cancer Res. 1983 Sep; 43 (9): 4443–4447. PubMed ] Google Scholar ]
  • Lointier P, Wargovich MJ, Saez S, Levin B, Wildrick DM, Boman BM. Rolul vitaminei D3 în proliferarea unei linii celulare de cancer de colon uman in vitro. Anticancer Res. 1987 iul-aug; 7 (4B): 817–821. PubMed ] Google Scholar ]
  • Mantell DJ, Owens PE, Bundred NJ, Mawer EB, Canfield AE. 1 alfa, 25-dihidroxivitamina D (3) inhibă angiogeneza in vitro și in vivo. Circ Res. 2000 4 august; 87 (3): 214–220. PubMed ] Google Scholar ]
  • El Abdaimi K, Dion N, Papavasiliou V, Cardinal PE, Binderup L, Goltzman D, Ste-Marie LG, Kremer R. Analogul vitaminei D EB 1089 previne metastaza scheletică și prelungește timpul de supraviețuire la șoarecii nude transplantate cu celule canceroase ale sânului uman. Cancer Res. 2000 15 august; 60 (16): 4412–4418. PubMed ] Google Scholar ]
  • Colston KW, Berger U, Coombes RC. Rolul posibil pentru vitamina D în controlul proliferării celulelor canceroase de sân. Lancet. 1989 28 ianuarie; 1 (8631): 188–191. PubMed ] Google Scholar ]
  • Iino Y, Yoshida M, Sugamata N, Maemura M, Ohwada S, Yokoe T, Ishikita T, Horiuchi R, Morishita Y. 1 alfa-hidroxivitamină D3, hipercalcemie și suprimarea creșterii a 7,12-dimetilbenz [a] indusă de antracen [ tumori mamare de șobolan. Tratamentul cu cancerul de sân. 1992; 22 (2): 133–140. PubMed ] Google Scholar ]
  • Eisman JA, Barkla DH, Tutton PJ. Suprimarea creșterii in vivo a xenogrefelor tumorii solide de cancer uman cu 1,25-dihidroxivitamina D3. Cancer Res. 1987 1 ianuarie; 47 (1): 21–25. PubMed ] Google Scholar ]
  • Landin-Wilhelmsen K, Wilhelmsen L, Wilske J, Lappas G, Rosén T, Lindstedt G, Lundberg PA, Bengtsson BA. Lumina soarelui crește concentrația de vitamina D în serul 25 (OH), în timp ce 1,25 (OH) 2D3 nu este afectată. Rezultate ale unui studiu general al populației din Göteborg, Suedia (proiectul OMS MONICA). Eur J Clin Nutr. 1995 iunie; 49 (6): 400–407. PubMed ] Google Scholar ]

Articole de la medicina muncii și de mediu sunt furnizate aici, prin amabilitatea BMJ Publishing Group

Siguranța și rezultatul tratamentului melanomului metastatic folosind 3-bromopiruvat (3-BP): o revizuire concisă a literaturii și studiu de caz

Abstract

3-Bromopiruvat (3BP) este un nou, promițător agent alchilant anticancer, cu mai multe funcții notabile. Pe lângă inhibarea enzimelor cheie ale glicolizei incluzând hexokinază II și lactat dehidrogenază (LDH), 3BP inhibă, de asemenea, selectiv fosforilarea oxidativă mitocondrială, angiogeneza și producerea de energie în celulele canceroase. Mai mult, 3BP induce producerea de peroxid de hidrogen în celulele canceroase (efect de stres oxidativ) și concurează cu substratul LDH piruvat și lactat.

Există un singur studiu clinic uman publicat care arată că 3BP a fost eficient în tratarea carcinomului hepatocelular fibrolamelar. 

LDH este o măsură bună pentru evaluarea tumorii și prezice rezultatul tratamentului mai bine decât prezența unei mase tumorale reziduale. Conform efectului Warburg, LDH este responsabil de sinteza lactatului, care facilitează supraviețuirea celulelor canceroase, progresia, agresivitatea, metastaza și angiogeneza. Lactatul produs prin activitatea LDH alimentează populațiile de celule aerobe din tumorile prin simbioză metabolică.

În melanom, cel mai mortal cancer de piele, moartea celulelor necrotice a indus 3BP în celulele sensibile, în timp ce conținutul ridicat de glutation (GSH) a făcut ca alte celule de melanom să fie rezistente la 3BP. Utilizarea concomitentă a unui depletor/ terminator de GSH cu 3BP a dus la celule de melanom rezistente ucise. Supraviețuirea pacienților cu melanom a fost asociată invers cu niveluri ridicate de LDH în ser, care a fost raportat a fi foarte predictiv pentru tratamentul melanomului în studiile clinice randomizate. Aici, raportăm un bărbat de 28 de ani prezentat cu melanom metastatic în stadiul IV care afectează spatele, pleura stângă și plămânul. Boala a provocat distrugerea totală a plămânului stâng și un nivel ridicat de LDH seric (4.283 U / L). După aprobarea comitetului de etică și consimțământul scris al pacientului, pacientul a primit perfuzii intravenoase 3BP (1-2,2 mg / kg), dar efectul anticancer a fost minim, așa cum este indicat de un nivel seric ridicat de LDH. Acest lucru s-ar fi putut datora conținutului mare de GSH tumoral. La combinarea paracetamolului oral, care epuizează GSH tumoral, cu tratament 3BP, nivelul seric de LDH a scăzut maxim. Deși o perfuzie intravenoasă lentă de 3BP părea să aibă o citotoxicitate minimă, eficacitatea sa anticancer prin această metodă de administrare a fost scăzută. Aceasta s-a datorat, probabil, conținutului mare de GSH tumoral, care a fost crescut după utilizarea concomitentă a paracetamolului depletor GSH. Dacă eficacitatea anticanceră a 3BP este mai mică decât se aștepta, combinația cu paracetamol poate fi necesară pentru sensibilizarea celulelor canceroase la efectele induse de 3BP.

Melanomul metastatic, cel mai mortal cancer de piele, este rezistent la modalitățile actuale de tratament. Alimentarea cu energie a melanomului este derivată din oxidarea glucozei (glicoliză) în centrul tumorii și fosforilarea oxidativă la periferia tumorii [1] , [2] . Cu toate acestea, inhibarea glicolizei este suficientă pentru a limita energia livrată melanomului prin ambele căi, deoarece oxidarea glucozei produce cantități enorme de lactat per efect Warburg [3] . Lactatul rezultat este utilizat pentru a alimenta fosforilarea oxidativă la periferia tumorii într-un fenomen numit simbioză metabolică [1] , [2] ( figura 1A ). Celulele melanomului prezintă efectul Warburg, deoarece folosesc mai mult glucoză și produc mai mult lactat decât melanocitele normale [4] . Lactatul induce acidoza microorganismului celulelor canceroase și creează un microambient toxic pentru celulele canceroase normale și susceptibile. Pe de altă parte, celulele canceroase care pot supraviețui acestui microambient nefavorabil prospera [5] , facilitând progresiv malignitatea și metastazarea ( figura 1A ).

Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este cjc-33-07-356-g001.jpg

Glicoliza și simbioza metabolică în cancerul și metastaza melanomului.

A, 3-bromopiruvat (3BP) vizează pași critici în biologia celulelor canceroase. Glicoliza este principala sursă de energie în celulele canceroase. Producția de lactat care apare prin acest proces oferă multe beneficii pentru celulele canceroase. 3BP este un analog structural al piruvatului și al lactatului și poate fi privit ca un antimetabolit. B, beneficii pe bază de lactat în celulele canceroase. Lactatul poate ajuta fosforilarea oxidativă în unele porțiuni aerobice ale celulelor canceroase și prezintă beneficii importante asupra celulelor canceroase.

Interesant este faptul că lactatul mediază reacțiile inflamatorii [6] , îmbunătățește angiogeneza [7] și este asociat cu scăderea supraviețuirii pacientului, chimiresistența, radiorezistența și scăderea imunității împotriva cancerului [8] ( Figura 1A ). „Lactatul este oglinda și motorul malignității” [9] , facilitând supraviețuirea, progresia și metastazarea celulelor canceroase [8] . Formarea lactatelor este ultima etapă a glicolizei în celulele canceroase și este catalizată de lactat dehidrogenază (LDH). LDH a fost raportat ca fiind cel mai semnificativ marker pentru progresia melanomului și este inclus în sistemul american de stadializare a melanomului Comitetului american pentru cancer (AJCC): pacienții cu LDH ridicat sunt diagnosticați cu melanom M1c în stadiul IV [10] . Sa raportat că nivelul LDH seric a fost foarte predictiv pentru tratamentul melanomului în studiile clinice randomizate [11] .

3-Bromopiruvatul (3BP) este un analog piruvat și lactat ( Figura 1B ) care a arătat activitate antitumorală împotriva unui număr de cancere. 3BP a fost raportat pentru a induce moartea celulelor necrotice în celulele de melanom sensibile [12] și a scădea viabilitatea celulelor limfoblastice acute (TUL) de leucemie acută din copilărie rezistente la glucocorticoizi [13] . Recent, 3BP a fost raportat pentru a trata neuroblastomul agresiv [14] , precum și gliomul și glioblastomul [15] . El Sayed și colab . [15] a raportat că 3BP a exercitat efecte anti-gliom puternice prin epuizarea surselor de energie a celulelor gliomului și inducerea stresului oxidativ. Există un singur studiu clinic publicat care arată eficacitatea 3BP ca agent anticancer și, în cadrul acestui studiu, a fost utilizat pentru tratarea carcinomului hepatocelular fibrolamelar uman (HCC) [16] . 3BP a fost administrat prin intermediul chimioembolizării arteriale transcatetere și prin moartea celulelor necrotice induse în țesutul tumoral, după cum se dovedește prin tomografie computerizată cu emisie de pozitron (PET-CT) [16] . Într-adevăr, 3BP a fost raportat la eradicarea HCC [17] . Selectivitatea 3BP față de țesutul cancerului a fost remarcată în mai multe studii [15] , [17] , [18] . 3BP a fost, de asemenea, raportat a fi mai puțin toxic pentru celulele normale atât in vitro, cât și in vivo [15] , [17] , [19] .

3BP are mai multe mecanisme anticanceroase. Este un puternic inhibitor al angiogenezei [20] și al transportatorilor de casete care leagă ATP-ul, care efluxează medicamente chimioterapice și provoacă chimiresistență [19] . Mai mult, 3BP inhibă enzimele cheie implicate în glicoliză, incluzând hexokinază II [17] , gliceraldehida-3-fosfat dehidrogenază [21] și LDH [22] . El Sayed și colab . [23] a raportat că 3BP antagonizează efectele lactatului și piruvatului. În plus, 3BP a fost raportat pentru a inhiba fosforilarea oxidativă [16] și a induce moartea celulelor canceroase prin generarea peroxidului de hidrogen și provocarea stresului oxidativ [15] . Sunt necesare cercetări suplimentare pentru a explora potențialul 3BP ca agent anticancer care exploatează efectul Warburg și vizează căile energetice critice în celulele canceroase. Informațiile obținute din astfel de lucrări pot fi utile pentru dezvoltarea viitoare a 3BP ca opțiune terapeutică pentru pacienții cu cancer.

Tratamentele bazate pe o mai bună înțelegere a biologiei melanomului pot fi promițătoare. Raportăm un bărbat în vârstă de 28 de ani, cu melanom metastatic în stadiul IV, care a primit perfuzii intravenoase de 3BP cu efect limitat. Cu toate acestea, combinarea 3BP cu un inhibitor oral al glutationului (GSH) a produs un răspuns mai bun. Combinarea 3BP cu paracetamolul poate fi necesară atunci când răspunsul inițial la 3BP nu este satisfăcător. Aici, ne oferim experiența cu acest caz, examinăm concis literatura de specialitate și discutăm direcții viitoare importante.

Raport de caz

Un bărbat în vârstă de 28 de ani, care cântărește 60 kg, s-a prezentat pentru prima dată cu o masă grea, nedureroasă în antebrațul stâng, în ianuarie 2012 și a fost admis la Sohag Cancer Institute. Un sondaj a fost colectat din masă pentru biopsie, iar histopatologia a indicat melanomul ( figura 2A ). Masa a fost excizată chirurgical, iar pacientul a fost externat la 2 săptămâni de la internare. Urmărirea periodică se făcea lunar.

Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este cjc-33-07-356-g002.jpg

Melanom metastatic la nivelul plămânului și al peretelui toracic.

A, histopatologia melanomului primar. Secțiunea colorată cu hematoxilină și eozină arată infiltrarea țesutului subcutanat prin foi de melanocite atipice cu nucleoli proeminenți (cap de săgeată) și mitoză anormală (săgeată). Măririle sunt 100 × pentru diapozitivul principal și 400 × pentru inserție. B, cicatricea rămasă după excizia melanomului primar. Tumora primară de melanom se prezintă ca o masă tare (1 cm × 1 cm) în partea superioară a aspectului frontal al antebrațului stâng. Masa a fost de consistență dură, de culoare roșiatică închisă (cu variație de culoare) și prezintă asimetrie cu margini neregulate. CF, melanom metastatic la peretele toracic stâng. C, masiv metastatic bombat prin peretele toracic stâng pentru care a fost administrată radioterapie locală. D, tomografia computerizată (CT) arată distrugerea totală a plămânului stâng cauzată de melanomul metastatic. E, radiografia toracică arată că plămânul drept este cruțat, în timp ce plămânul stâng este total distrus. F, scanarea CT arată că o masă tumorală metastatică circulară imensă ocupă o parte majoră a plămânului stâng.

În iulie 2012, a apărut o recidivă locală, în care a fost simțit un nodul progresiv dur în antebrațul stâng, la locul masei excizate ( Figura 2B ). De asemenea, pacientul a prezentat dureri în spate și peretele toracic stâng. Scanele cu radiografie toracică și tomografia computerizată (CT) au evidențiat o masă pleurală stângă în creștere progresivă care a provocat distrugerea unei porțiuni largi a plămânului stâng, ceea ce a dus la prăbușirea acesteia ( figurile 2C – F ) și trecerea inimii spre partea dreaptă ( dextrocardia). Pacientul a fost tratat cu bifosfonați. Durerea în peretele toracic și în spate a fost intolerabilă, iar pacientul a fost tratat cu medicamente anti-inflamatorii nesteroidiene (ibuprofen și diclofenac), care nu au fost suficiente pentru gestionarea durerii. Pe măsură ce masa de la peretele toracic stâng a continuat să crească, o masă metastatică puternică (5 cm × 3 cm) bombată în afara peretelui toracic ( figura 2C ). Radioterapia locală, care a presupus o doză totală de 25 Gy, administrată în fracții 5-Gy, 5 zile pe săptămână, folosind un accelerator liniar, a fost aplicată la masa bombată.

Pacientul a solicitat consultanță medicală la Departamentul de Oncologie Medicală și Medicină Nucleară din Facultatea de Medicină din Sohag, la Universitatea Sohag (Egipt) și a fost internat pe 13 septembrie 2012. Imediat după internare, evaluarea inițială a relevat că avea dispnee, ortopnee, hipotensiune (BP) , 90/60 mmHg), anorexie, anasarca generalizată (în principal edem nutritiv), deplasare spre dreapta a bătăii apicale cardiace (dextrocardie), masă metastatică bombată prin peretele toracic stâng și regiuni dureroase peste peretele pieptului stâng și spate. Evaluarea de laborator a confirmat hipoxalbuminemia, hipoproteinemia și anemia, împreună cu funcțiile renale și hepatice normale. Întregul plămân stâng al pacientului a fost distrus de metastaza pulmonară, pe scanare CT ( Figurile 2C-F ), fără intrare de aer pe partea stângă. Astfel, pacientul a fost menținut pe masă de oxigen atunci când a fost necesar. Evaluarea radiologică a evidențiat plămânul stâng prăbușit, revărsat pleural pe partea stângă și masă metastatică pe peretele toracic stâng provocând deplasarea mediastinului spre dreapta. Aspiratia ghidata cu ultrasunografie nu a reusit sa elimine lichidul si putin din efuziunea hemoragica a fost aspirata. Nu a fost utilizat tubul intercostal. Pacientul nu a primit tratament legat de melanom, dar a primit tratament de susținere sub formă de infuzie albumină umană fără sare, diuretice, tonice, analgezice nesteroidiene, agenți hemostatici (de exemplu, capron) și o unitate de sânge proaspăt prin transfuzie. .

Pacientul a solicitat tratament cu noi linii de chimioterapie pentru starea lui actuală și a fost în consecință informat despre 3BP, inclusiv mecanismul său de acțiune și posibilele reacții adverse. După ce a primit aprobarea de la Comitetul de Etică al Facultății de Medicină din Sohag și consimțământul scris al pacientului conform Declarației de la Helsinki, tratamentul utilizând 3BP a fost planificat în doze terapeutice sigure, scăzute, pe baza rapoartelor anterioare și a studiilor publicate ale 3BP [15] , [16] , [18] , [24] , [25] . Planul terapeutic a fost conceput pentru a beneficia în siguranță pacientul începând cu cea mai mică doză posibilă, care ar fi administrat prin perfuzie intravenoasă de picurare. Această nouă cale pentru administrarea 3BP fracționează doza calculată. Aceasta poate fi mai sigură decât injecția intra-arterială directă a unei doze de bolus, despre care s-a raportat că în mod eficient, cu o toxicitate minimă, se tratează tumorile hepatice implantate la iepuri [25] . O modificare suplimentară a dozei a fost luată în considerare siguranța tratamentului și tolerabilitatea.

Starea generală a pacientului a fost corectă, cu excepția anasarcei ușoare până la moderate, care a fost parțial ameliorată cu albumină și diuretice fără sare. De asemenea, pacientul a menținut o cantitate bună de urină. În urma tratamentului, pacientul a avut funcții renale și hepatice normale, fără ortopnee sau dispnee. Nivelul LDH seric a fost testat înainte și în timpul tratamentului cu 3BP folosind un analizator Beckman Coulter AU prin intermediul laboratorului automat de patologie clinică din Spitalul Universitar Sohag (Egipt). Înainte de tratament, nivelul seric al LDH a fost ridicat, ceea ce reflectă rata ridicată de glicoliză și metabolismul energetic în tumoră și țesutul metastatic [26] . Urmărirea nivelului seric de LDH a răspuns la un tratament planificat cu 3BP.

Prima perfuzie de 3BP a fost administrată pe 18 septembrie 2012. Pe baza intervalului de dozare de 3BP la om (2-3,5 mg / kg corp) raportat recent de Ko et al . [16] , pacientul a primit 3BP în doză de 1 mg / kg, adăugată la 500 ml glucoză (5%), prin perfuzie intravenoasă cu picurare lentă timp de 2 ore ( Figura 3A ).Tratamentul a fost tolerat, fără anafilaxie sau evenimente adverse neașteptate. Membrii echipei de tratament au participat alături de pacient în timpul perfuziei 3BP și au fost disponibile măsuri pentru tratamentul de urgență. Singurul eveniment advers a fost o senzație de arsură ușoară până la moderată la locul perfuziei, care a scăzut la încetinirea vitezei de perfuzie. Nu au fost întâlnite flebite, reacții inflamatorii locale sau reacții alergice. La sfârșitul perfuziei, pacientul era într-o stare generală bună, culcat confortabil în pat și putând să stea, să stea și să meargă. S-a dus la toaletă și apetitul i s-a îmbunătățit.

Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este cjc-33-07-356-g003.jpg

Tratamentul cu 3BP (perfuzie intravenoasă).

A, doze de tratament date pacientului. Tratamentul B, 3BP a determinat o scădere moderată a nivelului de lactat dehidrogenază (LDH) seric, un predictor metabolic al energiei celulelor canceroase. Nivelul LDH seric a scăzut maxim la combinarea paracetamolului și 3BP.

A doua zi, rezultatele au fost promițătoare, întrucât LDH a scăzut moderat de la 4.283 U / L la 3.126 U / L ( Figura 3B ). Atât funcțiile renale, cât și cele hepatice au fost normale ( figura 4 ). Nu au fost înregistrate anomalii metabolice în ceea ce privește gazele arteriale, glucoza serică sau acidul uric seric. Analizele sângelui a fost în indici normali, fără a avea dovezi de anemie hemolitică ( Figura 5 ). Obiceiurile intestinale au fost normale după tratament cu 3BP. Durerea la peretele pieptului stâng și la spate a fost controlată cu un plasture cutanat trans-cutanic duragesic (fentanil).

Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este cjc-33-07-356-g004.jpg

3BP nu este toxic pentru funcțiile hepatice sau renale.

A, alanina transaminazei (ALT) se află în raza normală cu tratament cu 3BP (poate apărea o creștere ușoară). B, transaminază aspartată serică (AST) prezintă creșteri moderate cu tratament cu 3BP. C, bilirubina serică se încadrează în intervalul normal cu tratament 3BP. D, albumina serică nu a scăzut (comparativ cu nivelul de pretratare) cu tratamentul cu 3BP. E, proteina serică este în limitele normale cu tratament 3BP. F, raportul seric de albumină / globulină (A / G) nu a scăzut (comparativ cu nivelul de pretratare) cu tratamentul cu 3BP. G, creatinina serică se situează în intervalul normal cu tratamentul 3BP. H, uree serică se situează în intervalul normal cu tratament 3BP (poate apărea o creștere moderată).

Un fișier extern care conține o imagine, ilustrare etc. Numele obiectului este cjc-33-07-356-g005.jpg

3BP nu afectează nivelul glucozei serice sau parametrii hematologici.

Tratamentul A, 3BP nu provoacă hipoglicemie. B, numărul eritrocitelor nu este afectat de tratamentul 3BP. Tratamentul C, 3BP nu provoacă trombocitopenie. Tratamentul D, 3BP nu provoacă leucopenie (leucocitoza s-ar putea datora infecției toracice intercurente). E, nivelul hemoglobinei nu este afectat de tratamentul 3BP.

 

Patru zile mai târziu, nivelul seric al LDH a început să crească din nou și a ajuns la 4.353 U / L.

Pacientul a primit o a doua doză de 3BP – de data aceasta, 1 mg / kg adăugat la 500 ml soluție salină normală (0,9%) a fost admis prin intermediul perfuziei intravenoase prin picurare peste 3 ore. Tratamentul a fost tolerat, iar pacientul a avut senzații de arsură la locul perfuziei comparativ cu prima dată, deoarece rata de perfuzie a fost mai mică. Nu a existat flebita sau anafilaxia.

În următoarele 10 zile, pacientul a primit 6 doze de 3BP (1,5-2,2 mg / kg adăugate la 500 ml soluție salină normală, administrate prin perfuzie intravenoasă prin picurare) ( figura 3A ). Toate evaluările de laborator au evidențiat funcții hepatice și renale normale ( figura 4 ), fără tulburări hematologice, cum ar fi neutopenie sau anemie hemolitică ( figura 5 ). Starea generală a pacientului a fost stabilă la tratamentul cu 3BP. Nivelul LDH seric a fost în jur de jumătate din nivelul inițial la prezentare, dar nu a scăzut la nivelul normal ( Figura 3B ).

Pe 5 octombrie 2012, pacientul a început tratamentul cu paracetamol, un epuizant GSH sigur [27]  [32] , sub formă de comprimate orale, de 500 mg administrate de două ori la fiecare 8 ore timp de 3 zile consecutive. Până a doua zi, pacientul a primit tratament 3BP (2,2 mg / kg adăugat la 500 ml de soluție salină normală, administrat prin perfuzie intravenoasă prin picurare lentă timp de 3 ore timp de 3 zile consecutive), care a fost tolerat fără anafilaxie sau evenimente adverse neașteptate.

Urmărirea clinică a relevat un răspuns bun la tratament, astfel cum este evidențiat de o scădere a durerii cu plasture dermice durabile și de o îmbunătățire moderată a apetitului. Edemul ușor al membrelor inferioare a persistat și a fost controlat cu diuretice. Funcțiile renale și hepatice au fost în limitele normale. A fost o scădere accentuată a nivelului seric de LDH până la 1.809 U / L (7 octombrie), 58 U / L (8 octombrie) și 12 U / L (9 octombrie) ( Figura 3B ). Tratamentul a fost oprit, iar pacientul era într-o stare corectă, în afară de o infecție toracică intercurentă și de edem ușor până la moderat al membrelor inferioare.

Infecția toracică se manifestă cu febră, tuse și tulburări respiratorii (dispnee). Examenul toracic a arătat că nu a existat nicio intrare de aer pe partea stângă a pieptului din cauza distrugerii anterioare consemnate. Analiza completa de sânge a evidențiat leucocitoză moderată ( Figura 5D ) și neutrofilie, în concordanță cu infecția. Pneumonia bacteriană a fost considerată în lumina imunocompromisului din cauza malignității și a hipoproteinemiei borderline, iar pacientul a primit injecție intravenoasă de antibiotice adecvate cu spectru larg. Tensiunea arterială a pacientului a fost de 90/60 mmHg, iar funcțiile renale și hepatice au fost normale ( figura 4 ). Hipoxalbuminemia și hipoproteinemia au fost persistente, în mare parte datorită anorexiei și deficienței nutriționale.

Pacientul a avut încă dureri în regiunea din spate și peretele toracic stâng în punctele metastatice, iar acest lucru a fost controlat cu plasture transdermic duragesic. Edemul la ambele membre inferioare a fost moderat sub tratament cu diuretice (cu o bună ieșire de urină). A doua zi, s-a observat febră, tuse, detresă respiratorie și scăderea intrării aerului pe partea dreaptă și s-a produs o scădere suplimentară a tensiunii arteriale. Edemul membrelor inferioare a persistat și scăderea producției de urină. Din cauza restricției de fluid, pacientul a primit perfuzie de dopamină la unitatea de terapie intensivă, unde tensiunea arterială a crescut la 100/60 mmHg. Producția de urină a crescut și urina proaspătă a fost anulată într-un sac de colectare a urinei. Ficatul și funcțiile renale au fost normale. Evaluarea ecocardiografică a evidențiat o masă metastatică în peretele ventriculului stâng (2,5 cm × 2,5 cm) împreună cu revărsat pericardic moderat. Diagnosticul a fost tamponadă cardiacă iminentă, care poate fi fost secundară metastazelor care a mișcat inima spre dreapta, precum și hipoproteinemie nutrițională. În general, mișcarea cardiacă a fost normală. Pacientul a fost menținut la tratamentul cu antibiotice, dopamină, dobutamină și diuretice în unitatea de terapie intensivă. Edemul la membrele inferioare a scăzut treptat, iar tensiunea arterială a fost stabilă la 100/60 mmHg.

Leucocitoza ( Figura 5D ) și neutrofilia absolută au crescut în ciuda antibioticelor cu spectru larg. Testele funcției hepatice, incluzând transaminază alanină serică (ALT) ( figura 4A ) au fost în intervalul normal, cu o ușoară creștere a transaminazei aspartate serice (AST) ( figura 4B ). În plus, bilirubina serică ( figura 4C ) a fost în limitele normale. Testele funcției renale, cum ar fi creatinina serică ( Figura 4G ) au fost în limita normală, cu o creștere moderată a ureei serice ( Figura 4H ). Pacientul era în suferință respiratorie și hipoxemia a fost evidentă. Pacientul a murit din cauza hipoxemiei pe 12 octombrie 2012.

Discuţie

LDH seric, un parametru bun pentru evaluarea tumorilor, cum ar fi melanomul, este superior prezenței unei mase tumorale reziduale pentru a prezice rezultatul tratamentului. Direcționarea glicolizei și a efectului Warburg cu agenți precum 3BP privează celulele melanomului de energia necesară supraviețuirii, proliferării și metastazelor.

Interesant este că nivelul LDH seric reflectă activitatea energetică metabolică a celulelor canceroase în interiorul masei tumorale, ceea ce poate fi un indicator mai sensibil al activității tumorii decât dimensiunea tumorii. Măsurarea timpurie a nivelului seric de LDH a fost raportată a fi utilă în identificarea răspunsului la chimioterapie. De exemplu, în leucemia pediatrică, nivelurile mai mari de LDH în ALL au fost asociate cu un număr mare de leucocite și celule blastice. În tumorile solide pediatrice, nivelurile ridicate de LDH au fost asociate cu întinderea masei tumorale și stadiul bolii [33] . Mai mult, LDH-A contribuie la dezvoltarea rezistenței celulelor canceroase la chimioterapie [34] . În melanom, LDH este un marker metabolic pentru a detecta progresia și a prezice prognosticul în stadiul IV al bolii [35] . Atunci când se discută despre efectele anticancerigene ale 3BP, estimarea nivelului de LDH seric ca răspuns la tratament este critică, deoarece 3BP este un analog structural atât la lactat cât și la piruvat. Lactatul produs prin activitatea combustibililor LDH în populațiile aerobe din tumorile prin simbioză metabolică ( Figura 1A ) [1] .

Combinând 3BP cu lactat sau piruvat, substraturi de LDH, viabilitatea celulelor canceroase protejate, ceea ce sugerează că 3BP este un antagonist pentru lactat și piruvat. 3BP a fost raportat să concureze cu piruvatul pentru LDH [36] . Mai mult, acesta poate fi transportat în interiorul celulelor canceroase prin intermediul transportorului piruvat-lactat (transportoare monocarboxilate). Reglarea actualizată a acestor transportori duce la o absorbție crescută de 3BP în celulele tumorale [37] . Astfel, 3BP inhibă LDH prin concurența cu substraturile sale [22] .

Paracetamolul (acetaminofen, N-acetil para-amino-fenol) este utilizat pe scară largă în practica pediatrică și la adulți. Paracetamolul este un depletor al GSH și este mai sigur decât acidul salicilic acetilic (aspirina, Aspegic) ca antipiretic, deoarece Aspegic poate induce sindromul Rey [27] . Paracetamolul este tolerat în doze mari [28] . Într-adevăr, nu a existat o creștere a toxicității hepatice la pacienții alcoolici cărora li s-a administrat doza terapeutică maximă de paracetamol (4 g / zi) [29] . Lipsa scăderii maxime a nivelului seric de LDH cu 3BP s-ar putea datora conținutului mare de GSH celular, adică conținutul ridicat de tumori de GSH poate inhiba efectele anticancerigene induse de 3BP. Atunci când paracetamolul depletor GSH a fost utilizat cu 3BP, LDH a scăzut dramatic. În special, această scădere nu s-a datorat inhibării de LDH seric mediată de 3BP, fapt dovedit de lipsa unei scăderi maxime a nivelului seric de LDH doar cu 3BP. Scăderea maximă a LDH la tratamentul combinat a confirmat că GSH tumorală a fost antagonistă la moartea celulelor melanomului indusă de 3BP. Acest lucru ar putea indica o închidere a glicolizei în celulele melanomului și semnalează vindecarea metabolică a melanomului metastatic. În mod similar, Qin și colab . [12] a raportat că unele celule de melanom au fost rezistente la 3BP datorită conținutului lor celular ridicat de GSH, un antioxidant și inhibitor al 3BP. Epuizarea GSH în melanom folosind L-Butionina sulfoximină (BSO), un inhibitor selectiv al biosintezei GSH, celule de melanom rezistente sensibilizate la 3BP și moartea celulelor necrotice induse. Astfel, atunci când răspunsul inițial la tratamentul cu 3BP este slab, poate fi indicat să se combine un depletor GSH cu 3BP.

BSO este un alt consumator de GSH care a fost studiat in vitro, dar care nu a fost studiat la om; paracetamolul este mai sigur decât BSO pentru uz uman. Interesant este că paracetamolul a inhibat creșterea și scăderea dimensiunii tumorii la modelele experimentale [30] . Celulele melanomului care folosesc enzima tirozinază au folosit paracetamolul ca substrat pentru tirozinază. În plus, paracetamolul a omorât celulele melanomului prin epuizarea GSH, creșterea nivelului reactiv al speciilor de oxigen și inducerea toxicității mitocondriale [31] . Paracetamolul a fost, de asemenea, raportat recent că crește activitatea LDH [38]. Combinarea paracetamolului cu 3BP pare promițătoare, deoarece 3BP țintește celulele canceroase în multe puncte. Recent am raportat că 3BP vizează brațul energetic, brațul metastatic (sinteza hialuronanului pe calea acidului uronic) și brațul mitotic al malignității (sinteza ADN), pe lângă țintirea fosfohexose izomerazei, un factor de motilitate autocrină [39] .

În cazul raportat aici, 3BP neformulată (Sigma, SUA) a fost administrată prin perfuzie intravenoasă lentă pentru a minimiza eventualele reacții adverse. Această abordare a fost tolerabilă cu o toxicitate minimă. Starea pacientului a fost stabilă sub tratament de susținere. 3BP și paracetamol au fost administrate atunci când starea pacientului și investigațiile de laborator au fost stabile. O supraveghere medicală atentă a fost oferită în orice moment și nu a fost administrat niciun tratament (cu excepția tratamentului de susținere) atunci când au fost prezente afecțiuni acute. Funcțiile renale normale, funcțiile hepatice și indicii hematologici în timpul tratamentului pot indica faptul că 3BP este un agent anticancer sigur. Creșterea moderată a ureei serice s-ar putea datora antibioticelor administrate pentru infecții toracice severe, stare de infecție sau 3BP.

concluzii

3BP poate fi privit ca un antimetabolit, fiind un analog structural al piruvatului și al lactatului, care poate fi administrat prin perfuzie intravenoasă lentă cu toxicitate hepatică, renală și hematologică minimă. Eficacitatea anticanceră a 3BP poate fi antagonizată de conținutul mare de GSH tumoral, dar poate fi potențată la administrarea concomitentă a depletorilor de GSH, cum ar fi paracetamolul. Sunt recomandate viitoarele studii clinice care utilizează 3BP ca agent anti-melanom și ca agent anticancer general. Atunci când efectul anticancer al 3BP trebuie să fie potențat, se poate lua în considerare combinația cu paracetamolul.

 

Recunoasteri

Suntem recunoscători bibliotecarilor din biblioteca Facultății de Medicină din Sohag, Universitatea Sohag, Egipt, pentru furnizarea de facilități de bibliotecă care au ajutat la scrierea acestei lucrări.

Referințe

1. Nakajima EC, Van Houten B. Simbioză metabolică în cancer: refocarea lentilelor Warburg. Mol Carcinog. 2012; 52 : 329–337. PubMed ] Google Scholar ]
2. Ho J, de Moura MB, Lin Y și colab. Importanța glicolizei și a fosforilării oxidative în melanomul avansat. Mol Cancer. 2012; 11 : 76–88. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
3. Warburg O. Despre originea celulelor canceroase. Ştiinţă. 1956; 123 : 309–314. PubMed ] Google Scholar ]
4. Scott DA, Richardson AD, Filipp FV și colab. Profilul metabolic comparativ al profilului de linii celulare de melanom: dincolo de efectul Warburg. J Biol Chem. 2011; 286 : 42626–42634. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
5. Gatenby RA, Gillies RJ. De ce cancerele au glicoliză aerobă ridicată? Nat Rev Cancer. 2004; 4 : 891–899. PubMed ] Google Scholar ]
6. Shime H, Yabu M, Akazawa T și colab. Acidul lactic secretat de tumoră favorizează calea proinflamatoare IL-23 / IL-17. J Immunol. 2008; 180 : 7175–7183. PubMed ] Google Scholar ]
7. Végran F, Boidot R, Michiels C și colab. Fluxul de lactat prin transportorul monocarboxilat de celule endoteliale MCT1 susține o cale NF-κB / IL-8 care conduce angiogeneza tumorală. Cancer Res. 2011; 71 : 2550–2560. PubMed ] Google Scholar ]
8. Hirschhaeuser F, Sattler UG, Mueller-Klieser W. Lactat: un actor cheie metabolic în cancer. Cancer Res. 2011; 71 : 6921–6925. PubMed ] Google Scholar ]
9. Walenta S, Mueller-Klieser WF. Lactat: oglindă și motor al malignității tumorii. Semin Radiat Oncol. 2004; 14 : 267–274. PubMed ] Google Scholar ]
10. Balch CM, Gershenwald JE, Soong SJ și colab. Versiunea finală a stadiului și clasificării melanomului AJCC din 2009. J Clin Oncol. 2009; 27 : 6199–6206. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
11. Agarwala SS, Keilholz U, Gilles E și colab. Corelația LDH cu supraviețuirea în melanomul avansat din două studii mari, randomizate (Oblimersen GM301 și EORTC 18951), Eur J Cancer. 2009; 45 : 1807–1814. PubMed ] Google Scholar ]
12. Qin JZ, Xin H, Nickoloff BJ. 3-Bromopiruvatul induce moartea celulelor necrotice în liniile celulare de melanom sensibile. Biochem Biophys Res Comun. 2010; 396 : 495–500. PubMed ] Google Scholar ]
13. Hulleman E, Kazemier KM, Holleman A și colab. Inhibarea glicolizei modulează rezistența prednisolonului în celulele leucemiei limfoblastice acute. Sânge. 2009; 113 : 2014–2021. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
14. Matsushita K, Uchida K, Saigusa S și colab. Inhibitori ai glicolizei ca o potențială opțiune terapeutică pentru tratarea neuroblastomului agresiv care exprimă GLUT1. J Pediatr Surg. 2012; 47 : 1323–1330. PubMed ] Google Scholar ]
15. El Sayed SM, Abou El-Magd RM, Shishido Y și colab. Terapia genică D-aminoacid oxidaza sensibilizează celulele gliomului la efectul antiglicolitic al 3-brmopiruvatului. Cancer Gene Gene. 2012; 19 : 1–18. PubMed ] Google Scholar ]
16. Ko YH, Verhoeven HA, Lee MJ și colab. Un studiu translațional „raport de caz” pe 3-bromopiruvat („blocant de energie”) al moleculei mici (3BP) ca agent anticancer puternic: de la bancă la pat. J Bioenerg Biomembr. 2012; 44 : 163–170. PubMed ] Google Scholar ]
17. Ko YH, Smith BL, Wang Y și colab. Cancere avansate: eradicarea în toate cazurile, folosind terapia cu 3 bromopiruvate pentru a epuiza ATP. Biochem Biophys Res Comun. 2004; 324 : 269–275. PubMed ] Google Scholar ]
18. Buijs M, Vossen JA, Geschwind JF și colab. Specificitatea activității anti-glicolitice a 3-bromopiruvatului confirmată prin absorbția de FDG la un model de șobolan de cancer de sân. Investiți noi medicamente. 2009; 27 : 120–123. PubMed ] Google Scholar ]
19. Nakano A, Tsuji D, Miki H și colab. Inhibiția glicolizei inactivează transportatorii ABC pentru a restabili sensibilitatea la medicamente în celulele maligne. Plus unu. 2011; 6 : 1-10. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
20. El Sayed SM, El-Magd RM, Shishido Y și colab. Stresul oxidativ indus de aminoacizii D, 3-bromopiruvatul și citratul inhibă angiogeneza, care prezintă efecte puternice anticancerigene. J Bioenerg Biomembr. 2012; 44 : 513–523. PubMed ] Google Scholar ]
21. Barnard JP, Reynafarje B, Pedersen PL. Catabolism cu glucoză în tripanozomii africani. Dovadă că etapa terminală este catalizată de un transportor cu piruvat, capabil să faciliteze absorbția de analogi toxici. J Biol Chem. 1993; 268 : 3654–3661. PubMed ] Google Scholar ]
22. Mulet C, Lederer F. Bromopyruvate ca etichetă de afinitate pentru drojdia de panificator flavocytochrome b2. Studiul cinetic al reacției de inactivare. Eur J Biochem. 1977; 73 : 443–447. PubMed ] Google Scholar ]
23. El Sayed SM, El-Magd RM, Shishido Y și colab. 3-Bromopiruvatul antagonizează efectele lactatului și piruvatului, sinergizează cu citratul și exercită noi efecte anti-gliom. J Bioenerg Biomembr. 2012; 44 : 61–79. PubMed ] Google Scholar ]
24. Vali M, Liapi E, Kowalski J, și colab. Terapia intraarterială cu un nou inhibitor puternic al metabolismului tumorii (3-bromopiruvat): identificarea dozei terapeutice și metoda de injecție la un model animal de cancer la ficat. Radiol J Vasc Interv. 2007; 18 : 95–101. PubMed ] Google Scholar ]
25. Geschwind JF, Ko YH, Torbenson MS și colab. Noua terapie pentru cancerul hepatic: injecție intraarterială directă a unui puternic inhibitor al producției de ATP. Cancer Res. 2002; 62 : 3909–1313. PubMed ] Google Scholar ]
26. Magrath IT. Tratamentul limfoamelor pediatrice: paradigme de plagiat? Ann Oncol. 1997; 1 : 7–14. PubMed ] Google Scholar ]
27. McCullough HN. Acetaminofen și ibuprofen în tratarea febrei și dureri ușoare până la moderate la copii. Sănătatea copilului pediatru. 1998; 3 : 246–250. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
28. Gregoire N, Hovsepian L, Gualano V și colab. Siguranța și farmacocinetica paracetamolului după administrarea intravenoasă de 5 g în primele 24 de ore cu o doză inițială de 2 g. Clin Pharmacol Ther. 2007; 81 : 401–405. PubMed ] Google Scholar ]
29. Kuffner EK, Dart RC. Utilizarea acetaminofenului la pacienții care beau alcool: dovezi ale studiului actual. Am J Manag Care. 2001; 7 : 592–596. PubMed ] Google Scholar ]
30. Vad NM, Yount G, Moore D și colab. Mecanismul biochimic al acetaminofenului (APAP) induce toxicitate în liniile celulare de melanom. J Pharm Sci. 2009; 98 : 1409–2525. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
31. Vad NM, Kudugunti SK, Graber D și colab. Eficacitatea acetaminofenului la șoarecii C57BL / 6 purtători de melanom B16-F0. Int J Oncol. 2009; 35 : 193–204. PubMed ] Google Scholar ]
32. Wolchok JD, Williams L, Pinto JT și colab. Procesul de faza I cu administrare de paracetamol în doză mare și de carmustină, cu melanom metastatic. Melanom Rez. 2003; 13 : 189–196. PubMed ] Google Scholar ]
33. Al-Saadoon EA, Al-Naama LM, Hassan JK. Activitate serică de lactat dehidrogenază (LDH) la copiii cu boli maligne. Bahrain Med Bull. 2003; 25 : 1–5. Academic Google ]
34. Zhao Y, Butler EB, Tan M. Metodologia metabolismului celular pentru îmbunătățirea terapeuticii cancerului. Moarte celulară Dis. 2013; 4 : 1–10. Articol gratuit PMC ] [ PubMed ] Google Scholar ]
35. Bánfalvi T, Edesné MB, Gergye M și colab. Markeri de laborator ai progresiei melanomului. Magy Onkol. 2003; 47 : 89–104. PubMed ] Google Scholar ]
36. Dell’Antone P. Obiectivele 3-bromopiruvatului, un agent anticancer, care se epuizează în energie. Med Chem. 2009; 5 : 491–416. PubMed ] Google Scholar ]
37. Fang J, Quinones QJ, Holman TL și colab. Transportor monocarboxilat legat cu H + (MCT1 / SLC16A1): o potențială țintă terapeutică pentru neuroblastom cu risc ridicat. Mol Farmacol. 2006; 70 : 2108-2115. PubMed ] Google Scholar ]
38. Olaleye MT, Akinmoladun AC, Ogunboye AA și colab. Activitatea antioxidantă și proprietatea hepatoprotectoare a extractelor de frunze de Boerhaavia diffusa Linn împotriva afectării hepatice provocate de acetaminofen la șobolani. Food Chem Toxicol. 2010; 48 : 2200-2205. PubMed ] Google Scholar ]
39. El Sayed SM, Mahmoud AA, El Sawy SA și colab. Efectul Warburg crește starea ROS în stare de echilibru în celulele canceroase prin scăderea capacităților lor antioxidante (efectele anticancerigene ale 3-bromopiruvatului prin antagonizarea efectului Warburg) Med Ipotezele. 2013; 81 : 866–870. PubMed ] Google Scholar ]

Articole din Jurnalul Chinezesc de Cancer sunt furnizate aici, prin amabilitatea BioMed Central

Lipsirea/privarea de arginină ca terapie tintita pentru cancer

Abstract

Anumite tipuri de cancer pot fi auxotrofice pentru un anumit aminoacid și privarea de acesti aminoacizi specifici este o metodă pentru tratarea acestor tumori. Lipsa de arginină este o abordare nouă în privința tumorilor țintă cărora le lipsește expresia sintetazei argininosuccinatului (ASS). ASS este o enzimă cheie care transformă citrulina în arginină. Tumorile care, de obicei, nu exprimă ASS includ melanomul, carcinomul hepatocelular, unele mezoteliomuri și unele tipuri de cancer renal. Arginina poate fi degradată de mai multe enzime, inclusiv arginin deiminaza (ADI). Deși ADI este o enzimă microbiană din micoplasmă, are afinitate ridicată la arginină și catalizează arginina la citrulină și amoniac. Citrulina poate fi reciclată înapoi la arginină în celulele normale care exprimă ASS, în timp ce celulele tumorale ASS (-) nu pot. A fost formulată o formă pegilată de ADI (ADI-PEG20) și a demonstrat activitate in vitro și in vivo împotriva melanomului și carcinomului hepatocelular. ADI-PEG20 induce apoptoza în liniile celulare de melanom.Cu toate acestea, deprivarea argininei poate induce expresia ASS în anumite linii celulare de melanom care pot conduce la rezistență in vitro la medicament. Studii clinice umane de fază I și II cu ADI-PEG20 au fost efectuate la pacienți cu melanom și carcinom hepatocelular și s-a demonstrat activitate antitumorală în ambele tipuri de cancer. Acest articol analizează experiența noastră în laborator și clinică, precum și altele cu ADI-PEG20 ca agent antineoplazic. Orientarea viitoare în utilizarea acestui agent este de asemenea discutată.

INTRODUCERE

Un tip de terapie vizată pentru cancerele umane implică epuizarea aminoacizilor cheie necesari tumorilor pentru a supraviețui. Cel mai bun exemplu este asparaginaza care este folosită pentru a trata leucemia limfoblastică acută (ALL), un tip comun de leucemie la copii și adulți tineri [ 1 , 2 ]. Această enzimă anticanceră scade sau scade nivelul sanguin de asparagină. În timp ce asparagina este un aminoacid neesențial la oameni, TOATE celulele o cer să supraviețuiască și să se prolifereze. Astfel, epuizarea acestui aminoacid prin terapia cu asparaginază este, în general, bine tolerată, deoarece celulele umane normale nu necesită asparagină. Astfel, eliminarea unui anumit aminoacid care nu este esențial la oameni, dar pentru care un anumit cancer este auxotrofic poate fi o metodă selectivă de țintire a malignităților.

Arginina este un alt aminoacid neesențial la adulți, dar este esențial pentru celulele cu proliferare rapidă.Astfel, privarea de arginină poate fi exploatată ca o potențială terapie vizată pentru tratamentul diferitelor forme de cancer. În această lucrare revedem rațiunea pentru această formă de terapie și propriile noastre, precum și alte date de laborator și clinice.

De ce privarea de arginina duce la moartea celulelor în anumite linii celulare tumorale?

Arginina este implicată în căi multiple care sunt implicate în funcțiile celulare majore, cum ar fi producția de oxid nitric, producția de creatină și sinteza poliaminei [ 3 , 4 ]. La om, arginina este derivată în principal din dietă, fluctuația proteinelor corporale și sinteza de-novo prin intermediul axei renale intestinale [ 4 ].Deși arginina poate fi sintetizată, este considerată un aminoacid semi-esențial la adulți, deoarece producția endogenă este insuficientă atunci când celulele sunt supuse stresului sau necesită proliferare [ 5 , 6 ]. În celulele tumorale, arginina influențează creșterea lor / proliferarea [ 5 , 7 – 9 ] și s-a demonstrat că restricția de dietă inhibă creșterea tumorilor metastatice [ 8 ].

 sinteza De-novo de arginină apare în primul rând în tubul renal proximal prin intermediul ciclului de uree.Cu toate acestea, această capacitate se regăsește și în multe alte celule [ 6 ]. Arginina este sintetizată din citrulină în două etape prin ciclul de uree. Enzima argininosuccinat sintetază catalizează conversia L-citrulinei și a acidului aspartic la argininosuccinat, care este apoi transformat în continuare în L-arginină și acid fumărie de argininosuccinat-lază, L-arginina poate fi degradată la L-ornitină prin enzima arginază din ciclul ureei. L-ornitina este apoi transformată înapoi în L-citrulină prin transcarbamil transferat de ornitină (OCT) și apoi reciclată înapoi la arginină prin ASS / ASL (vezi figura 1 ). Astfel, capacitatea de a regenera arginina din citrulină depinde de cantitatea / activitatea ASS și ASL10 , 11 ]. De fapt, Wheatley a sugerat că aceste două enzime sunt cuplate strâns [ 12-14 ] și că sensibilitatea celulelor la privarea argininei depinde de capacitatea lor de regenerare a argininei din intermediarul alternativ (ornitină, citrulină și argininosuccinat) în ciclul ureei [ 9 , 12-14 ].

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f1.jpg

Enzime implicate în ciclul de uree. Linia punctată pe ADI desemnează acțiunea sa asupra conversiei extracelulare a argininei la citrulină și amoniac.

 

Mai multe laboratoare au raportat că anumite linii de celule tumorale, cum ar fi melanomul, carcinomul hepatocelular, carcinomul celulelor renale și unele mesothelioame, nu exprimă ASS și, prin urmare, devin auxotrofice pentru arginină [ 9 , 11 , 15-18 ]. În consecință, enzima de degradare a argininei a fost demonstrată de mai multe laboratoare pentru a avea efect antitumoral în aceste tumori [ 9 , 13 , 19-25 ].Pentru a dovedi în continuare că lipsa expresiei ASS în liniile celulare de melanom este o cheie pentru a le face susceptibile la moartea celulară după deprivarea argininei, noi și alții am transfectat celulele melanomului cu ASS. Acești transfectanți sunt rezistenți la deprivarea argininei [ 15 , 18 ].

Arginina poate fi catabolizată de trei enzime: arginază, arginină decarboxilază și deminazidă de arginină (ADI). Arginaza a fost testată pe animale experimentale încă din 1950, cu toate acestea, terapia nu a reușit să producă răspunsuri majore. Motivul eșecului ar putea fi datorat faptului că această enzimă are o afinitate scăzută pentru arginină și astfel va fi necesară o cantitate mare de enzimă. PH-ul optim pentru arginază este, de asemenea, ridicat (9,5) [ 26 ] și nu poate fi atins. Cu toate acestea, recent, Wheatly și colab. au arătat că arginaza este eficientă de la pH 7,2-927 ]. Foarte important, arginaza catabolizează arginina cu ornitina. Nu se știe dacă alte țesuturi normale, cu excepția ficatului și intestinului subțire, pot sintetiza ornitina la citrulină datorită faptului că OCT, o enzimă cheie necesară pentru această reacție, este exprimată în principal în ficat. În alte țesuturi, gena OCT este hipermetilată și, prin urmare, nu este exprimată. Astfel, se poate întâlni toxicitate normală a țesutului. Aceste neajunsuri pot explica de ce dezvoltarea arginazei ca agent antitumoral a eșuat în ciuda activității sale observate in vitro [ 28 , 29 ]. Cu toate acestea, s-a arătat că arginaza pegilată recent are activitate în carcinomul hepatocelular atât in vitro, cât și in vivo datorită lipsei expresiei OCT în anumite linii celulare de carcinom hepatocelular30 ]. Pe de altă parte, arginina deiminaza, o enzimă microbiană din micoplasma care catabolizează arginina cu citrulină și amoniac, este mai atractivă datorită faptului că celulele tumorale care nu au ASS nu vor putea să sintetizeze arginina intracelulară din citrulină, în timp ce celulele normale sunt capabile să regenereze arginina. Această abordare va evita toxicitatea țesutului normal. Mai mult, această enzimă este activă în pH fiziologic și are o afinitate ridicată pentru arginină. De fapt, s-a raportat că ADI are activitate antitumorală atât in vitro, cât și in vivo în liniile celulare de melanom și hepatocellular carcinom și în alte linii celulare15-18 , 31-34 ].Cu toate acestea, unul dintre dezavantajele ADI este că nu este produs de oameni și, prin urmare, este foarte antigenic. În plus, ADI are și un timp de înjumătățire scurt. Pentru a depăși aceste dezavantaje, o formă pegilată a ADI (ADI-PEG20) a fost dezvoltată de Polaris, Inc (fostă Phoenix Pharmacologics) [ 35 ] și după testele in vitro și studiile in vivo [ 15 , 34 ] a intrat în studiu clinic atât pentru carcinom hepatocelular, cât și pentru melanom.

Activitatea antitumorală a ADI-PEG20 în celulele de melanom

Noi și alții am demonstrat că arginina degradantă în mediile de cultură folosind ADI sau expunerea liniilor celulare melanom la mediul liber de arginină cu citrulină și suplimentul cu NH4CI poate inhiba creșterea și poate avea efecte citotoxice în liniile celulare de melanom [ 15 , 18 ]. IC50 după 7 zile de expunere a fost cuprins între 0,01-0,3 μg / ml dintre cele 16 linii celulare melanom testate [ 15 ]. În laboratorul nostru, am studiat efectul de inhibare a creșterii ADI-PEG20 în 4 linii celulare de melanom (A-375, SK-Mel2, A-2058 și Mel-1220 toate fibroblastele umane normale (BJ-1 ) și o linie NSCLC ASS (+) Efectul inhibitor al creșterii a variat de la 0,05-0,09 μg / ml după expunerea timp de 3 zile la liniile celulare de melanom 4 testate (vezi tabelul 1 ) și mai mare de 1 în liniile celulare BJ-1 și NSCLCS [ 18 ] .. Interesant, la 72 de ore a rămas în mediu arginina (12,8 pM pentru Sk-Mel-2 și 23,5 pM pentru A2058 și nici arginină detectabilă pentru A375 și MEL-1220). cu 0,05 pg / ml de ADI-PEG20, nu există valori detectabile ale argininei la 48 h. Astfel, se pare că capacitatea mașinilor intracelulare de a menține nivelele de arginină fie prin degradarea altor proteine ​​neesențiale, fie prin scăderea proliferării sau prin activarea ASS prin translație sau transcripție este diferită în rândul liniilor celulare melanom. Aceste diferențe pot explica de ce o partelanoma de celule lanoma pot deveni rezistente la această formă de tratament.

tabelul 1

Efectul de inhibare a creșterii ADI-PEG20

Linii telefonice ID 50 (ug / ml) Arginina (uM) la 72 ore Citrulină (uM) la 72 ore
A2058 0,088 ± 0,008 23.5 367.5
A375 0,05 ± 0,001 ND 317.5
Sk-Mel-2 0,070 ± 0,008 12.8 329.2
Mel-1220 0,090 ± 0,008 0 3
BJ-1 > 1 1.6 404
NSCLCS * > 1 20.27 603
* Medii RPMI (linie de bază Arginină: 971 uM).

Mediul EMEM (linia de bază arginină: 400 uM).

Activitatea antitumorală a ADI-PEG20 în carcinomul hepatocelular

S-a demonstrat că ADI-PEG20 are activitate antitumorală în unele linii celulare de carcinom hepatocelular care nu au expresia ASS [ 15 ]. Cu toate acestea, recent, Cheng et al. au studiat 5 linii celulare HCC (HepG2, Hep3B, PLC / PRF / 5, Huh7 și Sk-HEP-1) și au raportat că aceste linii celulare exprimă ASS și nu sunt sensibile la ADI [ 30 ]. Pe de altă parte, aceste linii de celule nu au expresia OCT și sunt sensibile la arginază [ 30 ]. Activitatea antitumorală a fost de asemenea observată in vivo utilizând PEG-arginază, dar profilul de toxicitate nu a fost discutat. Este interesant de ce celulele carcinomului hepatocelular nu au o expresie OCT sau ASS deoarece hepatocitele normale posedă aceste enzime. Astfel, nu este încă cunoscut cum celulele frecvente de carcinom hepatocelular nu exprimă ASS sau OCT sau ambele. Cu toate acestea, Dillion et al . au raportat că toate cele 51 de probe de tumori hepatoame sunt deficitare în ASS prin colorare imunohistochimică [ 36 ]

Activitatea antitumorală a ADI-PEG20 în alte linii celulare

Anumite linii celulare mezoteliom (2591 și MSTO) nu exprimă ASS și sunt sensibile la ADI-PEG20, în timp ce alte două linii celulare (226,2461) exprimă niveluri ridicate [ 17 ]. Studiul imunohistochimic a arătat că 63% din mezoteliom exprimă niveluri scăzute de ASS [ 17 ]. Pe baza acestui studiu, au fost inițiate studii clinice cu mezoteliom [Szlosarck, comunicare personală]. ADI-PEG20 este, de asemenea, activ în anumite linii celulare de celule renale care nu exprimă ASS [ 16 ]. Interesant, unele cancere celulare renale sunt, de asemenea, negative pentru ASS prin colorare imunohistochimică, în ciuda nivelurilor ridicate ale acestor enzime găsite în rinichi. Alte linii celulare care sunt sensibile la ADI-PEG20 includ linii celulare neuroblastomice [ 37 ] și liniile celulare limfoblastice T și B umane [ 31 – 33 ], dar nu o linie celulară leucemică mieloidă (HL-60). În acest raport, ADI-PEG20 are o activitate antitumorală mai bună decât L-asparaginaza [ 31 ]. Liniile celulare tumorale care exprimă niveluri scăzute de ASS pot fi, de asemenea, sensibile la deprivarea argininei [ 11 ]. În schimb, Kang și colab. 38 ] au demonstrat că epuizarea argininei cu ADI izolat din celulele sertoli nu a induce apoptoza în liniile celulare de cancer de prostată DU145, totuși, le-a protejat de apoptoza indusă de paclitaxel. Acest lucru nu este surprinzător, deoarece DU145 posedă ASS, iar scăderea argininei va duce la o întârziere a creșterii celulare care le face rezistente la chimioterapie.

ADI-PEG20 induce apoptoza în liniile celulare de melanom

Sa demonstrat că ADI-PEG20 inhibă sinteza proteinelor utilizând încorporarea de 35S , dar modul în care inhibarea sintezei proteinelor conduce la moartea celulară nu este clară. Gong și colab . au raportat moartea celulelor apoptotice în liniile celulare limfoblastice umane [ 31 , 32 ]. De asemenea, am văzut moartea celulelor apoptotice în celulele melanomului [ 18 ] ( figurile 2 și 3). 3 ). Interesant este că, deși apoptoza este observată în celulele melanomului tratate cu ADI-PEG20 la doza ID50 timp de trei zile, aceste celule pot supraviețui prin reaprovizionarea mediilor noi cu arginină și îndepărtarea ADI-PEG20, dar dacă continuă să se adauge ADI-PEG20 în noul mediu , nu există celule viabile în cele trei linii de celule (A-375, Sk-mel2 și Mel1220) în 3 săptămâni. Se speculează că toate aceste celule suferă autofagie fără arginină înainte de a suferi apoptoză. De fapt, datele noastre preliminare au arătat o creștere a Beclin1 în aceste linii celulare, cu Mel1220 având nivelele cele mai ridicate de Beclin1. În mezoteliom, Szlosarek a arătat că epuizarea argininei induce modificări ale conformației BAX și depolarizarea membranei mitocondriale interne în celulele ASS (-) care conduc la apoptoză [ 17 , 39 ]. Astfel, mecanismul (mecanismele) care conduc la apoptoză este complex și poate fi diferit printre toate liniile celulare care nu au expresia ASS.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f2.jpg

In situ testul de apoptoză de etichetare la linia celulară A375. R: control. B: după expunerea la 0,08 ug / ml timp de 72 ore. Celulele tratate suferă apopotoză care prezintă petele de maro în nuclee

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f3.jpg

Apoptoza detectată prin clivarea PARP în liniile celulare de melanom 4 (A375, Sk-mel-2, A2058 și MEL-1220). Celula netratată a prezentat PARP nevăzută la 116 kD, în timp ce celulele tratate au prezentat PARP scindat observat la 89 kD.

ADI-PEG20 inhibă producerea NO

Deoarece arginina este singurul substrat pentru sintetaza de oxid nitric [ 3 ], nu este surprinzător faptul că ADI-PEG20 inhibă producția de NO în lipopolizaharide și macrofage provocate de interferon [ 40 ].Această observație a fost de asemenea observată in vivo atunci când șoarecii au fost tratați cu TNF și endotoxină. 40 ]. Totuși, ADI-PEG20 nu a inhibat NO care produce eNOS [ 40 ]. Astfel, se pare că ADI-PEG20 poate fi utilizat ca modulator selectiv pentru NO care este produs de iNOS. Implicarea acestor rezultate asupra supraviețuirii celulelor tumorale / carcinogenezei nu a fost studiată. Pe de altă parte, NO poate inactiva în mod reversibil ASS prin S-nitrozulări atât in vitro, cât și in vivo [ 41 ]. Astfel, relația complexă a acestor parametri va necesita investigații suplimentare.

ADI-PEG20 inhibă angiogeneza

Efectul ADI asupra angiogenezei a fost investigat atât in vitro, cât și in vivo . Beloussow și colab. prima [ 42 ] a demonstrat efectul antiangiogen al ADI recombinant cu celulele endoteliale ale venei umane ombilicale cultivate (HUVEC). Park și colab. au folosit de asemenea HUVEC și ADI recombinant pentru a arăta că ADI ar putea inhiba angiogeneza într-o manieră dependentă de doză și acest efect inhibitor poate fi inversat prin alimentarea argininei înapoi în mediul de cultură [ 43 ]. Park și colab. a observat că ADI recombinant a exercitat inhibiția angiogenezei în studiile in vivo utilizând modelul de embrion pui și model de șoarece [ 43 ]. Această proprietate antiangiogenetică a ADI a sugerat o modalitate eficientă de tratare a tumorilor. Ei au arătat că ADI a fost capabil să inhibe creșterea celulelor tumorale utilizând liniile celulare CHO și HeLa. Mai mult, Gong și colab. 37 ] au arătat, de asemenea, că ADI a fost eficace în inhibarea creșterii neuroblastomului nefavorabil similar cu alți reactivi de blocare a angiogenezei. Interesant, ADI sau acești reactivi au fost capabili să potențeze efectul radioterapiei pentru această tumoare utilizând un model de șoarece.

ADI-PEG20 scade ticlul viral al hepatitei C

Izzo și colab . au raportat că ADI-PEG20 poate reduce titrul HCV până la 99% la pacienții cu HCV sero-5b de 5/10 cu o îmbunătățire ulterioară a funcției hepatice. Cu toate acestea, nu are efect asupra pacienților cu VHC de tip 2c [ 44 ]. Mecanismul exact al acestui lucru nu este cunoscut și poate fi legat de scăderea producției de NO.

ADI-PEG20 afectează semnalizarea mTOR

Se știe că deprivarea de nutrienți scade semnalul mTOR [ 45 – 47 ]. Acest lucru se datorează cel mai probabil scăderii ATP care conduce la activarea AMPK și, prin urmare, influențează negativ activitatea mTOR [ 48 ]. Este nesigur că este implicat complexul TSC1 / 2 [ 49 ]. Degradarea nutrițională influențează pozitiv asocierea mTOR cu raptorul, asocierea strânsă dintre mTOR și Raptor va diminua activitatea mTOR [ 50 ]. Am demonstrat că, după expunerea a 4 linii de celule melanom la ADI-PEG20 timp de 72 ore, fosforilarea 4E-BP este redusă substanțial în 3 linii celulare de melanom și într-o măsură mult mai mică în linia celulară A-2058 ( Fig.4A ). Mai mult, cantitatea de fosforilare a p-70S6 kinazei este de asemenea redusă la 72 ore ( Figura 4B ). În contrast, pAMPK care influențează negativ activitatea mTOR este foarte crescut la A-375 și Mel1220 la 72 de ore, dar este moderat crescut în A-2058 ( Figura 4C ). Nu există nici o schimbare în Sk-Mel 2; această linie celulară poate avea o modificare în LKB. Modificările în fosforilarea 4E-BP și fosforilarea kinazei P-70S6 nu sunt observate în linia celulară NSCLC și liniile celulare BJ-1 care posedă ASS. Astfel, deprivarea argininei în celulele melanomului ASS (-) are un impact negativ asupra semnalizării mTOR. Sa demonstrat că inhibarea mTOR a scăzut proliferarea celulară și contribuie la autofagie [ 51 ] care poate explica activitatea antitumorală a ADI-PEG20 în celulele melanomului

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f4.jpg

A). Activitatea mTOR a fost măsurată prin capacitatea sa de a 4E-BP fosforilat. Banda inferioară este forma nefosforilată. 4E-BP. 4E-BP are o fosfilare multiplă care descrie mai multe benzi observate. După tratamentul cu ADI-PEG la 0,6 ug / ml (81 UI / ml = 11,3 mg / ml) timp de 72 ore, forma majoră de 4E-BP este nefosforilată. B). fosforilarea p-70S6 kinazei reflectă de asemenea activitatea mTOR. După expunerea la ADI-PEG20 la 0,6 mg / ml, kinaza fosfo-p-70S6 a descrescut în A-375, Sk-Mel2, dar a crescut în A-2058, ceea ce indică fosforilarea altor proteine ​​din amonte. Mel-1220 are o fosforilare minimă a kinazei p-70S6 și, prin urmare, modificările nu sunt discernebile. C). fosfo-AMPK în liniile celulare de melanom 4 după expunerea la ADI-PEG20 pentru 72 ht. Trei linii celulare au crescut fosfo-AMPK, dar nici o schimbare în Sk-Mel 2.

Alte efecte biologice ale ADI

Deoarece arginina servește drept precursor pentru poliamină (ornitină, putrescină), deprivarea argininei poate produce biosinteza poliaminei. În acest sens, Shen și colab . au arătat că adăugarea de putrezină la ADI nu a afectat activitatea antitumorală a ADI, totuși a anulat efectul antitumoral al DFMO, un inhibitor de decarboxilază a ornitinei [ 10 ]. Mai mult, în celulele CHO care nu au expresia ASS, tratamentul cu ADI nu a afectat concentrația de poliamină intracelulară. Autorii au concluzionat că scăderea Km de ODC, precum și compensarea prin degradarea, efluxul și absorbția proteinelor ar putea fi responsabile de aprovizionarea cu arginină, iar concentrația argininei nu este critică pentru menținerea concentrației de poliamină intracelulară. Alte efecte ale deprivării argininei, inclusiv alte modificări ale proteinei, cum ar fi proteina de șoc termic și proteinele care sporesc susceptibilitatea celulară la apoptoză [ 52 ]. Recent, Graboa și colab . 53 ] a arătat că arginina poate juca un rol crucial în carcinogeneză.

De ce ASS nu este exprimat în anumite tipuri de tumori?

Gena ASS este localizată pe perechea de bază cromozom 9q34.1 132, 310,092 la 132,366,481. Există multe pseudogene (14 raportate) situate printre alte cromozomi [ 54 ]. Este posibil ca deleția cromozomului la această regiune în celulele tumorale să poată explica lipsa expresiei ASS. Totuși, în 4 linii celulare de melanom testate prin analiza Southern blot, a fost prezentă ADN ASS ( Figura 5 ). Cu toate acestea, este încă posibil ca promotorul să poată fi modificat și nu poate fi detectat prin analiza southernblot. Datele noastre [ 18 ] și alte lucrări publicate [ 15 , 17 ] indică faptul că lipsa proteinei ASS corespunde unor niveluri scăzute de exprimare a ARNm (care nu au fost detectate prin analiza northernblot). Recent, Szlosarek et al . au descoperit că liniile celulare mezoteliom care exprimă nivele scăzute de ASS au metilare promotor aberant CpG [ 17 ]. Autorii au concluzionat că reglarea epigenetică a transcripției ASS joacă un rol în controlul exprimării ASS observată în liniile celulare mezoteliom. Studiul nostru inițial de laborator nu a susținut acest concept în liniile celulare de melanom, iar 5-azacytidina, un agent de demethylație cunoscut, nu afectează expresia ASS în liniile celulare de melanom (Savaraj, date nepublicate). Astfel, întrebarea cheie care rămâne fără răspuns este motivul pentru care diferitele linii de celule tumorale posedă niveluri diferite de expresie ASS. ASS cADN a fost clonat în 1981 [ 55 ] și este foarte conservat între specii. Regiunea promotor la om și la șoareci a fost caracterizată parțial. La om, secvența de flancare 5 ‘prezintă multiple situsuri de legare SP-1, AP2, GCN4, NF-KappaB, Max1, Egr și altele [ 56 , 57 ]. Aceste site-uri de legare sunt, de asemenea, previzionate folosind instrumentul de căutare web AliBaba 2.1. În prezent, am clonat promotorul și am construit o serie de mutanți eliminați pentru a studia această întrebare. Deși proprietățile cinetice ale enzimei ASS au fost studiate pe larg și structura cristalină din bacterii a fost identificată [ 4 ], controlul transcripțional și translațional al genei ASS nu este bine înțeles. Au fost raportate două specii de ARNm mRNA care diferă în 5’UTR (baza de date Genbank).Studiile anterioare publicate indică faptul că reglementarea ASS are loc la niveluri pre-translaționale [ 4 ].S-a arătat că mulți factori influențează pozitiv și negativ gena ASS și pot fi specifici țesutului. Mai mulți anchetatori au demonstrat că glucocorticoidul, glucagonul și ciclina AMP măresc expresia ASS, în timp ce acizii grași reprimau expresia ASS [ 58-65 ]. Insulina și hormonul de creștere au o influență negativă asupra ASS în țesutul hepatic, dar nu au efect asupra altor țesuturi [ 66 – 68 ]. Citokinele, IL-Ib, interferonul și TGF-b pot, de asemenea, influența expresia ASS [ 69 , 70 ]. Recent, s-a arătat că glutamina stimulează exprimarea ASS în hepatocite de șobolan și celule Caco-2 prin O-glicozilarea lui Sp1. site-uri [ 71 ]. Expresia ASS a fost, de asemenea, arătată a fi reglementată de arginină [ 72 ]. În această privință, am demonstrat că în liniile de celule melanom expresia ASS este influențată de arginină în medii [ 18 ], dar nu este influențată nici de glucocorticoidul glutamină, nici de acizii grași (date nepublicate). Cu toate acestea, reglarea genei ASS este cel mai probabil diferită în diferite tipuri de tumori. În prezent, investigăm reglementarea ASS în celulele de melanom. Este de remarcat faptul că melanocitele umane normale (linia celulară HEM-1 și HEM-m obținute de la Sciencell) exprimă niveluri foarte scăzute de proteină ASS care este diferită de hepatocitele normale.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f5.jpg

Analiza Southernblot a ASS în liniile celulare de melanom 4 și în liniile celulare BJ-1. Toate cele cinci linii celulare prezintă niveluri similare de ADN ASS.

Exprimarea proteinei de melanom indusă de arginină

S-a demonstrat că nivelele de arginină pot regla expresia ASS în celulele limfoblastomului și celulele epiteliale. În mod similar, am descoperit că expunerea liniilor celulare de melanom la ADI-PEG20 sau medii libere de arginină cu supliment de citrulină și NH4CI2 timp de 3 zile, proteina ASS detectată prin Western blot a fost găsită în trei linii celulare. Cu toate acestea, nivelurile expresiei ASS sunt diferite: A2058 are mai multă expresie ASS (2,76 ori) urmată de Sk-Mel-2 (2,03) și A375 (1,52) în timp ce MEL-1220 nu este capabilă să producă proteină ASS. Cu toate acestea, după reaprovizionarea cu medii normale, expresia proteinei ASS este din nou reprimată [ 18 ]. Figura (6) a rezumat aceste constatări. Interesant, în liniile celulare (BJ-1 și NSCLCS) care exprima în mod constitutiv ASS, nivelurile de ASS nu s-au schimbat la expunerea la mediile fără arginină. Am studiat în continuare dacă creșterea proteinei ASS apare la nivelul de transcripție. Cu toate acestea, nu am putut detecta ARNm ASS prin analiza Northern blot ( figura 7 ). Am dezvoltat o metodă RT-PCR în timp real pentru a cuantifica exprimarea ARNm ARN, numai A-2058 a arătat o creștere a expresiei mRNA la 48 și 72 ore ( figura 8 ). Celelalte trei linii celulare, incluzând BJ-1 (fibroblaste umane normale), nu au prezentat o creștere a ARNm ASS la deprivarea argininei. AARN-ul ASS a revenit, de asemenea, la normal după plasarea celulelor înapoi în medii normale. Cu toate acestea, după expunerea continuă la mediile fără arginină, A-2058 este capabil să activeze o cantitate substanțială de ARNm care ar putea fi detectată prin analiza northernblot ( Figura 7 ).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f6.jpg

Imunoblot de proteină ASS în liniile celulare de melanom 4 (A375, Sk-mel-2, A2058 și MEL-1220) înainte și după expunerea mediului liber de arginină suplimentat cu citrulină și NH4CI timp de 24, 48 și 72 ore. După aceea, celulele au fost spălate și reumplete cu medii normale EMEM timp de 24, 48 și 72 ore. Banda 1: control.Lane 2: 24 de ore. pe suport liber de arginină Lane 3: 48 ore pe mediu liber de arginină Liniul 4: 72 ore pe mediu liber de arginină Litiu 5: Eliminarea mediului liber de arginină și schimbat în mediu EMEM normal timp de 24 de ore. Latima 6: 48 de ore. pe suporturi normale. Latima 7: 72 ore. pe suporturi normale. Rezultate similare s-au obținut cu medii fără arginină fără supliment de citrulină și medii tratate cu ADI-PEG20. cu citrulină și supliment de NH4CI.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f7.jpg

Analiza Northernblot a ASS într-un panou de linie de celule melanom și celule BJ-1. Linia 1: A375. Banda 2: A375 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 3: SK-Mel-2 Banda 4: Sk-Mel-2 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 5: MEL-1220. Banda 6: MEL-1220 după expunerea la ADI-PEG20 timp de 72 de ore. Linia 7: A2058. Banda 8: A2058 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 9: A2058R. Banda 10: BJ-1. Banda 11: BJ-1 după expunerea la ADI-PEG20 timp de 72 de ore.Notă: numai A2058R și BJ-1 posedă ARN mRNA de 1,9 kb și nu există diferențe în mRNA ASS în celulele BJ-1 după expunerea la ADI-PEG20.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f8.jpg

Nivelul de expresie relativ al mRNA ASS detectat cu PCR în timp real în diferite linii celulare în medii (-Arg) fără arginină, comparativ cu cel din mediul normal (+ Arg). Metoda de cuantificare utilizată a fost propusă de Pfaffl în Nucleic Acid Research, 29: 2002-2007. GAPDH a fost utilizat ca gene de referință. Orele de pe grafic indică timpul pentru care celulele au fost cultivate în medii -Arg sau + Arg.

Rezistența la ADI-PEG20 în melanom

Datele din linia de celule melanomului, precum și culturile primare obținute de la pacienți, se pare că liniile celulare sau culturile primare care se pot transforma în ARNm ASS după deprivarea argininei au cel mai probabil să dezvolte rezistență la ADI. Suntem capabili să generăm linia celulară rezistentă la ADI-PEG20 în A-2058, dar nu în A-375, Skmel-2 sau Mel 1220. Aceste trei linii celulare nu pot transforma ARNm ASS după privarea de arginină. Creșterea tranzitorie a proteinei ASS observată la A-375 și Sk-mel2 este mediată în principal prin creșterea tranzitorie a traducerii. După ce ARNm mRNA este indus până la o anumită măsură, expresia ASS devine stabilă și nu poate fi inversată ( figura 9 ). De ce anumite linii celulare pot activa rapid AARN mRNA nu este cunoscut și în prezent investigăm controlul transcripției ARNm al ASS.

Un fișier extern care conține o imagine, o ilustrație etc. Numele de obiect este nihms287629f9.jpg

Imunoblot de proteină ASS în A-2058R (rezistență la ADI) după cultură în mediu normal timp de 7 și 29 de zile. Expresia este stabilă fără modificări.

DIRECȚII DE LABORATOR VIITOARE

Lucrările din laboratorul nostru, precum și altele, sprijină activitatea antitumorală a ADI-PEG20 în tipurile de tumori ASS (-). Până în prezent, melanomul și hepatomul par a fi tumorile potrivite pentru această abordare datorită lipsei expresiei ASS. Anumite mezoteliom și cancerele celulare renale pot fi, de asemenea, luate în considerare pentru această abordare. Cu toate acestea, dezvoltarea rezistenței la medicament secundară exprimării ASS poate fi problematică, dar ar putea fi depășită. În prezent, dezvoltăm o metodă de identificare a acelor tumori care sunt negative ASS, dar pot fi induse după un tratament repetat. Aceste tumori vor necesita, cel mai probabil, un tratament combinat care va ucide celulele rapid și, prin urmare, celulele tumorale nu sunt capabile să activeze ASS. O altă posibilitate este de a inhiba expresia ASS utilizând o abordare farmacologică. În prezent investigăm aceste abordări diferite în melanom.

STUDII CLINICE CU ADI-PEG20

Am raportat un studiu de fază I / II cu ADI-PEG20 la pacienții cu melanom metastatic [ 73 ]. Au fost realizate două studii de escaladare a dozei de cohortă: un studiu de fază I în SUA și un studiu de fază I / II din Italia. Studiul de fază I din SUA a inclus 15 pacienți din 4 cohorte. Tratamentul ADI-PEG20 a constat în injecții intramusculare săptămânale în zilele 1, 15 și 22. Primele 3 cohorte au constat din 3 pacienți și fiecare cohortă a primit ADI-PEG20 la 20, 40 sau 80 U / m2. Ulterior, 6 pacienți au fost tratați la 160 U / m2, care a fost considerată o doză biologică optimă (OBD).

Cohorta italiană a înscris 24 de pacienți în studiul de fază I. Pacienții au fost înscriși într-una din cele șase cohorte. Primele 4 cohorte au constat din 3 pacienți fiecare și fiecare cohortă a fost tratată cu un ciclu ADI-PEG20 la 40, 80, 160 sau 320 U / m2. Șase pacienți au primit un ciclu ADI-PEG20 la 640 U / m2.Primul ciclu a fost compus din terapia din zilele 1, 15 și 22. Mai mult, 6 pacienți au fost tratați pe o cohorta de 3 cicluri care a constat din 4 injecții săptămânale la OBD.

Un obiectiv al acestor studii a fost determinarea farmacocineticii / farmacodinamicii, siguranța și activitatea antitumorală a medicamentului. Studiile farmacocinetice / farmacodinamice au arătat că o doză de ADI-PEG20 la 160 U / m2 a redus nivelul argininei plasmatice de la un nivel de bază de aproximativ 130 μmol / L la mai puțin de 2 μmol / L timp de cel puțin 7 zile. Mai mult, nivelurile plasmatice ale oxidului de azot au scăzut, de asemenea, fără efect măsurabil asupra tensiunii arteriale sau a frecvenței cardiace.

În acest studiu clinic nu au fost atribuite toxicități de gradul 3 sau 4. Cel mai frecvent efect secundar a fost disconfort ușor la locul injectării. Doi pacienți au avut hipotensiune în decurs de 20-40 de minute de tratament. Unul dintre pacienți a prezentat o istorie de hipertensiune arterială și a prezentat medicamente antihipertensive. Celălalt pacient a prezentat hipotensiune după cea de-a patra injectare de ADI-PEG20, dar a primit șase tratamente suplimentare ale medicamentului fără recidiva hipotensiunii. Anomaliile din testele de laborator care au fost observate în timpul studiului includ niveluri ridicate ale acidului uric în sânge, creșterea ușoară a nivelului de fibrinogen din sânge și creșterea rar a nivelurilor de lipază serică și amilază. Niciun pacient nu a prezentat semne clinice de pancreatită.

Din punct de vedere al răspunsului, niciunul dintre cei 15 pacienți înscriși în studiul de fază I din SUA nu a răspuns. În faza italiană I / II a studiului, 6 din 24 de pacienți cu fază I / II au răspuns la tratament, incluzând un răspuns complet și 5 răspunsuri parțiale, pentru o rată de răspuns totală de 25%. Paisprezece pacienți au avut o boală stabilă pentru ≥ 1 ciclu de terapie și 6 pacienți au avut boală stabilă timp de 3 luni de la studiu. Toți pacienții cu boală sau răspuns stabil au primit OBD sau o doză mai mare de ADI-PEG20.

Un obiectiv al studiului a fost de a investiga imunogenitatea ADI-PEG20. În ceea ce privește imunogenitatea medicamentului, niciunul dintre pacienți nu a dezvoltat activitate măsurată enzimatic neutralizând anticorpul în probele de plasmă. Acest lucru este în concordanță cu lipsa reacțiilor alergice observate clinic. În ceea ce privește doza maximă tolerată, 6 pacienți au fost tratați la doza cea mai mare de 640 U / m2 intramuscular săptămânal. Cu excepția disconfortului la locul de injectare (gradul 1), nu s-au observat efecte toxice majore. Întrucât 640U / m2 a fost cea mai mare doză care s-a putut administra cu ușurință prin injecție intramusculară, s-a concluzionat că doza maximă tolerată depășea doza care ar putea fi administrată convenabil pe această cale.

În prezent, efectuăm un studiu de fază II cu ADI-PEG20 în melanom avansat, utilizând o doză săptămânală de 160 U / m2 intramuscular. Rezultatele preliminare din acest studiu au fost prezentate (ASCO, 2005).Douăzeci de pacienți cu melanom local avansat sau metastatic au fost tratați până acum. În ceea ce privește răspunsul, 4 pacienți au avut un răspuns parțial, iar 3 pacienți au avut un răspuns minor (<50% reducere) pentru o rată de control a tumorii de 35%. În plus, 3 pacienți au prezentat un răspuns mixt sugerând dovezi ale activității antitumorale.

 Interesant, un pacient care a avut un răspuns parțial la o doză de 160 U / m 2 a avut progresie săptămânală a bolii. Doza a crescut și pacientul a răspuns din nou la tratament. Acest lucru sugerează că poate exista un răspuns la doză sau poate dezvoltarea rezistenței la medicament datorită anticorpului de neutralizare care a fost depășit de doza crescută de medicament. 

Locurile de răspuns includ plămânul, boala nodală, țesutul moale și pielea. Acest lucru nu este neașteptat, deoarece pacienții cu boală în aceste organe au mai multe șanse de reacție decât pacienții cu alte boli viscerale. Am observat un răspuns mixt la un pacient cu metastaze hepatice extensive utilizând ADI-PEG20.

În ceea ce privește toxicitatea, un pacient a prezentat neutropenie de gradul 3, care a fost rezolvată atunci când medicamentul a fost oprit. Un alt pacient a avut grade neutropenie ¾. Ulterior, el a primit filgrastim la fiecare 2 săptămâni, ceea ce a împiedicat complet neutropenia și ia permis să continue să primească săptămânalul ADI-PEG20. Alte toxicități au fost ușoare și, în principal, au constat în oboseală și disconfort la locul injectării. Nu au fost observate alopecie, greață, vărsături, diaree sau toxicitate majoră la organe.Niciun pacient nu a oprit medicamentul din cauza toxicității.

Datele preliminare sugerează că prezența expresiei ASS în tumoare poate prezice răspunsul la ADI-PEG20.Doi pacienți au avut probe de tumori de melanom testate pentru exprimarea ASS înainte de tratament și au fost ASS (-). Ambii pacienți au avut un răspuns clinic la ADI-PEG20, dar au dezvoltat mai târziu progresia bolii. Eșantioanele de tumoare au fost obținute la momentul progresiei bolii și tumora a fost colorată ASS pozitivă. Un pacient a cărui tumoare de melanom a fost colorat cu ASS pozitiv înainte de ADI-PEG20 nu a răspuns la tratament. Cu toate acestea, 7 din 11 pacienți a căror tumoare au fost ASS (-) înainte de tratament aveau dovezi ale activității antitumorale (răspuns parțial, minor sau mixt) cu ADI-PEG20. Acest studiu continuă să acumuleze pacienți și este nevoie de investigații suplimentare pentru a confirma corelația dintre expresia ASS a tumorii și răspunsul clinic la tratament.

ADI-PEG20 a fost de asemenea studiat în studiile clinice la pacienții cu carcinom hepatocelular inoperabil. Un pacient cu carcinom hepatocelular inoperabil a fost tratat cu doze escaladate de ADI-PEG20 ca o scutire unică a pacientului [ 74 ]. Tumoarea a redus în dimensiune și a existat o reducere a nivelurilor serice ale alfa-fetoproteinei. Nu a fost observată toxicitate datorată medicamentului. Acest răspuns încurajator a condus la un studiu de fază I / II cu ADI-PEG20 la pacienții cu carcinom hepatocelular inoperabil [ 75 ]. Pacienții cu carcinom hepatocelular au fost acumulați de la Institutul de Cancer Pascale din Napoli, Italia. Nouăzeci de pacienți au fost înscriși în studiu în 1 din 4 cohorte. Nivelurile dozelor inițiale ale ADI-PEG20 au fost 20, 40, sau 80 U / m 2. Pacienții ulterioare au fost tratați cu o doză inițială de 160 U / m 2 , care a fost determinată să fie doza biologică optimă , care a redus nivelul argininei plasmatice la niveluri nedetectabile (<2 pM / L) timp de cel puțin 7 zile. Din punct de vedere al răspunsului, 2 pacienți au răspuns complet și 7 pacienți au răspuns parțial la o rată de răspuns totală de 47%. Durata răspunsului a fost definită ca timpul de la începerea tratamentului până la progresie. Durata mediană a răspunsului a fost> 400 zile (interval: 37 până la> 680 zile). În ceea ce privește toxicitatea, efectele secundare includ durerea la locul injectării, creșterea acidului uric seric și a fibrinogenului și creșterea în mod ocazional a nivelurilor de lipază serică și amilază. Nu au apărut semne clinice de pancreatită. Nu a fost găsită nicio dovadă a producerii de anticorpi neutralizanți.

Un al doilea studiu de fază I / II al ADI-PEG20 săptămânal a fost efectuat la spitalul MD Anderson (ASCO, 2005). Faza I a studiului a implicat creșterea dozei de medicament până la 160 U / m 2 . Partea din faza a II-a a testului a utilizat o doză inițială de 160 U / m 2 care a fost considerată OBD, dar a permis o creștere a dozei de până la ≤240 U / m 2. Treizeci și cinci de pacienți au fost înscriși în studiu. În ceea ce privește răspunsul, un pacient a avut un răspuns care a permis pacientului să fie rezistent. În plus, 16 pacienți aveau boală stabilă. Patru pacienți nu au efectuat studiul din cauza reacției alergice sau a bolii intercurente. Douăsprezece opt pacienți au prezentat progresia bolii. Timpul mediu raportat pentru progresie a fost de 3,4 luni, cu un interval de 1 până la 13 luni. Toți pacienții au avut niveluri plasmatice ale argininei nedetectabile după tratamentul ADI-PEG20 (<2 pM). Pentru un pacient care a avut un răspuns și a devenit rezistent, moartea a apărut datorită trombozei venoasei portal și eșecului viu rezultat. Autopsia a arătat o tumoare viabilă minimă rămasă.

În ceea ce privește toxicitatea, efectele secundare au fost mai pronunțate în comparație cu studiul de fază I din Italia. Doisprezece pacienți aveau toxicitate de gradul 3 constând în principal din funcția hepatică sau anomaliile electrolitice serice. În plus, 3 pacienți aveau toxicitate de gradul 4 care constau în anomalii ale funcției hepatice sau în creșterea lipazei serice. Ulterior, am participat la testul de fază 2B a ADI-PEG20 la pacienții cu carcinom hepatocelular nerezecabil, în colaborare cu Institutul de Cancer Pascale. Pacientii au primit ADI-PEG20 la 80 sau 160 U / m 2. Obiectivul primar a fost supraviețuirea globală. O analiză intermediară a arătat că supraviețuirea mediană din momentul diagnosticului a fost de 11,7 luni, iar supraviețuirea mediană de la primul tratament a fost de 8,8 luni. Rata de supraviețuire de 12 luni a fost de 36,7%. Aceste numere sunt comparabile cu cele raportate de Institutul de Cancer Pascale și de la un studiu de fază I / II raportat de MD Anderson [ 75 ]. Interesant, din cei 9 pacienti tratati la Universitatea din Miami, doi pacienti au avut boala stabila timp de cel putin 12 luni. Un pacient a prezentat o boală stabilă timp de un an, iar celălalt pacient a prezentat o boală stabilă timp de> 2 ani, fără efecte secundare observate în urma tratamentului, cu excepția disconfortului la locul injectării. Acest pacient continuă să primească tratament cu injecții săptămânale ADI-PEG20.

CONCLUZII FINALE

Lipsa de arginină este o abordare nouă și promițătoare orientată spre tratamentul anumitor tumori care nu pot forma arginină din ciclul ureei și, prin urmare, sunt auxotrofice pentru arginină. În special, melanomul și carcinomul hepatocelular și, eventual, anumite mezoteliomuri și cancerele celulare renale pot fi sensibile la această terapie. In timp ce noi terapii sunt in curs de aparitie pentru cancerul de celule renale, alte tipuri de cancer sunt dificil de tratat cu terapie de droguri si pentru pacientii cu boala neresectable, ratele de raspuns si supravietuirea globala ramane saraca. Astfel, există o mare nevoie de a dezvolta noi terapii de droguri pentru aceste boli maligne.

Datorită incidenței scăzute a efectelor secundare majore, cum ar fi supresia mieloidă și toxicitatea gastrointestinală sau alte efecte toxice asupra organelor, deprivarea argininei poate fi ușor combinată cu alți agenți anti-cancer pentru a crește rata de răspuns. Datele noastre in vitro de laborator sugerează că ADI-PEG20 poate fi sinergic cu agenții de distrugere a ADN-ului, cum ar fi cisplatina și temozolomida (AACR, 2007). Acest lucru pare a fi din cauza incapacității ASS (-) Pentru MDR1, primerii au fost MDR1 secvențe specifice GGAGTGTCCGTGGATCACAAG (resturile 1909-1930) și TGTTCAGGATCATCAATTCTTGT (resturile 2218-2241). Acești primeri au fost selectați în regiuni care sunt doar 36,4 și 37,5% similare cu regiunea corespunzătoare a ADNc mdr-3 . Astfel, ei nu ar trebui să recunoască mdr-3gena. Produsul PCR rezultat din acești primeri a fost de 232 bp. celulele tumorale pentru repararea ADN-ului în absența argininei. Combinația dintre ADI-PEG20 și acești agenți de deteriorare a ADN-ului și alte medicamente sunt în prezent studiate pentru un studiu clinic viitor.

Dezvoltarea rezistenței la medicament datorată inducerii expresiei genei ASS este o problemă potențială în anumite tumori. Această formă de rezistență poate fi depășită prin înțelegerea controlului transcripției / translației acestei gene. Se investighează manipularea farmacologică pentru controlul expresiei ASS și prevenirea rezistenței la medicament în laboratorul nostru.

Logo-ul nihpa

About Author manuscripts Submit a manuscript HHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Curr Pharm Des . Manuscris de autor; disponibil în PMC 2011 17 mai.
Publicat în formularul final modificat ca:
PMCID: PMC3096551
NIHMSID: NIHMS287629
PMID: 18473854
Lipsirea de arginină ca terapie orientată pentru cancer
L. Feun , 1, * M. Tu , 1 CJ Wu , 1 MT Kuo , 2 M. Wangpaichitr , 1 S. Spector , 3 și N. Savaraj 1, 4

Abstract

Recunoasteri

Această lucrare este susținută de un grant (R01CA109578) de la NIH și un grant de cercetare de la VA. Dorim să mulțumim companiei Polaris Inc. pentru furnizarea ADI-PEG20 și analiza argininei și citrulinei.

Referințe

1. Asselin BL. Adv Exp Med Biol. 1999; 457 : 621-9. PubMed ] Google Scholar ]
2. Muller HJ, Boos J. Crit Rev Oncol Hematol. 1998; 28 : 97-113. PubMed ] Google Scholar ]
3. Wu G, Morris SM., Jr Biochem J. 1998; 336 (Pt1): 1-17. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
4. Husson A, Brasse-Lagnel C, Fairand A, Renouf S, Lavoinne A. Eur J Biochem. 2003; 270 : 1887-99. PubMed ] Google Scholar ]
5. Lind DS. J Nutr. 2004; 134 : 2837S-2841S. discuție 2853S. PubMed ] Google Scholar ]
6. Morris SM., Jr Am J Clin Nutr. 2006; 83 : 508S-512S. PubMed ] Google Scholar ]
7. Caso G, McNurlan MA, McMillan ND, Eremin O, Garlick PJ. Clin Sci (Londra) 2004; 107 : 371-9. PubMed ] Google Scholar ]
8. Gonzalez GG, Byus CV. Cancer Res. 1991; 51 : 2932-9. PubMed ] Google Scholar ]
9. Wheatley DN, Campbell E. Br J Cancer. 2003; 89 : 573-6. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
10. Shen LJ, Beloussow K, Shen WC. Cancer Lett. 2006; 231 : 30-5. PubMed ] Google Scholar ]
11. Shen LJ, WC Lin, Beloussow K, Shen WC. Cancer Lett. 2003; 191 : 165-70. PubMed ] Google Scholar ]
12. Wheatley DN. Semin Cancer Biol. 2005; 15 : 247-53. PubMed ] Google Scholar ]
13. Wheatley DN. Medicamente anticanceroase. 2004; 15 : 825-33. PubMed ] Google Scholar ]
14. wheatley DN, Campbell e, Lai PBS, Cheng PNM. Terapia genică și biologia moleculară. 2005; 9 : 33-40. Google Scholar ]
15. Ensor CM, Holtsberg FW, Bomalaski JS, Clark MA. Cancer Res. 2002; 62 : 5443-50. PubMed ] Google Scholar ]
16. Yoon CY, Shim YJ, Kim EH, Lee JH, Won NH, Kim JH, și colab. Int J Cancer. 2007; 120 : 897-905. PubMed ] Google Scholar ]
17. Szlosarek PW, Klabatsa A, Pallaska A, Sheaff M, Smith P, Crook T, și colab. Clin Cancer Res. 2006;12 : 7126-31. PubMed ] Google Scholar ]
18. Savaraj N, Wu C, Kuo M, You M, Wangpaichitr M, Robles C, și colab. Datele despre obiectivele de droguri. 2007; 2 : 119-128. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
19. Philip R, Campbell E, Wheatley DN. Br J Cancer. 2003; 88 : 613-23. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
20. Scott L, Lamb J, Smith S, Wheatley DN. Br J Cancer. 2000; 83 : 800-10. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
21. Takaku H, Takase M, Abe S, Hayashi H, Miyazaki K. Int J Cancer. 1992; 51 : 244-9. PubMed ] Google Scholar ]
22. Takaku H, Misawa S, Hayashi H, Miyazaki K. Jpn J Cancer Res. 1993; 84 : 1195-200.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
23. Takaku H, Matsumoto M, Misawa S, Miyazaki K. Jpn J Cancer Res. 1995; 86 : 840-6.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
24. Sugimura K, Ohno T, Kusuyama T, Azuma I. Melanoma Res. 1992; 2 : 191-6. PubMed ] Google Scholar ]
25. Sugimura K, Ohno T, Fukuda S, Wada Y, Kimura T, Azuma I. Cancer Res. 1990; 50 : 345-9. PubMedGoogle Scholar ]
26. Dillon BJ, Holtsberg FW, Ensor CM, Bomalaski JS, Clark MA. Med Sci Monit. 2002; 8 : BR248-53. PubMed ] Google Scholar ]
27. Wheatley DN, Philip R, Campbell E. Mol Cell Biochem. 2003; 244 : 177-85. PubMed ] Google Scholar ]
28. Currie GA, Gyure L., Cifuentes L. Br J Cancer. 1979; 39 : 613-20. Articolul gratuit PMC ] [ PubMedGoogle Scholar ]
29. Storr JM, Burton AF. Br J Cancer. 1974; 30 : 50-9. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
30. Cheng PN, Lam TL, Lam WM, Tsui SM, Cheng AW, Lo WH și colab. Cancer Res. 2007; 67 : 309-17. PubMed ] Google Scholar ]
31. Gong H, Zolzer F, von Recklinghausen G, Havers W, Schweigerer L. Leukemia. 2000; 14 : 826-9. PubMed ] Google Scholar ]
32. Gong H, Zolzer F, von Recklinghausen G, Rossler J, Breit S, Havers W, și colab. Biochem Biophys Res Commun. 1999; 261 : 10-4. PubMed ] Google Scholar ]
33. Noh EJ, Kang SW, Shin YJ, Choi SH, Kim CG, Park IS și colab. Int J Cancer. 2004; 112 : 502-8. PubMed ] Google Scholar ]
34. Shen LJ, Shen WC. Curr Opin Mol Ther. 2006; 8 : 240-8. PubMed ] Google Scholar ]
35. Holtsberg FW, Ensor CM, Steiner MR, Bomalaski JS, Clark MA. J Comunicat de control. 2002; 80 : 259-71. PubMed ] Google Scholar ]
36. Dillon BJ, Prieto VG, Curley SA, Ensor CM, Holtsberg FW, Bomalaski JS, și colab. Cancer. 2004; 100: 826-33. PubMed ] Google Scholar ]
37. Gong H, Pottgen C, Stuben G, Havers W, Stuschke M, Schweigerer L. Int J Cancer. 2003; 106 : 723-8.PubMed ] Google Scholar ]
38. Kang SW, Kang H, Park IS, Choi SH, Shin KH, Chun YS și colab. Celulele Mol. 2000; 10 : 331-7. PubMed ] Google Scholar ]
39. Szlosarek P, Klabatsa A, Pallaska A, Sheaf fM, Balkwell F, Fennell D. Proc Am Assoc Can Res. Washington D. C, SUA: 2006. Google Scholar ]
40. Shen LJ, Lin WC, Beloussow K, Hosoya K, Terasaki T, Ann DK, și colab. Biochem Pharmacol. 2003;66 : 1945-52. PubMed ] Google Scholar ]
41. Hao G, Xie L, Gross SS. J Biol Chem. 2004; 279 : 36192-200. PubMed ] Google Scholar ]
42. Beloussow K, Wang L, Wu J, Ann D, Shen WC. Cancer Lett. 2002; 183 : 155-62. PubMed ] Google Scholar ]
43. Park IS, Kang SW, Shin YJ, Chae KY, Park MO, Kim MY și colab. Br J Cancer. 2003; 89 : 907-14.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
44. Izzo F, Montella M, Orlando AP, Nasti G, Beneduce G, Castello G, și colab. J Gastroenterol Hepatol.2007; 22 : 86-91. PubMed ] Google Scholar ]
45. Sarbassov DD, Ali SM, Sabatini DM. Curr Opin Cell Biol. 2005; 17 : 596-603. PubMed ] Google Scholar ]
46. Tokunaga C, Yoshino K, Yonezawa K. Biochem Biophys Res Commun. 2004; 313 : 443-6. PubMed ] Google Scholar ]
47. Guertin DA, Sabatini DM. Cancer Cell. 2007; 12 : 9-22. PubMed ] Google Scholar ]
48. Kimura N, Tokunaga C, Dalal S, Richardson C, Yoshino K, Hara K și colab. Genele Celule. 2003; 8 : 65-79. PubMed ] Google Scholar ]
49. Smith EM, Finn SG, Tee AR, Browne GJ, Proud CG. J Biol Chem. 2005; 280 : 18717-27. PubMed ] Google Scholar ]
50. Nobukuni T, Joaquin M, Roccio M, Dann SG, Kim SY, Gulati P, și colab. Proc Natl Acad Sci SUA A.2005; 102 : 14238-43. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
51. Pattingre S, Espert L, Biard-Piechaczyk M, Codogno P. Biochimie. 2007. Google Scholar ]
52. Lenaerts K, Renes J, Bouwman FG, Noben JP, Robben J, Smit E, și colab. Proteomica. 2007; 7 : 565-77. PubMed ] Google Scholar ]
53. Grabon W. Postepy Hig Med Dosw (online) 2006; 60 : 483-9. PubMed ] Google Scholar ]
54. Carritt B, Povey S. Cytogenet Cell Genet. 1979; 23 : 171-81. PubMed ] Google Scholar ]
55. Su TS, Bock HG, O’Brien WE, Beaudet AL. J Biol Chem. 1981; 256 : 11826-31. PubMed ] Google Scholar ]
56. Jinno Y, Matuo S, Nomiyama H, Shimada K, Matsuda I. J Biochem (Tokyo) 1985; 98 : 1395-403. PubMed ] Google Scholar ]
57. Anderson GM, Freytag SO. Mol Cell Biol. 1991; 11 : 1935-43. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
58. Haggerty DF, Spector EB, Lynch M, Kern R, Frank LB, Cederbaum SD. J Biol Chem. 1982; 257 : 2246-53. PubMed ] Google Scholar ]
59. Gebhardt R., Mecke D. Eur J Biochem. 1979; 97 : 29-35. PubMed ] Google Scholar ]
60. Lin RC, Snodgrass PJ, Rabier D. J Biol Chem. 1982; 257 : 5061-7. PubMed ] Google Scholar ]
61. Ulbright C, Snodgrass PJ. Arch Biochem Biophys. 1993; 301 : 237-43. PubMed ] Google Scholar ]
62. Morris SM, Jr, Moncman CL, Rand KD, Dizikes GJ, Cederbaum SD, O’Brien WE. Arch Biochem Biophys. 1987; 256 : 343-53. PubMed ] Google Scholar ]
63. Nebes VL, Morris SM., Jr Mol Endocrinol. 1988; 2 : 444-51. PubMed ] Google Scholar ]
64. Husson A, Bouazza M, Buquet C, Vaillant R. Biochem J. 1983; 216 : 281-5. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
65. Tomomura M, Tomomura A, Dewan MA, Saheki T. FEBS Lett. 1996; 399 : 310-2. PubMed ] Google Scholar ]
66. Grofte T, Wolthers T, Jensen SA, Moller N, Jorgensen JO, Tygstrup N, și colab. Hepatologie. 1997; 25 : 964-9. PubMed ] Google Scholar ]
67. McLean P, Novello F. Biochem J. 1965; 94 : 410-22. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
68. Grofte T, Jensen DS, Gronbaek H, Wolthers T, Jensen SA, Tygstrup N, și colab. Am J Physiol. 1998;275 : E79-86. PubMed ] Google Scholar ]
69. Hattori Y, Shimoda S, Gross SS. Biochem Biophys Res Commun. 1995; 215 : 148-53. PubMed ] Google Scholar ]
70. Zhang WY, Gotoh T, Oyadomari S, Mori M. Brain Res Mol Brain Res. 2000; 83 : 1-8. PubMed ] Google Scholar ]
71. Brasse-Lagnel C, Fairand A, Lavoinne A, Husson A. J Biol Chem. 2003; 278 : 52504-10. PubMed ] Google Scholar ]
72. Jackson MJ, Allen SJ, Beaudet AL, O’Brien WE. J Biol Chem. 1988; 263 : 16388-94. PubMed ] Google Scholar ]
73. Ascierto PA, Scala S, Castello G, Daponte A, Simeone E, Ottaiano A, și colab. J Clin Oncol. 2005; 23 : 7660-8. PubMed ] Google Scholar ]
74. Curley SA, Bomalaski JS, Ensor CM, Holtsberg FW, Clark MA. Hepatogastroenterology. 2003; 50 : 1214-6. PubMed ] Google Scholar ]
75. Izzo F, Marra P, Beneduce G, Castello G, Vallone P, De Rosa V, și colab. J Clin Oncol. 2004; 22 : 1815-22. PubMed ] Google Scholar ]

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3096551/

O formulare a pro-enzimelor pancreatice oferă o eficacitate potentă anti-tumorală: un studiu pilot axat pe cancerul pancreatic și ovarian

Abstract

Enzimele proteolitice au demonstrat eficacitate în tratamentul cancerului. Prezentăm o combinație a celor două pro-enzime Trypsinogen și Chymotrypsinogen A cu eficacitate antitumorală in vitro și in vivo . A fost determinat un efect sinergic anti-tumoral pentru Trypsinogen și Chimotripsinogenul A la un raport 1: 6 (denumit PRP) utilizând 24 de linii celulare de cancer uman. Efectul antiangiogen al PRP a fost analizat prin formarea de tuburi bazate pe matrigel și prin teste de formare a capsulelor fibroase. Mai mult, au fost efectuate teste de invazie celulară și de vindecare a rănilor împreună cu determinarea qRT-PCR a markerilor de tranziție epitelial-mezenchimică (EMT) pe celule canceroase umane tratate cu PRP. În plus, au fost puse în aplicare studii farmacocinetice in vivo , iar eficacitatea antitumorală a PRP a fost studiată împotriva tumorilor ortotopice de cancer pancreatic și ovarian. Formularea PRP s-a dovedit a inhiba angiogeneza in vitro , creșterea tumorii, migrația celulelor canceroase și invazivitatea; și să fie un tratament anti-tumoral in vivo eficient și bine tolerat. În cele din urmă, eficacitatea clinică a unei formulări de supozitoare care conține atât pro-enzime pancreatice în contextul unei scheme speciale farmaceutice britanice a fost evaluată la pacienții cu cancer avansat. În consecință, PRP ar putea avea aplicații clinice oncologice relevante pentru tratamentul adenocarcinomului pancreatic avansat sau metastatic și a cancerului ovarian epitelial avansat.

Introducere

Cancerul este a doua cauză de deces în SUA. Potrivit Societății Americane de Cancer, 42% dintre bărbați și 37% dintre femei sunt expuși riscului de a dezvolta cancer în timpul vieții lor. Cancerul pancreatic reprezintă aproximativ 3% din toate cazurile de cancer din SUA și aproximativ 7% din decesele provocate de cancer, în timp ce cancerul ovarian se află pe locul cinci în decesele cauzate de cancer în rândul femeilor, ceea ce reprezintă mai multe decese decât orice alt cancer al sistemului reproducător feminin.Deoarece numai 10% din decesele provocate de cancer sunt cauzate de tumora primară, provocarea terapeutică este tumora metastatică sau secundară, care este generată de răspândirea celulelor canceroase inițiată de pierderea moleculelor de adeziune care țin tumora în țesutul inițial 1 . În anii următori, procesul de tranziție epitelial până la mezenchimie (EMT) a fost propus ca eveniment inițial pentru metastazarea tumorii 2 . De fapt, atunci când o celulă cancerică își pierde proprietățile epiteliale pentru a dobândi un fenotip mezenchimic, dobândește o șansă crescută de a migra către alte țesuturi 3 . Astfel, dezvoltarea de noi strategii terapeutice care modulează progresia EMT în celulele canceroase a devenit, în ultimii ani, o prioritate cu aplicabilitate clinică largă.

Deși aplicarea terapeutică a enzimelor pancreatice a fost propusă cu mai mult de 100 de ani în urmă 4 și combinația de enzime proteolitice a demonstrat eficacitate în tratamentul cancerului 5,6 , cele mai multe abordări se bazează pe combinația mai multor enzime proteolitice, ceea ce ar putea crește probabilitatea de nedorite și evenimente neprevăzute. Recent, am demonstrat că tratamentul celulelor canceroase umane cu Trypsinogen (T) și Chimotripsinogenul A (C) are ca rezultat o creștere a adeziunii celulare, o atenuare a câtorva markeri asociate cu EMT și o creștere a expresiei mai multor asocieri asociate diferențierii markeri, sugerând obținerea unui fenotip mai puțin malign 7 . În plus, studiile retrospective de cohortă clinică la pacienții cu cancer au demonstrat că terapia cu enzime pe cale orală a redus în mod semnificativ efectele secundare și simptome induse de tumori și terapie, cum ar fi greața, tulburările gastrointestinale, oboseala, pierderea în greutate și agitația și, (QoL) de pacienți cu cancer 8 – 10 .

Aici, prezentăm studii aprofundate in vitro și in vivo pentru a investiga eficacitatea antitumorală a unei formulări pro-enzime constând dintr-o combinație de Trypsinogen și Chymotrypsinogen A într-un raport sinergie. În primul rând, am testat efectul antiproliferativ pentru combinarea T și C în 24 de linii de celule canceroase și am determinat un raport sinergie pentru T și C (1: 6), care a fost definit ca PRP. În al doilea rând, am evaluat efectul antiangiogenic in vitro al acestei formulări, prin testul de formare a tubului cu agar moale și in vivo utilizând testul AngioChamber ™, care se bazează pe procesul fiziologic normal de vindecare a rănilor, pentru a promova formarea capsulelor fibroase în jurul o cameră de teflon care eliberează factorul de creștere 11 . În al treilea rând, pentru a analiza efectul anti-metastatic al tratamentului pro-enzimatic, am studiat efectul PRP în invazia celulară, migrarea celulelor și în modularea genelor legate de EMT în celulele cancerului pancreatic și ovarian. Mai mult, efectuăm un studiu farmacocinetic PRP in vivo și am evaluat eficacitatea anti-tumorală a PRP în modelele de cancer murinic. În acest scop, am tratat șoareci inoculați ortotopic cu celule de cancer ovarian uman A2780 sau cu celule tumorale pancreatice pancreatice de tip Pan02 cu PRP. În cele din urmă, raportăm aici eficacitatea clinică la 46 de pacienți cu boală malignă avansată de origine diferită, tratați cu o formulare rectală de pro-enzime pancreatice.

Rezultate

Determinarea raportului optim pro-enzimatic

În acest studiu, am determinat mai întâi concentrațiile inhibitorii jumătate maxime (IC50) ale tripsinogenului și chitomicroscopic A ca efect unic al unui articol de testare, într-un grup extins de 24 de linii celulare de cancer uman. Valorile IC50 ale tripsinogenului au constituit baza pentru calculul raporturilor de concentrație pentru combinația între Trypsinogen și Chymotrypsinogen A la 1: 1, 1: 2, 1: 4, 1: 6, 1: 8 și 1:10. La aceste rapoarte, proprietățile de inhibare a creșterii combinației au fost evaluate în 24 de linii de celule canceroase. Pe baza coeficienților de interacțiune medicamentoasă (CDI), combinația Trypsinogen plus Chymotrypsinogen A a demonstrat o inhibare mai mare a creșterii la raporturi de 1: 4, 1: 6 și 1: 8, comparativ cu raportul 1: 1 în toate liniile celulare testate, 786-O, G-361, BT-474 și celulele tumorale HL-60 (figura 1 , tabelul suplimentar S4 ). În final, s-a constatat că un raport T: C = 1: 6 al ambelor pro-enzime este optim și a fost utilizat pentru următoarele experimente. Tabelul suplimentar S5 rezumă valorile IC50 ale liniilor celulare utilizate pentru experimentele in vitro .

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig1_HTML.jpg

Determinarea coeficienței interacțiunii medicamentoase. Testele combinate de Trypsinogen și Chymotrypsinogen au fost realizate în rapoarte de 1: 1, 1: 2, 1: 4, 1: 6, 1: 8 și 1:10. Graficele reprezentative arată un raport optim sinergic pro-enzimatic al tripsinogenului cu chitomoplasinogenul ca 1: 6.

Eficacitatea antiangiogenă a formulării proenzimelor pancreatice

Pentru a determina dacă terapia enzimatică afectează angiogeneza, s-a utilizat un test de formare a tubului cu agar moale. Celulele endoteliale de control ale celulelor venei ombilicale de control (HUVEC) au fost organizate în clustere după 3 ore și au început să formeze structuri asemănătoare tubului după 5 ore, care au fost clar evidente după 24 de ore ( Fig.2A ). Dimpotrivă, HUVEC-urile tratate cu PRP au prezentat o reducere semnificativă a numărului și lungimii tuburilor capilare închise într-o manieră dependentă de concentrație, cu o dispariție totală a structurilor după tratamentul cu T / C 0,07 / 0,42 mg / ml (Figura 2A ) .Pentru a evalua dacă inhibarea formării structurilor tubulare asemănătoare ar putea fi determinată de moartea celulelor cauzată de tratamentul cu PRP, Kitul de Viabilitate / Citotoxicitate LIVE / DEAD a fost utilizat pentru a identifica celulele viabile. Așa cum s-a apreciat în figura 2B , atât celulele de control, cât și cele tratate cu PRP au prezentat o colorare verde, ceea ce indică faptul că inhibarea cordoanelor celulare a fost independentă de viabilitatea celulară.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig2_HTML.jpg

Testarea formării tubului de angiogeneză. A ) Imagini reprezentative de microscopie ușoară a HUVEC în analizele Matrigel ™. Celulele HUVEC au fost crescute pe Matrigel și după 5 ore și după 24 de ore de tratament cu T / C 0,035 / 0,21 (mg / ml) sau T / C 0,07 / 0,42 (mg / ml) a fost evaluată formarea structurilor capilare. B ) Testul de viabilitate celulară a fost efectuat prin măsurarea celulelor metabolice active colorate cu Calcein AM. Imaginile reprezentative fluorescente ale celulelor de control HUVEC (CTR) și celulelor tratate (T / C 0,07 / 0,42 mg / ml) după 24 h sunt arătate, unde celulele vii apar verde și apar celule moarte colorate cu homodimer-1 (EthD-1) roșu. Mărire originală 10x pentru toate panourile. C ) Numărul de structuri capilare asemănătoare măsurate după 24 de ore de cultură. Datele din 3 experimente independente efectuate în duplicat sunt exprimate ca medie ± SD (** P <0,01 vs. Control). D ) Greutatea medie a capsulei (g) de la șoareci cu AngioChambers ™ implantată fără βFGF1 și tratată cu Controlul vehiculului (Grupul 1), conținând βFGF1 și tratată cu Controlul vehiculului (Grupul 2) și conținând βFGF1 și tratată cu T / C (0,13 / 0,78 mg / kg administrate ip, într-un volum de dozare de 10 ml / kg) (Grupa 3) (** P <0,05).

Mai mult, cuantificarea numărului de structuri asemănătoare capilarului în diferite zone ale puțului a evidențiat o diferență dramatică și semnificativă între numărul de structuri formate de celulele netratate în comparație cu celulele tratate cu PRP (figura 2C ).

Efectul anti-angiogen al PRP a fost investigat suplimentar in vivo utilizând testul AngioChamber ™, un model utilizat pentru a evalua eficacitatea tratamentelor antiangiogene prin măsurarea formării capsulelor fibroase la șoareci. În această analiză, includerea bFGF în cameră susține inducerea dezvoltării vaselor de sânge și formarea unei capsule fibroase. AngioChambers ™ au fost excluse de la toți șoarecii post-mortem în ziua terminării, 24 de ore după tratamentul final (Ziua 5). Figura 2D arată că formarea capsulelor fibroase a fost semnificativ mai mare în grupul de control al vehiculului cu bFGF captat în cameră (Grupul 2, Controlul Inducției) decât în ​​grupul de control al vehiculului fără bFGF încărcat în cameră (grupul 1, Controlul de bază) (p < 0,05) indicând faptul că bFGF a stimulat în mod adecvat și semnificativ formarea capsulelor. Tratamentul cu PRP (Grupa 3) a determinat o reducere semnificativă a angiogenezei comparativ cu controlul de inducție (grupul 2), așa cum este indicat de diferența în greutatea capsulei (p <0,05) cu o inhibare a formării capsulelor fibroase de 57%. Astfel, PRP inhibă formarea capsulelor fibroase care prezintă efecte anti-angiogenice in vivo semnificative.

Efectul anti-invazie, anti-migrare și anti-EMT al PRP

Pentru a analiza efectul anti-metastatic in vitro al tratamentului pro-enzimatic, am studiat efectul PRP în invazia celulară, migrarea celulară și în modularea genelor legate de EMT în celulele canceroase. În primul rând, pentru a evalua efectul PRP asupra migrării celulare, un eveniment cheie în carcinogeneză, am efectuat un test de vindecare a rănilor pe cinci linii de celule canceroase diferite: BxPC3 și Mia Paca-2 pancreatice umane, celule A2780 ovariene umane, melanomul uman A375 și colon uman (HCT 116).Migrarea este definită ca mișcarea direcționată a celulelor pe un substrat, cum ar fi plăcile de plastic care apar pe suprafețe 2D. Aici arătăm că celulele netratate au migrat mai repede pentru a închide decalajul unei zgârieturi în monostratul celular decât celulele tratate cu PRP. PRP a redus semnificativ migrarea celulelor celulelor BxPC3 pancreatice și a comparat cu celulele martor chiar a lărgit lățimea plăgii, un model de migrare care a fost diferit în comparație cu celelalte linii celulare și că părea să fie specific celular ( Fig.3A) . Deși linia celulară tumorală ovariană A2780 nu crește, formând un monostrat omogen ca BxPC3, se poate observa că tratamentul PRP reduce semnificativ capacitatea celulelor ovariene de a migra (Figura 3B). Datele au arătat o inhibare semnificativă a migrării celulare, cu numai 23% din celulele migrate după 48 de ore de tratament cu PRP în comparație cu celulele martor care au atins 88% ( fig.3A și B ). Rezultate similare au fost obținute cu celule MIA PaCa-2, A375 și HCT 116, celulele tratate au prezentat valori ale migrării celulare de ordinul a 25-30% după 48 ore de tratament cu PRP, în timp ce celulele netratate treptat s-au mutat în celulă – regiune zero de zgâriere (figura 3C-E ).

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este 41598_2017_14571_Fig3_HTML.jpg

Experimentul de vindecare a rănilor pentru a determina migrarea celulelor. Testele de vindecare a rănilor au fost efectuate la 0, 24 și 48 de ore în celule BxPC3, A2780, MIA PaCa-2, A375 și HCT 116 în celule tratate cu IC50 și celule netratate utilizate ca martori. A ) Imagini reprezentative cu microscop de contrast în fază care prezintă zona acoperită de celule la 0, 24 și 48 de ore după rănire. Mărire originală 10 ×. B ) Mărire originală 10 ×. B ) Migrarea celulelor a fost determinată de viteza celulelor care se deplasează spre zona zgâriată în timp utilizând software-ul ImageJ ™ ( * P <0,05 și ** P <0,01).

În al doilea rând, am testat efectul inhibitor al formulării pro-enzimatice asupra invaziei celulare a celulelor tumorale de colon și de pancreas. Invazia este definită ca o mișcare a celulelor printr-o matrice 3D extracelulară. Principiul acestui test se bazează pe două camere conținând medii separate printr-o membrană poroasă prin care celulele se transmigrează. Aici, am testat diferite concentrații de PRP (tabelul suplimentar S2 ) pe liniile celulare de cancer uman pancreatic MIA PaCa-2 și HCT-15. Interesant, PRP a prezentat o inhibare marcată și semnificativ dependentă de doză a invaziei în ambele linii celulare.Inhibarea totală a migrării celulare a fost obținută din concentrațiile de PRP de 0,015 / 0,093 mg / ml T / C și așa mai departe, cu celelalte concentrații crescătoare testate (Figura 4A ).

Un fișier extern care deține o imagine, o ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig4_HTML.jpg

Invazia celulară și analiza genelor legate de EMT. A ) testul de migrare 3D. Graficele reprezintă numărul de celule care transmigrează prin membrana poroasă după expunerea la concentrații crescătoare de PRP. Se utilizează PBS ca martor negativ și combretastatin ca control pozitiv. B ) expresia genelor legate de EMT.Analiza qRT-PCR a evidențiat creșterea expresiei E-cadherinei cu reducerea concomitentă semnificativă a expresiei N-cadherinei, Slug și vimentinei în celulele BxPC3. PRP nu a afectat în mod semnificativ vimentinul, dar a redus în mod semnificativ exprimarea N-cadherin și Slug și a crescut expresia E-cadherin în celule A2780. * P <0,05 și ** P <0,01). C ) Imagini confocale reprezentative ale expresiei E-cadherin și β-catenin în celulele tratate și controlate cu BxPC3 și A2780. Expresia E-cadherin și expresia β-catenină a fost detectată (în roșu), iar nucleele au fost contracarate cu DAPI (albastru). Mărire originală 40 ×.

Pentru a investiga dacă expunerea PRP are o posibilă reglementare în mecanismele transcripționale care conduc EMT în celulele canceroase, expresia genelor EMT a fost studiată în celulele cancerigene umane pancreatice BxPC3 și A2780 ( Fig.4B ). Indicatorii EMT în ambele celule BxPC3 și A2780 au fost afectați de tratamentul PRP la T / C 0,07 / 0,42 mg / ml. Figura 4B arată că tratamentul PRP a crescut expresia E-cadherinei (0,4 ori) (* P <0,05), în timp ce a redus expresiile de N-cadherin, Slug și vimentin (0,9, 0,5 și 0,6 ori, 0,01) în celule BxPC3. În adiție, PRP a modificat în mod semnificativ expresia E caderinei (0,9 ori) (** P <0,01) și a redus în mod semnificativ expresia N-cadherinei și Slug (0,4 și respectiv 0,6 ori) (** P < 0,01) și a indus o scădere ușoară, dar nu semnificativă, a expresiei vimentinei în celulele A2780. În cele din urmă, au fost efectuate analize de imunofluorescență pentru a confirma modificările expresiei genice.Imaginile confocale ale celulelor BxPC3 și A2780 imunostainate pentru a detecta expresia markerilor epiteliali E-cadherină și β-catenină au arătat o creștere a expresiei ambelor markeri în membrana celulară a celulelor tratate cu PRP în comparație cu celulele de control netratate ( Fig.4C ).

Studiu farmacocinetic PRP

Pentru a evalua farmacocinetica și distribuția de organe a Trypsinogen și Chymotrypsinogen A, șoarecii Nymph-Foxn nu femelă purtători de tumori au fost tratați cu Trypsinogen marcat cu IRDye® 800CW (5 mg / kg) plus tripsinogen (50 mg / kg) sau IRDye® 800 mg Chymotripsinogen A marcat cu CW (7 mg / kg), plus Chimotripsinogenul A neimologat (300 mg / kg). Animalele au fost eutanasiate la punctele de timp specificate post-doză, iar plasmă împreună cu omogenatele de organe a fost preparată, apoi imaginate prin intermediul sistemului de imagistică IVIS.

Fluorescența a fost măsurată în omogenatele de organe. Șoarecii tratați cu T marcat au prezentat un vârf de fluorescență în toate organele între 15 minute și 2 ore după doză. În timp ce șoarecii tratați cu C marcat au prezentat emisia maximă de fluorescență între 15 minute și 6 ore după doză. Pentru ambele valori cele mai ridicate au fost observate în rinichi și ficat ( fig.5A și B ). Nivelurile maxime ale ambelor tripsinogene marcate cu IRDye®800CW și ale chitomicroscopic A în plasmă de șoarece au apărut la 15 minute după administrarea dozei (7,5 și respectiv 72,2 μg / ml). Nivelurile atât ale proenzimelor marcate cu IRDye® 800CW au scăzut rapid după acest timp ( fig.5C și D ).

Un fișier extern care deține o imagine, ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig5_HTML.jpg

Studiu farmacocinetic. S-au citit fluorescență în omogenatele de organe de la șoareci tratați cu ( A ) IRGye® 800CW marcat cu tripsinogen (5 mg / kg) și tripsinogen (50 mg / kg) sau B cu chimotrispsinogen A marcat cu IRDye® 800CW și chitomizinogen A (300 mg / kg). C ) Nivele de trypsinogen marcat cu IRDye®800CW și ( D ) chitomicrosinogen A în plasmă de șoarece.

Eficacitatea antitumorală a PRP în modelele de șoareci orthotopici

Efectul formulării PRO-enzime PRP în doze diferite asupra greutății tumorale în tumorile pancreatice și ovare implantate ortotopic este reprezentat în fig.6. În grupul de control al tumorii pancreatice, un animal a fost eutanasiat în ziua a 6-a datorită unor semne clinice adverse care nu au legătură cu tratamentul și un alt animal a fost găsit mort datorită unor cauze necunoscute în ziua 23. Nu a existat o reducere semnificativă (* P <0,05) animale tratate timp de 26 zile cu Trypsinogen / Chimotripsinogen A la 83,3 / 500 mg / kg (30,2 mg, inhibare 85,9%) comparativ cu martor (PBS 214,8 mg), dar nu între Trypsinogen / Chimotripsinogen A la 27,5 / 165 mg / kg 196,5 mg, inhibare de 8,5%) și controlul (figura 6A ).

Un fișier extern care deține o imagine, ilustrație, etc. Numele obiectului este 41598_2017_14571_Fig6_HTML.jpg

Activitatea antitumorală in vivo a PRP. A ) Imagini ale tumorilor excizate la terminarea studiului tumorilor pancreatice ortotropice. Greutatea medie a tumorii în ziua terminării după injectarea intravenoasă iv a PBS, T / C 27,5 / 165 (mg / kg) sau T / C 83,3 / 500 (mg / kg) ( * P <0,05). B ) Imagini ale tumorilor excizate la terminarea studiului tumorilor ovariene ortotropice. Greutatea medie a tumorii în ziua terminării după injectarea intravenoasă iv a PBS, T / C 9,1 / 54 (mg / kg) sau T / C 27,5 / 165 (mg / kg) ( * P <0,05).

Mai mult, șoarecii purtători de tumori ovariene ( Fig.6B ) au prezentat o reducere semnificativă (* P <0,05) a greutății medii a tumorii la animalele tratate timp de 21 de zile cu două doze diferite de Trypsinogen / Chimotripsinogen A, 9,1 / 54 mg / kg și 27,5 / 165 mg / kg, comparativ cu martor (PBS). Greutatea medie a tumorilor din grupul de control a fost de 2062,2 mg, în timp ce grupurile tratate au prezentat o greutate medie a tumorii de 1074,2 mg și, respectiv, 957,3, variind într-o inhibare a tumorii de 50% (52-46%).

Prezentare generală a studiilor clinice

Eficacitatea clinică a unei formulări de supozitoare care conține pro-enzime pancreatice bovine Trypsinogen și Chymotrypsinogen A a fost evaluată în contextul unei scheme speciale farmaceutice britanice. Efectele clinice au fost studiate la 46 de pacienți cu cancer metastatic avansat de origine diferită (prostată, mamar, ovarian, pancreatic, colorectal, stomac, pulmonar nemetal celular, cancer intestinal și melanom) după tratamentul cu o formulare rectală a ambelor enzime pancreatice . Nu s-au observat evenimente adverse grave sau grave legate de administrarea rectală. Pacienții nu au prezentat efecte secundare hematologice, așa cum se observă de obicei în regimurile chimioterapice clasice. Nu au fost observate reacții alergice după administrarea rectală de supozitoare. Pentru a evalua activitatea terapeutică a administrării rectale, supraviețuirea globală a pacienților aflați sub tratament a fost comparată cu speranța de viață atribuită unui pacient înainte de începerea tratamentului. Tabelul 1 prezintă lista pacienților tratați cu formularea pro-enzimatică pancreatică. Nouăsprezece dintre cei 46 de pacienți (41,3%) cu boli maligne avansate, majoritatea suferind de metastaze, au avut o durată de supraviețuire semnificativ mai mare decât durata de viață estimată, de fapt, pentru întregul set de tipuri de cancer, supraviețuirea medie (9,0 luni) semnificativ mai mare decât speranța medie de viață (5,6 luni).

tabelul 1

Prezentare generală a studiilor clinice. Pacienții care au prezentat prognoza speranței de viață (*).Pentru întregul set de tipuri de cancer, supraviețuirea medie (9,0 luni) a fost statistic semnificativ mai mare decât speranța medie de viață (5,6 luni). ANOVA cu o singură cale (α = 0,05, P <0,05).

Tipul de cancer  durata asteptata viata (luni) Supraviețuire ** (luni)
Carcinom pancreatic (n = 4) 2 8
4 *
7
4
Cancer ovarian (n = 7) 4 11
6 12
6 11
<12 38
<1 1
4 *
3 *
Cancerul de sân (n = 6) 6 9
6 *
2 *
12 *
<12 *
12 *
Colon Cancer rectal (n = 5) 6 *
6 *
12 *
6 40
12 *
Cancerul gastric (n = 2) 2 8
7
Cancerul de prostată (n = 8) 4 *
1 5
4 *
<12 *
12 14
12 *
12 *
12 *
Limfom non-Hodgkin (n = 1) 2 9
Mezoteliom (n = 1) 3 9
Melanomul (n = 2) 6 *
4
Tumorile neuro-endocrine (n = 1) 10 24
Vezică urinară (n = 2) *
12 *
NSCLS (n = 2) 3 5
6 *
Bowel (n = 2) <12 *
3
Carcinom cu celule mici (n = 1) <12 *
Cancerul renal (n = 1) *
Abdomen necunoscut primar (n = 1) <12 *

Deși numărul pacienților pe indicație de cancer este în mod natural destul de scăzut, 3 din 8 pacienți cu cancer de prostată și 5 din 11 pacienți cu cancer gastro-intestinal par să beneficieze în special de tratamentul cu supozitoarele pro-enzimatice.

Discuţie

Datele prezentate au fost relevante pentru adoptarea unei noi strategii în formularea unui preparat compus din prozime enzimele pancreatice (PRP) care s-au dovedit a reduce principalele caracteristici ale răspândirii cancerului. În acest context, angiogeneza, capacitatea de a forma noi vase de sânge reprezintă un pas critic în dezvoltarea tumorii prin care tumorile își stabilesc propria sânge 12 . Prin urmare, inhibarea angiogenezei va bloca una dintre cerințele fundamentale pentru creșterea tumorii, precum și răspândirea metastazelor tumorale în situsurile tumorale secundare. Am investigat activitatea anti-angiogenică in vitroa PRP utilizând testul de formare a tubului și testul de formare a tubului cu agar moale și in vivo cu analiza AngioChambers ™. Rezultatele au arătat că PRP inhibă formarea structurilor capilare asemănătoare HUVEC și suprimă formarea capsulelor fibroase conduse de bFGF capturat în AngioChambers TMimplantat subcutanat și ulterior prin stimularea VEGF endogenă. Factorii angiogenici, cum ar fi bFGF și VEGF, secretați de multe celule, inclusiv macrofage și celule canceroase, au demonstrat că joacă un rol important în progresia carcinomului pancreatic 13 și a altor tipuri tumorale 14-16 . Într-adevăr, bFGF stimulează toate etapele majore în cascada angiogenezei, așa cum se știe că este implicată în proliferarea, migrarea și diferențierea celulelor endoteliale 17 .

Un alt factor cheie în progresia cancerului este pierderea adeziunii celulelor celulare, care se corelează cu o capacitate crescută de migrare a celulelor și cu dobândirea proprietăților invazive de către celulele maligne, care suferă o schimbare morfologică care adaptează un aspect asemănător cu axul 18 . În plus, un test in vitro de vindecare a rănilor a arătat că capacitatea de migrație a celulelor cancerigene ovariene, de melanom și cancer de colon a fost suprimată după incubarea cu PRP. Mai mult, inhibarea potențialului de invazie celulară posedă cel mai probabil un potențial semnificativ de inhibare a metastazelor in vivo .

Pentru a înțelege mecanismele moleculare posibile care inhibă migrarea și invazia celulelor tratate cu PRP, a fost efectuată analiza qRT-PCR pentru a studia expresia genelor legate de EMT, un proces în care celulele epiteliale își pierd caracteristicile și se supun transdiferențierii celulelor mezenchimale motile. Dovezile sugerează că EMT este asociat cu metastaze și cu dobândirea de proprietăți chemorezistente în multe tipuri de cancer 19, inclusiv ovarian 20 și cancer pancreatic 21 . Într-adevăr, studiile anterioare au arătat că în timpul progresiei cancerului ovarian, EMT joacă un rol important în creșterea invaziei celulare, ceea ce duce la un rezultat slab al pacienților cu cancer ovarian 22 , 23 . În plus, studiile au constatat că EMT contribuie la rezistența la medicamente chimioterapeutice în cancerul pancreatic 24 și că mai mulți markeri EMT au fost, de asemenea, recunoscuți în cancerul pancreatic 25 , 26 . În acest studiu, demonstrăm că tratamentul cu PRP a promovat expresia genică a markerului epitelial E-cadherin și a scăzut expresia ambelor markeri mezenchimali, N-cadherin și vimentin. O trăsătură cheie a EMT este trecerea de la markeri epiteliali, cum ar fi E-cadherin și citokeratin la markeri mezenchimali cum ar fi N-cadherin, vitronectin 75 sau vimentin 27 , 28 . Aici arătăm că liniile celulare de cancer ovarian și pancreatic au prezentat o scădere semnificativă a expresiei N-cadherinei ca răspuns la tratamentul PRP. Aceasta este o observație foarte relevantă, deoarece reglarea în sus a N-caderinei este asociată cu un potențial crescut de migrație și invazie a celulelor cancerigene ovariene și pancreatice 29-31 . În plus, mai multe studii au evidențiat importanța semnalizării N-caderinei în progresia cancerului pancreatic 32 , 33 . S-a raportat că distrugerea N-cadherinei în celulele BxPC3 conduce la o exprimare crescută a E-cadherinei și a determinat, de asemenea, o reducere semnificativă a motilității liniei celulare BxPC3, sugerând că N-cadherina este un mediator cheie al procesului EMT în celulele pancreatice 28 .

În plus, expresia proteică a markerilor epitelii E-cadherin și β-catenin a fost mărită după tratamentul PRP și a apărut limitată la membrana celulară atunci când a fost analizată prin imunofluorescență. E-cadherina este o moleculă importantă de semnalizare în EMT în parte prin interacțiunea sa cu β-catenină 18 , de fapt, reducerea expresiei E-cadherin și β-catenin a fost asociată cu o diminuare a adeziunii celulare7. Mai mult decât atât, translocarea β-cateninei la nucleu și scăderea expresiei E-cadherinei sunt observate în diferite malignități umane asociate cu metastazarea 20 .

Mai mult, unul dintre genele puternic inhibat prin tratamentul cu PRP în ambele linii celulare BxPC3 și A2780 a fost Slug, un factor de transcripție care s-a dovedit a reprima E-cadherina și a reglat alte markeri EMT. Mai mult, s-a raportat că Slug este un inductor puternic al VEGF și prezintă efecte pro-angiogenice puternice 34 . De asemenea, Slug este asociat îndeaproape cu metastazele tumorale și angiogeneza în cancerul ovarian 35 și cu reglarea expresiei fascinei de proteină asociată cu actina, adesea foarte ridicată în tumorile maligne și recent sugerată ca o țintă marker sau terapeutică pentru cancerul pancreatic 36 . Prin urmare, datele noastre sugerează că PRP revine EMT în celulele canceroase.

Injecția intravenoasă a pro-enzimelor a determinat niveluri maxime detectabile în plasmă la 15-30 minute care au scăzut în prima oră și au fost încă prezente la niveluri scăzute după trei ore după administrarea dozei. Aceste observații sunt similare cu profilurile concentrației de timp găsite în studiile farmacocinetice anterioare cu potențiali agenți terapeutici pentru cancerele umane, incluzând pancreasul 37 , 38 și, de asemenea, în chimioterapeutica actuală utilizată în clinică, cum ar fi gemcitabina 39 . Mai mult, examinarea distribuției țesuturilor a demonstrat că proenzimele perfuzate în organe, incluzând inima, ficatul, splina, plămânul, rinichii și întregul tract gastrointestinal, au indicat o distribuție largă a țesuturilor pro-enzimelor 40 .

Am investigat în continuare modele de tumori ortotopice pentru a testa eficacitatea anti-tumorală a PRP utilizând celule tumorale umane (A2780) sau celule tumorale murine (Pan 02). Observațiile clinice au sugerat că mediul de organe poate influența răspunsul tumorilor la chimioterapie. De asemenea, implantarea ortotopică a celulelor tumorale umane în șoareci nudi oferă avantaje pentru studiul creșterii tumorale și a metastazelor 41 . În plus, Panc 02 s-a dovedit a fi o linie celulară de cancer pancreatic syngenetic adecvată pentru dezvoltarea tumorilor ortotopice în model murin imunocompetent, care imită îndeaproape cancerul pancreatic uman 42 . Unul dintre avantajele raportate ale modelelor ortotopice este acela că procesele de țintire care implică invazia locală (de exemplu, angiogeneza) pot fi efectuate la un loc mai relevant din punct de vedere clinic. Prin urmare, eficacitatea antitumorală a tratamentului zilnic cu Trypsinogen și Chimotripsinogenul A administrată în combinație ca o injecție iv singulară în două doze a fost evaluată împotriva celulelor cancerigene ovariene și pancreatice umane inoculate ortodic la șoareci femelici numi / nu șoareci C57BL / 6 femele, respectiv. În timp ce cele două doze testate au fost eficiente împotriva tumorilor ovariene ortotopice, numai doza mai mare testată a fost eficace în tumorile pancreatice. De remarcat, răspunsul slab al tumorilor pancreatice la terapiile disponibile este bine cunoscut 43 .

PRP nu numai că a demonstrat dimensiunea tumorii dicreazite, dar, de asemenea, s-a dovedit a fi un agent anti-cancer non-toxic deoarece nu au fost identificate evenimente adverse clinice legate de tratament. Luate împreună, formularea pro-enzimatică prezentată (PRP) inhibă în mod semnificativ tumori pancreatice și ovariene umane, atât entități tumorale bine vascularizate, cât și relativ rapide. Pentru ambele indicații, cancer pancreatic și ovarian, terapia clinică disponibilă este limitată și, prin urmare, prezintă indicații atractive pentru dezvoltarea clinică suplimentară a PRP.

În cele din urmă, în contextul unei scheme speciale britanice privind medicamentele, am evaluat eficacitatea clinică a unei formulări supozitoare, care conține tripsinogen, chimiotrypsinogen A și urme de α-amilază, la pacienți cu mai multe malignități diferite. A-amilaza a fost inclusă deoarece a făcut parte din extractele pancreatice brute care au fost utilizate în primele zile de terapie cu enzime, dar după evaluarea interacțiunii sinergice dintre tripsinogen, chitomoplasmogen și α-amilază s-a concluzionat că a-amilaza nu a contribuit la activitatea antitumorală a formulării.

Prin administrare rectală, tratamentul a fost bine tolerat de către pacienți și are avantajul că formularea este absorbită de către vasele de sânge ale rectului în circulație, evitând digestia enzimelor din duoden. Prin urmare, o formulare rectală conduce la o eficacitate îmbunătățită față de terapiile cu enzime orale actuale și ar reduce dozele mari utilizate în mod curent pentru aplicațiile orale 44 . Există unele controverse în literatura de specialitate cu privire la cantitatea de pro-enzime intacte care ajunge efectiv în fluxul sanguin atunci când se administrează pe cale orală, dar și rectal. În timp ce unii autori susțin că numai o mică fracțiune (0,002%) 45 sau chiar niciuna 46 nu este absorbită, o teorie alternativă sugerează că aceste enzime sunt stabile la nivel acid și sunt absorbite prin mucoasa gastrointestinală în fluxul sanguin ca parte a unui proces de reciclare enteropancreatică 47 . Mai mult, eficacitatea clinică a enzimei pancreatice rectale, după cum este evaluată prin timpul de supraviețuire prelungit în comparație cu speranța de viață estimată la începutul tratamentului, a fost evidentă la un număr de pacienți.

Rezumând, PRP se dovedește a fi un tratament anti-tumoral eficace și netoxic in vivo , capabil să inhibe angiogeneza și creșterea tumorii, migrarea celulelor canceroase și invazivitatea. Mai departe, o formulare de supozitoare conținând atât pro-enzime pancreatice a arătat o creștere a speranței de viață a pacienților cu cancer avansat. În consecință, PRP ar putea avea aplicații clinice oncologice relevante pentru tratamentul tumorilor solide cum ar fi adenocarcinomul pancreatic avansat și cancerul ovarian epitelial avansat.

Materiale si metode

Cultură de celule

Liniile de celule de cancer au fost obținute de la Colecția Americană de Cultură de Tip (ATCC) (Rockville, MD, USA). Tabelul suplimentar S1 prezintă liniile celulare utilizate și condițiile de creștere a culturii pentru fiecare dintre acestea. Toate celulele au fost cultivate la 37 ° C într-un incubator de cultură de celule umidificat furnizat cu 95% aer / 5% CO2.

Asigurarea îngrijirii animalelor

Procedurile care implică îngrijirea și utilizarea animalelor în studiu au fost revizuite și aprobate de către Comitetul de Stat pentru Medicină și Farmacie (IACUC) din Pennsylvania State College of Medicine. În timpul studiului, îngrijirea și utilizarea animalelor au fost efectuate în conformitate cu principiile enunțate în Ghidul pentru îngrijirea și utilizarea animalelor de laborator, ediția a 8- a , 2010 (Consiliul Național de Cercetare).

Teste de citotoxicitate in vitro și determinări ale interacțiunilor medicamentoase

Trypsinogenul (T) și Chitopripsinogenul A (C) s-au dizolvat în PBS, soluțiile stoc au fost sterilizate prin filtrare (0,22 pm) și pentru fiecare formula enzimatică stocurile au fost amestecate în combinațiile corespunzătoare. Pentru a determina citotoxicitatea in vitro (jumătate din concentrațiile inhibitorii maxime, IC50) și CDI, plăcile cu 96 de godeuri au fost însămânțate pentru fiecare linie celulară, s-au adăugat combinații pro-enzime la celule 24 ore după însămânțare și testate triplicat pentru fiecare linie celulară . La 72 de ore după adăugare, testul CellTiter-Blue® a fost efectuat pe toate plăcile conform instrucțiunilor producătorului.Pe scurt, 10 pl de CellTiter-Blue® s-au adăugat la fiecare godeu și s-au incubat cu celule timp de până la 4 ore. Fluorescența a fost măsurată utilizând un Fluorometru Spectramax Gemini XPS. Toate datele au fost înregistrate și introduse în foi de calcul Microsoft® Excel pentru interpretare. Datele colectate de la testele CelITiter-Blue® au fost reprezentate grafic ca curbele de răspuns la doză pentru IC 50 determinare și ca isobolograms pentru a evalua CDI.

Testul de formare a tubului Matrigel

Venă derivate ombilical celule endoteliale umane (HUVEC) au fost cultivate în mediu complet de creștere-2 AGE (Lonza, Basel, Elveția) , în condiții standard de cultură celulară de 37 ° C și 5% CO 2 . Celulele au fost utilizate între trecerile 4 și 5. Plăcile cu multiple godeuri (plăci cu 12 godeuri) au fost acoperite cu 300 pL Matrigel (Collaborative BD PharMingen, San Diego, CA) la 4 ° C și incubate timp de 30 de minute la 37 ° C. HUVEC (1,2 × 10 5celule / godeu) au fost adăugate la godeurile acoperite cu Matrigel în mediu de cultură complet. Formularea pro-enzimatică a fost adăugată după 20 de minute de însămânțare pe Matrigel la 2 concentrații, T / C: 0,035 / 0,21 mg / ml și T / C: 0,07 / 0,42 mg / ml. După 5 și 24 de ore de incubare, celulele au fost fotografiate în microscopie cu contrast de fază (Leica DM 5500B, Solms, Germania). Capacitatea celulelor de a forma capilare a fost examinată și a fost măsurat numărul de structuri capilare asemănătoare. Fiecare porțiune de cord dintre ramificații a fost considerată ca fiind o unitate capilară. Valorile medii ± deviația standard (SD) s-au obținut prin evaluarea a patru zone reprezentative din fiecare cultură din trei experimente independente.

Celuloza de viabilitate a culturii a fost realizată prin Kitul de Viabilitate / Citotoxicitate LIVE / DEAD (Molecular Probes), conform instrucțiunilor producătorului. Pe scurt, HUVEC (3 x 105 celule / godeu) au fost cultura în godeurile acoperite cu Matrigel în mediu de cultură complet. Formularea pro-enzimatică a fost adăugată după 20 de minute de însămânțare pe Matrigel la T / C: 0,07 / 0,42 mg / ml și viabilitatea celulară a fost testată după 24 de ore de cultură cu Calcein AM, o probă pentru activitatea de esterază intracelulară, , și homodimer-1 de etidiu, o sondă pentru pierderea integrității membranei plasmatice, care a marcat celule moarte. Celulele tratate cu metanol 70% au servit ca martori pentru celulele moarte (datele nu sunt prezentate). Imaginile au fost preluate prin microscopie confocală (Nikon Eclipse Ti-E A1, SUA) și analizate utilizând software-ul NIS-Elements.

Implantul și tratamentul AngioChamber ™

Camere de țesut poros Teflon (AngioChambers ™) 48 , 49au fost umplute în condiții sterile cu 0,8% agaroză conținând 20 UI / ml heparină, cu sau fără 4 ug / ml factor de creștere fibroblast bazic (bFGF). 30 de șoareci FvB de sex feminin au primit câte un AngioChamber ™ implantat subcutanat, cu sau fără factor de creștere fibroblastic bazic (bFGF). 30 de șoareci au fost implantate cu camere fără bFGF (grupa 1) și 20 de șoareci, implantate cu camere care conțin bFGF (grupurile 2 și 3), au fost randomizați prin masa corporală în 3 grupe de câte 10 șoareci (grupa 1, 2 și 3). Grupurile de control (grupurile 1 și 2) au primit o doză orală de NMP: PEG300 ca un vehicul de control și șoareci tratați (Grupa 3) au primit injecție intraperitoneală zilnică (ip) cu T / C: 0,13 / 0,78 mg / mL într-un volum de dozare 10 ml / kg. Animalele au fost tratate la 2 ore după ce șoarecii s-au recuperat din chirurgie pentru a implanta AngioChamber ™ în Ziua de studiu 0.AngioChambers ™ au fost excluse de la toți șoarecii post-mortem în ziua terminării, 24 de ore după tratamentul final (Ziua 5). Capsula fibroasă vascularizată care a fost formată în jurul fiecărei camere a fost îndepărtată cu grijă și greutatea umedă a fost înregistrată imediat. Inhibarea angiogenezei prin pro-enzime (%) a fost calculată folosind

% Inhibare = [( A – B ) / ( A – C ) x 100];
1

unde A este greutatea medie a capsulei de la șoareci cu factor de creștere implantat AngioChambers ™ și tratată cu Controlul vehiculului (Grupa 2), B este greutatea medie a capsulei de la șoareci cu agent de creștere implantat AngioChambers ™ și tratată cu proenzima (Grupa 3) și C este greutatea medie a capsulei de la șoareci cu AngioChambers ™ implantată fără factor de creștere și tratată cu Controlul vehiculului (Grupul 1).

Testul de vindecare a rănilor in vitro

Pancreatice (BxPC3 și Mia Paca-2), celule ovariene (A2780), melanom (A375) și colon (HCT 116) au fost însămânțate în plăci cu 6 godeuri și crescute până la confluență de 80%. Plăgile au fost create prin răzuirea celulelor monostrat cu un vârf de pipetă de 200 pl, iar celulele neaderente au fost spălate cu mediu. Celulele canceroase BxPC3 și A2780 au fost tratate cu T / C: 0,07 / 0,42, mg / ml, celulele canceroase Mia Paca-2 și HCT 116 au fost tratate cu T / C: 0,025 / 0,15 mg / ml și celulele canceroase A375 au fost tratate cu T / C: 0,035 / 0,21 mg / ml ,. La 0, 24 și 48 de ore după crearea rănilor, s-au observat celule tratate și de control ne-tratate, iar imaginile de migrare au fost captate cu un obiectiv de 10x într-o microscopie cu contrast de fază. Migrarea celulelor a fost determinată de viteza celulelor care se deplasează spre zona zgâriată. Software-ul ImageJ ™ a fost folosit pentru a cuantifica zona zgâriată.Toate experimentele au fost placate în godeuri triplicate și au fost efectuate de cel puțin trei ori.

Testul de invazie a celulelor Matrigel

Inserțiile de cultură celulară (mărimea porilor de 8 pm) au fost spălate de două ori cu mediu RPMI sau DMEM fără ser și introduse în godeurile unei plăci de cultură de celule cu 24 de godeuri. Utilizând vârfuri de pipetă reci, la fiecare inserție s-au adăugat 40 pl de Matrigel diluat 1:10 în mediu RPMI, balansând cu ușurință plăcuța pentru a distribui Matrigel uniform pe suprafața membranei. Matrigel a fost lăsat să se solidifice prin incubare peste noapte la 37 ° C. A doua zi, 7,5 x 10 4 MIA PaCa-2 celule în 200 pl de mediu DMEM suplimentat cu 0,1% BSA, sau 7,5 x 10 4 HCT 15 celule în 200 pl de mediu RPMI suplimentat cu 0,1% BSA, au fost adăugate la camera superioară a fiecărei inserții. Suspensiile celulare au conținut combinație pro-enzimă la opt concentrații (tabelul suplimentar S2) sau PBS (control netratat). Combretastatina A4 a fost utilizată ca un control al inhibării migrării celulare 50 la o concentrație finală de 250 nM. Fiecare probă a fost analizată în două exemplare. Mediul condiționat din celule U87-MG (500 pl) a fost utilizat ca chemoattractant în camera inferioară 51 , 52 . Celulele au fost lăsate să migreze prin matricea extracelulară timp de 24 de ore la 37 ° C. Celulele care nu migrează au fost îndepărtate din camera superioară cu un vârf de bumbac. Celulele de pe partea de jos a membranei au fost fixate în etanol 70% timp de 15 minute și colorate cu 10% colorare Giemsa filtrată timp de 1 oră la temperatura camerei. Migrarea a fost cuantificată prin numărarea celulelor în trei câmpuri de vedere la mărirea de 40x utilizând un microscop cu lumină inversă (Olympus).

Izolarea ARN și analiza cantitativă RT-PCR în timp real

A2780 și BxPC3 au fost crescute în plăci cu 6 godeuri și tratate de două ori cu PRP (T / C 0,07 / 0,42 mg / ml) în ziua 2 și în ziua 4. În ziua 5, ARN celular total a fost izolat folosind TriReagent (Sigma) utilizând setul pentru sistemul de transcriere inversă (Promega). PCR în timp real a fost realizat utilizând amestecul principal SYBR-Green PCR (Promega) conform recomandărilor producătorului. Reacțiile PCR s-au efectuat după cum urmează: o denaturare inițială la 95 ° C timp de 2 min, 40 cicluri de 95 ° C timp de 5 s și 60 ° C timp de 30 s și ciclu final de disociere de 60-95 ° C. Nivelurile de exprimare a genei au fost normalizate la valorile corespunzătoare GAPDH și sunt prezentate ca schimbare ori în raport cu valoarea probei de control. Celulele netratate au fost utilizate ca martor. Toate probele au fost efectuate în triplicat pentru fiecare genă. Grundurile utilizate sunt prezentate în tabelul suplimentarS3 .

Analiza imunohistochimică

A2780 și BxPC3 au fost crescute pe capace de sticlă și tratate de două ori cu PRP (T / C 0,07 / 0,42 mg / ml) în ziua 2 și în ziua 4. Pentru colorarea cu imunofluorescență probele au fost fixate cu 4% paraformaldehidă (PFA) min la RT. Celulele au fost blocate timp de 1 oră la temperatura camerei (RT) cu 5% BSA, 5% ser fetal bovin în PBS și apoi incubate cu E-Cadherin (SC-21791, St. Cruz) și β-catenină (SC-7963, , Cruz) peste noapte la 4 ° C. A doua zi, probele au fost spălate de trei ori cu PBS și incubate cu anticorpi secundari corespunzători (Santa Cruz) timp de 1 oră la RT, spălate de trei ori cu PBS și apoi montate cu mediu de montare și DAPI. Imaginile au fost preluate prin microscopie confocală (Nikon Eclipse Ti-E A1, SUA) și analizate utilizând software-ul NIS-Elements.

Studiu farmacocinetic

Conjugarea tripsinogenului și a chitomicroscopului A cu eticheta IRDye® 800CW a fost făcută în conformitate cu protocolul producătorului (biotehnologia LI-COR). Pe scurt, tripsinogenul și chitomicrosinogenul A s-au dizolvat la o soluție 1 mg / ml (greutate / volum) și s-a utilizat fosfat de potasiu 50 mM pentru a ajusta pH-ul la 8,5. Amestecul proteic și IRDye® 800CW a fost incubat timp de 2 ore la temperatura ambiantă. După filtrarea pe coloană pentru a îndepărta colorantul neconjugat și tamponul de schimb pentru soluție salină tamponată cu fosfat (PBS), pH 7,2, concentrația finală de proteină și gradul de etichetare (raportul colorant până la pro-enzimă) au fost determinate prin măsurarea absorbției la 280 și 780 nm. Produsul marcat a fost păstrat la 4 ° C până la utilizare.

Studiile de biodistribuție au fost efectuate pe șoareci nude-Foxnlnu femelă athymic non-tumorală (n = 3 per punct de timp). Se administrează (intravenos) combinația de pro-enzime etichetate și neetichetate IRDye® 800CW (la fiecare șoarece) la Trypsinogen marcat cu IRDye® 800CW (5 mg / kg) cu tripsinogen marcat cu 50 mg / kg IRDye® 800 CW 7 mg / kg) cu Chitomoprinogen A neimologat (300 mg / kg). Șoarecii au fost eutanasiați la punctele de timp predeterminate (0 min, 15 min, 30 min, 1 h, 2 hr, 6 ore, 12 ore, 24 ore și 48 ore după injectare) și organele pertinente (sânge prelucrate în plasmă, ficat, plămân, inimă, splină, tract gastrointestinal întreg și ambii rinichi) au fost excizate, omogenizate și înregistrate prin intermediul IVIS Lumina XR de la Perkin Elmer.Concentrațiile de proteine ​​marcate IRDye® 800CW (intensitatea fluorescenței / mg de proteină) au fost analizate la fiecare punct de timp pentru probele de plasmă și de omogenitate de organe.

Modele tumorale ortotopice in vivo

40 femele atimici nuzi-Foxn1 NU șoarecii au fost inoculați ortotopic (ovar dreapta) cu 1 x 10 6 A2780 celulele de cancer ovarian uman; și 40 femele / 6 șoareci C57BL au fost inoculați ortotopic (coada pancreasului) cu 1 x 10 6 celule tumorale pancreatice Pan02 șoarece. 10 animale din fiecare grupă au rămas netratate pentru evaluarea ratei de absorbție a tumorii. După 7 zile după inoculare (Ziua 0), animalele au fost randomizate în 3 seturi de 10 (grupul de tumori ovariene) și 3 seturi de 10 (grupul tumoral pancreatic).

A fost administrată o singură injecție de venei de coadă într-un volum de dozare de 10 ml / kg o dată pe zi pentru fiecare animal. Volumul de soluție de dozare administrat fiecărui animal a fost calculat și ajustat în funcție de greutatea corporală individuală măsurată imediat înainte de administrare. Tratamentele au început în ziua 0 și au fost administrate timp de 21 de zile consecutive. Animalele tumorale ovariene ortotrope au fost injectate cu PBS (Grupul 1) sau T / C la doze de 27,5 / 165 mg / kg (Grupa 2) și 83,3 / 500 mg / kg (Grupa 3). Animalele tumorale din pancreasul ortotropic au fost injectate cu PBS (Grupa 1) sau T / C la doze de 9,1 / 54 mg / kg (Grupa 2) și 27,5 / 165 mg / kg (Grupuri 3). La terminare, ovarul și pancreasul au fost excluse de la toate animalele cu tumoare intactă. Tumoarea a fost izolată, cântărită și apoi fotografiată.Modificarea procentuală a greutății medii a tumorii pentru grupurile tratate comparativ cu grupul martor a fost calculată utilizând:

Modificarea procentuală = ((Control mediu – Tratament mediu) / Control mediu) × 100.
2

„Special” tratament cu licența – formularea proenzimelor pancreatice

46 de pacienți cu boală malignă avansată de origine diferită au fost tratați zilnic cu o formulare rectală conținând 8,92 mg din fiecare dintre cele două enzime pancreatice și 1,78 mg α-amilază (A) pe supozitor. Studiul a fost efectuat în baza unei licențe britanice „Specials” la Clinica Dove, Hampshire, Marea Britanie pentru perioade de până la 14 luni. Specialități Regulamentul privind licența oferă un cadru legal pentru utilizarea unui medicament fără autorizație de introducere pe piață sau licență de produs de către un medic în vederea satisfacerii nevoilor speciale ale unui pacient pentru care este direct responsabil. Prin urmare, tratamentul în baza unei licențe speciale nu poate fi considerat un studiu clinic formal. Preocuparea informată a fost obținută de la toți pacienții înainte de tratament. Datele raportate au fost generate din notele pacientului deținute de Clinica Dove.

Fără criterii formale de includere și excludere, grupul de pacienți al acestui program de utilizare compasională a fost foarte eterogen. Majoritatea pacienților au fost diagnosticați cu cancere metastatice de diferite origini, inclusiv prostată (n = 8), sân (n = 6), ovarian (n = 7), pancreatice (n = 4), colo-rectale (n = 2), cancerul intestinal (n = 2), cancerul de colon (n = 2), melanomul (n = 2) limfom non-Hodgkin, mezoteliom, tumora neuro-endocrină, carcinom cu celule mici, cancer renal și abdomen necunoscut primar (toate n = 1). Pentru a evalua beneficiul tratamentului, supraviețuirea sub tratament a fost comparată cu speranța de viață individuală alocată înainte de începerea tratamentului.Aceasta speranta de viata a fost determinata pentru fiecare pacient avand in vedere i) data diagnosticului clinic, ii) varsta pacientului si comorbiditatile, iii) tratamente anterioare si modul in care acestea au fost tolerate, iv) sange standard si biomarkeri relevanti, v) scanari istorice , deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.deoarece nu au fost oferite alte scanări în timpul perioadei de tratament și vi) starea clinică generală a pacientului. Aceste date împreună cu informațiile publicate privind tumoarea specifică au fost luate în considerare atunci când a fost estimată supraviețuirea preconizată pentru pacienții individuali pancreatici. Speranța de viață a pacientului, conform previziunilor oncologiste, a variat între câteva zile și aproximativ 12 luni.

Calcule statistice

Diferențe semnificative au fost testate de One Way ANOVA. Ipotezele de analiză a varianței (homocedesență și normalitate) au fost testate și asigurate prin utilizarea seturilor de date transformate atunci când este necesar. Semnificația a fost acceptată la P <0,05 în toate cazurile.

Declarație privind disponibilitatea datelor

Seturile de date generate în timpul și / sau analizate în timpul studiului actual sunt disponibile de la autorul corespunzător, la cerere rezonabilă.

Logo-ul scirepului

About Editorial Board For Authors Scientific Reports
Sci Rep . 2017; 7: 13998.
Publicat online 2017 Oct 25 doi: 10.1038 / s41598-017-14571-x
PMCID: PMC5656641
PMID: 29070896
O formulare a pro-enzimelor pancreatice oferă o eficacitate potentă anti-tumorală: un studiu pilot axat pe cancerul pancreatic și ovarian
Macarena Perán , autorul corespunzător 1, 2 Elena López-Ruiz , 1, 2 María Ángel García , 2, 3, 4 Shorena Nadaraia-Hoke , 5 Ralf Brandt5 Juan A. Marchal , 2, 4, 6 și Julian Kenyon autorul corespunzător 7

Material suplimentar electronic

Recunoasteri

Autorii mulțumesc, de asemenea, cu recunoștință dr. Klaus Kutz pentru revizuirea atentă a manuscrisului.

Contribuțiile autorului

MP conceperea și proiectarea studiului, analiza și interpretarea datelor, redactarea articolului și aprobarea finală a manuscrisului depus. Concepția JK și proiectarea studiului, furnizarea datelor pacientului și aprobarea finală a manuscrisului depus. Colectarea, analiza și interpretarea datelor ELR, SNH și MAG. RB și JAM proiectarea studiului, analiza datelor și revizuirea articolului. Toți autori: aprobarea finală a manuscrisului depus.

notițe

Interese concurente

Dr. Julian Kenyon este fondatorul și directorul științific al companiei Propanc Pty Ltd și deține acțiuni în cadrul companiei. Propanc Pty Ltd a finanțat Universitatea din Jaen și vivoPharm LLC pentru a efectua această cercetare.

Note de subsol

Material suplimentar electronic

Informații suplimentare însoțesc această lucrare la 10.1038 / s41598-017-14571-x.

Nota editorului: Springer Nature rămâne neutră în ceea ce privește pretențiile jurisdicționale în hărțile publicate și afilierile instituționale.

Informații despre colaboratori

Macarena Perán, se.neaju@narepm .

Julian Kenyon, moc.cinilcevod@noyneknj .

Referințe

1. Reticker-Flynn NE, ș.a. O platformă de matrice extracelulară combinatorie identifică interacțiunile matricei extracelulare celulare care se corelează cu metastazele. Nat. Commun. 2012; 3 : 1122. doi: 10.1038 / ncomms2128. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
2. Thiery JP. Epilare-mezenchimale tranzitorii în progresia tumorii. Nat. Rev. Cancer. 2002; 2 : 442-454. doi: 10.1038 / nrc822. PubMed ] [ CrossRef ] Google Scholar ]
3. Kalluri R, Weinberg RA. Elementele de bază ale tranziției epitelio-mezenchimale. Journal of Clinical Investigation. 2009; 119 : 1420-1428. doi: 10.1172 / JCI39104. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
4. Jordão BP, Terra WR, Ribeiro AF, Lehane MJ, Ferreira C. Secreția de tripsină în midgutul midian Musca domestica: Un studiu biochimic și imunocitochimic. Insect Biochem. Mol. Biol. 1996; 26 : 337-346. doi: 10.1016 / 0965-1748 (95) 00084-4. CrossRef ] Google Scholar ]
5. Wald M, și colab. Amestecul de tripsină, chymotrypsin și papain reduce formarea metastazelor și extinde timpul de supraviețuire a șoarecilor C57Bl6 cu melanomul syngeneic B16. Cancer Chemother. Pharmacol.2001; 47 (Suppl): S16-S22. doi: 10.1007 / s002800170004. PubMed ] [ CrossRef ] Google Scholar ]
6. Saruc M, și colab. Extractul de enzime pancreatice îmbunătățește supraviețuirea în cancerul pancreatic murin. Pancreas. 2004; 28 : 401-412. doi: 10.1097 / 00006676-200405000-00009. PubMed ] [ CrossRef ] Google Scholar ]
7. Perán M, Marchal JA, García MA, Kenyon J, Tosh D. Tratamentul in vitro al liniilor celulare de carcinom cu enzimele (pro) pancreatice suprimă programul EMT și promovează diferențierea celulelor.Cell. Oncol. 2013; 36 : 289-301. doi: 10.1007 / s13402-013-0134-8. PubMed ] [ CrossRef ] Google Scholar ]
8. Sakalová A, et al. Studiu de cohortă retrografică a unei terapii aditive cu un preparat enzimatic oral la pacienți cu mielom multiplu. Cancer Chemother. Pharmacol. 2001; 47 (Suppl): S38-S44. PubMed ] Google Scholar ]
9. Beuth J, și colab. Impactul aplicării enzimelor orale complementare asupra rezultatelor tratamentului postoperator al pacienților cu cancer de sân – rezultate ale unui studiu de cohortă epidemiologic multicentric retroreflexiv. Cancer Chemother. Pharmacol. 2001; 47 (Suppl): S45-S54. doi: 10.1007 / s002800170009. PubMed ] [ CrossRef ] Google Scholar ]
10. Popiela T, Kulig J, Hanisch J, Bock PR. Influența unui tratament complementar cu enzimele orale asupra pacienților cu cancer colorectal – un studiu de cohortă epidemiologic retrolectiv. Cancer Chemother.Pharmacol. 2001; 47 (Suppl): S55-S63. doi: 10.1007 / s002800170010. PubMed ] [ CrossRef ] Google Scholar ]
11. Wood W, și colab. Rănirea rănilor recapitulează morfogeneza în embrionii Drosophila. Nat. Cell Biol.2002; 4 : 907-12. doi: 10.1038 / ncb875. PubMed ] [ CrossRef ] Google Scholar ]
12. Hanahan D, Weinberg RA. Semnele distinctive ale cancerului. Cell. 2000; 100 : 57-70. doi: 10.1016 / S0092-8674 (00) 81683-9. PubMed ] [ CrossRef ] Google Scholar ]
13. Yan C, și colab. Rinoplarea mediată de interferența ARN a VEGF și bFGF suprimă secreția de endostatină în celulele carcinomului pancreatic. Oncol. Lett. 2013; 5 : 1031-1035. Articolul gratuit PMC ]PubMed ] Google Scholar ]
14. Cao R și colab. Colaborarea colaborativă între FGF-2 și VEGF-C promovează limfangiogeneza și metastazarea. Proc. Natl. Acad. Sci. 2012; 109 : 15894-15899. doi: 10.1073 / pnas.1208324109.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
15. Marchal, J. a. și colab . Purificarea și extinderea pe termen lung a celulelor multipotent endoteliale, cu regenerare cardiovasculară potențială. Celulele stem și dezvoltarea 21 (2012). PubMed ]
16. Li D, și colab. Blocarea dublă a factorului de creștere endotelial vascular (VEGF) și a factorului de creștere fibroblastic bazic (FGF-2) prezintă efecte anti-angiogenice puternice. Cancer Lett. 2016; 377 : 164-173. doi: 10.1016 / j.canlet.2016.04.036. PubMed ] [ CrossRef ] Google Scholar ]
17. Pavcnik D, și colab. Evaluarea angiografică a altoirii arterei carotide cu grefele submucoase cu diametru mic prefabricat, cu mici intestine submucoase la ovine. Cardiovasc. Intervent. Radiol. 2009; 32 : 106-113. doi: 10.1007 / s00270-008-9449-7. PubMed ] [ CrossRef ] Google Scholar ]
18. Voulgari A, Pintzas A. Tranziția epitelială-mezenchimică în metastazele cancerului: mecanisme, markeri și strategii pentru a depăși rezistența medicamentului în clinică. Biochimica et Biophysica Acta – Recenzii despre cancer. 2009; 1796 : 75-90. doi: 10.1016 / j.bbcan.2009.03.002. PubMed ] [ CrossRef ] Google Scholar ]
19. Wan L, Pantel K, Kang Y. Metastaze tumorale: mișcări noi de cunoștințe biologice în clinică. Nat. Med.2013; 19 : 1450-1464. doi: 10.1038 / nm.3391. PubMed ] [ CrossRef ] Google Scholar ]
20. Vergara D, și colab. Epilare-mezenchimie în cancerul ovarian. Cancer Lett. 2010; 291 : 59-66. doi: 10.1016 / j.canlet.2009.09.017. PubMed ] [ CrossRef ] Google Scholar ]
21. Yuan Y, și colab. Supraexpresia YAP promovează tranziția epitelio-mezenchimică și rezistența la chimioterapie în celulele cancerigene pancreatice. Mol. Med. Rep. 2016; 13 : 237-242. doi: 10.3892 / mmr.2015.4550. PubMed ] [ CrossRef ] Google Scholar ]
22. Parikh A, și colab. microRNA-181a are un rol critic în progresia cancerului ovarian prin reglarea tranziției epitelio-mezenchimale. Nat. Commun. 2014; 5 : 2977. doi: 10.1038 / ncomms3977.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
23. Adham SAI și colab. Vizualizarea imunohistologică în corelația dintre markerii neuropilin-1 și markerii de tranziție mezenchimală epitelială în cancerul ovarian epitelial. J. Histochem. Cytochem. 2014; 62 : 619-31. doi: 10.1369 / 0022155414538821. PubMed ] [ CrossRef ] Google Scholar ]
24. Arumugam T, și colab. Tranziția epitelială la mezenchimie contribuie la rezistența la medicament în cancerul pancreatic. Cancer Res. 2009; 69 : 5820-5828. doi: 10.1158 / 0008-5472.CAN-08-2819.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
25. Yamada S și colab. Tranziția epitelio-mezenchimală prezice prognosticul cancerului pancreatic. Surg.(Statele Unite ale Americii) 2013; 154 : 946-954. PubMed ] Google Scholar ]
26. Cates JMM, și colab. Etichete de tranziție mezenchimale epiteliale-mezenchimale în adenocarcinomul ductal pancreatic. Pancreas. 2009; 38 : e1-e6. doi: 10.1097 / MPA.0b013e3181878b7f.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
27. Cavallaro U, Christofori G. Aderența celulară și semnalizarea de către cadherine și Ig-CAM în cancer.Nat. Rev. Cancer. 2004; 4 : 118-132. doi: 10.1038 / nrc1276. PubMed ] [ CrossRef ] Google Scholar ]
28. Rachagani S, și colab. MUC4 potențează invazia și metastazarea celulelor cancerigene pancreatice prin stabilizarea receptorului factorului de creștere fibroblast 1. Carcinogeneză. 2012; 33 : 1953-1964. doi: 10.1093 / carcin / bgs225. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
29. Alaee M, Danesh G, Pasdar M. Plakoglobin Reduce in vitro creșterea, migrarea și invazia celulelor canceroase ovariene care exprimă N-Cadherin și p53 mutant. Plus unu. 2016; 11 : e0154323. doi: 10.1371 / journal.pone.0154323. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
30. Suyama K, Shapiro I, Guttman M, Hazan RB. O cale de semnalizare care conduce la metastaze este controlată de N-caderină și de receptorul FGF. Cancer Cell. 2002; 2 : 301-314. doi: 10.1016 / S1535-6108 (02) 00150-2. PubMed ] [ CrossRef ] Google Scholar ]
31. Nakajima S, și colab. Exprimarea N-cadherinei și tranziția epitelială-mezenchimică în carcinomul pancreatic. Clin. Cancer Res. 2004; 10 : 4125-4133. doi: 10.1158 / 1078-0432.CCR-0578-03. PubMed ] [ CrossRef ] Google Scholar ]
32. Chiang KC, și colab. Analogul vitaminei D, MART-10, reprima potențialul metastazelor prin reducerea reglării tranziției epitelio-mezenchimale în celulele cancerului pancreatic. Cancer Lett. 2014; 354 : 235-244. doi: 10.1016 / j.canlet.2014.08.019. PubMed ] [ CrossRef ] Google Scholar ]
33. Li W, și colab. Resveratrol inhibă tranziția epitelio-mezenchimică a celulelor cancerului pancreatic prin suprimarea căii PI-3K / Akt / NF-κB. Curr Med Chem. 2013; 20 : 4185-4194. doi: 10.2174 / 09298673113209990251. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
34. Huang TS, și colab. O angiogeneză indusă de estrogen favorizează adenomioza prin activarea axei Slug-VEGF în celule epiteliale endometriale. J. Cell. Mol. Med. 2014; 18 : 1358-1371. doi: 10.1111 / jcmm.12300. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
35. Guo W, și colab. Slug și Sox9 determină în mod cooperativ starea mamară a celulelor stem. Cell. 2012;148 : 1015-1028. doi: 10.1016 / j.cell.2012.02.008. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
36. Li, A. și colab . Fascinul este reglementat de slug, promovează progresia cancerului pancreatic la șoareci și este asociat cu rezultatele pacientului. Gastroenterologie 146 (2014). Articol gratuit PMC ] [ PubMed ]
37. Zhang X, și colab. Evaluarea preclinică a eficacității anticanceroase și a proprietăților farmacologice ale FBA-TPQ, un nou analog sintetic de makaluvamin. Mar. Drugs. 2012; 10 : 1138-1155. doi: 10.3390 / md10051138. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
38. Yang M, și colab. Compusul natural sulforaphena, ca un nou reactiv anticanceros, care vizează calea de semnalizare PI3K-AKT în cancerul pulmonar. Oncotarget. 2016; 7 : 76656-76666.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
39. Wang H, Li M, Rinehart JJ, Zhang R. Pre-tratamentul cu dexametazonă crește activitatea antitumorală a carboplatinei și gemcitabinei la șoareci purtători de xenogranți ai cancerului uman: activitatea in vivo , farmacocinetica și implicațiile clinice pentru chimioterapia cancerului. Clin. Cancer Res. 2004; 10 : 1633-1644. doi: 10.1158 / 1078-0432.CCR-0829-3. PubMed ] [ CrossRef ] Google Scholar ]
40. Wang, W. și colab . KCN1, un agent anticancer sintetic de sinteză noi: activități in vitro și cancer in vitro anti-pancreatic și farmacologie preclinică. PLoS One 7 (2012). Articol gratuit PMC ] [ PubMed ]
41. Talmadge JE, Singh RK, Fidler IJ, Raz A. Modele pentru a evalua strategiile terapeutice noi și convenționale pentru cancer. A.m. J. Pathol. 2007; 170 : 793-804. doi: 10.2353 / ajpath.2007.060929.Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
42. Partecke LI, și colab. Un model murine ortotopic orginologic de adenocarcinom pancreatic la șoarecele C57 / BL6 utilizând liniile celulare Panc02 și 6606PDA. Euro. Surg. 2011; 47 (2): 98-107. PubMed ] Google Scholar ]
43. Ding XZ, Tong WG, Adrian TE. Ciclooxigenazele și lipoxigenazele ca ținte potențiale pentru tratamentul cancerului pancreatic. Pancreatology. 2001; 1 : 291-299. doi: 10.1159 / 000055827. PubMed ] [ CrossRef ] Google Scholar ]
44. Liebow C, Rothman SS. Circulația enteropancreatică a enzimelor digestive. Știință (80-). 1975; 189 : 472-474. doi: 10.1126 / science.1154022. PubMed ] [ CrossRef ] Google Scholar ]
45. Ziv E, Lior O, Kidron M. Absorbția proteinei prin peretele intestinal. Un model cantitativ. Biochem.Pharmacol. 1987; 36 : 1035-1039. doi: 10.1016 / 0006-2952 (87) 90411-4. PubMed ] [ CrossRef ] Google Scholar ]
46. Gewert K, Holowachuk S, Rippe C, Gregory P, Pierzynowski S. Nivelele enzimelor din sânge nu sunt afectate de administrarea orală a preparatului enzimatic pancreatic (Creon 10,000) la porcii insuficienți ai pancreasului. Pancreas. 2004; 28 : 80-88. doi: 10.1097 / 00006676-200401000-00013. PubMed ] [ CrossRef ] Google Scholar ]
47. Rothman S, Liebow C, Isenman L. Conservarea enzimelor digestive. Physiol. Rev. 2002; 82 : 1-18. doi: 10.1152 / physrev.00022.2001. PubMed ] [ CrossRef ] Google Scholar ]
48. Wood JM, și colab. PTK787 / ZK 222584, un inhibitor roman și potențial al factorului de creștere vascular endotelial tirozin kinazei, afectează răspunsurile induse de factorul de creștere endotelial vascular și creșterea tumorilor după administrarea orală. Cancer Research. 2000; 60 (8): 2178-2189. PubMed ] Google Scholar ]
49. Wallis, NG Activitatea antiangiogenă a inhibitorilor derivați din fragmentul METAP2. Analele Oncologiei . 23 (Supliment 1), i26-i44 (2012).
50. Weixin L, și colab. Combretastatina A4 reglează proliferarea, migrarea, invazia și apoptoza celulelor canceroase tiroidiene prin calea de semnalizare PI3K / Akt. Med. Sci. Monit. 2016; 22 : 4911-4917. doi: 10.12659 / MSM.898545. Articolul gratuit PMC ] [ PubMed ] [ CrossRef ] Google Scholar ]
51. Annabi B, și colab. Hipoxia promovează migrația celulară derivată din maduva osoasă și formarea tubului. Celule stem. 2003; 21 : 337-347. doi: 10.1634 / stemcells.21-3-337. PubMed ] [ CrossRef ] Google Scholar ]
52. Ichigotani Y, Yokozaki S, Fukuda Y, Hamaguchi M, Matsuda S. Exprimarea forțată a NESH suprimă motilitatea și diseminarea metastatică a celulelor maligne. Cancer Res. 2002; 62 : 2215-2219. PubMed ] Google Scholar ]

Articolele din rapoartele științifice sunt furnizate aici prin amabilitatea Nature Publishing Group

Remisiunea completă și supraviețuirea pe termen lung a unui pacient cu metastaze melanomice tratate cu extras din albumul Viscum

Abstract

Introducere:

Melanomul cutanat malign melanic (MCM) – un cancer extrem de imunogen – are de obicei un prognostic slab. Viscum album -extract (VAE) are efecte puternice de stimulare a imunității, apoptotice și citotoxice.

Prezentarea cazului:

Un pacient MCM în vârstă de 66 de ani, cu metastaze nou diagnosticate în ganglionii limfatici, a optat pentru un tratament VAE unic. VAEs au fost inițial administrate subcutanat, și apoi mai târziu în doze extrem de mari, de inducție a febrei, atât intravenos cât și intralezional. Metastazele s-au diminuat în următoarele luni, iar după 2 ani, toate leziunile au fost complet remise (ganglioni limfatici regionali și hilari). Pacientul a fost fără tumori timp de 3,5 ani la momentul publicării (și timp de 5 ani de la inițierea tratamentului VAE intensificat). Pe lângă febra și simptome asemănătoare gripei, nu au apărut reacții adverse.

Discuţie:

Presupunem că VAE a declanșat o eliberare crescută de antigene asociate tumorilor, a sporit recunoașterea imunologică și a sporit răspunsul imun împotriva țesutului tumoral și a indus remisia tumorii.

1. Introducere

Melanomul cutanat malign (MCM) este al șaselea dintre cele mai frecvente tipuri de cancer și cel mai mortal din toate cazurile de cancer de piele, cu o incidență tot mai mare la nivel mondial (incidența și mortalitatea sunt 9,3-10,2 și respectiv 1,2-2,0 la 100 000 de persoane). MCM are un prognoză corectă în boala locală (supraviețuire de 20 de ani de 75%), dar un prognostic prost în cazul bolii metastatice (supraviețuirea de 5 ani de 5-19%). Factorii de risc sunt sexul masculin, pielea ușoară (albii non-hispanici), indicele ultraviolet (UV) crescut (expunere intensă la soare intermitentă, paturile de bronzat) și imunosupresia. Excizia chirurgicală completă este standardul de îngrijire pentru tratamentul melanomului timpuriu și poate vindeca leziunile minim invazive și in situ. Excizia ganglionilor limfatici și a imunoterapiei adjuvante sistemice este recomandată pentru boala avansată la nivel local. Boala metastatică este tratată cu metastazectomie chirurgicală, imunoterapie, terapii vizate și radioterapie. Chimioterapia este limitată la pacienții a căror boală nu poate fi controlată cu imunoterapie sau agenți vizați. 1 ]

MCM prezintă o imunogenitate ridicată și a jucat un rol-cheie în dezvoltarea imunologiei tumorale. De interes deosebit este rata neobișnuit de mare de regresie spontană a leziunilor primare (3,7-15% dar fără a afecta supraviețuirea); o rată corectă de remisiune spontană a bolii metastatice (aproximativ 0,23% cu un impact pozitiv asupra supraviețuirii); regresia MCM după infecții sau tratamente imunologice active; și infiltrarea limfocitelor în leziuni regresate și depigmentarea situsului de regresie. 2 ] În plus, un număr crescut de infecții și episoade de febră mare, precum și antecedentele anumitor vaccinări, sunt corelate cu un risc redus de dezvoltare a MCM. 3 , 4 ] Aceste constatări au condus cercetarea în interacțiunile complexe și dinamice dintre sistemul imunitar și celulele melanomului, ducând la dezvoltarea imunoterapiilor capabile să beneficieze de anumite subgrupuri de pacienți cu melanom. 5 ]

Viscum album L. crește ca un arbust hemi-parazit (vâsc european) pe diferite arbori gazdă și conține o varietate de compuși biologic activi, în special lectine de vâsc (ML) și viscotoxine (VT). 6 ] Extractele de album viscum (VAE) și compușii lor prezintă activități antineoplazice, inclusiv efecte citotoxice și apoptoge, stimulare imună, reglarea în jos/scadere a genelor tumorale, inhibarea migrării celulelor tumorale și neo-angiogeneza. 6 – 10 ] Diferitele valente comerciale standardizate sunt disponibile în preparate injectabile (de obicei utilizate subcutanat, dar ocazional intravenos și intratumoral). 11 ] Studiile clinice au constatat o îmbunătățire a calității vieții la pacienții cu cancer tratați cu VAE și supraviețuirea mai lungă la pacienții cu cancer pancreatic avansat. 12 , 13 ] Un studiu randomizat cu privire la tratamentul MCV cu adjuvant VAE, interferon-alfa sau interferon-gamma comparativ cu un grup de control netratat și nu a găsit niciun beneficiu pentru intervenție. 14 ] Un studiu de cohortă farmacopeio-epidemiologic privind MCM (etapa II / III UICC / AJCC) a evidențiat supraviețuirea prelungită a cancerului, globală și fără boală și mai puține metastaze la nivelul plamanilor și creierului la pacienții tratați cu VAE. Remisiile diferitelor tumori – inclusiv MCM – au fost descrise în rapoartele de caz și în studiile mici. 16-24 ] Efectele secundare frecvente ale tratamentului VAE includ reacții cutanate autoimune, dependente de doză, inflamatorii locale și simptome asemănătoare gripei. Ocazional pot apărea reacții pseudo-alergice. Indiferent, terapia VAE este, în cea mai mare parte, sigură, chiar și la doze mai mari. 25 ]

2. Prezentarea cazului

O femeie caucaziană în vârstă de 61 de ani a fost diagnosticată cu un stadiu 1a MCM al auricul stâng [pT1a, N0 (nodul limfatic santinel negativ), cM0, grosimea tumorii verticale 1,0 mm]. Pacientul este un fost profesor, care lucrează în prezent ca terapeut. În ceea ce privește expunerea la radiații UV, pacientul a raportat călătorii frecvente în timpul verii ca o femeie tânără, în timpul căreia capul era acoperit cu un capac care, eventual, nu proteja urechile.

Tumora a fost tratată cu excizie chirurgicală (analiza mutației BRAF a fost negativă). După 4 ani și 4 luni, MCM sa repetat la auricul stâng și a fost din nou excizat. În plus, pacientul a început un tratament cu injecții VAE subcutanate [Iscador P c Hg Seria I (flacoane cu 0,1-10 mg) de 3 ori pe săptămână]. După 11 luni, o tomografie cu tomografie computerizată cu emisie de pozitroni (PET-CT) a prezentat metastaze ale ganglionilor limfatici în regiunea glandei parotide stângi (8 × 7 mm) și hilar (26 × 19 mm). Aceste rezultate au fost confirmate prin biopsie cu puncție fină a acului. A fost recomandată terapia sistemică (Dacarbazină / Ipilimumab), dar pacientul a decis să se opună. În schimb, în ​​următorii 2 ani, terapia VAE a fost intensificată în dozare, preparare și aplicare, pentru a obține un tratament mai agresiv al țesutului tumoral:

  • 1)
    Injecțiile subcutanate au fost modificate la Iscador P 60 mg de 3 ori pe săptămână (pentru informații detaliate despre preparatele VAE utilizate, vezi tabelul Tabelul1 1 ). 26 , 27 ]

    tabelul 1

    An external file that holds a picture, illustration, etc.
Object name is medi-96-e8731-g001.jpg

    Viscum album extract (VAE) preparate.

  • 2)
    Infuzările intravenoase – la intervale de 2 săptămâni – au fost aplicate cu doze crescute de VAE pentru a provoca reacții la febră pentru a stimula sistemul imunitar împotriva țesutului tumoral; doza de VAE a fost ajustată după aceste reacții. În total, pacientul a primit 36 ​​de tratamente VAE intravenoase timp de 2 ani cu doze de până la 2200 mg VAE (conținând 171,600 ng / ML și 6700 μg VT). Reacțiile de temperatură induse de VAE și febra sunt descrise în figura 11 și afișate într-o curbă de timp caracteristică în figura 2 .
    An external file that holds a picture, illustration, etc.
Object name is medi-96-e8731-g002.jpg

    Timpul pacientului cu ilustrații mărită la cei 3 ani după recurența tumorii și cei doi ani de terapie ViscumAlbumExtract intensificată.

    An external file that holds a picture, illustration, etc.
Object name is medi-96-e8731-g003.jpg

    Cursul temperaturii corporale în timpul a 10 tratamente de probă cu perfuzii intravenoase de ViscumAlbumExtract în clinica de zi. Temperatura a fost înregistrată continuu cu o sondă de temperatură rectală / vaginală.

  • 3)
    Aplicarea intraaliațională a fost efectuată în metastaza glandei parotide (Viscum album Qu F, preparat compozit, nefermentat, Lot 3186/3033/4138/3138) în doze crescătoare de până la 200 mg VAE (conținând 58100 ng / ML și 585 pg VT) o reacție citotoxică împotriva celulelor tumorale, o procesare imună crescută a particulelor tumorale și un răspuns imun crescut față de țesutul tumoral.Timp de 2 ani, pacientul a primit 26 de aplicații VAE intralezionale (Fig.1.1 ).

După perioada intensificată de tratament de 2 ani, tratamentul VAE subcutanat a fost continuat până în prezent, iar celelalte tipuri de aplicații au fost continuate la intervale mai mari. Reacțiile adverse au inclus simptome asociate febrei, cum ar fi dureri de corp, tremurături și, uneori, greață puternică, care au fost limitate la perioada de tratament și febră; reacțiile cutanate la punctele de injectare s-au auto-limitat în decurs de 2 până la 3 zile. Medicul performant a avut o experiență vastă în ceea ce privește terapia VAE cu doze mari, precum și formarea în medicina de terapie intensivă și de urgență. În afară de simptomele descrise, tratamentul a fost bine tolerat și nu au apărut alte reacții adverse pe parcursul întregului curs.

Următoarele examinări PET-CT au evidențiat regresarea metastazelor locale și hilare. La doisprezece luni de la inițierea tratamentului VAE intensiv intravenos și intralezional intensificat, nu s-a observat nicio altă absorbție de fludeoxiglucoză (FFG) în metastaza glandei parotide stângi, iar leziunile hilare au scăzut semnificativ. După alte 12 luni, nu s-au detectat leziuni suspecte în PET-CT (fig.3 (Fig.3) ). Următoarele examinări, efectuate la fiecare 12 luni, nu au prezentat semne de malignitate. Pacientul nu a prezentat evenimente adverse grave; frecvența totală a sângelui (eritrocite, trombocite, număr de diferențe de leucocite) nu a evidențiat abateri de la intervalul normal; celulele ucigase naturale au fost însă scăzute înainte de inițierea terapiei VAE (78 celule / μL) și au rămas scăzute pe parcursul intervenției (interval de 73-137 celule / μL).

An external file that holds a picture, illustration, etc.
Object name is medi-96-e8731-g004.jpg

PET-CT a primului diagnostic al metastazelor regionale (cervicale) și hilarelor limfatice și scanarea ulterioară în cazul în care metastazele sunt în remisiune completă.

Pe întreaga perioadă de tratare a bolii metastatice, nu a fost aplicată nici o altă terapie specifică tumorii. La momentul acestei publicații, la 5 ani după diagnosticarea bolii metastatice (10,5 ani după diagnosticul inițial), pacientul este fără tumori, este în stare bună de sănătate și nu are limitări funcționale.

3. Terapii antecedente și concomitente

În acest caz, terapia VAE cu doză mare a fost utilizată în cadrul unui concept individualizat de terapie a medicamentului antroposofic integrat. 28 ] Nu au fost utilizate alte tratamente medicale specifice cancerului.

Pacientul a suferit, de asemenea, osteochondroză avansată intervertebralis, goiter și migrenă. Cu paisprezece ani inainte de diagnosticul initial al MCM, pacientul a fost diagnosticat cu carcinom in situ al colului uterin, care a fost tratat cu laser conization. Cu 48 de ani înainte de diagnosticul cu MCM, ea a suferit o fractură de bază craniană.

Pacientul a participat la seminarii privind vindecarea psihică, asigurată de asigurările de sănătate, unde a lucrat la evenimente negative de viață din copilăria ei timpurie. 29 ] Pe lângă suplimentele nutritive care conțin sodiu, calciu, potasiu și magneziu, pacientul a luat capsule de ulei de pește.

4. Vederea pacientului

În urma diagnosticării metastazelor, mi s-a spus la Spitalul Universitar că va fi cel mai probabil o lună înainte de continuarea terapiei ulterioare. În acest timp, am aflat despre terapia intensă a matismului și despre spitalul care oferă medicina antroposofică. Am aflat că am încredere în mine și că aș putea contribui la propriul meu proces de auto-vindecare. Mi-am dat seama că a fost nevoie de propriul meu angajament de a deveni sănătos și am învățat să fiu recunoscător pentru tot ceea ce era sănătos în mine. Acest angajament față de sănătatea mea a implicat, de asemenea, dezvoltarea conștientizării vieții mele, inclusiv descoperirea tuturor acelor lucruri care m-au sabotat din interior. Din acest motiv, am reușit să-mi găsesc și să-mi iau calea în terapie – chiar dacă ar exista doctori care să mă convingă să nu iau această cale. Am fost în stare să tolerez Terapia de Mistletoe, cu febra ridicată și efectele secundare, precum și injecțiile uneori dureroase, pentru că m-am simțit în siguranță și încrezătoare în tratament.

5. Discuție

Prezentăm un caz de metastaze MCM tratat cu VAE. Dozele inițiale au fost scăzute ca de obicei. În urma diagnosticului metastatic, totuși, dozele au fost intensificate treptat până la niveluri foarte ridicate cu inducție de febră și s-au utilizat combinații de forme de aplicare (subcutanat, intravenos, intralesional). Nu a fost utilizat alt tratament specific tumorii. Acest tratament a dus la remisiunea completă a tuturor leziunilor tumorale și a supraviețuirii pe termen lung, caracterizată prin sănătatea generală bună și lipsa de limitări fizice.

Alte rapoarte de caz ale VAE în MCM au raportat, de asemenea, remisia completă, de lungă durată și supraviețuirea pe termen lung. 16 , 17 , 22 ] Von Laue 16 ] a descris observația interesantă că injecțiile de VAE într-o metastază subcutanată a MCM au condus la regresia sa și la regresia unei metastaze cerebrale.În urma tratamentului VAE subcutanat cu doză mică, totuși, s-au dezvoltat metastaze noi, dar acestea au revenit din nou sub tratament VAE cu doze mari. 16 ] VAE este citotoxică și stimulează o varietate de răspunsuri imune (de exemplu, proliferarea și prezentarea antigenică a celulelor dendritice, proliferarea celulelor T CD4 + , creșterea citotoxicității mediate de celulele criminale naturale, eliberarea citokinelor incluzând pirogenii interleukina 1 și 6 ). 10 ] Fenomenul observat de von Laue 16 ] poate fi, prin urmare, explicat printr-o eliberare sporită a antigenelor asociate tumorilor după acțiunea citotoxică a VAE, precum și prin recunoașterea imunologică sporită și răspunsul imun crescut față de țesutul tumoral – toate declanșate de VAE tratament. Același mod de acțiune poate fi presupus și în cazul nostru, în care tratamentul intralesional al metastazelor glandei parotide a condus la remisia completă a tuturor leziunilor de cancer, inclusiv a metastazelor tratate.

ML este legat structural de toxina shiga, acționează ca un ligand receptor de recunoaștere a modelului și astfel activează celulele dendritice necesare pentru un răspuns celular T-plin față de celulele canceroase. [30 ] Acest mod de acțiune poate explica răspunsurile foarte inflamatorii cu temperaturi ridicate ale corpului care apar după administrarea intravenoasă de doze mari de VAE. Această imagine clinică seamănă, de asemenea, cu remisiile tumorale după administrarea vaccinurilor bacteriene care provoacă febra ( S pyogenes și Serratia marcescens – toxinele lui Coley) sau remisiile spontane observate în cursul Erysipelas.În studiile clinice privind cancerul hepatic și de sân, precum și în cazurile și rapoartele de caz privind diferite tipuri de cancer, inclusiv MCM, au fost descrise tratamente cu VAE cu doze mari de inducție de febră, cu remiteri ulterioare relevante și de lungă durată. 16 , 18 , 19 , 22 , 23 , 34 , 35 ]

Din aceste observații preclinice și clinice, presupunem că proprietățile imunologice ale VAE, în special cele ale lectinelor sale, joacă un rol-cheie în răspunsul tumoral la tratamentul VAE în acest caz.

6. Aspecte privind siguranța

Acest caz descrie un tratament excepțional cu doze mari de VAE (chiar și în comparație cu alte tratamente VAE cu doze mari în rapoarte și studii de caz) fără efecte secundare severe sau persistente. Tratamentul a fost efectuat de un medic cu experiență vastă în tratamentul VAE cu doze mari. Înainte de tratament și pe întreaga perioadă de tratament, pacientul era sănătos și în stare bună și fără comorbidități. Concentrațiile regulate ale sângelui au fost normale pe întreaga durată a intervenției și nu au evidențiat niciun indiciu pentru hematoxicitate sau imunotoxicitate a acestor doze foarte mari de VAE. Trebuie să considerăm totuși că raportăm rezultatele unui singur caz singular. Prin urmare, strategia de tratament nu poate înlocui tratamentul multimodal standard recomandat. Tratamentul cu VAE, în timp ce este sigur chiar și în doze mai mari, 25 ] produce încă reacții de febră mare, care pot fi prea severe pentru pacienții cu boală avansată sau cei cu sănătate fizică sau psihică redusă sau care suferă chemo- / radioterapie contemporană. În cazuri rare, perfuziile intravenoase VAE – o utilizare necorespunzătoare a VAE – pot induce reacții alergice sau pseudo-alergice, mai ales atunci când viteza de administrare este prea rapidă. În consecință, pacienții trebuie să-și dea consimțământul în cunoștință de cauză și să rămână sub supravegherea medicală, iar medicii trebuie să fie pregătiți pentru a trata reacțiile alergice sau pseudo-alergice. 27 , 36 ]

7. Concluzie

Pe baza acestui caz și a cazurilor raportate mai devreme, VAE pare să aibă un potențial pozitiv în MCM, mai ales atunci când este utilizat în doze mari. ML și VT sunt cunoscute ca având proprietăți citotoxice directe și stimulează căile imune ale sistemului imun specific și nespecific și în acest mod ar fi putut contribui la controlul tumorii în acest caz. Sunt necesare cercetări suplimentare privind siguranța și eficacitatea VAE în doze mari și VAE intravenoase și intralezionale, în special în MCM.

Recunoasteri

Mulțumim departamentului de cercetare al Klinik Arlesheim pentru furnizarea datelor privind temperatura pacientului și pentru ajutor practic, Dr. Helmut Kiene pentru revizuirea manuscrisului și „Stiftung Integrative Medizin” pentru sprijin financiar. Acest raport de caz a fost întocmit în conformitate cu Ghidul CARE.

Note de subsol

Abrevieri: AJCC = Comitetul mixt american pentru cancer, BRAF = gena fibrosarcomului cu creștere rapidă de tip B, FDG = Fludeoxiglucoză ( 18 F), MCM = melanom cutanat malign, ML = lectină de vâsc, PET- CT = tomografie cu emisie de pozitroni tomografie computerizată = Uniunea internațională contre le cancer, VAE = Extractele albumului Viscum, VT = viscotoxină.

Autor: PGW, AH și GSK au contribuit la proiectarea rapoartelor de caz. AH a fost medicul responsabil și a furnizat informațiile pacientului. PGW și AH au colectat și au furnizat datele. PGW a fost autorul principal al lucrării, a avut acces deplin la toate datele și este garantul. GSK a supravegheat raportul de caz și procesele de publicare.

Finanțare / asistență: Acest raport de caz a fost pregătit în conformitate cu Ghidul CARE.

A fost primit un consimțământ informat de la pacient pentru publicarea raportului și a imaginilor însoțitoare. Pacientul a citit versiunea de trimitere a raportului și a confirmat conținutul acestuia.

Autorii au declarat următoarele potențiale conflicte de interese în ceea ce privește cercetarea, autorul și / sau publicarea acestui articol: IFAEMM a beneficiat de granturi de cercetare restricționate, onorariile și cheltuielile de călătorie de la Weleda, Abnoba și Helixor. Niciunul dintre aceștia nu a avut nicio influență asupra proiectării, conducerii, analizei și publicării studiului. AH nu a declarat niciun conflict de interese.

Logo de medicină

Home Search Submit a Manuscript Medicine
Medicină (Baltimore) . 2017 Nov; 96 (46): e8731.
Publicat online 2017 Nov 17 doi: 10.1097 / MD.0000000000008731
PMCID: PMC5704862
PMID: 29145317
Remisiunea completă și supraviețuirea pe termen lung a unui pacient cu metastaze melanomice tratate cu extras din albumul Viscum
Un raport de caz
Paul G. Werthmann , MD, a, * Alexandr Hintze , MD, b și Gunver S. Kienle , MD a, c
Editor de monitorizare: Satyabrata Pany.

Referințe

[1] Millet A, Martin AR, Ronco C și colab. Metastatic melanom: perspective asupra evoluției tratamentelor și provocărilor viitoare: melanomul metastatic . Med Res Rev 2017; 37 : 98-148. PubMed ]
[2] Kalialis LV, Drzewiecki KT, Klyver H. Regresia spontană a metastazelor din melanom: revizuirea literaturii . Melanom Res 2009; 19 : 275-82. PubMed ]
[3] Kölmel KF, Pfahlberg A, Mastrangelo G și colab. Infecțiile și riscul de melanom: rezultatele unui studiu multicentric de caz-control EORTC. Organizația Europeană pentru Cercetarea și Tratamentul Cancerului . Melanoma Res 1999; 9 : 511-9. PubMed ]
[4] Pfahlberg A, Schneider D, Uter