Arhive etichetă | carcinom hepatocelular

Un studiu translațional „raport de caz” pe molecula mică „blocant de energie” 3-bromopiruvat (3BP) ca agent anticancer puternic

Abstract

Mica moleculă de alchilare, 3-bromopiruvat (3BP), este un agent anticancer puternic și specific. 3BP este diferit în acțiunea sa de cele mai multe medicamente chimice disponibile în prezent. Astfel, 3BP vizează metabolismul energetic al celulelor canceroase, atât glicoliza ridicată („Efectul Warburg”), cât și fosforilarea oxidativă mitocondrială. Aceasta inhibă / blochează producția totală de energie, ceea ce duce la o epuizare a rezervelor de energie. Mai mult, 3BP ca „blocant al energiei”, este foarte rapid în uciderea unor astfel de celule. Acest lucru este în contrast puternic cu agenții anticanceroși mai des folosiți, care de obicei durează mai mult pentru a arăta un efect vizibil. În plus, 3BP la concentrațiile sale eficiente care ucid celulele canceroase are un efect mic sau deloc asupra celulelor normale. Prin urmare, 3BP poate fi considerat un membru, poate unul dintre primii, ai unei noi clase de agenți anticancer. În urma descoperirii 3BP ca un nou agent anticancer in vitro în anul 2000 (publicat în Ko et al. Can Lett 173: 83-91, 2001), precum și ca agent anticancer, extrem de eficient și rapid, in vivo la scurt timp după aceea (Ko et al Biochem Biophys Res Commun 324: 269-275, 2004), a fost demonstrată eficacitatea sa ca agent anticancer puternic la om. Aici, pe baza cercetărilor translaționale, raportăm rezultatele unui studiu de caz la un pacient adult cu cancer tânăr cu carcinom hepatocelular fibrolamelar. Astfel, o descoperire de la banca de la Departamentul de Chimie Biologică de la Universitatea Johns Hopkins, Școala de Medicină a fost dusă în mod eficient la tratamentul de la pat la Universitatea Johann Wolfgang Goethe Frankfurt / Spitalul principal, Germania.

Rezultatele obținute promit 3BP ca viitor cancer terapeutic, fără citotoxicitate aparentă, atunci când este formulată corect.

PMID: 
22328020 
DOI: 
10.1007 / s10863-012-9417-4
 2012 febr. 44 (1): 163-70. doi: 10.1007 / s10863-012-9417-4. Epub 2012 11 feb.

1
Cancer Cure Med LLC, Owings Mills, MD 21117, SUA.

Un caz de carcinom hepatocelular rezistent la doxorubicină după transplantul hepatic care arată răspuns la produsul medicamentos din plante, extract de Rhus verniciflua Stokes

Abstract

Nu există un protocol stabilit dovedit a fi benefic pentru tratamentul recurenței carcinomului hepatocelular după transplant hepatic. Doar câteva rapoarte au arătat ca tratamentul direct prin operație sau ablație să fie predictori independenți de supraviețuire pentru recurența localizată. Mai mult, necesitatea imunosupresiei pentru a preveni respingerea alografei îi face pe mulți medici să ezite să administreze chimioterapia sistemică. Acest raport de caz documentează un caz în care administrarea unui produs pe bază de plante, un extract din arborele de lac, Rhus verniciflua Stokes, a fost asociată cu o scădere a dimensiunii metastazelor pulmonare la un pacient cu carcinom recurent hepatocelular după transplantul hepatic refractar la doxorubicină . Acest pacient a prezentat o supraviețuire prelungită în comparație cu timpii de supraviețuire medii și o toxicitate mică.

PMID: 
20308087 
DOI: 
10.1177 / 1534735409359772
[Indexat pentru MEDLINE]
 2010 mar; 9 (1): 100-4. doi: 10.1177 / 1534735409359772.

Kim KS 1 , Jung HS , Choi WC , Eo WK , Cheon SH .

1
Colegiul de Medicină Orientală Kyunghee, Seul, Coreea.

Erratum în

  • Integr Cancer Ther. 2010 mar; 9 (1) doi: 10.1177 / 1534735411416420. Kim, Hye Ryun [eliminat].
  • Integr Cancer Ther. 2011 septembrie; 10 (3): 299.

Un caz de regresie spontană a carcinomului hepatocelular cu metastaze pulmonare multiple

Abstract

Regresia spontană a carcinomului hepatocelular (HCC) este un fenomen rar. Prezentăm aici cazul unui pacient cu carcinom hepatocelular cu metastaze pulmonare multiple, la care malignitatea a regresat în mod spontan după administrarea de Mycelium de Phellinus linteus .Un bărbat în vârstă de 79 de ani a consultat spitalul care se plânge de disconfort epigastric.RMN abdominal și CT au arătat o tumoare cu diametrul de 3 cm în ficat, iar CT în piept au arătat numeroase leziuni nodulare. Nivelurile de alfa-fetoproteină (AFP) și proteina induse de deficitul sau antagonistul de vitamină K (PIVKA-II) au fost foarte mari. Am diagnosticat HCC cu metastaze pulmonare multiple și nu s-a efectuat nici o terapie. Independent el a luat exact de la Mycelium Phellinus linteus timp de o lună, iar după 6 luni tumorile păreau a fi în regresie completă. Mecanismul care stă la baza acestui fenomen intrigant rămâne necunoscut.

Regresia spontana a unei TUMORI MALIGNE e considerat un fenomen rar întâlnit într-unul dintre la fiecare 60.000-100.000 de cazuri . Prezentam cazul  unui pacient cu carcinom hepatocelular (HCC) cu metastaze pulmonare multiple, la care tumora malignă a regresat după ce a luat Phellinus linteus Miceliu. Un total de 47 de cazuri de regres spontan hepatocarcinom celular HCC au fost raportate, dar mecanismele care stau la baza acestora trebuie încă elucidate Mai multe rapoarte despre astfel de cazuri
ar trebui să contribuie la clarificarea mecanismelor din spatele spontanei regresii a cancerelor și care sa faciliteze stabilirii de noi terapii anticanceroase.
CAZ
Pacient: Un bărbat de 79 de ani
Concluzie principală: Disconfort epigastric
Istoria bolii actuale: pacientul a suferit hepatita cronică C și ciroza hepatică. În 2000, HCC
a fost detectată în regiunea s 8 , și terapia de coagulare cu micro- unde(PMCT) a fost efectuata . În 2002, HCC a revenit în aceeași zonă, iar PMCT a fost efectuată în aprilie 2002, urmată de transcatheter chemoembolizarea arterială (TACE) în august 2002.
Pacientul a fost ulterior urmărit și a fost suspectat în martie 2003. Pacientul a fost
trimis la departamentul nostru pentru examinare amănunțită și tratament.
Datele de laborator privind prezentarea inițială au fost la fel urmează: RBC, 401 •
Hb, 13,2 g / dl; WBC, 3.600 / / xl; PLT, 11,9 • T-Bil, 0,7 mg / dl; GOT, 63 U / l; GPT, 49 U / l; LDH, 211 U / l; ChE, 69 U / l; TP, 7,8 g / dl;ALB, 4,1 g / dl; Activitatea PT, 105%; și APTT, 25,3 sec; nu ascita; nici o encefalopatie hepatică. Funcțiile hepatice a fost clasificat drept Child A. Nivelurile de  – markeri tumori hepatici au fost semnificativ mai mari: alfa-fetoproteina (AFP) a fost de 10,101 ng / dl (valoare de referință: 10,0 ng / dl)
teină indusă de deficiența sau antagonistul de vitamina K (PIVKA-II) a fost de 5,114 AU / I (valoare de referință: 40 AU / l).
Antigenul HBV a fost negativ, în timp ce anticorpul anti-HCV a fost
pozitiv.
Rezonanță magnetică imagistica (RMN) intensă dinamică abdominală  a aratat ca a fost o tumora cu diametrul de 3 cm prezent în regiunea $ 8 în faza arterială și o zona ramificata de intensitate mică a bolii a fost observată în   faza portala, sugerând HCC însoțită de tromb portal (figura 1). Dynamic CT imbunatatit a arătat, de asemenea, constatările care a fost compatibil cu rezultatele RMN HCC.  CT piept a arătat numerosi noduli bine definiți în ambele câmpuri pulmonare, sugerând astfel metastaze pulmonare multiple 

(fig.2).
HCC ciuperca imunitara
Figura 1. RMN amplificat dinamic din abdomen.
În faza arterială, este evidentă o leziune intens colorată cu un diametru de aproximativ 3 cm.
În faza portalului, se observă o zonă de intensitate mică a bolii, sugerând HCC însoțită cu tromb portal.
Figura 2. CT cu piept obișnuit.
Semnele leziunilor nodulare semicirculare sunt evidente în ambele câmpuri pulmonare, sugerând metastaze pulmonare multiple.
Pe baza constatărilor de mai sus, HCC cu noduli plămânii multipli au fost diagnosticat – HCC cu metastaze. Prezența a multiple metastaze ale plămânilor a contraindicat terapiei invazive și s-a recomandat terapia conservativă.
Urmărirea pacientului de catre un specialist , dar nu a primit niciun tratament pentru HCC. Independent, pacientul a luat exact de la Phellinus linteus (P. linteus) Miceliu (pulberea Meshima EX, LS Medical, Tokyo, Japonia) 3,3 GRAME / zi timp de o lună. Șase luni mai târziu, abdominal RMN  dinamic amplificat a indicat disparitia tumorii în regiunea $ 8 și lipsa semne indicative din HCC (figura 3). În mod similar, CT dinamic îmbunătățit, de asemenea nu au prezentat semne de HCC, în conformitate cu RMN.
În plus, CT în piept simplu a arătat că leziunile pulmonare au dispărut (figura 4). În plus, nivelurile de markerii HCC AFP și PIVKA-II care au fost semnificativ marite la prima vizită inițială, au scăzut la 13,2 ng / dl și respectiv 18 UA / 1, începând cu 6 luni mai tarziu, cand leziunea primară și metastazele pulmonare au regresat (Tabelul 1).
În prezent, pacientul este urmărit  ambulatoriu, și nici o constatare imagistică care să indice recurente HCC sau metastaze pulmonare NU au fost observate la 10 luni de la prima sa vizită la spitalul nostru. În mod similar, nivelurile markerilor HCC nu au crescut.
HCC ciuperca imunitara 2
Fig. 3. RMN dinamic abdominal îmbunătățit 6 luni mai târziu.
În faza arterială, leziunea intens pătată în regiunea 8 $ a dispărut și
nu există semne indicative de HCC în ficat.
Figura 4. CT  piept normal, 6 luni mai târziu.
Leziunile nodulare multiple observate la prezentarea inițială au dispărut.
Tabelul 1. Schimbări ale markerilor tumorali
6 martie 2003
21 august 2003 16 martie 2004 2 septembrie 2004
AFP (ng / ml)
10101
13.2
13.6
12.9
PIVKA II (AU / ml)
5114
18.0
16.0
18.0
DISCUŢIE
definitia de regresie spontană a cancerului malign propusă de Everson și Cole în 1966  : partiala sau completa disparitie a tumorii fara administrarea unui tratament cunoscut care sa ofere vindecare  .Incidenta de regresie spontană a cancerului malign este una în
la fiecare 60.000-100.000 de cazuri. 1
Potrivit unui studiu din 2004 de Kato și colab., 47 de cazuri de regresie spontană HCC au fost documentate, inclusiv pacientii lor. În7 dintre aceste cazuri, metastazele pulmonare au dispărut, de asemenea. 2 In 2001, Ikeda și colab. au examinat 34 de cazuri spontane-regresii HCC și a raportat că regresia hepatcarcinomului celular HCC a avut tendința să apară la bărbați> 60 de anicu boală hepatică cronică, tumoare gigantică și  cu nivelurile de AFP crescute.  3
Cu excepția dimensiunii tumorii, pacientul prezent a îndeplinite toate aceste caracteristici.
În ceea ce privește cauza regresiei spontane a HCC, pot exista factori externi, cum ar fi următorii factori implicati: sângerare gastrointestinală; tumora ischemica modificări datorate cateterismului în timpul angiografiei; masiva transfuzie de sânge; administrarea steroizilor; discontinuarea preparatelor hormonale, inclusiv pe cale orală contraceptivele; utilizarea ierburilor și a medicamentelor chinezești;
trauma; interventie chirurgicala; și biopsie. Cu toate acestea, detaliile ref. regresia spontană rămân necunoscute. 
Nakai și colab. a raportat cazul unui pacient cu HCC care a crescut în dimensiune după TACE și 16 luni mai târziu a regresat spontan, fără tratament. a fost efectuată o investigație imunologica între regresia spontană și sporiti Markeri de celule NK. 5
În plus, Abiru și colab. au luat în considerare că relațiile dintre regresia spontană și creșterea IL-8 se datorează creșterii T- și NK- activități celulare. 6
La pacientul prezent, HCC a recidivat după TACE a regresat spontan fără orice terapie anticanceroasă, sugerând implicarea de mecanisme imunologice. În ultimii ani, există
au fost multe studii ale mecanismelor imunologice tumorale, și rezistența la HCC la apoptoza hepatomului a fost demonstrata. Exprimarea receptorului Fas, care poate
induce apoptoza, se crede că scade sau dispare.
În plus față de anormalitatea receptorului Fas, în acest caz  activarea apoptozei ar fi putut contribui la regresia spontană. 7
În plus, spontana regresie în cazul prezentului pacient poate fi atribuită efectele antitumorale ale Mycelium P. linteus, pe care pacientul a decis în mod independent să ia.
P. linteus Mycelium este un tip de ciupercă care aparține  familiei de ciuperci de copite negre care crește pe dud-copaci și ingredientul activ este B-glucan. Diferite tulpini de P. linteus există (tulpinile PL2 și PL5 sunt con- siderate cele mai puternice), și ciuperci sunt crescute în diferite regiuni. 
P. linteus este considerat a poseda unele proprietăți antitumorale și pentru a activa sistemul imunitar.
În 1968, P. linteus a demonstrat că suprimă proliferație la șoarecii altoiți cu celule canceroase. În plus, P. linteus se referă la activarea semnificativă a celulelor
și imunitățile umorale prin îmbunătățirea funcției macrofagelor, limfocitelor T și limfocitelor B, la prevenirea proliferării cancerului și a metastazelor într-o formă / manieră netoxică . 9-11 Cu toate acestea, nici o relație între P. linteus și  regresia HCC nu s-a raportat.
În ultimii ani, mass-media au raportat utilizarea de remedii populare, inclusiv Agaricus, Curcuma și Phellinus, la pacienții cu cancer malign terminal,
dar nu există dovezi concludente care să susțină eficacitatea acestora căi de atac. Cu toate acestea, ca și în cazul prezentului pacient, unii pacienții pot răspunde la acest tip de tratament. determinarea eficacitatii remediilor folclorice, de identificare a
reacțiile adverse și evaluarea utilizării combinate cu tratamentele convenționale sunt necesare.
CONCLUZIE
Am descris aici cazul unui pacient în care HCC cu metastaze pulmonare multiple a regresat spontan Regresia ar fi putut fi atribuită efectele antitumorale ale P. linteus.
REFERINȚE
1) Cole WH. Eforturile de a explica regresia spontană a
cancer. J Surg Oncol, 17: 201-209, 1981.
2) Kato H, Nakamura M, Muramatsu M, Orito E, Ueda R,
Mizokami M. Regresia spontană a hepatocelularilor
carcinomul: două rapoarte de caz și o revizuire a literaturii.
Hepatol Res, 29: 180-190, 2004.
3) Ikeda M, Okada S, Ueno H, Okusaka T, Kuriyama H.
Regresia spontană a carcinomului hepatocelular cu
multiple metastaze pulmonare: un raport de caz. Jpn J Clin Oncol,
31: 454-458, 2001.
4) Nakai T, Shinomura T, Nakai H. Un caz de trei ani
supraviețuirea fără supraviețuire după regresia spontană fără
orice tratament pentru carcinomul hepatocelular recurent
Evaluarea activității celulelor NK cu re-
vedere. J Wakayama Med Soc, 53: 197-201, 2002.
5) Nakai T, Shimomura T, Hirokawa F. Regresul spontan
a carcinomului hepatocelular recurent după TAE:
mecanismele posibile de mediere imună. Int J Clin
Oncol, 6: 149-152, 2001.
6) Abiru S, Kato Y, Hamasaki K, Nakao K, Nakata K, Eguchi
K. Regresia spontană a carcinomului hepatocelular
asociate cu niveluri ridicate de interleukină 18. Am J
Gastroenterol, 97: 774-775, 2002.
7) Iyoda Kenya, Sasaki Yutaka, Hayashi Norio. apoptoza
și transducția semnalului în boala hepatică. Saishin Igaku,
57: 42-46, 2002.
8) Ikekawa T, Nakanishi M, Uehara N, Chihara G, Fukuoka
F. Acțiunea antitumorală a unor basidiomicite, în special
Phllinus Linteus. Gann, 59: 155-157, 1968.
9) Ishibashi H, Komiyama M, Maruyama N, Abe S,
Yamaguchi H. Activarea imunologică a macrofagelor
și limfocitele la șoareci administrați intraperitoneal
cu un preparat Phlininus linteus. Pharmacometrics, 65:
35-38, 2003.
Han SB, Lee CW, Jeon YJ și colab. Efectul inhibitor al
polizaharide izolate din Phellinus linteus pe tumoare
creștere și metastaze. Immunopharmacology, 41: 157-
164, 1999.
Kim HM, Han SB, Oh GT și colab. Stimularea umoral
și imunitatea mediată de celule prin polizaharidă din
ciupercă Phellinus linteus. IntJlmmunopharmacol, 18:
295-303, 1996.
Lô)
11)
142
RADIAȚIE MEDICINA
  • Hiroyuki Kojima
  • Noboru Tanigawa
  • Shuji Kariya
  • Atsushi Komemushi
  • Yuzo Shomura
  • Satoshi Sawada
  • Eitatsu Arai
  • Yoshiro Yokota

O formula tradițională chineză pe bază de plante medicinale versus terapie intervențională după rezecția carcinomului hepatocelular mic: urmărire de 22 de ani

Abstract

OBIECTIV:

Pentru a compara eficacitatea pe termen lung a comprimatelor din compusul numit Ruanjianhugan (RJH) și a terapiei interventionale (IT) la pacienții după rezecția carcinomului hepatocelular mic (HCC). la 399 de pacienti dupa rezectie de HCC mici, care au fost admise intre ianuarie 1987 si decembrie 2008 in cadrul Departamentului de Chirurgie Hepato-Biliara si Centrul de chirurgie minim invaziva, primul afiliat Spitalul de la Universitatea de Medicina din Guangxi. Patru grupe s-au bazat pe diferite moduri de terapie: un grup DOAR medicina plante chinezesti  (TCMO), un grup TCM combinat cu terapie interventională (TCM-IT), un grup terapeutic interventional (ITO) și un grup de operatie simplă (SO). Factorii prognostici au fost corelați cu supraviețuirea globală (OS), iar ratele supravietuire globala OS au fost calculate prin metoda Kaplan-Meier, iar analizele multivariate pentru factorii care afectează supraviețuirea au fost evaluate prin modelul de risc proporțional Cox.

REZULTATE:

OS mediană a fost de 151.20 luni în grupul TCM-IT, 43.87 luni în grupul ITO și 20.77 luni în grupul SO.

Toate ratele de supraviețuire ale grupului care a folosit DOAR plane medicinale TCMO au fost mai mari decât cele ale celorlalte trei grupuri (> 50%).

Sistemul OS cu durata de 5, 10 și 15 ani la pacienții cu TCMO și ITO a fost de 83,94%, 45,50% și 71,22% și respectiv 33,34%, 55,58% și respectiv 9,26% (raport risc, 0,209; interval de încredere 95% , 0,126-0,347; P = 0,000).

Analiza multivariată a evidențiat faptul că factorii de risc independenți au fost modul terapiei (P = 0,000), sexul (P = 0,005), istoricul familial (P = 0,011), clasificarea TNM a stadiului tumorilor maligne (P = P = 0,021) și diametru maxim (P = 0,030).

CONCLUZIE:

Utilizarea pe termen lung a comprimatelor din compusul RJH pe cale orală poate îmbunătăți supravietuirea globala pentru mici HCC după rezecție comparativ cu terapia interventionala IT.

 

INTRODUCERE
Cancerul de ficat este al șaselea cel mai comun cancer de lume – cu 626.000 de cazuri noi pe an [1] , dintre care jumătate sunt în China [2] . Pentru tumori mici (tumori ≤ 5 cm în diametru) carcinomul hepatocelular (HCC), rezecția precoce este acceptat ca fiind cel mai bun mod de a prelungi supraviețuirea ca timp [3,4] , dar recurența postoperatorie reprezintă bariera în calea prelungirii supravietuirii. Rata de recurență de 5 ani a HCC
după rezecția curativă este> 60% [5,6] , iar rezecția de 5 ani, rata de currence a mici HCC după rezecția curativă poate fi la fel de mare ca 43,5% [7] .Studii  Randomizate cu terapii, incluzând embolia arterială transcatheter (TAE) și  perfuzie arterială chimioterapie transcatheter ( (TAI) care confirmă eficacitatea tratamentului prelungit in ceea ce priveste timpul de supraviețuire global (OS) sunt rare, deci prevenirea recurentei  și metastazelor ale cancerului hepatic au devenit a punct focus actual [7,8] . Studiul nostru anterior a dezvăluit ca utilizarea combinată a TACE și plante (TCM) au fost mai avantajoase în durata duratei de supraviețuire [9,10] .
Guangxi este o zona cu un risc ridicat de repentru HCC în China [11] și carcinoame hepatice primare au ocupat locul al doilea în mortalitatea cauzată de cancer în China [12] . Acest studiu în primul Spital afiliat din Universitatea de Medicină Guangxi a fost concepută pentru a dovedi acest lucru ca pe termen lung, comprimate orale Ruanjianhugan (RJH), un compus din plante medicinale chinezesc , este mai avantajos
în îmbunătățirea sistemului de operare pentru miciiHCC după rezecție comparativ cu terapia interventionala (IT chimioterapie si restul celor mentionate anterior). Acest studiu a fost aprobat de comisiile competente de etică și a fost efectuat în conformitate cu standardele etice stipulate în Declarația de la Helsinki. Toate persoanele și-au semnat consimțământul informat înainte de studiu.
METODE
Subiecte
Un total de 1420 de pacienți consecutivi cu cancer hepatocelular HCC care au suferit o rezecție curativă începând din ianuarie 1987 în Decembrie 2008 au fost înscriși în acest studiu prin identificarea codurilor de diagnostic pentru HCC în Clasificarea Internațională a bolii, revizuirea a 10-a, Modificări clinice (ICD-10), folosind fișele medicale ale primului Spital afiliat al Universității medicale Guangxi, Nanning, China.
Incluziune și excludere
Din cei 1420 de pacienți, 493 au fost diagnosticați cu carcinom hepatocelular HCC prin histopatologie postoperatorie și care au avut mic HCC (diametrul <5 cm) a îndeplinit criteriul de includere . Dintre acești 493 de pacienți cu HCC mic, 94 au fost exclusi
din următoarele motive: 21 au suferit rezecții necirative, 4 au murit în timpul spitalizării, 49 au avut date incomplete de urmărire, 14 au suferit percutanat
o terapie injectabilă cu etanol, iar 6 au fost supuse la nivel local terapia de ablație. Restul de 399 de pacienți (346 bărbați și 53 de femei) au fost incluse și retrospectiv
analizate.
Acest studiu a fost revizuit și aprobat de către comitetelor de cercetare de ambele Guangxi Medical Universitatea (Nanning, China) și Militar al II-lea Universitatea Medicală (Shanghai, China) în conformitate cu liniile directoare publicate de Ministerul chinez Sănătate, muncă și bunăstare [13] . Toți pacienții au semnat, înainte de includerea lor în studiu, iar toate înregistrările au fost păstrate confidențiale. Fiecare pacient din
acest studiu a fost de acord cu supravegherea pe termen lung de către doctori de la Departamentul de Hepatobilar Chirurgie, primul Spital afiliat din Universitatea Guangxi Medical (Nanning, China), iar numele lor nu va fi eliberat .
Proiectare proiect
Acești 399 de pacienți au fost împărțiți în patru grupuri  în funcție de modul de terapie: DOAR plante chineze TCM-Only (TCMO) grup ( n = 122),
TCM combinat cu terapie interventionala IT (TCM-IT) grupul ( n = 68), 
grupul IT Only -monoterapie IT (ITO) ( n = 172) 
simpla operatie (SO) ( n = 37).
Cele patru grupuri au fost comparabile în funcție de vârstă, sex, istorie familială, medicală comportament în căutarea ingrijirii , starea infecției cu virusul hepatitei,
starea cirozei, scorul Child-Pugh, stadiul TNM, numărul si  mărimea tumorilor , invazia vasculară, sule și prezența invaziei venei portale (Tabelul 1).
Grupul TCMO: Pacienții din grupul TCMO au luat/ administrat pe cale orală pe termen lung  compusul RJH tablete se lasă după 1 până la 3 luni după rezecția curativă.
Produse de Fabrica farmaceutica din Guangxi MedicalUniversitatea, Nanning, China (licență de producție nr.Gui ZzY 19950717), comprimatele RJH au fost compuse din 10
materiale /plante medicale: Ku Shen (Radix Sophorae Tonkinesis, Xia Ku Cao (Spica Prunellae), Hu Zhang (Rhizoma Polygoni Cuspidati), Wu Wei Zi (Fructus Schisandrae), Chi Shao (Radix Paeoniae Rubra), Nü Zhen Zi (Fructus Ligustri Lucidi), San Qi (Radix Notoginseng), Dan Shen (Salvia miltiorrhiza Bunge), Huang Qi (Radix Astragali) și Sha Ren (Fructus Amomi).
Fiecare comprimat conține 0,31 g de medicamente echivalent cu 6,0216 g de medicament brut. 
doza a fost de trei comprimate de trei ori pe zi.
Un curs de tratamentul a durat 3 luni, iar pacienții au primit două pina la trei cursuri în fiecare an.
Grupul ITO: Acești pacienți au suferit o intervenție postoperatorie i Un cateter superselectiv a fost inserat în arteria hepatica propria sau la artera hepatica stânga / dreapta pentru TAI sau TAE. Două până la trei droguri au fost selectate dintre epirubicină, hidroxicamptotecină, mitomycin și fluorouracil pentru TAI, în timp ce adezivi, gelatina spongioasă, Lipiodol și Lipiodol Ultra Fluidele au fost selectiv utilizate ca agenți de embolizare în timpul tratamentului
Grupul TCM-IT: Acești pacienți au luat oral pe termen lung administrarea comprimatelor RJH timp de 1 până la 3 luni după rezecție curativă combinată cu IT.
Grupul SO: Grupul SO nu a primit tratament după rezecție.

hcc TCM 1

Evaluare și urmărire
Îngrijirea ambulatoriu și spitalizare a fost efectuată odată la 2 luni în cursul primului an, la fiecare 3 luni de la al 2-lea până la al patrulea an, și semianual după 5 ani. Nivelurile a-fetoproteinei serice (AFP), funtie hepatica si renala , B-ultrasonografia și examinarea cu raze X,(semianual) au fost măsurate. Dacă se presupune ca o focalizare /infecție a fost descoperită , CT sau RMN uneori a permis  reducerea diagnosticului prompt înainte de rezultatele culturii; diagnosticele au fost confirmate prin examen patologic cu biopsie sau semnătură digitală dacă este necesar.
Un savant, profesorul Liang Shui-ting, a fost acreditat ca membru al personalului medical cu normă întreagă a personalului medical al doilea nivel de prevenire pentru HCC. Profesor Shui-ting a urmărit și a înregistrat toate importanțele pacienților
tant, inclusiv metode de tratament,reactii adverse, recurenta, timpul morții etc., la fiecare 3 luni. Unii pacienți au fost urmăriți prin telefon și corespondența ca o chestiune de conveniență. În plus , unele informații au fost obținute de la Departamente a înregistrărilor medicale ale spitalelor sau clinici locale . Urmărirea a continuat până la pacienți au decedat. Ultima urmărire a avut loc la 28 februarie 2009.
Obiectivul primar.Sistemul de operare a fost definit ca fiind timpul scurs de la intervenția chirurgicală până la moarte sau ultima urmărire.
Timpul de supraviețuire al pacienților pierduți la urmărire a fost definit ca ultimă perioadă de urmărire exactă și timp al pacienților rămași până la sfârșitul anului
studiul a fost analizat statistic ca valoare cenzurată.
analize statistice
Diferite grupuri de date de măsurare după testul de tributare și omogenitate a rezultatelor variațiilor au fost comparate folosind analiza varianței atunci când variantele au fost egale și teste  neparametrice în cazul varianțelor ce nu erau egale. Datele clasificate au fost analizate folosind metoda Cochran-Mantel-Haenszel. Analizele de supraviețuire au fost efectuate prin metoda Kaplan-Meier, iar metoda supraviețuirea a fost comparată utilizând testul log-rank. o multivariata
 analiză de regresie variabilă utilizând metoda Cox a fost efectuată modelul riscurilor proporționale și fiecare grup a fost semnat sub formă de variabilă dummy pentru diferitele sale terapii. Analiza de regresie treptată a fost utilizată pentru ajustarea multivariată a tuturor celor 15 factori clinico-patologici: vârsta, sexul, istoria familială, îngrijirea medicală,starea infecției cu virusul hepatitei, starea cirozei, scorul Child-Pugh, stadiul TNM, localizarea tumorii,dimensiunea și numărul tumorii, invazia vasculară,
encapsularea tumorii, prezența invaziei venei portale și terapia model. Pentru toate analizele, valorile P erau bidirecționale și numai P < 0,05 a fost considerat statistic semnificativ. Procesarea și analiza datelor au fost efectuate cu SPSS 10,0 pachet statistic (SPSS Inc., Chicago, IL, SUA) și pachetul statistic SAS 9.1.3 (SAS Institute, Inc., Cary, NC, SUA) și EPIDATA Versiunea 3.1 (EpiData Asociația, Odense, Danemarca).
REZULTATE
Compararea caracteristicilor clinicopatologice și patologice 
Tabelul 1 prezintă comparația caracteristicilor clinicopatologice și  patologice. Numai localizarea tumorii a fost considerată semnificativă ( P = 0,036). Ceilalți factori nu diferă semnificativ între grupuri ( P> 0,05); localizarea tumorii s-a dovedit a fi un factor de prognostic folosind variantă (tabelul 2).
Comparație  supravietuire globala OS dupa chirurgie
Grupul TCMO vs grupul ITO. 5, 10 și 15 ani
Ratele OS în grupul TCMO ( n = 122) și grupul ITO n = 172) au fost
83,94% și 45,50%, 71,22% și 33,34%, respectiv 55,58%, respectiv 9,26%
P =0.000; risc relativ = 0,209; 95% CI, 0,126-0,347) (Ta-2-4).
Grupul TCMO vs grupul TCM-IT. 5- și 10-ani
Ratele de operare în grupul TCMO au fost de 83,94% și 74,16%, respectiv cei din grupul TCM-IT au fost de 71,22%, respectiv 57,10% (test log-rank, χ 2 = 2,365;P = 0,124) (tabelele 2 și 3). Nu a existat nimic diferența semnificativă dintre cele două grupuri.
Grupul TCM-IT vs grupul ITO.
A existat o tendință de a arata mai bine ratele OS la pacientii TCM-IT (5- si  10 ani de 74,16% și 57,10%) în comparație cu pacienții ITO (ratele de 5 și 10 ani
45,50%, respectiv 33,34%), iar diferența a fost semnificativă ( P < 0,0001) (tabelele 2 și 3).
Grupul TCMO vs grupul SO.
A fost o tendință spre rate mai bune ale OS la pacienții cu TCMO (5- și 10-ani
ratele de 83,94% și 71,22%, respectiv) comparativ cu pacienți cu SO (rate de 5 și 10 ani de 13,84% și 13,84%, respectiv), iar diferența a fost semnificativă
cant (test log-rank, χ 2 = 74.407; P = 0,000) (tabelele 2 și 3).
Grupul ITO vs grupul SO.
Ratele de 5 și 10 ani ale sistemului de operare
la pacienții ITO au fost 45,50% și 13,84%, respectiv –
iar pacienții cu SO au fost 33,34% și 13,84%
respectiv (test log-rank, χ 2 = 15,832, P = 0,000) (Ta- 2 și 3); a existat o diferență semnificativă, între cele două grupuri.
hcc tcm 2
Analiză univariată și multivariată pentru factori prognostic
OS. Analiza univariată pentru OS a fost efectuată pentru pacienti(tabelul 2) și 7 din 15 variații au fost semnificative factori prognostici ( P < 0,05): antecedente familiale, tumori-număr, invazie vasculară, localizarea tumorii, Child-Pugh-clasificarea, stadializarea TNM și modul de terapie.
Analiza de supraviețuire multivariată pentru OS a fost efectuată de către inclusiv toți cei 15 factori de prognostic pentru a determina factorii independenți de prognostic. După cum se arată în tabelul 4,șase factori independenți au fost după cum urmează: modul de terapie,sex, istoric familial, stadializare TNM, căutări medicale comportamentul și dimensiunea tumorii.
Rezultatele analizei multivariate de supraviețuire au arătat, de asemenea acel grup (3), dimensiunea tumorii, stadiul TNM și familial-istoric au fost factori de risc major de reaparitie pentru mici tumori HCC ( P < 0,05; coeficient de regresie> 0; risc de 2.600, 1.208.1.366, 2.109,) (Tabelul 4), în timp ce comportamentul de îngrijire medicală, sexul, grupul 1) și grupul 2) folosind diferite moduri de terapie au fost factori de protecție  ( P < 0,05, coeficient de regresie <0, risc relativ 0,650, 0,431, 0,209, 0,293)
tcm hcc 3.jpg
Rezultatele au arătat că riscul de deces din cauza HCC în 2009 la pacienții din grupul TCMO au fost reduse la 0,209 comparativ cu în ​​grupurile ITO(de 5 ORI- 500 % risc scazut daca se utilizeaza DOAR aceste plante chinezesti in loc de chimioterapie!!!!!) și în grupurile TCM-IT reduse la 0,293 fata de pacienții din grupurile ITO(de 3 ori daca se opteaza pentru combinatie plante u\cu chimio comparativ cu chimio!!!), respectiv, în timp ce riscul de deces la pacienții din grupul SO a fost de 2.600 ori mai mare fata de pacienții din grupul ITO.
Pierderea de urmărire. Dintre cei 399 de pacienți din studiu, cel mai lung timp de supraviețuire a fost de 22 de ani. Nouăzeci și trei din 399 pacienții au trăit mai mult de 5 ani;56 pacienți din 399 pacienții au fost în cele din urmă pierduți în urma monitorizării. În general rata de pierdere din urmărire a fost de 14,0% (56/399); în grupurile TCMO și ITO a fost de 13,1% (16/122) și, respectiv, 15,7% (27/172).
Reacții adverse:Nu au fost raportate reacții adverse semnificative legate de consumul de plante  la pacienții care au luat-o administrarea orală pe termen lung a compusului RJH. Foarte puțini pacienți au suferit de urinare frecventă nocturnă,
, dar acest simptom a dispărut rapid după tratamentul cu pastile Liuwei Dihuang oral.
hcc TCM 4.jpg
Grupa 3, grupuri SO vs ITO. Ruanjianhugan în carcinomul hepatocelular rezecat.
DISCUŢIE
Până în prezent, rezecția radicală este tratamentul primar ce creste eficacitatea totala operativa a micilor HCC tumori [14,15] . IT a fost aplicata clinic de la sfârșitul anului
1980. Profesioniștii din domeniul medical din China au ajuns recent la un consens în care experții au fost de acord că chimioterapia cu perfuzie intravenoasă arteriala  și embolizarea arterială hepatică sunt principalele metode IT și au sugerat IT pentru HCC la 40 de zile după hepatectomia neurativă [16] .
Cu toate acestea, studiile preliminare au arătat că IT înainte chirurgie pentru tumori mari de HCC NU a prelungit  supraviețuirea fără boala [17] . În plus, au existat încă unele dezbateri asupra eficacității IT în prevenirea HCC-recurența după rezecție curativă pentru tumori mici [18] , în timp ce au existat mai puține rapoarte care au comparat TCM cu IT în China.
În ultimii 20 de ani, tratamentul TCM al tumorilor a avut loc a atras atenție sporită. Mecanismul de medicamente chinezești în tratamentul cancerului a fost recent elucidată de cărturarii din China. Asta a stârnit răspunsuri mari în mediul medical internațional. [19-21] . Studiul prezent a constatat că terapia-mod și istoric familial au fost factori de risc care afectează OS, în timp ce TCM este o intervenție benefică în prevenirea recurentei HCC după rezecția curativă pentru tulpini mici, confirmată în acest studiu; și această constatare referitor istoricul familiei coincide cu concluzia
despre agregarea familială de către savanți în China [22] .
Se consideră în TCM că patogenezele de bază care conduc la cancer de ficat sunt dezechilibre ale integrității și reglarea funcțională a întregului corp [23,24] , și aceasta
punctul de vedere coincide cu teoria despre cancer în Medicină modernă China; IT pentru tumorile a atras creștere de atenție [25] . Bazat pe practica clinică pe termen lung în tratamentul cancerului, cercetătorii din China au concluzionat ca prognoza tumorilor maligne depinde de caracteristicilor biologice ale tumorii [26] , și unele
studiile preclinice au demonstrat că, comprimatele RJH joacă un rol important în prevenirea pentru cei cu factori de risc importanți  HCC [27,28] . În studiu prezent, rata de supraviețuire de 5 și 10 ani în TCMO-pacienți  au fost semnificativ mai mare decât cei aflați în recente rapoarte (ratele de supraviețuire de 5 și 10 ani au fost 58.20%, respectiv 38.47%) [29] . Studii dacă această eficacitate este asociată cu reglementareași controlul invaziei și metastazelor celulelor cancerului hepatic sunt încă în stadii incipiente, iar aceste constatări au nevoie pentru a fi replicate prin alte studii clinice.
Din anii 1970, epidemiologia prevenirii secundare strategiile de hepatom au fost supuse intensiv cercetarii în Nanning, Guangxi și procedurile pentru cancerul de ficat au fost înființate în Departamentul de Hepatobiliar Chirurgie, Primul Spital afiliat din Guangxi Universitatea de Medicina cu detaliate follow-up datele înregistrate în timp.
Cu toate acestea, acest studiu are de asemenea unele limitări. În primul rând, nu am putut să elucidăm în mod suficient date mecanismul molecular al RJH în îmbunătățire
efectul terapeutic clinic pentru compozițiile sale complicate studiile sunt necesare pentru a clarifica. secund, ca studiu unic, dimensiunea eșantionului nu a fost
suficient de mare, acest lucru poate fi afectat fiabilitatea rezultatelor. În al treilea rând, ca studiu retrospectiv, pierderile de urmarire folow-up pacienti au fost inevitabile. În acest studiu, rata de pierdere urmarire a fost de 14,0% (56/399), iar pierderea urmărirea în grupul TCMO a fost de 13,1% (16/122). Pentru pacientii care au fost pierduți pentru urmărire, trebuia să le luăm ultima perioadă de urmărire ca date pentru analiză. Acesti factori necontrolabili ar fi putut conduce la părtinire, studiu fiabil, fiabilitatea a fost limitată la mărime.
În concluzie, acest studiu arată că utilizarea orală pe termen lung comprimate compuse plante RJH după rezecție pentru mici hepatocarcinoame HCC poate îmbunătăți supravietuirea ca timp dupa operatie în comparație cu chimioterapia – IT-ul. Cu toate ca
efectul exact și mecanismul trebuie să fie explorate de către studiile clinice prospective, această vizează o bază pentru a verifica avantajul clar al utilizării TCM pentru pacienți după rezecție pentru pacienții cu HCC mic
PMID: 22876437

Text complet gratuit

https://www.ncbi.nlm.nih.gov/pubmed/22876437

 2012 Jun; 32 (2): 156-63.
O formula tradițională chineză pe bază de plante medicinale versus terapie intervențională după rezecția carcinomului hepatocelular mic: urmărire de 22 de ani
Sun Z 1 , Liang ST , Zhai XF , Lang QB , Zhou QH , Yue XQ , He J , Xu J , Zhu Y , Ling CQ .

1
Departamentul de Sanitarium Area, Spitalul General Nanjing din Comandamentul Militar Nanjing, PLA, Nanjing 211131, China.

 

MULȚUMIRI
Autorii mulțumesc mai ales WU Mei-jing, LU Li-Ping și YU Yang pentru sugestiile lor utile
prelucrarea datelor și analiza statistică.
REFERINȚE
1
Parkin DM , Bray F, Ferlay J, Pisani P. Statistica globală a cancerului –
tics 2002. CA Cancer J Clin 2005; 55: 74-108
2
Qing LX , Sun HC, Tang ZY. Progresele înregistrate în cercetarea pe
tratamentul cancerului hepatic primar – procesul-verbal al ședinței
2006 Hepatopatia internațională Shanghai-Hong Kong.
Chineză J Surg 2006; 44: 1070
3
Yu YQ , Tang ZY, Zhou XD. Experiență în rezecția
carcinom hepatocelular mic. Chin Med J 1980; 93:
491-494
4
Tang ZY , Yu YQ, Zhou XD, Ma ZC, Yang R, Lu JZ, Lin
ZY, Yang BH. .Chirurgia carcinomului hepatocelular mic.
Analiza a 144 de cazuri. Cancer 1989; 64: 546-541
5
Chirurgie de carcinom hepatocelular mic. Analiza 144
cazuri. Cancer 1989; 64: 546-541
6
Llovet JM , Schwartz M, Mazzaferro V. Resecția și livrarea
transplantul de eritrocite pentru carcinomul hepatocelular. Semin Liv-
er Dis 2005; 25: 181-200
7
Schwartz JD , Schwartz M, Mandeli J, Sung M.Neoadju-
vant si terapie adjuvant pentru masina hepatocellular resectable-
cinom: revizuirea studiilor clinice randomizate. lanțetă
Oncol 2002; 3: 593-603
8
Tang ZY , Ye SL, Liu YK, Qin LX, Sun HC, Ye QH, Wang
L, Zhou J, Qiu SJ, Li Y, Ji XN, Liu H, Xia JL, Wu ZQ,
Fan J, Ma ZC, Zhou XD, Lin ZY, Liu KD. Un deceniu, s
studii privind metastazarea carcinomului hepatocelular. J Can-
cer Res Cli Oncol 2004; 130: 187-196
9
Lopez PM , Villanueva A, Llovet JM. Analiza sistematică:
dovezi bazate pe managementul carcino-
ma-o analiză actualizată a studiilor randomizate controlate. Al-
iment Pharmacol Ther 2006; 23: 1535-1547
10
Ling CQ . Probleme în tratamentul cancerului și re-
căutarea unui medicament integrat. J Chin Integr Med 2003;
1: 168-170
11
Chen Z , Li B, Yue XQ, Zhu DZ, Yu CQ, Wu MC, Ling
CQ. O analiză de control retrospectivă a rezultatelor utilizării
terapie integrată a medicamentelor tradiționale chinezești și
icine pentru cancerul hepatic primar de etape medii și tardive. J
Altern Complement Med 2006; 12: 941-942
12
Xiao KY . Advance în caracteristicile epidemiologice ale
cancerul de ficat primar. Chin J Bases Clinic General Surg
2000; 7: 272-274
13
Tang ZY . Cercetarea clinică a carcinomului hepatocelular.
Revista chineză de Hepatologie 2006; 14: 481-482
14
Ministerul chinez al Sănătății din China. Revizuirea etică
de cercetare biomedicală care implică subiecți umani; 2007: 17
15
Tang ZY . Perspectiva studiului carcinozei hepatocelulare mici
Noma. J Clin Res 2003; 20: 643-644
16
Zhou XD , Tang ZY, Yang BH, Lin ZY, Ma ZC, Ye SL,
Wu ZQ, Fan J, Qin LX, Zhang BH. Experiență de 1000
pacienții care au suferit hepatectomie hepatocelulară mică,
lary carcinoma.Cancer 2001; 91: 1479-1486
17
Ye SL , Qin SK, Wu MC. Expertul consens privind standardizarea
JTCM | www. journaltcm. com
15 iunie 2012 | volumul 32 | Numărul 2
Sun Z și colab. Un preparat medicamentos pe bază de plante versus terapie intervențională după rezecția de HCC mic
gestionarea cancerului hepatic primar. tumoare
2009; 29: 299-300
18
Wu CC , Ho YZ, Ho WL, TC Wu, Liu TJ, Peng FK. Pre
operația de chemoembolizare arterială transcatheter operativă pentru re-
carcinom hepatocelular mare secundar: o reevaluare. Br J
Surg 1995; 82: 122-126
19
Llovet JM , Bruix J. Noile progrese în managementul
a carcinomului hepatocelular în 2008. J Hepatol
2008; 48: S20-37
20
Wang L , Zhou GB, Liu P, Song JH, Liang Y, Yan XJ, Xu
F, Wang BS, Mao JH, Shen ZX, Chen SJ, Chen Z. Dissec-
de mecanisme de formula farmaceutică chineză Real-
Gar-Indigo naturalis ca un tratament eficient pentru promyelo-
leucemie cirotică. Proc Natl Acad Sci USA 2008; 105:
4826-4831
21
Efferth T , Li PC, Konkimalla VS, Kaina B. Din tradițional-
medicina chineză pentru tratamentul cancerului rațional. tendinţe
Mol Med 2007; 13: 353-61
22
Hui KK , Hui EK, Johnston MF.Potențialul unui per-
abordarea axată pe abordarea corectitudinii în îngrijirea pacienților cu cancer: a
perspectivă din partea centrului UCLA pentru mediul
cine. Integr Cancer Ther 2006; 5: 56-62
23
Xiao KY , Li LQ, Peng MH, Yang DH, Liang ST, Qin X,
Chen XG, Guo Y, Qin Z, Peng T, Chen B, Su ZX, Shang
LM. Antecedente familiale și caracteristicile clinice ale
101 pacienți cu carcinom hepatocelular cu
gregare (FH). Jurnalul de la Universitatea Medicală Guangxi
2005; 22: 224-226
24
Soare Z , Su YH, Yue XQ. Experiența profesorului Ling Changquan
în tratarea cancerului hepatic primar: o analiză a
medicamente. J Chin Integr Med 2008; 6: 1221-1225
25
Ling CQ . Toxina canceroasă este factorul patogen major
tumoare maligna. J Chin Integr Med / Zhong Xi Yi Jie El
Xue Bao 2008; 6: 111-114
26
Yu Y , Lang QB, Chen Z, Li B, Yu CQ, Zhu DZ, Huang
XQ, Zhai XF, Ling CQ. Eficacitatea pentru He-
carcinomul patocelular poate fi îmbunătățit prin transcatheter
chemoembolizarea arterială în combinație cu o tradiție
formula chineză pe bază de plante medicinale. Cancer 2009;
115: 5132-5138
27
Tang ZY . Perspectiva oncologiei clinice din perspectiva-
punct al studiilor privind cancerul la ficat. Tumor 2009; 29: 1-3
28
Guo QQ , Liang ST, Liang XJ, Yu H. Procesul experimental re-
pentru a preveni formarea fibrozei hepatice. Jurnalul lui
Guangxi Medical University 2007; 24: 261-263
29
Liang ST , Qin X, Li LQ, Lu YF, Qin Z, Ling JL, Wu S,
Liang XJ, Zhou HS. Efectul preferențial al lui RuanJian-
HuGanPian și GanCaoTianSuPian privind reoperarea postoperatorie,
currence în carcinomul hepatocelular. Chin J Clin Hepatol
2004; 20: 293-294
30
Fan J , Zhou J, Wu ZQ, Tang ZY, Zhou XD, Ma ZC, Qin
LX, Wang Z. Tratamentul chirurgical al hepatocelular primar
carcinom: experiență clinică de 20 de ani la 7566 pacienți.
Chin J Dig Surg 2009; 4: 99

Lipsirea/privarea de arginină ca terapie tintita pentru cancer

Abstract

Anumite tipuri de cancer pot fi auxotrofice pentru un anumit aminoacid și privarea de acesti aminoacizi specifici este o metodă pentru tratarea acestor tumori. Lipsa de arginină este o abordare nouă în privința tumorilor țintă cărora le lipsește expresia sintetazei argininosuccinatului (ASS). ASS este o enzimă cheie care transformă citrulina în arginină. Tumorile care, de obicei, nu exprimă ASS includ melanomul, carcinomul hepatocelular, unele mezoteliomuri și unele tipuri de cancer renal. Arginina poate fi degradată de mai multe enzime, inclusiv arginin deiminaza (ADI). Deși ADI este o enzimă microbiană din micoplasmă, are afinitate ridicată la arginină și catalizează arginina la citrulină și amoniac. Citrulina poate fi reciclată înapoi la arginină în celulele normale care exprimă ASS, în timp ce celulele tumorale ASS (-) nu pot. A fost formulată o formă pegilată de ADI (ADI-PEG20) și a demonstrat activitate in vitro și in vivo împotriva melanomului și carcinomului hepatocelular. ADI-PEG20 induce apoptoza în liniile celulare de melanom.Cu toate acestea, deprivarea argininei poate induce expresia ASS în anumite linii celulare de melanom care pot conduce la rezistență in vitro la medicament. Studii clinice umane de fază I și II cu ADI-PEG20 au fost efectuate la pacienți cu melanom și carcinom hepatocelular și s-a demonstrat activitate antitumorală în ambele tipuri de cancer. Acest articol analizează experiența noastră în laborator și clinică, precum și altele cu ADI-PEG20 ca agent antineoplazic. Orientarea viitoare în utilizarea acestui agent este de asemenea discutată.

INTRODUCERE

Un tip de terapie vizată pentru cancerele umane implică epuizarea aminoacizilor cheie necesari tumorilor pentru a supraviețui. Cel mai bun exemplu este asparaginaza care este folosită pentru a trata leucemia limfoblastică acută (ALL), un tip comun de leucemie la copii și adulți tineri [ 1 , 2 ]. Această enzimă anticanceră scade sau scade nivelul sanguin de asparagină. În timp ce asparagina este un aminoacid neesențial la oameni, TOATE celulele o cer să supraviețuiască și să se prolifereze. Astfel, epuizarea acestui aminoacid prin terapia cu asparaginază este, în general, bine tolerată, deoarece celulele umane normale nu necesită asparagină. Astfel, eliminarea unui anumit aminoacid care nu este esențial la oameni, dar pentru care un anumit cancer este auxotrofic poate fi o metodă selectivă de țintire a malignităților.

Arginina este un alt aminoacid neesențial la adulți, dar este esențial pentru celulele cu proliferare rapidă.Astfel, privarea de arginină poate fi exploatată ca o potențială terapie vizată pentru tratamentul diferitelor forme de cancer. În această lucrare revedem rațiunea pentru această formă de terapie și propriile noastre, precum și alte date de laborator și clinice.

De ce privarea de arginina duce la moartea celulelor în anumite linii celulare tumorale?

Arginina este implicată în căi multiple care sunt implicate în funcțiile celulare majore, cum ar fi producția de oxid nitric, producția de creatină și sinteza poliaminei [ 3 , 4 ]. La om, arginina este derivată în principal din dietă, fluctuația proteinelor corporale și sinteza de-novo prin intermediul axei renale intestinale [ 4 ].Deși arginina poate fi sintetizată, este considerată un aminoacid semi-esențial la adulți, deoarece producția endogenă este insuficientă atunci când celulele sunt supuse stresului sau necesită proliferare [ 5 , 6 ]. În celulele tumorale, arginina influențează creșterea lor / proliferarea [ 5 , 7 – 9 ] și s-a demonstrat că restricția de dietă inhibă creșterea tumorilor metastatice [ 8 ].

 sinteza De-novo de arginină apare în primul rând în tubul renal proximal prin intermediul ciclului de uree.Cu toate acestea, această capacitate se regăsește și în multe alte celule [ 6 ]. Arginina este sintetizată din citrulină în două etape prin ciclul de uree. Enzima argininosuccinat sintetază catalizează conversia L-citrulinei și a acidului aspartic la argininosuccinat, care este apoi transformat în continuare în L-arginină și acid fumărie de argininosuccinat-lază, L-arginina poate fi degradată la L-ornitină prin enzima arginază din ciclul ureei. L-ornitina este apoi transformată înapoi în L-citrulină prin transcarbamil transferat de ornitină (OCT) și apoi reciclată înapoi la arginină prin ASS / ASL (vezi figura 1 ). Astfel, capacitatea de a regenera arginina din citrulină depinde de cantitatea / activitatea ASS și ASL10 , 11 ]. De fapt, Wheatley a sugerat că aceste două enzime sunt cuplate strâns [ 12-14 ] și că sensibilitatea celulelor la privarea argininei depinde de capacitatea lor de regenerare a argininei din intermediarul alternativ (ornitină, citrulină și argininosuccinat) în ciclul ureei [ 9 , 12-14 ].

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f1.jpg

Enzime implicate în ciclul de uree. Linia punctată pe ADI desemnează acțiunea sa asupra conversiei extracelulare a argininei la citrulină și amoniac.

 

Mai multe laboratoare au raportat că anumite linii de celule tumorale, cum ar fi melanomul, carcinomul hepatocelular, carcinomul celulelor renale și unele mesothelioame, nu exprimă ASS și, prin urmare, devin auxotrofice pentru arginină [ 9 , 11 , 15-18 ]. În consecință, enzima de degradare a argininei a fost demonstrată de mai multe laboratoare pentru a avea efect antitumoral în aceste tumori [ 9 , 13 , 19-25 ].Pentru a dovedi în continuare că lipsa expresiei ASS în liniile celulare de melanom este o cheie pentru a le face susceptibile la moartea celulară după deprivarea argininei, noi și alții am transfectat celulele melanomului cu ASS. Acești transfectanți sunt rezistenți la deprivarea argininei [ 15 , 18 ].

Arginina poate fi catabolizată de trei enzime: arginază, arginină decarboxilază și deminazidă de arginină (ADI). Arginaza a fost testată pe animale experimentale încă din 1950, cu toate acestea, terapia nu a reușit să producă răspunsuri majore. Motivul eșecului ar putea fi datorat faptului că această enzimă are o afinitate scăzută pentru arginină și astfel va fi necesară o cantitate mare de enzimă. PH-ul optim pentru arginază este, de asemenea, ridicat (9,5) [ 26 ] și nu poate fi atins. Cu toate acestea, recent, Wheatly și colab. au arătat că arginaza este eficientă de la pH 7,2-927 ]. Foarte important, arginaza catabolizează arginina cu ornitina. Nu se știe dacă alte țesuturi normale, cu excepția ficatului și intestinului subțire, pot sintetiza ornitina la citrulină datorită faptului că OCT, o enzimă cheie necesară pentru această reacție, este exprimată în principal în ficat. În alte țesuturi, gena OCT este hipermetilată și, prin urmare, nu este exprimată. Astfel, se poate întâlni toxicitate normală a țesutului. Aceste neajunsuri pot explica de ce dezvoltarea arginazei ca agent antitumoral a eșuat în ciuda activității sale observate in vitro [ 28 , 29 ]. Cu toate acestea, s-a arătat că arginaza pegilată recent are activitate în carcinomul hepatocelular atât in vitro, cât și in vivo datorită lipsei expresiei OCT în anumite linii celulare de carcinom hepatocelular30 ]. Pe de altă parte, arginina deiminaza, o enzimă microbiană din micoplasma care catabolizează arginina cu citrulină și amoniac, este mai atractivă datorită faptului că celulele tumorale care nu au ASS nu vor putea să sintetizeze arginina intracelulară din citrulină, în timp ce celulele normale sunt capabile să regenereze arginina. Această abordare va evita toxicitatea țesutului normal. Mai mult, această enzimă este activă în pH fiziologic și are o afinitate ridicată pentru arginină. De fapt, s-a raportat că ADI are activitate antitumorală atât in vitro, cât și in vivo în liniile celulare de melanom și hepatocellular carcinom și în alte linii celulare15-18 , 31-34 ].Cu toate acestea, unul dintre dezavantajele ADI este că nu este produs de oameni și, prin urmare, este foarte antigenic. În plus, ADI are și un timp de înjumătățire scurt. Pentru a depăși aceste dezavantaje, o formă pegilată a ADI (ADI-PEG20) a fost dezvoltată de Polaris, Inc (fostă Phoenix Pharmacologics) [ 35 ] și după testele in vitro și studiile in vivo [ 15 , 34 ] a intrat în studiu clinic atât pentru carcinom hepatocelular, cât și pentru melanom.

Activitatea antitumorală a ADI-PEG20 în celulele de melanom

Noi și alții am demonstrat că arginina degradantă în mediile de cultură folosind ADI sau expunerea liniilor celulare melanom la mediul liber de arginină cu citrulină și suplimentul cu NH4CI poate inhiba creșterea și poate avea efecte citotoxice în liniile celulare de melanom [ 15 , 18 ]. IC50 după 7 zile de expunere a fost cuprins între 0,01-0,3 μg / ml dintre cele 16 linii celulare melanom testate [ 15 ]. În laboratorul nostru, am studiat efectul de inhibare a creșterii ADI-PEG20 în 4 linii celulare de melanom (A-375, SK-Mel2, A-2058 și Mel-1220 toate fibroblastele umane normale (BJ-1 ) și o linie NSCLC ASS (+) Efectul inhibitor al creșterii a variat de la 0,05-0,09 μg / ml după expunerea timp de 3 zile la liniile celulare de melanom 4 testate (vezi tabelul 1 ) și mai mare de 1 în liniile celulare BJ-1 și NSCLCS [ 18 ] .. Interesant, la 72 de ore a rămas în mediu arginina (12,8 pM pentru Sk-Mel-2 și 23,5 pM pentru A2058 și nici arginină detectabilă pentru A375 și MEL-1220). cu 0,05 pg / ml de ADI-PEG20, nu există valori detectabile ale argininei la 48 h. Astfel, se pare că capacitatea mașinilor intracelulare de a menține nivelele de arginină fie prin degradarea altor proteine ​​neesențiale, fie prin scăderea proliferării sau prin activarea ASS prin translație sau transcripție este diferită în rândul liniilor celulare melanom. Aceste diferențe pot explica de ce o partelanoma de celule lanoma pot deveni rezistente la această formă de tratament.

tabelul 1

Efectul de inhibare a creșterii ADI-PEG20

Linii telefonice ID 50 (ug / ml) Arginina (uM) la 72 ore Citrulină (uM) la 72 ore
A2058 0,088 ± 0,008 23.5 367.5
A375 0,05 ± 0,001 ND 317.5
Sk-Mel-2 0,070 ± 0,008 12.8 329.2
Mel-1220 0,090 ± 0,008 0 3
BJ-1 > 1 1.6 404
NSCLCS * > 1 20.27 603
* Medii RPMI (linie de bază Arginină: 971 uM).

Mediul EMEM (linia de bază arginină: 400 uM).

Activitatea antitumorală a ADI-PEG20 în carcinomul hepatocelular

S-a demonstrat că ADI-PEG20 are activitate antitumorală în unele linii celulare de carcinom hepatocelular care nu au expresia ASS [ 15 ]. Cu toate acestea, recent, Cheng et al. au studiat 5 linii celulare HCC (HepG2, Hep3B, PLC / PRF / 5, Huh7 și Sk-HEP-1) și au raportat că aceste linii celulare exprimă ASS și nu sunt sensibile la ADI [ 30 ]. Pe de altă parte, aceste linii de celule nu au expresia OCT și sunt sensibile la arginază [ 30 ]. Activitatea antitumorală a fost de asemenea observată in vivo utilizând PEG-arginază, dar profilul de toxicitate nu a fost discutat. Este interesant de ce celulele carcinomului hepatocelular nu au o expresie OCT sau ASS deoarece hepatocitele normale posedă aceste enzime. Astfel, nu este încă cunoscut cum celulele frecvente de carcinom hepatocelular nu exprimă ASS sau OCT sau ambele. Cu toate acestea, Dillion et al . au raportat că toate cele 51 de probe de tumori hepatoame sunt deficitare în ASS prin colorare imunohistochimică [ 36 ]

Activitatea antitumorală a ADI-PEG20 în alte linii celulare

Anumite linii celulare mezoteliom (2591 și MSTO) nu exprimă ASS și sunt sensibile la ADI-PEG20, în timp ce alte două linii celulare (226,2461) exprimă niveluri ridicate [ 17 ]. Studiul imunohistochimic a arătat că 63% din mezoteliom exprimă niveluri scăzute de ASS [ 17 ]. Pe baza acestui studiu, au fost inițiate studii clinice cu mezoteliom [Szlosarck, comunicare personală]. ADI-PEG20 este, de asemenea, activ în anumite linii celulare de celule renale care nu exprimă ASS [ 16 ]. Interesant, unele cancere celulare renale sunt, de asemenea, negative pentru ASS prin colorare imunohistochimică, în ciuda nivelurilor ridicate ale acestor enzime găsite în rinichi. Alte linii celulare care sunt sensibile la ADI-PEG20 includ linii celulare neuroblastomice [ 37 ] și liniile celulare limfoblastice T și B umane [ 31 – 33 ], dar nu o linie celulară leucemică mieloidă (HL-60). În acest raport, ADI-PEG20 are o activitate antitumorală mai bună decât L-asparaginaza [ 31 ]. Liniile celulare tumorale care exprimă niveluri scăzute de ASS pot fi, de asemenea, sensibile la deprivarea argininei [ 11 ]. În schimb, Kang și colab. 38 ] au demonstrat că epuizarea argininei cu ADI izolat din celulele sertoli nu a induce apoptoza în liniile celulare de cancer de prostată DU145, totuși, le-a protejat de apoptoza indusă de paclitaxel. Acest lucru nu este surprinzător, deoarece DU145 posedă ASS, iar scăderea argininei va duce la o întârziere a creșterii celulare care le face rezistente la chimioterapie.

ADI-PEG20 induce apoptoza în liniile celulare de melanom

Sa demonstrat că ADI-PEG20 inhibă sinteza proteinelor utilizând încorporarea de 35S , dar modul în care inhibarea sintezei proteinelor conduce la moartea celulară nu este clară. Gong și colab . au raportat moartea celulelor apoptotice în liniile celulare limfoblastice umane [ 31 , 32 ]. De asemenea, am văzut moartea celulelor apoptotice în celulele melanomului [ 18 ] ( figurile 2 și 3). 3 ). Interesant este că, deși apoptoza este observată în celulele melanomului tratate cu ADI-PEG20 la doza ID50 timp de trei zile, aceste celule pot supraviețui prin reaprovizionarea mediilor noi cu arginină și îndepărtarea ADI-PEG20, dar dacă continuă să se adauge ADI-PEG20 în noul mediu , nu există celule viabile în cele trei linii de celule (A-375, Sk-mel2 și Mel1220) în 3 săptămâni. Se speculează că toate aceste celule suferă autofagie fără arginină înainte de a suferi apoptoză. De fapt, datele noastre preliminare au arătat o creștere a Beclin1 în aceste linii celulare, cu Mel1220 având nivelele cele mai ridicate de Beclin1. În mezoteliom, Szlosarek a arătat că epuizarea argininei induce modificări ale conformației BAX și depolarizarea membranei mitocondriale interne în celulele ASS (-) care conduc la apoptoză [ 17 , 39 ]. Astfel, mecanismul (mecanismele) care conduc la apoptoză este complex și poate fi diferit printre toate liniile celulare care nu au expresia ASS.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f2.jpg

In situ testul de apoptoză de etichetare la linia celulară A375. R: control. B: după expunerea la 0,08 ug / ml timp de 72 ore. Celulele tratate suferă apopotoză care prezintă petele de maro în nuclee

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f3.jpg

Apoptoza detectată prin clivarea PARP în liniile celulare de melanom 4 (A375, Sk-mel-2, A2058 și MEL-1220). Celula netratată a prezentat PARP nevăzută la 116 kD, în timp ce celulele tratate au prezentat PARP scindat observat la 89 kD.

ADI-PEG20 inhibă producerea NO

Deoarece arginina este singurul substrat pentru sintetaza de oxid nitric [ 3 ], nu este surprinzător faptul că ADI-PEG20 inhibă producția de NO în lipopolizaharide și macrofage provocate de interferon [ 40 ].Această observație a fost de asemenea observată in vivo atunci când șoarecii au fost tratați cu TNF și endotoxină. 40 ]. Totuși, ADI-PEG20 nu a inhibat NO care produce eNOS [ 40 ]. Astfel, se pare că ADI-PEG20 poate fi utilizat ca modulator selectiv pentru NO care este produs de iNOS. Implicarea acestor rezultate asupra supraviețuirii celulelor tumorale / carcinogenezei nu a fost studiată. Pe de altă parte, NO poate inactiva în mod reversibil ASS prin S-nitrozulări atât in vitro, cât și in vivo [ 41 ]. Astfel, relația complexă a acestor parametri va necesita investigații suplimentare.

ADI-PEG20 inhibă angiogeneza

Efectul ADI asupra angiogenezei a fost investigat atât in vitro, cât și in vivo . Beloussow și colab. prima [ 42 ] a demonstrat efectul antiangiogen al ADI recombinant cu celulele endoteliale ale venei umane ombilicale cultivate (HUVEC). Park și colab. au folosit de asemenea HUVEC și ADI recombinant pentru a arăta că ADI ar putea inhiba angiogeneza într-o manieră dependentă de doză și acest efect inhibitor poate fi inversat prin alimentarea argininei înapoi în mediul de cultură [ 43 ]. Park și colab. a observat că ADI recombinant a exercitat inhibiția angiogenezei în studiile in vivo utilizând modelul de embrion pui și model de șoarece [ 43 ]. Această proprietate antiangiogenetică a ADI a sugerat o modalitate eficientă de tratare a tumorilor. Ei au arătat că ADI a fost capabil să inhibe creșterea celulelor tumorale utilizând liniile celulare CHO și HeLa. Mai mult, Gong și colab. 37 ] au arătat, de asemenea, că ADI a fost eficace în inhibarea creșterii neuroblastomului nefavorabil similar cu alți reactivi de blocare a angiogenezei. Interesant, ADI sau acești reactivi au fost capabili să potențeze efectul radioterapiei pentru această tumoare utilizând un model de șoarece.

ADI-PEG20 scade ticlul viral al hepatitei C

Izzo și colab . au raportat că ADI-PEG20 poate reduce titrul HCV până la 99% la pacienții cu HCV sero-5b de 5/10 cu o îmbunătățire ulterioară a funcției hepatice. Cu toate acestea, nu are efect asupra pacienților cu VHC de tip 2c [ 44 ]. Mecanismul exact al acestui lucru nu este cunoscut și poate fi legat de scăderea producției de NO.

ADI-PEG20 afectează semnalizarea mTOR

Se știe că deprivarea de nutrienți scade semnalul mTOR [ 45 – 47 ]. Acest lucru se datorează cel mai probabil scăderii ATP care conduce la activarea AMPK și, prin urmare, influențează negativ activitatea mTOR [ 48 ]. Este nesigur că este implicat complexul TSC1 / 2 [ 49 ]. Degradarea nutrițională influențează pozitiv asocierea mTOR cu raptorul, asocierea strânsă dintre mTOR și Raptor va diminua activitatea mTOR [ 50 ]. Am demonstrat că, după expunerea a 4 linii de celule melanom la ADI-PEG20 timp de 72 ore, fosforilarea 4E-BP este redusă substanțial în 3 linii celulare de melanom și într-o măsură mult mai mică în linia celulară A-2058 ( Fig.4A ). Mai mult, cantitatea de fosforilare a p-70S6 kinazei este de asemenea redusă la 72 ore ( Figura 4B ). În contrast, pAMPK care influențează negativ activitatea mTOR este foarte crescut la A-375 și Mel1220 la 72 de ore, dar este moderat crescut în A-2058 ( Figura 4C ). Nu există nici o schimbare în Sk-Mel 2; această linie celulară poate avea o modificare în LKB. Modificările în fosforilarea 4E-BP și fosforilarea kinazei P-70S6 nu sunt observate în linia celulară NSCLC și liniile celulare BJ-1 care posedă ASS. Astfel, deprivarea argininei în celulele melanomului ASS (-) are un impact negativ asupra semnalizării mTOR. Sa demonstrat că inhibarea mTOR a scăzut proliferarea celulară și contribuie la autofagie [ 51 ] care poate explica activitatea antitumorală a ADI-PEG20 în celulele melanomului

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f4.jpg

A). Activitatea mTOR a fost măsurată prin capacitatea sa de a 4E-BP fosforilat. Banda inferioară este forma nefosforilată. 4E-BP. 4E-BP are o fosfilare multiplă care descrie mai multe benzi observate. După tratamentul cu ADI-PEG la 0,6 ug / ml (81 UI / ml = 11,3 mg / ml) timp de 72 ore, forma majoră de 4E-BP este nefosforilată. B). fosforilarea p-70S6 kinazei reflectă de asemenea activitatea mTOR. După expunerea la ADI-PEG20 la 0,6 mg / ml, kinaza fosfo-p-70S6 a descrescut în A-375, Sk-Mel2, dar a crescut în A-2058, ceea ce indică fosforilarea altor proteine ​​din amonte. Mel-1220 are o fosforilare minimă a kinazei p-70S6 și, prin urmare, modificările nu sunt discernebile. C). fosfo-AMPK în liniile celulare de melanom 4 după expunerea la ADI-PEG20 pentru 72 ht. Trei linii celulare au crescut fosfo-AMPK, dar nici o schimbare în Sk-Mel 2.

Alte efecte biologice ale ADI

Deoarece arginina servește drept precursor pentru poliamină (ornitină, putrescină), deprivarea argininei poate produce biosinteza poliaminei. În acest sens, Shen și colab . au arătat că adăugarea de putrezină la ADI nu a afectat activitatea antitumorală a ADI, totuși a anulat efectul antitumoral al DFMO, un inhibitor de decarboxilază a ornitinei [ 10 ]. Mai mult, în celulele CHO care nu au expresia ASS, tratamentul cu ADI nu a afectat concentrația de poliamină intracelulară. Autorii au concluzionat că scăderea Km de ODC, precum și compensarea prin degradarea, efluxul și absorbția proteinelor ar putea fi responsabile de aprovizionarea cu arginină, iar concentrația argininei nu este critică pentru menținerea concentrației de poliamină intracelulară. Alte efecte ale deprivării argininei, inclusiv alte modificări ale proteinei, cum ar fi proteina de șoc termic și proteinele care sporesc susceptibilitatea celulară la apoptoză [ 52 ]. Recent, Graboa și colab . 53 ] a arătat că arginina poate juca un rol crucial în carcinogeneză.

De ce ASS nu este exprimat în anumite tipuri de tumori?

Gena ASS este localizată pe perechea de bază cromozom 9q34.1 132, 310,092 la 132,366,481. Există multe pseudogene (14 raportate) situate printre alte cromozomi [ 54 ]. Este posibil ca deleția cromozomului la această regiune în celulele tumorale să poată explica lipsa expresiei ASS. Totuși, în 4 linii celulare de melanom testate prin analiza Southern blot, a fost prezentă ADN ASS ( Figura 5 ). Cu toate acestea, este încă posibil ca promotorul să poată fi modificat și nu poate fi detectat prin analiza southernblot. Datele noastre [ 18 ] și alte lucrări publicate [ 15 , 17 ] indică faptul că lipsa proteinei ASS corespunde unor niveluri scăzute de exprimare a ARNm (care nu au fost detectate prin analiza northernblot). Recent, Szlosarek et al . au descoperit că liniile celulare mezoteliom care exprimă nivele scăzute de ASS au metilare promotor aberant CpG [ 17 ]. Autorii au concluzionat că reglarea epigenetică a transcripției ASS joacă un rol în controlul exprimării ASS observată în liniile celulare mezoteliom. Studiul nostru inițial de laborator nu a susținut acest concept în liniile celulare de melanom, iar 5-azacytidina, un agent de demethylație cunoscut, nu afectează expresia ASS în liniile celulare de melanom (Savaraj, date nepublicate). Astfel, întrebarea cheie care rămâne fără răspuns este motivul pentru care diferitele linii de celule tumorale posedă niveluri diferite de expresie ASS. ASS cADN a fost clonat în 1981 [ 55 ] și este foarte conservat între specii. Regiunea promotor la om și la șoareci a fost caracterizată parțial. La om, secvența de flancare 5 ‘prezintă multiple situsuri de legare SP-1, AP2, GCN4, NF-KappaB, Max1, Egr și altele [ 56 , 57 ]. Aceste site-uri de legare sunt, de asemenea, previzionate folosind instrumentul de căutare web AliBaba 2.1. În prezent, am clonat promotorul și am construit o serie de mutanți eliminați pentru a studia această întrebare. Deși proprietățile cinetice ale enzimei ASS au fost studiate pe larg și structura cristalină din bacterii a fost identificată [ 4 ], controlul transcripțional și translațional al genei ASS nu este bine înțeles. Au fost raportate două specii de ARNm mRNA care diferă în 5’UTR (baza de date Genbank).Studiile anterioare publicate indică faptul că reglementarea ASS are loc la niveluri pre-translaționale [ 4 ].S-a arătat că mulți factori influențează pozitiv și negativ gena ASS și pot fi specifici țesutului. Mai mulți anchetatori au demonstrat că glucocorticoidul, glucagonul și ciclina AMP măresc expresia ASS, în timp ce acizii grași reprimau expresia ASS [ 58-65 ]. Insulina și hormonul de creștere au o influență negativă asupra ASS în țesutul hepatic, dar nu au efect asupra altor țesuturi [ 66 – 68 ]. Citokinele, IL-Ib, interferonul și TGF-b pot, de asemenea, influența expresia ASS [ 69 , 70 ]. Recent, s-a arătat că glutamina stimulează exprimarea ASS în hepatocite de șobolan și celule Caco-2 prin O-glicozilarea lui Sp1. site-uri [ 71 ]. Expresia ASS a fost, de asemenea, arătată a fi reglementată de arginină [ 72 ]. În această privință, am demonstrat că în liniile de celule melanom expresia ASS este influențată de arginină în medii [ 18 ], dar nu este influențată nici de glucocorticoidul glutamină, nici de acizii grași (date nepublicate). Cu toate acestea, reglarea genei ASS este cel mai probabil diferită în diferite tipuri de tumori. În prezent, investigăm reglementarea ASS în celulele de melanom. Este de remarcat faptul că melanocitele umane normale (linia celulară HEM-1 și HEM-m obținute de la Sciencell) exprimă niveluri foarte scăzute de proteină ASS care este diferită de hepatocitele normale.

Un fișier extern care deține o imagine, o ilustrație etc. Numele obiectului este nihms287629f5.jpg

Analiza Southernblot a ASS în liniile celulare de melanom 4 și în liniile celulare BJ-1. Toate cele cinci linii celulare prezintă niveluri similare de ADN ASS.

Exprimarea proteinei de melanom indusă de arginină

S-a demonstrat că nivelele de arginină pot regla expresia ASS în celulele limfoblastomului și celulele epiteliale. În mod similar, am descoperit că expunerea liniilor celulare de melanom la ADI-PEG20 sau medii libere de arginină cu supliment de citrulină și NH4CI2 timp de 3 zile, proteina ASS detectată prin Western blot a fost găsită în trei linii celulare. Cu toate acestea, nivelurile expresiei ASS sunt diferite: A2058 are mai multă expresie ASS (2,76 ori) urmată de Sk-Mel-2 (2,03) și A375 (1,52) în timp ce MEL-1220 nu este capabilă să producă proteină ASS. Cu toate acestea, după reaprovizionarea cu medii normale, expresia proteinei ASS este din nou reprimată [ 18 ]. Figura (6) a rezumat aceste constatări. Interesant, în liniile celulare (BJ-1 și NSCLCS) care exprima în mod constitutiv ASS, nivelurile de ASS nu s-au schimbat la expunerea la mediile fără arginină. Am studiat în continuare dacă creșterea proteinei ASS apare la nivelul de transcripție. Cu toate acestea, nu am putut detecta ARNm ASS prin analiza Northern blot ( figura 7 ). Am dezvoltat o metodă RT-PCR în timp real pentru a cuantifica exprimarea ARNm ARN, numai A-2058 a arătat o creștere a expresiei mRNA la 48 și 72 ore ( figura 8 ). Celelalte trei linii celulare, incluzând BJ-1 (fibroblaste umane normale), nu au prezentat o creștere a ARNm ASS la deprivarea argininei. AARN-ul ASS a revenit, de asemenea, la normal după plasarea celulelor înapoi în medii normale. Cu toate acestea, după expunerea continuă la mediile fără arginină, A-2058 este capabil să activeze o cantitate substanțială de ARNm care ar putea fi detectată prin analiza northernblot ( Figura 7 ).

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f6.jpg

Imunoblot de proteină ASS în liniile celulare de melanom 4 (A375, Sk-mel-2, A2058 și MEL-1220) înainte și după expunerea mediului liber de arginină suplimentat cu citrulină și NH4CI timp de 24, 48 și 72 ore. După aceea, celulele au fost spălate și reumplete cu medii normale EMEM timp de 24, 48 și 72 ore. Banda 1: control.Lane 2: 24 de ore. pe suport liber de arginină Lane 3: 48 ore pe mediu liber de arginină Liniul 4: 72 ore pe mediu liber de arginină Litiu 5: Eliminarea mediului liber de arginină și schimbat în mediu EMEM normal timp de 24 de ore. Latima 6: 48 de ore. pe suporturi normale. Latima 7: 72 ore. pe suporturi normale. Rezultate similare s-au obținut cu medii fără arginină fără supliment de citrulină și medii tratate cu ADI-PEG20. cu citrulină și supliment de NH4CI.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f7.jpg

Analiza Northernblot a ASS într-un panou de linie de celule melanom și celule BJ-1. Linia 1: A375. Banda 2: A375 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 3: SK-Mel-2 Banda 4: Sk-Mel-2 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 5: MEL-1220. Banda 6: MEL-1220 după expunerea la ADI-PEG20 timp de 72 de ore. Linia 7: A2058. Banda 8: A2058 după expunerea la ADI-PEG20 timp de 72 de ore. Banda 9: A2058R. Banda 10: BJ-1. Banda 11: BJ-1 după expunerea la ADI-PEG20 timp de 72 de ore.Notă: numai A2058R și BJ-1 posedă ARN mRNA de 1,9 kb și nu există diferențe în mRNA ASS în celulele BJ-1 după expunerea la ADI-PEG20.

Un fișier extern care conține o imagine, o ilustrație etc. Numele obiectului este nihms287629f8.jpg

Nivelul de expresie relativ al mRNA ASS detectat cu PCR în timp real în diferite linii celulare în medii (-Arg) fără arginină, comparativ cu cel din mediul normal (+ Arg). Metoda de cuantificare utilizată a fost propusă de Pfaffl în Nucleic Acid Research, 29: 2002-2007. GAPDH a fost utilizat ca gene de referință. Orele de pe grafic indică timpul pentru care celulele au fost cultivate în medii -Arg sau + Arg.

Rezistența la ADI-PEG20 în melanom

Datele din linia de celule melanomului, precum și culturile primare obținute de la pacienți, se pare că liniile celulare sau culturile primare care se pot transforma în ARNm ASS după deprivarea argininei au cel mai probabil să dezvolte rezistență la ADI. Suntem capabili să generăm linia celulară rezistentă la ADI-PEG20 în A-2058, dar nu în A-375, Skmel-2 sau Mel 1220. Aceste trei linii celulare nu pot transforma ARNm ASS după privarea de arginină. Creșterea tranzitorie a proteinei ASS observată la A-375 și Sk-mel2 este mediată în principal prin creșterea tranzitorie a traducerii. După ce ARNm mRNA este indus până la o anumită măsură, expresia ASS devine stabilă și nu poate fi inversată ( figura 9 ). De ce anumite linii celulare pot activa rapid AARN mRNA nu este cunoscut și în prezent investigăm controlul transcripției ARNm al ASS.

Un fișier extern care conține o imagine, o ilustrație etc. Numele de obiect este nihms287629f9.jpg

Imunoblot de proteină ASS în A-2058R (rezistență la ADI) după cultură în mediu normal timp de 7 și 29 de zile. Expresia este stabilă fără modificări.

DIRECȚII DE LABORATOR VIITOARE

Lucrările din laboratorul nostru, precum și altele, sprijină activitatea antitumorală a ADI-PEG20 în tipurile de tumori ASS (-). Până în prezent, melanomul și hepatomul par a fi tumorile potrivite pentru această abordare datorită lipsei expresiei ASS. Anumite mezoteliom și cancerele celulare renale pot fi, de asemenea, luate în considerare pentru această abordare. Cu toate acestea, dezvoltarea rezistenței la medicament secundară exprimării ASS poate fi problematică, dar ar putea fi depășită. În prezent, dezvoltăm o metodă de identificare a acelor tumori care sunt negative ASS, dar pot fi induse după un tratament repetat. Aceste tumori vor necesita, cel mai probabil, un tratament combinat care va ucide celulele rapid și, prin urmare, celulele tumorale nu sunt capabile să activeze ASS. O altă posibilitate este de a inhiba expresia ASS utilizând o abordare farmacologică. În prezent investigăm aceste abordări diferite în melanom.

STUDII CLINICE CU ADI-PEG20

Am raportat un studiu de fază I / II cu ADI-PEG20 la pacienții cu melanom metastatic [ 73 ]. Au fost realizate două studii de escaladare a dozei de cohortă: un studiu de fază I în SUA și un studiu de fază I / II din Italia. Studiul de fază I din SUA a inclus 15 pacienți din 4 cohorte. Tratamentul ADI-PEG20 a constat în injecții intramusculare săptămânale în zilele 1, 15 și 22. Primele 3 cohorte au constat din 3 pacienți și fiecare cohortă a primit ADI-PEG20 la 20, 40 sau 80 U / m2. Ulterior, 6 pacienți au fost tratați la 160 U / m2, care a fost considerată o doză biologică optimă (OBD).

Cohorta italiană a înscris 24 de pacienți în studiul de fază I. Pacienții au fost înscriși într-una din cele șase cohorte. Primele 4 cohorte au constat din 3 pacienți fiecare și fiecare cohortă a fost tratată cu un ciclu ADI-PEG20 la 40, 80, 160 sau 320 U / m2. Șase pacienți au primit un ciclu ADI-PEG20 la 640 U / m2.Primul ciclu a fost compus din terapia din zilele 1, 15 și 22. Mai mult, 6 pacienți au fost tratați pe o cohorta de 3 cicluri care a constat din 4 injecții săptămânale la OBD.

Un obiectiv al acestor studii a fost determinarea farmacocineticii / farmacodinamicii, siguranța și activitatea antitumorală a medicamentului. Studiile farmacocinetice / farmacodinamice au arătat că o doză de ADI-PEG20 la 160 U / m2 a redus nivelul argininei plasmatice de la un nivel de bază de aproximativ 130 μmol / L la mai puțin de 2 μmol / L timp de cel puțin 7 zile. Mai mult, nivelurile plasmatice ale oxidului de azot au scăzut, de asemenea, fără efect măsurabil asupra tensiunii arteriale sau a frecvenței cardiace.

În acest studiu clinic nu au fost atribuite toxicități de gradul 3 sau 4. Cel mai frecvent efect secundar a fost disconfort ușor la locul injectării. Doi pacienți au avut hipotensiune în decurs de 20-40 de minute de tratament. Unul dintre pacienți a prezentat o istorie de hipertensiune arterială și a prezentat medicamente antihipertensive. Celălalt pacient a prezentat hipotensiune după cea de-a patra injectare de ADI-PEG20, dar a primit șase tratamente suplimentare ale medicamentului fără recidiva hipotensiunii. Anomaliile din testele de laborator care au fost observate în timpul studiului includ niveluri ridicate ale acidului uric în sânge, creșterea ușoară a nivelului de fibrinogen din sânge și creșterea rar a nivelurilor de lipază serică și amilază. Niciun pacient nu a prezentat semne clinice de pancreatită.

Din punct de vedere al răspunsului, niciunul dintre cei 15 pacienți înscriși în studiul de fază I din SUA nu a răspuns. În faza italiană I / II a studiului, 6 din 24 de pacienți cu fază I / II au răspuns la tratament, incluzând un răspuns complet și 5 răspunsuri parțiale, pentru o rată de răspuns totală de 25%. Paisprezece pacienți au avut o boală stabilă pentru ≥ 1 ciclu de terapie și 6 pacienți au avut boală stabilă timp de 3 luni de la studiu. Toți pacienții cu boală sau răspuns stabil au primit OBD sau o doză mai mare de ADI-PEG20.

Un obiectiv al studiului a fost de a investiga imunogenitatea ADI-PEG20. În ceea ce privește imunogenitatea medicamentului, niciunul dintre pacienți nu a dezvoltat activitate măsurată enzimatic neutralizând anticorpul în probele de plasmă. Acest lucru este în concordanță cu lipsa reacțiilor alergice observate clinic. În ceea ce privește doza maximă tolerată, 6 pacienți au fost tratați la doza cea mai mare de 640 U / m2 intramuscular săptămânal. Cu excepția disconfortului la locul de injectare (gradul 1), nu s-au observat efecte toxice majore. Întrucât 640U / m2 a fost cea mai mare doză care s-a putut administra cu ușurință prin injecție intramusculară, s-a concluzionat că doza maximă tolerată depășea doza care ar putea fi administrată convenabil pe această cale.

În prezent, efectuăm un studiu de fază II cu ADI-PEG20 în melanom avansat, utilizând o doză săptămânală de 160 U / m2 intramuscular. Rezultatele preliminare din acest studiu au fost prezentate (ASCO, 2005).Douăzeci de pacienți cu melanom local avansat sau metastatic au fost tratați până acum. În ceea ce privește răspunsul, 4 pacienți au avut un răspuns parțial, iar 3 pacienți au avut un răspuns minor (<50% reducere) pentru o rată de control a tumorii de 35%. În plus, 3 pacienți au prezentat un răspuns mixt sugerând dovezi ale activității antitumorale.

 Interesant, un pacient care a avut un răspuns parțial la o doză de 160 U / m 2 a avut progresie săptămânală a bolii. Doza a crescut și pacientul a răspuns din nou la tratament. Acest lucru sugerează că poate exista un răspuns la doză sau poate dezvoltarea rezistenței la medicament datorită anticorpului de neutralizare care a fost depășit de doza crescută de medicament. 

Locurile de răspuns includ plămânul, boala nodală, țesutul moale și pielea. Acest lucru nu este neașteptat, deoarece pacienții cu boală în aceste organe au mai multe șanse de reacție decât pacienții cu alte boli viscerale. Am observat un răspuns mixt la un pacient cu metastaze hepatice extensive utilizând ADI-PEG20.

În ceea ce privește toxicitatea, un pacient a prezentat neutropenie de gradul 3, care a fost rezolvată atunci când medicamentul a fost oprit. Un alt pacient a avut grade neutropenie ¾. Ulterior, el a primit filgrastim la fiecare 2 săptămâni, ceea ce a împiedicat complet neutropenia și ia permis să continue să primească săptămânalul ADI-PEG20. Alte toxicități au fost ușoare și, în principal, au constat în oboseală și disconfort la locul injectării. Nu au fost observate alopecie, greață, vărsături, diaree sau toxicitate majoră la organe.Niciun pacient nu a oprit medicamentul din cauza toxicității.

Datele preliminare sugerează că prezența expresiei ASS în tumoare poate prezice răspunsul la ADI-PEG20.Doi pacienți au avut probe de tumori de melanom testate pentru exprimarea ASS înainte de tratament și au fost ASS (-). Ambii pacienți au avut un răspuns clinic la ADI-PEG20, dar au dezvoltat mai târziu progresia bolii. Eșantioanele de tumoare au fost obținute la momentul progresiei bolii și tumora a fost colorată ASS pozitivă. Un pacient a cărui tumoare de melanom a fost colorat cu ASS pozitiv înainte de ADI-PEG20 nu a răspuns la tratament. Cu toate acestea, 7 din 11 pacienți a căror tumoare au fost ASS (-) înainte de tratament aveau dovezi ale activității antitumorale (răspuns parțial, minor sau mixt) cu ADI-PEG20. Acest studiu continuă să acumuleze pacienți și este nevoie de investigații suplimentare pentru a confirma corelația dintre expresia ASS a tumorii și răspunsul clinic la tratament.

ADI-PEG20 a fost de asemenea studiat în studiile clinice la pacienții cu carcinom hepatocelular inoperabil. Un pacient cu carcinom hepatocelular inoperabil a fost tratat cu doze escaladate de ADI-PEG20 ca o scutire unică a pacientului [ 74 ]. Tumoarea a redus în dimensiune și a existat o reducere a nivelurilor serice ale alfa-fetoproteinei. Nu a fost observată toxicitate datorată medicamentului. Acest răspuns încurajator a condus la un studiu de fază I / II cu ADI-PEG20 la pacienții cu carcinom hepatocelular inoperabil [ 75 ]. Pacienții cu carcinom hepatocelular au fost acumulați de la Institutul de Cancer Pascale din Napoli, Italia. Nouăzeci de pacienți au fost înscriși în studiu în 1 din 4 cohorte. Nivelurile dozelor inițiale ale ADI-PEG20 au fost 20, 40, sau 80 U / m 2. Pacienții ulterioare au fost tratați cu o doză inițială de 160 U / m 2 , care a fost determinată să fie doza biologică optimă , care a redus nivelul argininei plasmatice la niveluri nedetectabile (<2 pM / L) timp de cel puțin 7 zile. Din punct de vedere al răspunsului, 2 pacienți au răspuns complet și 7 pacienți au răspuns parțial la o rată de răspuns totală de 47%. Durata răspunsului a fost definită ca timpul de la începerea tratamentului până la progresie. Durata mediană a răspunsului a fost> 400 zile (interval: 37 până la> 680 zile). În ceea ce privește toxicitatea, efectele secundare includ durerea la locul injectării, creșterea acidului uric seric și a fibrinogenului și creșterea în mod ocazional a nivelurilor de lipază serică și amilază. Nu au apărut semne clinice de pancreatită. Nu a fost găsită nicio dovadă a producerii de anticorpi neutralizanți.

Un al doilea studiu de fază I / II al ADI-PEG20 săptămânal a fost efectuat la spitalul MD Anderson (ASCO, 2005). Faza I a studiului a implicat creșterea dozei de medicament până la 160 U / m 2 . Partea din faza a II-a a testului a utilizat o doză inițială de 160 U / m 2 care a fost considerată OBD, dar a permis o creștere a dozei de până la ≤240 U / m 2. Treizeci și cinci de pacienți au fost înscriși în studiu. În ceea ce privește răspunsul, un pacient a avut un răspuns care a permis pacientului să fie rezistent. În plus, 16 pacienți aveau boală stabilă. Patru pacienți nu au efectuat studiul din cauza reacției alergice sau a bolii intercurente. Douăsprezece opt pacienți au prezentat progresia bolii. Timpul mediu raportat pentru progresie a fost de 3,4 luni, cu un interval de 1 până la 13 luni. Toți pacienții au avut niveluri plasmatice ale argininei nedetectabile după tratamentul ADI-PEG20 (<2 pM). Pentru un pacient care a avut un răspuns și a devenit rezistent, moartea a apărut datorită trombozei venoasei portal și eșecului viu rezultat. Autopsia a arătat o tumoare viabilă minimă rămasă.

În ceea ce privește toxicitatea, efectele secundare au fost mai pronunțate în comparație cu studiul de fază I din Italia. Doisprezece pacienți aveau toxicitate de gradul 3 constând în principal din funcția hepatică sau anomaliile electrolitice serice. În plus, 3 pacienți aveau toxicitate de gradul 4 care constau în anomalii ale funcției hepatice sau în creșterea lipazei serice. Ulterior, am participat la testul de fază 2B a ADI-PEG20 la pacienții cu carcinom hepatocelular nerezecabil, în colaborare cu Institutul de Cancer Pascale. Pacientii au primit ADI-PEG20 la 80 sau 160 U / m 2. Obiectivul primar a fost supraviețuirea globală. O analiză intermediară a arătat că supraviețuirea mediană din momentul diagnosticului a fost de 11,7 luni, iar supraviețuirea mediană de la primul tratament a fost de 8,8 luni. Rata de supraviețuire de 12 luni a fost de 36,7%. Aceste numere sunt comparabile cu cele raportate de Institutul de Cancer Pascale și de la un studiu de fază I / II raportat de MD Anderson [ 75 ]. Interesant, din cei 9 pacienti tratati la Universitatea din Miami, doi pacienti au avut boala stabila timp de cel putin 12 luni. Un pacient a prezentat o boală stabilă timp de un an, iar celălalt pacient a prezentat o boală stabilă timp de> 2 ani, fără efecte secundare observate în urma tratamentului, cu excepția disconfortului la locul injectării. Acest pacient continuă să primească tratament cu injecții săptămânale ADI-PEG20.

CONCLUZII FINALE

Lipsa de arginină este o abordare nouă și promițătoare orientată spre tratamentul anumitor tumori care nu pot forma arginină din ciclul ureei și, prin urmare, sunt auxotrofice pentru arginină. În special, melanomul și carcinomul hepatocelular și, eventual, anumite mezoteliomuri și cancerele celulare renale pot fi sensibile la această terapie. In timp ce noi terapii sunt in curs de aparitie pentru cancerul de celule renale, alte tipuri de cancer sunt dificil de tratat cu terapie de droguri si pentru pacientii cu boala neresectable, ratele de raspuns si supravietuirea globala ramane saraca. Astfel, există o mare nevoie de a dezvolta noi terapii de droguri pentru aceste boli maligne.

Datorită incidenței scăzute a efectelor secundare majore, cum ar fi supresia mieloidă și toxicitatea gastrointestinală sau alte efecte toxice asupra organelor, deprivarea argininei poate fi ușor combinată cu alți agenți anti-cancer pentru a crește rata de răspuns. Datele noastre in vitro de laborator sugerează că ADI-PEG20 poate fi sinergic cu agenții de distrugere a ADN-ului, cum ar fi cisplatina și temozolomida (AACR, 2007). Acest lucru pare a fi din cauza incapacității ASS (-) Pentru MDR1, primerii au fost MDR1 secvențe specifice GGAGTGTCCGTGGATCACAAG (resturile 1909-1930) și TGTTCAGGATCATCAATTCTTGT (resturile 2218-2241). Acești primeri au fost selectați în regiuni care sunt doar 36,4 și 37,5% similare cu regiunea corespunzătoare a ADNc mdr-3 . Astfel, ei nu ar trebui să recunoască mdr-3gena. Produsul PCR rezultat din acești primeri a fost de 232 bp. celulele tumorale pentru repararea ADN-ului în absența argininei. Combinația dintre ADI-PEG20 și acești agenți de deteriorare a ADN-ului și alte medicamente sunt în prezent studiate pentru un studiu clinic viitor.

Dezvoltarea rezistenței la medicament datorată inducerii expresiei genei ASS este o problemă potențială în anumite tumori. Această formă de rezistență poate fi depășită prin înțelegerea controlului transcripției / translației acestei gene. Se investighează manipularea farmacologică pentru controlul expresiei ASS și prevenirea rezistenței la medicament în laboratorul nostru.

Logo-ul nihpa

About Author manuscripts Submit a manuscript HHS Public Access; Author Manuscript; Accepted for publication in peer reviewed journal;
Curr Pharm Des . Manuscris de autor; disponibil în PMC 2011 17 mai.
Publicat în formularul final modificat ca:
PMCID: PMC3096551
NIHMSID: NIHMS287629
PMID: 18473854
Lipsirea de arginină ca terapie orientată pentru cancer
L. Feun , 1, * M. Tu , 1 CJ Wu , 1 MT Kuo , 2 M. Wangpaichitr , 1 S. Spector , 3 și N. Savaraj 1, 4

Abstract

Recunoasteri

Această lucrare este susținută de un grant (R01CA109578) de la NIH și un grant de cercetare de la VA. Dorim să mulțumim companiei Polaris Inc. pentru furnizarea ADI-PEG20 și analiza argininei și citrulinei.

Referințe

1. Asselin BL. Adv Exp Med Biol. 1999; 457 : 621-9. PubMed ] Google Scholar ]
2. Muller HJ, Boos J. Crit Rev Oncol Hematol. 1998; 28 : 97-113. PubMed ] Google Scholar ]
3. Wu G, Morris SM., Jr Biochem J. 1998; 336 (Pt1): 1-17. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
4. Husson A, Brasse-Lagnel C, Fairand A, Renouf S, Lavoinne A. Eur J Biochem. 2003; 270 : 1887-99. PubMed ] Google Scholar ]
5. Lind DS. J Nutr. 2004; 134 : 2837S-2841S. discuție 2853S. PubMed ] Google Scholar ]
6. Morris SM., Jr Am J Clin Nutr. 2006; 83 : 508S-512S. PubMed ] Google Scholar ]
7. Caso G, McNurlan MA, McMillan ND, Eremin O, Garlick PJ. Clin Sci (Londra) 2004; 107 : 371-9. PubMed ] Google Scholar ]
8. Gonzalez GG, Byus CV. Cancer Res. 1991; 51 : 2932-9. PubMed ] Google Scholar ]
9. Wheatley DN, Campbell E. Br J Cancer. 2003; 89 : 573-6. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
10. Shen LJ, Beloussow K, Shen WC. Cancer Lett. 2006; 231 : 30-5. PubMed ] Google Scholar ]
11. Shen LJ, WC Lin, Beloussow K, Shen WC. Cancer Lett. 2003; 191 : 165-70. PubMed ] Google Scholar ]
12. Wheatley DN. Semin Cancer Biol. 2005; 15 : 247-53. PubMed ] Google Scholar ]
13. Wheatley DN. Medicamente anticanceroase. 2004; 15 : 825-33. PubMed ] Google Scholar ]
14. wheatley DN, Campbell e, Lai PBS, Cheng PNM. Terapia genică și biologia moleculară. 2005; 9 : 33-40. Google Scholar ]
15. Ensor CM, Holtsberg FW, Bomalaski JS, Clark MA. Cancer Res. 2002; 62 : 5443-50. PubMed ] Google Scholar ]
16. Yoon CY, Shim YJ, Kim EH, Lee JH, Won NH, Kim JH, și colab. Int J Cancer. 2007; 120 : 897-905. PubMed ] Google Scholar ]
17. Szlosarek PW, Klabatsa A, Pallaska A, Sheaff M, Smith P, Crook T, și colab. Clin Cancer Res. 2006;12 : 7126-31. PubMed ] Google Scholar ]
18. Savaraj N, Wu C, Kuo M, You M, Wangpaichitr M, Robles C, și colab. Datele despre obiectivele de droguri. 2007; 2 : 119-128. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
19. Philip R, Campbell E, Wheatley DN. Br J Cancer. 2003; 88 : 613-23. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
20. Scott L, Lamb J, Smith S, Wheatley DN. Br J Cancer. 2000; 83 : 800-10. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
21. Takaku H, Takase M, Abe S, Hayashi H, Miyazaki K. Int J Cancer. 1992; 51 : 244-9. PubMed ] Google Scholar ]
22. Takaku H, Misawa S, Hayashi H, Miyazaki K. Jpn J Cancer Res. 1993; 84 : 1195-200.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
23. Takaku H, Matsumoto M, Misawa S, Miyazaki K. Jpn J Cancer Res. 1995; 86 : 840-6.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
24. Sugimura K, Ohno T, Kusuyama T, Azuma I. Melanoma Res. 1992; 2 : 191-6. PubMed ] Google Scholar ]
25. Sugimura K, Ohno T, Fukuda S, Wada Y, Kimura T, Azuma I. Cancer Res. 1990; 50 : 345-9. PubMedGoogle Scholar ]
26. Dillon BJ, Holtsberg FW, Ensor CM, Bomalaski JS, Clark MA. Med Sci Monit. 2002; 8 : BR248-53. PubMed ] Google Scholar ]
27. Wheatley DN, Philip R, Campbell E. Mol Cell Biochem. 2003; 244 : 177-85. PubMed ] Google Scholar ]
28. Currie GA, Gyure L., Cifuentes L. Br J Cancer. 1979; 39 : 613-20. Articolul gratuit PMC ] [ PubMedGoogle Scholar ]
29. Storr JM, Burton AF. Br J Cancer. 1974; 30 : 50-9. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
30. Cheng PN, Lam TL, Lam WM, Tsui SM, Cheng AW, Lo WH și colab. Cancer Res. 2007; 67 : 309-17. PubMed ] Google Scholar ]
31. Gong H, Zolzer F, von Recklinghausen G, Havers W, Schweigerer L. Leukemia. 2000; 14 : 826-9. PubMed ] Google Scholar ]
32. Gong H, Zolzer F, von Recklinghausen G, Rossler J, Breit S, Havers W, și colab. Biochem Biophys Res Commun. 1999; 261 : 10-4. PubMed ] Google Scholar ]
33. Noh EJ, Kang SW, Shin YJ, Choi SH, Kim CG, Park IS și colab. Int J Cancer. 2004; 112 : 502-8. PubMed ] Google Scholar ]
34. Shen LJ, Shen WC. Curr Opin Mol Ther. 2006; 8 : 240-8. PubMed ] Google Scholar ]
35. Holtsberg FW, Ensor CM, Steiner MR, Bomalaski JS, Clark MA. J Comunicat de control. 2002; 80 : 259-71. PubMed ] Google Scholar ]
36. Dillon BJ, Prieto VG, Curley SA, Ensor CM, Holtsberg FW, Bomalaski JS, și colab. Cancer. 2004; 100: 826-33. PubMed ] Google Scholar ]
37. Gong H, Pottgen C, Stuben G, Havers W, Stuschke M, Schweigerer L. Int J Cancer. 2003; 106 : 723-8.PubMed ] Google Scholar ]
38. Kang SW, Kang H, Park IS, Choi SH, Shin KH, Chun YS și colab. Celulele Mol. 2000; 10 : 331-7. PubMed ] Google Scholar ]
39. Szlosarek P, Klabatsa A, Pallaska A, Sheaf fM, Balkwell F, Fennell D. Proc Am Assoc Can Res. Washington D. C, SUA: 2006. Google Scholar ]
40. Shen LJ, Lin WC, Beloussow K, Hosoya K, Terasaki T, Ann DK, și colab. Biochem Pharmacol. 2003;66 : 1945-52. PubMed ] Google Scholar ]
41. Hao G, Xie L, Gross SS. J Biol Chem. 2004; 279 : 36192-200. PubMed ] Google Scholar ]
42. Beloussow K, Wang L, Wu J, Ann D, Shen WC. Cancer Lett. 2002; 183 : 155-62. PubMed ] Google Scholar ]
43. Park IS, Kang SW, Shin YJ, Chae KY, Park MO, Kim MY și colab. Br J Cancer. 2003; 89 : 907-14.Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
44. Izzo F, Montella M, Orlando AP, Nasti G, Beneduce G, Castello G, și colab. J Gastroenterol Hepatol.2007; 22 : 86-91. PubMed ] Google Scholar ]
45. Sarbassov DD, Ali SM, Sabatini DM. Curr Opin Cell Biol. 2005; 17 : 596-603. PubMed ] Google Scholar ]
46. Tokunaga C, Yoshino K, Yonezawa K. Biochem Biophys Res Commun. 2004; 313 : 443-6. PubMed ] Google Scholar ]
47. Guertin DA, Sabatini DM. Cancer Cell. 2007; 12 : 9-22. PubMed ] Google Scholar ]
48. Kimura N, Tokunaga C, Dalal S, Richardson C, Yoshino K, Hara K și colab. Genele Celule. 2003; 8 : 65-79. PubMed ] Google Scholar ]
49. Smith EM, Finn SG, Tee AR, Browne GJ, Proud CG. J Biol Chem. 2005; 280 : 18717-27. PubMed ] Google Scholar ]
50. Nobukuni T, Joaquin M, Roccio M, Dann SG, Kim SY, Gulati P, și colab. Proc Natl Acad Sci SUA A.2005; 102 : 14238-43. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
51. Pattingre S, Espert L, Biard-Piechaczyk M, Codogno P. Biochimie. 2007. Google Scholar ]
52. Lenaerts K, Renes J, Bouwman FG, Noben JP, Robben J, Smit E, și colab. Proteomica. 2007; 7 : 565-77. PubMed ] Google Scholar ]
53. Grabon W. Postepy Hig Med Dosw (online) 2006; 60 : 483-9. PubMed ] Google Scholar ]
54. Carritt B, Povey S. Cytogenet Cell Genet. 1979; 23 : 171-81. PubMed ] Google Scholar ]
55. Su TS, Bock HG, O’Brien WE, Beaudet AL. J Biol Chem. 1981; 256 : 11826-31. PubMed ] Google Scholar ]
56. Jinno Y, Matuo S, Nomiyama H, Shimada K, Matsuda I. J Biochem (Tokyo) 1985; 98 : 1395-403. PubMed ] Google Scholar ]
57. Anderson GM, Freytag SO. Mol Cell Biol. 1991; 11 : 1935-43. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
58. Haggerty DF, Spector EB, Lynch M, Kern R, Frank LB, Cederbaum SD. J Biol Chem. 1982; 257 : 2246-53. PubMed ] Google Scholar ]
59. Gebhardt R., Mecke D. Eur J Biochem. 1979; 97 : 29-35. PubMed ] Google Scholar ]
60. Lin RC, Snodgrass PJ, Rabier D. J Biol Chem. 1982; 257 : 5061-7. PubMed ] Google Scholar ]
61. Ulbright C, Snodgrass PJ. Arch Biochem Biophys. 1993; 301 : 237-43. PubMed ] Google Scholar ]
62. Morris SM, Jr, Moncman CL, Rand KD, Dizikes GJ, Cederbaum SD, O’Brien WE. Arch Biochem Biophys. 1987; 256 : 343-53. PubMed ] Google Scholar ]
63. Nebes VL, Morris SM., Jr Mol Endocrinol. 1988; 2 : 444-51. PubMed ] Google Scholar ]
64. Husson A, Bouazza M, Buquet C, Vaillant R. Biochem J. 1983; 216 : 281-5. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
65. Tomomura M, Tomomura A, Dewan MA, Saheki T. FEBS Lett. 1996; 399 : 310-2. PubMed ] Google Scholar ]
66. Grofte T, Wolthers T, Jensen SA, Moller N, Jorgensen JO, Tygstrup N, și colab. Hepatologie. 1997; 25 : 964-9. PubMed ] Google Scholar ]
67. McLean P, Novello F. Biochem J. 1965; 94 : 410-22. Articolul gratuit PMC ] [ PubMed ] Google Scholar ]
68. Grofte T, Jensen DS, Gronbaek H, Wolthers T, Jensen SA, Tygstrup N, și colab. Am J Physiol. 1998;275 : E79-86. PubMed ] Google Scholar ]
69. Hattori Y, Shimoda S, Gross SS. Biochem Biophys Res Commun. 1995; 215 : 148-53. PubMed ] Google Scholar ]
70. Zhang WY, Gotoh T, Oyadomari S, Mori M. Brain Res Mol Brain Res. 2000; 83 : 1-8. PubMed ] Google Scholar ]
71. Brasse-Lagnel C, Fairand A, Lavoinne A, Husson A. J Biol Chem. 2003; 278 : 52504-10. PubMed ] Google Scholar ]
72. Jackson MJ, Allen SJ, Beaudet AL, O’Brien WE. J Biol Chem. 1988; 263 : 16388-94. PubMed ] Google Scholar ]
73. Ascierto PA, Scala S, Castello G, Daponte A, Simeone E, Ottaiano A, și colab. J Clin Oncol. 2005; 23 : 7660-8. PubMed ] Google Scholar ]
74. Curley SA, Bomalaski JS, Ensor CM, Holtsberg FW, Clark MA. Hepatogastroenterology. 2003; 50 : 1214-6. PubMed ] Google Scholar ]
75. Izzo F, Marra P, Beneduce G, Castello G, Vallone P, De Rosa V, și colab. J Clin Oncol. 2004; 22 : 1815-22. PubMed ] Google Scholar ]

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3096551/

Mecanismele și eficacitatea terapeutică a terapiei camp electromagnetic pulsat PEMF în oncologie

Abstract

cancerul este una dintre cele mai frecvente cauze de deces la nivel mondial.  Tratamentele disponibile sunt asociate cu numeroase efecte secundare și doar un procent scăzut de pacienți ating o remisie completă.Prin urmare, există o nevoie puternică de noi strategii terapeutice. În acest sens, terapia în câmp electromagnetic cu impulsuri ( PEMF ) prezintă câteva avantaje potențiale, inclusiv neinvazivitatea, siguranța, lipsa de toxicitate pentru celulele necanceroase și posibilitatea de a fi combinate cu alte terapii disponibile. Într-adevăr, stimularea cu PEMF a fost deja utilizată în contextul diferitelor tipuri de cancer, incluzând cancer piele, sân, prostată, hepatocelular, plămân, ovarian, pancreatic, vezică, tiroidiană și cancer de colon in vitro și in vivo. În prezent, doar o aplicare limitată a PEMF la cancer a fost documentată la om. În acest articol, analizăm dovezile experimentale și clinice ale terapiei cu PEMF care discută perspectivele viitoare în utilizarea sa în oncologie.

Introducere

Cancerul este una dintre cele mai frecvente cauze de deces la nivel mondial și a reprezentat 8,2 milioane de decese în 2012 1 . Se estimează că numărul de decese legate de cancer va crește până la peste 11 milioane până în 2030 2 . Tipurile de cancer cu cea mai mare incidență sunt plămânii (1,59 milioane de persoane), ficatul (745,000), stomacul (723,000), colonul și rectul (694,000), sânul (521,000) și esofagul (400,000) 1 .În oncologie, selectarea strategiei corecte de tratament, în stadiile inițiale ale bolii, este esențială pentru creșterea probabilității de remisiune și îmbunătățirea supraviețuirii. Tratamentele de cancer disponibile includ chimioterapia, imunoterapia sau terapia bazată pe anticorpi, radioterapia și chirurgia 3 . Strategia terapeutică este aleasă luând în considerare evaluarea medicală individuală a pacientului, tipul de cancer, localizarea și stadiul 4 al bolii. Tratamentele multimodale sunt adesea necesare pentru a reduce efectele secundare induse de terapie alopata 5 legate de abordări farmacologice precum și alte abordări, inclusiv chirurgie 6. Efectele secundare induse de chimioterapie depind de diferite variabile cum ar fi medicamentul utilizat, doza sa și durata tratamentului. Aceste reacții adverse includ dureri, oboseală, răni de gât și gură, diaree, greață, vărsături, constipație și tulburări ale sângelui. Efectele secundare care afectează sistemul nervos sunt frecvent întâlnite la chimioterapie și includ disfuncții cognitive, cefalee, amețeli, pierderea vederii și tulburări de vedere cum ar fi vedere încețoșată sau dublă, schimbări în învățare și memorie, disfuncție sexuală, ataxie și neuropatie periferică 7 , 9 , 10 , 11 . iritare, febră, hipotensiune arterială, colită sau alte probleme gastro-intestinale și disfuncții tiroidiene sunt reacții adverse legate de imunoterapie 12 .Principalele efecte secundare induse de radioterapie sunt: ​​dureri uscate la nivelul gurii și gingiei, rigiditate maxilară, grețuri, limfedem, dificultăți la înghițire, dificultăți de respirație, dureri la nivelul sânilor sau mamelonului, sângerări rectale, incontinență, iritație vezică urinară și disfuncție hipofizară 13 . Tehnicile chirurgicale, cum ar fi intervenția chirurgicală minim invazivă, au ca rezultat, de asemenea, dureri, oboseală, pierderea apetitului, umflături și vânătăi în jurul locului chirurgiei, sângerări, infecții, limfedem și disfuncție de organe 14 . Numeroase studii sprijină dezvoltarea de noi tratamente în oncologie care urmează să fie adăugate la protocoalele tradiționale pentru a spori eficacitatea tratamentelor disponibile, reducerea efectului efectelor secundare și a calității vieții pacienților 15 , 16 , 17 , 18 . Aceste resurse includ medicina tradițională chineză, medicina ayurvedică, homeopatia și naturopatia19. În timp ce medicina complementară și alternativă (CAM) nu este în general considerată parte a medicinei alopate, ea a fost folosită pe scară largă în domeniul oncologiei ca terapie suplimentară pentru a controla simptomele pacienților și a îmbunătăți calitatea vieții lor 20 , 21 , 22 , 23 , 24 , 25 , 26 . Începutul secolului XX a văzut primele aplicații terapeutice ale terapiilor CAM pentru tratamentul cancerului; aceste terapii includ acupunctura, cromoterapia și terapia cu câmpuri electromagnetice pulsate (PEMF) 4 , 15 , 27 , 28 , 29 , 30 . În această revizuire, ne-am concentrat asupra terapiei PEMF, o tehnică neinvazivă caracterizată de câmpuri electromagnetice care induc microcampuri întregului corp sau local pentru a viza anumite țesuturi ale corpului. Expunerea la PEMF în intervalul 0-300 Hz este un instrument terapeutic utilizat în mod extensiv pentru tratamentul mai multor patologii incluzând osteoartrita, boala Parkinson, durerea și edemul post-chirurgical, tratamentul rănilor cronice și facilitarea vasodilatării și angiogenezei care produc stimulare directă la celulele excitabile inclusiv celulele nervoase și musculare 3132 , 33 , 34 . Stimularea cu o intensitate și durată suficientă induce un curent prin membranele celulare vizate, activând celulele nervoase sau mușchii pentru a propaga potențialele de acțiune 35 , 36 , 37 . Într-adevăr, terapia PEMF poate fi utilizată ca tratament adjuvant pentru chimioterapie și radioterapie, în scopul reducerii dozei, al atenuării efectelor secundare nocive și al creșterii prognosticului pacientului 15 , 35 , 3839 , 40 .

Scopul și criteriile de căutare

Am analizat studiile in vitro, in vivo și studiile clinice care utilizează terapia cu PEMF pentru tratamentul cancerului, publicată între 1976 și 2016. Am căutat Pubmed / Medline, Embase, Web of Science și Scopus folosind cuvintele cheie „PEMF”, „cancer” „,” Frecvențele specifice tumorii „și” oncologia „singure sau combinate. Această revizuire urmărește să descrie stadiul tehnicii terapiei PEMF, să discute înțelegerea actuală a mecanismelor care stau la baza și să contureze perspectivele terapeutice viitoare în oncologie.

Studii in vitro

Tratamentul cu PEMF a fost extensiv studiat in vitro utilizând diferite linii celulare de cancer uman, cum ar fi cancerul de sân (de exemplu MCF7, MDA-MB-231 și T47D) derivat de la feocromocitom (PC12) și cancerul de colon (SW-480 și HCT- 116) 41 , 42 , 43 , 44 , 45 . Aceste studii au arătat că terapia cu PEMF poate exercita o inhibare proliferativă și o întrerupere a fusului mitotic 18 , 40 blochează dezvoltarea neovascularizării necesare pentru aprovizionarea cu tumori 46 , 47 și 48 și exacerbează o instabilitate genetică inerentă sau indusă prin reducerea stringenței ciclului tardiv (G2) 49 . În timp ce chimioterapia nu este specifică celulelor canceroase și țintește toate celulele cu diviziune rapidă 50 , 51 , 52 , PEMF exercită un efect citotoxic selectiv asupra celulelor neoplazice 15 , 40 , 53 , 54 , 55 făcând această terapie o strategie extrem de promițătoare.

În următoarele paragrafe, vom examina studiile care utilizează terapia PEMF în diferite linii celulare ca model pentru studierea anumitor tipuri de cancer (Tabelul 1 ).

tabelul 1

Studii in vitro ale terapiei cu PEMF în oncologie

Autor (i), an Tipul celulei Tratament Principalele descoperiri Referințe
Crocetti și colab., 2013 Celulele adenocarcinomului mamar uman (MCF7) și celulele nontumorigenice (MCF10) Sesiune zilnică de terapie PEMF de 60 de minute (20 Hz; 3 mT) timp de 3 zile PEMF-urile au crescut apoptoza în celulele MCF7 dar nu au avut niciun efect asupra celulelor MCF10 38
Filipovic și colab., 2014 Cancerul de colon uman (MDA-MB-231) și cancerul de colon (SW-480 și HCT-116) 24 și 72 de ore de expunere la terapia cu PEMF (50 Hz, 10 mT) PEMF au crescut apoptoza în rândul celulelor MDA-MB-231 (55% și 20%), SW480 (11% și 6%) și liniilor celulare HCT-116 (2% și 3%) după 24 și respectiv 72 de ore comparativ cu netratate de linii celulare de cancer de control 58
Morabito și colab., 2010 Celule fotochromocitom PC12 nediferențiate și celule diferențiate PC12 Sesiune scurtă de terapie PEMF (50 Hz, 0,1-1,0 mT) timp de 30 de minute și sesiune PEMF pe termen lung (50 Hz, 0,1-1,0 mT) timp de 7 zile Sesiunea PEMF de 30 de minute în celule PC12 nediferențiate a crescut nivelele ROS și a scăzut activitatea de catalază. Nu a fost observată nicio modificare a concentrației de Ca 2+ intracelulare.Sesiunea de terapie PEMF de 7 zile în celulele PC12 nediferențiate a determinat o creștere a concentrației Ca 2+ intracelulare și a creșterii activității catalazei. Nu s-au observat observații semnificative în celulele diferențiate PC12 41

PEMF, câmp electromagnetic pulsatoriu; ROS, specii reactive de oxigen.

Studii ale terapiei cu PEMF în liniile celulare de cancer de sân uman și de cancer de colon

Un studiu efectuat de Crocetti și colaboratorii 38 a investigat dacă terapia PEMF cu intensitate ultra-scăzută și frecvență ar putea induce apoptoza în celulele adenocarcinomului mamar uman (MCF7).Expunerea la PEMF a fost citotoxică la celulele MCF7, dar nu la celulele epiteliale mamare normale (MCF10). Ambele celule MCF7 și MCF10 au fost expuse terapiei PEMF și au fost măsurați indicii citotoxici pentru a proiecta paradigme PEMF care ar putea reduce proliferarea selectivă a celulelor neoplazice. Parametrii PEMF testați au fost: (1) frecvența de 20 Hz, (2) intensitatea de 3 mT și (3) timpul de expunere de 60 min / zi timp de până la 3 zile. Patru metode independente de monitorizare a apoptozei induse de cancer (testul albastru trypan, determinarea apoptozei prin detecția ruperii ADN-ului, analiza proprietăților electrice celulare prin citometrul de impedanță microflow și determinarea apoptozei prin colorarea cu Annexin V) au arătat că acest set specific de parametri PEMF a fost citotoxic la celulele cancerului mamar. În timp ce acest tratament a indus selectiv apoptoza celulelor MCF7, nu a avut niciun efect asupra celulelor MCF10 care au fost mai rezistente la apoptoză ca răspuns la PEMFs. Deși aceste rezultate sunt încurajatoare, expunerea PEMF a fost limitată la 3 zile. Expunerea pe termen lung la PEMF trebuie evaluată în studii suplimentare bazate pe conceptul că eficacitatea PEMF este strâns legată de parametrii semnalului, de magnitudinea expunerii, durata, forma semnalului, durata tratamentului precum și tipul de celule expuse câmpului magnetic 56 , 57 .

Efectul antineoplazic al PEMF-urilor a fost, de asemenea, investigat în cazul cancerului de sân uman MDA-MB-231, al cancerului de colon SW-480 și al liniilor celulare HCT-116. Aceste celule au fost expuse la PEMF de 50 Hz timp de 24 și 72 de ore 58 . PEMF-urile au scăzut numărul celulelor viabile în toate liniile celulare testate, ajungând la 55% după 24 de ore și 20% după 72 de ore în linia de celule MDA-MB-231, 11% după 24 de ore și 6% după 72 de ore în SW480 celulară și 2% după 24 de ore și 3% după 72 de ore în linia celulară HCT-116, în comparație cu liniile de celule canceroase neexpuse utilizate ca martori, după cum este evaluat printr-un model de difuzie a computerelor, un model matematic utilizat pe scară largă pentru studiu proliferarea și infiltrarea celulelor 59 . Inhibarea procentuală mai mică a proliferării celulelor neoplazice a fost observată după 72 de ore, arătând că terapia cu PEMF a avut activitate antiproliferativă care a scăzut în timp. Această acțiune este exercitată in vitro prin interferența cu polimerizarea fusului microtubulei. Într-adevăr, expunerea la PEMF reduce fracția de microtubuli polimerizați, perturbe structura mitotică a axului, inhibă diviziunea celulară, conducând astfel la segregarea eronată a cromozomilor și apoptoza indusă de cancer 60 . În concluzie, studiile efectuate în linii celulare de cancer mamar și de colon la om promit și justifică investigații suplimentare.

Studii ale terapiei cu PEMF în celule derivate din feocromocitom

Parametrii semnalului PEMF au fost extensiv utilizați pe diferite tipuri de celule pentru a determina eficacitatea in vitro 61 , 62 . De exemplu, Morabito și colegii 41 au investigat reacția celulară și neuritogeneza in vitro după expunerea la PEMF. Ei s-au concentrat în special asupra capacității PEMF de a modifica morfologia, proliferarea și diferențierea celulelor feocromocitomului PC12. Mai mult, ei au evaluat dacă PEMF-urile pot induce modificări specifice și variabile ale speciilor în calea stresului oxidativ, cum ar fi stresul oxidativ dependent de Ca2 + , care îmbunătățește producția de radicali liberi, în special prin reacția Fenton, conducând la decesele celulelor apoptotice 63 , 64 , 65 , 66 , 67 , 68 , 69 .Nediferențiată și diferențiată [suplimentată cu 50 ng / ml factor de creștere a nervului (NGF)] Celulele PC12 au fost expuse la terapia PEMF de 50 Hz (0,1-1,0 mT), iar creșterea și viabilitatea celulară au fost evaluate după o perioadă de timp de 30 minute (7 zile), utilizând teste colorimetrice și morfologice.Expunerea pe termen lung la PEMF nu a afectat răspunsul biologic în ceea ce privește proliferarea și neuritogeneza. Expunerea la PEMF de treizeci de minute la 1,0 mT în celule PC12 nediferențiate a crescut nivelele de specii reactive de oxigen (ROS) și scăderea activității catalazei, un indicator al stresului oxidativ. Dimpotrivă, expunerea pe termen lung la PEMF a celulelor PC12 nediferențiate a crescut de asemenea activitatea catalazei care ar putea reflecta absența acumulării ROS și un posibil răspuns de adaptare celular la PEMF-uri. În timpul expunerii imediate a PEMF la celule PC12 nediferențiate, nu sa observat nici o modificare a concentrației de Ca 2+ intracelulare, în timp ce aceasta a crescut după expunerea pe termen lung. Acest nivel sporit de calciu ar putea activa, prin canale de calciu cu tensiune de tip L, căi de semnalizare și ar conduce la exprimarea genelor care modulează diferențierea, supraviețuirea și apoptoza celulară, cum ar fi kinazele reglementate de semnal extracelular, c-Jun N-terminal protein kinaza / proteina kinază activată de stres și p38 70 , 71 , 72 , 73 . În particular, celulele PC12 nediferențiate au fost mai sensibile la expunerea la PEMF, în timp ce celulele PC12 diferențiate au fost mai stabile și rezistente la stres, probabil datorită acțiunii receptorilor NGF de suprafață celulară, cum ar fi p75NR 74 .

Sunt necesare studii suplimentare pentru identificarea căii ROS / Ca2 + intracelulare inter-celulară activată prin terapia cu PEMF. Cu toate acestea, studiul efectuat de Morabito și colaboratorii susține ipoteza că ROS și Ca2 + ar putea fi „primum movens” celular al efectelor induse de terapia PEMF, așa cum se observă în celulele feocromocitomului.

Studii in vivo

Mai multe studii au investigat efectul antineoplazic al PEMF-urilor folosind modele animale utilizate pe scară largă pentru mai multe tipuri de cancer, inclusiv cancerul de sân, carcinomul hepatocelular (HCC) și melanomul (tabelul 2 ) 4 , 48 , 75 , 76 , 77 , 78 .

tabel 2

Studii in vivo ale terapiei cu PEMF în oncologie

Autor (i), an Modelul animal (numărul de animale, designul studiului) Calea de administrare Tratament Principalele descoperiri Referințe
Tatarov și colab., 2011 12 șoareci nudi (Cr: NIH (S) – nu / nu ), imunodeficienți cu celule T, imunodeficienți, divizați în 4 grupe ( n = 3 fiecare) Injectarea ortotopică a liniei celulare de celule tumorale de sân metastazice de șoarece [celule EpH4-MEK Bcl2 13(1 x 106)] în suportul de grăsime mamar Grupurile 1, 2 și 3 au fost expuse la PEMF (1 Hz, 100 mT) zilnic timp de 60, 180 sau respectiv 360 de minute timp de 4 săptămâni; grupul 4 nu a primit nici un tratament și a fost utilizat ca control Șoarecii expuși timp de 60 și 180 de minute pe zi au prezentat o reducere a tumorii de 30% și respectiv 70% în săptămâna 4, în comparație cu valoarea inițială 85
Emara și colab., 2013 60 șobolani (tulpina nu a fost raportată) împărțită în 6 grupe Administrarea intraperitoneală a unui agent carcinogen, DEN Grupul 1 (șobolani naivi) a primit terapia cu PEMF (2-3 Hz, 0,004 T) timp de 30 de minute pe zi timp de 4 săptămâni; grupul 2 (șobolani naivi) a primit terapie cu PEMF (<1 Hz, 0,6 T) 15 min / zi timp de 6 zile / săptămână timp de 4 săptămâni; grupul 3 (șobolani naivi) a fost lăsat netratat; grupul 4 (șobolani HCC) a primit terapie cu PEMF (2-3 Hz, 0,004 T) timp de 30 de minute pe zi timp de 4 săptămâni;grupul 5 (șobolani HCC) a primit terapie cu PEMF (<1 Hz, 0,6 T) 15 min / zi timp de 6 zile / săptămână timp de 4 săptămâni; lotul 6 (șobolani HCC) a fost lăsat netratat. O scădere semnificativă a nivelului AFP seric și o ușoară îmbunătățire a proprietăților dielectrice ale țesuturilor hepatice au fost observate la șobolanii HCC tratați cu PEMF. Aceste rezultate au fost confirmate prin microscopie electronică și analiză histologică care prezintă regresia HCC. Nu s-au observat modificări ale histopatologiei și ale proprietăților dielectrice ale țesutului hepatic la șobolanii naivi expuși la PEMF. 91
Nuccitelli și colab., 2006 23 șoareci imunocompetenți, fără păr, albinoși SKH-1 Injecție subcutanată unică a celulelor melanomului murin B16 (1 x 105) pe partea dorsală a urechii mouse-ului 30 de minute de sesiune de terapie PEMF (0,5 Hz, 0,2 T) de trei ori pe zi timp de 6 zile Toți șoarecii au prezentat picnică semnificativă, contracția nucleilor celulelor tumorale cu 54% în câteva minute după terapia cu PEMF și cu 68% în decurs de 3 ore și reducerea fluxului sanguin în aproximativ 15 minute după terapia cu PEMF 95
Nuccitelli și colab., 2010 Patru șoareci imunodeficienți, fără păr, albinoși Nu / Nu Injectarea subcutanată unică a celulelor de melanom murinic (B16-F10-eGFP, 1 x 105) pe pielea mouse-ului Sesiune zilnică de 6 minute PEMF (5-7 Hz, 0,2 T) timp de 10 zile Celulele de melanom s-au diminuat într-o oră după terapia cu PEMF, prezentând picnoză în 24 de ore după tratament.Șoarecii tratați cu PEMF au prezentat o remisiune completă a melanomului 100

PEMF, câmp electromagnetic pulsatoriu; DEN, N- dietilnitrosamina; AFP, alfa-fetoproteina; HCC, carcinom hepatocelular

Eficacitatea terapiei cu PEMF în modelele de șoarece de cancer mamar

Eficacitatea terapiei PEMF asupra creșterii și viabilității tumorii a fost testată pe modele de șoarece de cancer mamar. De exemplu, modelele de șoareci xenografți sunt utilizate pe scară largă pentru a studia cancerul de sân. Acest model este obținut prin injectarea celulelor cancerului de sân uman, incluzând linii celulare de carcinom de sân estrogen-negativ (MDA-MB-231) și estrogen-pozitiv (MCF7) sau celule de cancer mamar de sân, inclusiv celule epiteliale mamare EpH4 sau protein kinază activată de mitogen MEK) transformează celulele EpH4 subcutanat, intravenos, intracardial sau ortotopic, de patru ori la fiecare 5 zile, în tamponul mamar de grăsime al șoarecilor imunodeprimați 79 , 80 . Celulele injectate sunt invazive in vitro și tumorigene atunci când sunt transplantate în tamponul mamar. După o săptămână de la ultima injecție, șoarecele este palpată de două ori pe săptămână pentru tumorile mamare, iar dimensiunile tumorilor sunt măsurate folosind un caliper extern zilnic. Șoarecii sunt eutanasiați atunci când dimensiunea tumorii devine ulcerată cu macro-metastaze, în principal în ficat, os și creier 81 , 82 , 83 , 84 . De exemplu, celulele EpH4-MEK Bcl213 (1 x 106) transfectate cu un vector de exprimare a luciferazei (pp P2-PollI-luciferază) au fost injectate în tamponul mamar de grăsime la șoareci nude feminin, Cr: NIH (S) – nu / nu ) 85 . Șoarecii au fost împărțiți în patru grupuri ( n = 3 fiecare). Grupurile 1, 2 și 3 au fost expuse terapiei PEMF (1 Hz, 100 mT) zilnic timp de 60, 180 sau 360 de minute, timp de 4 săptămâni, în timp ce grupul 4 nu a primit terapia cu PEMF și a fost utilizat drept control. Toți șoarecii au fost monitorizați pentru creșterea tumorii prin imagistica prin bioluminescență corporală o dată la 2 până la 4 zile timp de 4 săptămâni. Apoi, toți șoarecii au fost sacrificați și probele de piele, ficat, plămân și splină au fost colectate pentru analiza histopatologică. Șoarecii expuși la PEMF timp de 60 și 180 de minute pe zi au prezentat o reducere a tumorii de sân de 30% și respectiv 70% în săptămâna 4, comparativ cu valoarea inițială.Șoarecii expuși la PEMF pentru 360 de minute zilnic au arătat o suprimare a creșterii tumorilor în săptămâna 4. În concluzie, acest studiu arată că timpul expunerii la PEMF este esențial pentru a determina eficacitatea acestuia. Șoarecii expuși pe o durată mai lungă (360 de minute zilnic timp de 4 săptămâni) au prezentat o reducere semnificativă a dimensiunii tumorii, probabil datorită inhibării angiogenezei care poate suprima formarea vaselor de sânge în țesuturile tumorale, reducând creșterea tumorii.

Efectul anineoplazic al terapiei cu PEMF la modelele de carcinom hepatocelular de rozătoare

HCC indus chimic este un model utilizat pe scară largă de hepatocarcinogeneză care imită dezvoltarea fibrozei și cirozei. Acest model este obținut prin administrarea intraperitoneală a unui agent carcinogen, N-dietilnitrosamină (DEN, 50-100 mg / kg greutate corporală a șoarecelui) singur sau urmată de administrarea orală a unui promotor tumoral hepatic nongenotoxic [fenobarbital (PB)]. DEN induce daune la ADN, proteine ​​și lipide, ducând la moartea hepatocitelor 86 . Acesta este hidroxilat la a-hidroxilnitrozamina, mediată de enzimele citocromului P450 care sunt localizate în primul rând în hepatocitele centrilobulare. Apoi, se formează un ion etildiazoniu electrofil și provoacă distrugerea ADN prin reacția cu nucleofilii. Trei până la patru săptămâni de la ultima injecție, șoarecii primesc apă potabilă conținând PB (0,07%) care crește expresia citocromului P450, determinând stres oxidativ și determinând dezvoltarea HCC după 6 luni de la administrarea PB 86 , 87 , 88 , 89 , 90 . Emara și colaboratorii au evaluat siguranța și eficacitatea PEMF cu intensitate și frecvență diferite la un model de șobolan HCC indus de DEN (75 mg / kg greutate corporală, o dată pe săptămână timp de 3 săptămâni) 91 . Șaizeci de șobolani au fost împărțiți în șase grupuri: Grupul 1 (șobolani naivi) a primit terapie PEMF (2-3 Hz, 0,004 T) timp de 30 de minute pe zi timp de 4 săptămâni; grupul 2 (șobolani naivi) a primit terapie cu PEMF (<1 Hz, 0,6 T) 15 min / zi timp de 6 zile / săptămână timp de 4 săptămâni; grupul 3 (șobolani naivi) a fost lăsat netratat; grupul 4 (șobolani HCC) a primit terapie cu PEMF (2-3 Hz, 0,004 T) timp de 30 de minute pe zi timp de 4 săptămâni; grupul 5 (șobolani HCC) a primit terapie cu PEMF (<1 Hz, 0,6 T) 15 min / zi timp de 6 zile / săptămână timp de 4 săptămâni; lotul 6 (șobolani HCC) a fost lăsat netratat. Nu s-au observat modificări ale histopatologiei și ale proprietăților dielectrice ale țesutului hepatic la șobolanii nativi expuși la PEMF care susțin siguranța acestuia. La șobolanii HCC expuși la PEMF, a fost raportată o scădere semnificativă a nivelului AFP (AFP este o glicoproteină serică adesea crescută la pacienții cu HCC și utilizată ca marker de carcinom la clinică), împreună cu o ușoară îmbunătățire a proprietăților dielectrice ale țesutului hepatic. Aceste rezultate au fost confirmate prin microscopie electronică și analiză histologică care prezintă regresia HCC. În total, aceste dovezi sprijină activitatea antineoplazică a terapiei PEMF în modelul de șobolan al HCC indus de DEN și justifică investigații suplimentare.

Eficacitatea terapiei cu PEMF în modelele de melanom murin

Cel mai frecvent utilizat model de melanom murinic este modelul syngeneic B16. Se obține printr-o singură injecție subcutanată de celule de melanom murin 1 x 105 celule B16 pe partea dorsală a urechii mouse-ului. Nodulii melanomului cu diametrul de 5-6 mm se dezvoltă la 7 zile după injectare 92 , 93 , 94 .Modelul de melanom la șoareci fără șoareci SKH-1 a fost utilizat pentru a investiga eficacitatea terapiei cu PEMF (0,5 Hz, 0,2 T, 30 min / zi). Șoarecii ( n = 23) au primit 1-3 tratamente PEMF zilnic timp de 6 zile și au fost monitorizați pentru creșterea tumorii, zilnic, prin metode optice, cum ar fi transilluminarea și reconstrucția cu ultrasunete Doppler care afișează imaginile cu fluxul sanguin pentru fiecare tumoare 95 .Apoi, toți șoarecii au fost sacrificați și țesuturile pielii au fost colectate pentru analiză histopatologică. Toți șoarecii expuși la PEMF au prezentat picnică semnificativă, contracția nucleilor celulelor tumorale cu 54% în câteva minute după terapia cu PEMF și cu 68% în decurs de 3 ore și reducerea fluxului sanguin în aproximativ 15 minute după terapia cu PEMF. Aceste efecte pot fi datorate terapiei PEMF care stimulează melanomul murin să se auto-distrugă prin declanșarea picnicii rapide a nucleelor ​​celulelor tumorale și reducerea fluxului sanguin 96 , 97 , 98 , 99 . Un studiu suplimentar 100 a optimizat parametrii terapiei PEMF numărul de impulsuri, amplitudine și frecvență pentru a suprima complet melanomul cu un singur tratament. În acest studiu, patru șoareci imunodeficienți, fără păr, albino Nu / Nu, au primit un singur tratament PEMF timp de 6 minute utilizând următorii parametri: 2.700 de impulsuri, amplitudine de 30 kV / cm și frecvență de 5-7 Hz timp de 10 zile. După 2-4 săptămâni, șoarecii au fost sacrificați și probele de piele au fost prelucrate pentru histologie. Celulele de melanom s-au diminuat la o oră după terapia cu PEMF, prezentând pincoză în 24 de ore după PEMF și prezentând o remisiune completă a melanomului la toți șoarecii, evaluată prin imagistica in vivo (transilluminare și fotografie). Pentru a evalua siguranța terapiei PEMF, autorii au înregistrat parametrii fiziologici și au introdus un termocuplu miniatural în tumoare pentru măsurarea simultană a temperaturii intratumorale în timpul tratamentului cu PEMF;temperatura corpului și tensiunea arterială sistolică nu au prezentat schimbări semnificative, în timp ce temperatura intratumorală a fost de ~ 6-7 ° C, demonstrând că, prin limitarea frecvenței la 7 Hz sau mai puțin, a fost posibil să se evite încălzirea tumorii la temperaturi hipertermice, afectarea țesuturilor înconjurătoare. Dovezile privind eficacitatea unui tratament unic PEMF asupra cancerului cutanat al pielii care are ca rezultat suprimarea creșterii tumorale și inducerea apoptozei este promițătoare pentru aplicațiile translaționale.

Studii clinice( la oameni)

Utilizarea terapiei PEMF în oncologie este încă limitată (Tabelul 3 ) 4 . Primul studiu care utilizează terapia cu PEMF a fost realizat de Barbault și colegii care au presupus că o combinație de frecvențe specifice, definite de frecvențe specifice tumorii, poate prezenta eficacitate terapeutică pentru tratamentul localizat al tumorilor 15 . Ei au identificat un total de 1524 frecvențe specifice tumorii, variind de la 0,1 la 114 kHz, constând în măsurarea variațiilor rezistenței electrice a pielii, a amplitudinii pulsului și a tensiunii arteriale la 163 pacienți afectați de diferite tipuri de cancer, inclusiv tumori cerebrale, cancer colorectal , Carcinomul hepatocelular HCC, cancerul pancreatic, colorectal, ovarian, mamar, prostata, plămân, tiroidian și vezical și expus la sistemul de radiofrecvență. Tratamentul PEMF administrat timp de 60 de minute, de trei ori pe zi, a fost oferit doar pentru 28 de pacienți cu cancer avansat (cancer mamar [ n = 7], cancer ovarian [ n = 5], cancer pancreatic = 3], cancerul colorectal [ n = 2], cancerul de prostată [ n = 2], glioblastomul multiform [ n = 1], carcinomul HCC [ n = 1], mezoteliom [ n = 1] , cancer pulmonar cu celule mici [ n = 1], oligodendrogliom [ n = 1], cancer pulmonar cu celule mici [ n = 1], sarcom [ n = 1] și tumora tiroidiană [ n = 1]). Niciunul dintre pacienții care au primit terapie cu PEMF nu a raportat reacții adverse; patru pacienți au prezentat o boală stabilă timp de 3 ani (cancer tiroidian cu metastaze pulmonare dovedite cu biopsie), 6 luni (mezoteliom metastatic la nivelul abdomenului), 5 luni (cancer pulmonar cu celule mici) și 4 luni (cancer pancreatic cu biopsie- metastaze hepatice dovedite).

Tabelul 3

Studii clinice ale terapiei cu PEMF în oncologie

Autor (i), an Design de studiu Număr de pacienți Patologie Tratament rezultate Efecte secundare Referințe
Barbault și colab., 2009 Studiu clinic compasional și experimental 28 Glioblastomul multiform, mezoteliomul, oligodendrogliomul, sarcomul, HCC și cancerul mamar, colorectal, pulmonar, neuroendocrin, ovarian, pancreatic, prostatic și tiroidian 60 de minute de sesiune PEMF (0,1 Hz-114 kHz, 1,5 T) de trei ori pe zi timp de 278,4 luni Un pacient cu cancer tiroidian, un pacient cu mezoteliom metastatic la nivelul abdomenului, un pacient cu cancer pulmonar cu celule mici și un pacient cu cancer pancreatic cu metastaze hepatice dovedite cu biopsie au prezentat o boală stabilă timp de 3 ani, 6 luni, 5 luni și 4 luni, respectiv Nu au fost raportate 15
Costa și colab., 2007 Un studiu clinic cu grup unic, deschis, de fază I / II 41 Avansat HCC Sesiune zilnică de 60 de minute PEMF (100 Hz-21 kHz, 1,5 T) de trei ori pe zi timp de 6 luni Cinci pacienți au raportat dispariția completă și doi pacienți au raportat scăderea durerii la scurt timp după tratament.Patru pacienți au prezentat un răspuns parțial la tratament, în timp ce 16 pacienți au prezentat o boală stabilă pentru mai mult de 12 săptămâni Nu au fost raportate 102

PEMF, câmp electromagnetic pulsat; HCC, carcinom hepatocelular.

Tratamentul cu PEMF a fost, de asemenea, utilizat pentru tratamentul carcinomului hepatocelular HCC. Sunt necesare terapii pentru această boală, în special pentru pacienții aflați într-o stadiu avansat de boală care nu tolerează chimioterapia sau intervențiile intrahepatice datorită funcției hepatice depreciate 101 . Fezabilitatea terapiei PEMF pentru tratamentul HCC a fost, de asemenea, investigată într-un studiu clinic deschis, de fază I / II, deschis, unic 102 . Patruzeci și unu de pacienți cu HCC avansați au primit niveluri foarte scăzute de PEMF modulate la frecvențe specifice HCC (100 Hz-21 kHz) și au primit tratamente de ambulatoriu cu durata de 60 de minute pe zi. Nu s-au observat reacții adverse în timpul tratamentului cu PEMF. Cinci pacienți au raportat dispariția completă și doi pacienți au raportat scăderea durerii la scurt timp după începerea tratamentului. Patru pacienți au prezentat un răspuns parțial la tratament, în timp ce 16 pacienți (39%) au prezentat o boală stabilă pentru mai mult de 12 săptămâni. Acest studiu arată că terapia cu PEMF oferă un tratament sigur și bine tolerat, precum și dovezi ale efectelor antineoplazice la pacienții cu HCC.

În concluzie, concluziile încurajatoare justifică studii clinice randomizate pentru a determina eficacitatea terapiei PEMF modulată prin amplitudine care poate întârzia progresia cancerului și poate crește supraviețuirea globală la pacienți. Cunoașterea crescută a frecvențelor specifice tumorii și dovezile preliminare că frecvențele suplimentare specifice tumorii pot da un beneficiu terapeutic oferă o rațiune puternică pentru noul concept conform căruia administrarea unui număr mare din aceste frecvențe poate conduce la o gestionare eficientă a bolii pe termen lung.

Discutii si concluzii

Studiile in vitro susțin efectele antineoplazice și antiangiogenice ale terapiei cu PEMF. Au fost elucidate mai multe mecanisme ale terapiei cu PEMF. De exemplu, PEMF-urile inhibă creșterea cancerului prin întreruperea fusului mitotic într-un proces mediat de interferența orientării tubulinei cu arbore și inducerea dielectroforezei. Mai mult, terapia cu PEMF modulează expresia genelor și sinteza proteinelor care interacționează cu secvențe de ADN specifice în regiunile de promotor gene 18 , 38 , 40 , 41 , 58 , 103 . În plus, PEMF-urile inhibă angiogeneza în țesuturile tumorale, suprimând vascularizarea tumorii și reducând creșterea tumorii, așa cum se arată prin studiile in vivo 95 , 9697 , 98 , 99 , 104 .

Cercetarea specifică, susținută de studiile in vivo descrise, este că toate grupurile tratate au prezentat o viteză de creștere a tumorii mai mică comparativ cu grupul martor netratat, confirmând că terapia cu PEMF poate modula fiziologia și electrochimia celulelor canceroase și influențează sistemele de membrană celulară și mitoza. În plus, PEMF induce unele modificări în capacitatea de transport a membranei prin impactul potențialului osmotic, supapele ionice și conducând la reducerea factorilor de stres celular, creșterea ratei de transcripție ADN și modularea răspunsului imun 105 .

PEMF au, de asemenea, un efect imunomodulator, susținut de dovezi in vivo care arată o creștere a nivelelor de factor alfa al factorului de necroză tumorală care induc un răspuns antitumoral, conducând la activarea unei căi proapoptotice indusă de interacțiunea cu caspaza-8 cu domeniul de deces asociat cu Fas , în splina modelului de șoarece cu melanom murin, după o terapie de 16 zile 78 . Modificări ale tensiunii arteriale, rezistența electrică a pielii, și amplitudinea pulsului la pacientii cu 163 oncologici expuse la frecvente PEMF specifice tumorale au fost de asemenea raportate sugereaza ca terapia PEMF nu numai tinta celulele neoplazice, dar poate avea de asemenea efecte sistemice 15. Cu toate acestea, tratamentul PEMF pe termen lung la pacienții cu HCC nu este toxic, confirmând siguranța terapiei PEMF care utilizează frecvențe mai mici de 100.000 de ori comparativ cu ablația radiofrecventa, care este de asemenea utilizată pentru tratamentul HCC 55 .

În concluzie, numai două studii clinice au utilizat terapia cu PEMF pentru tratamentul cancerului. Aceste studii arată că terapia cu PEMF este sigură și promițătoare în comparație cu alte terapii disponibile pentru cancer. În viitor, PEMF-urile ar putea fi utilizate nu doar ca terapie primară, ci și în combinație cu alte terapii comune antineoplazice. Având în vedere că dispozitivele noi PEMF portabile și accesibile sunt din ce în ce mai disponibile pe piață, se așteaptă ca studiile clinice controlate viitoare să determine în continuare potențialul terapiei PEMF în oncologie.

Logo de caned

Link to Publisher's site
Cancer Med . 2016 Nov; 5 (11): 3128-3139.
Publicat online 2016 Oct 17 doi: 10.1002 / cam4.861
PMCID: PMC5119968
PMID: 27748048
Mecanismele și eficacitatea terapeutică a terapiei camp electromagnetic pulsat PEMF în oncologie

Conflictul de interese

Autorii certifică faptul că nu există niciun conflict de interese cu nici o organizație financiară cu privire la materialul discutat în manuscris.

Recunoasteri

JCMM recunoaște CONACyT pentru aderare.

notițe

Cancer Medicine 2016; 5 (11): 3128 – 3139

Referințe

1. Arteaga CL, Adamson PC, Engelman JA, Foti M., Gaynor RB, Hilsenbeck SG, și colab. 2014. Raportul AACR privind progresele în domeniul cancerului 2014 . Clin. Cancer Res. 20 ( 19 Suppl. ): S1-S112. PubMed ]
2. Woods RRCM și Coldman AJ. 2015. Incidenta cancerului in British Columbia se asteapta sa creasca cu 57% intre 2012 si 2030 . BC Med. J. 5 : 190-196.
3. Fischer G., Pelka RB și Barovic J .. 2005. [ Tratamentul adjuvant al osteoartritei genunchiului cu câmpuri magnetice slabe. Rezultatele unui studiu clinic prospectiv controlat cu placebo ]. Z. Orthop. Ihre Grenzgeb. 143 : 544-550. PubMed ]
4. Verginadis IVA, Karagounis I., Simos Y., Peschos D., Karkabounas S., și Evangelou A .. 2012. Efectele benefice ale radiației electromagnetice în cancer . Radiații electromagnetice ; în tehnologie.
5. Wang ZM, Wang GX, Wang SM, Bassi A., Khalid M., Schoenbach KH, și colab. 2006. Genele răspunsului timpuriu la deteriorarea ADN-ului prin câmpuri electrice impulsive nanosecunde . IEEE Trans. Plasma Sci. 28 : 206-223.
6. Tofani S., Barone D., Cintorino M., de Santi MM, Ferrara A., Orlassino R. și colab. 2001. Câmpurile magnetice statice și ELF induc inhibarea creșterii tumorale și apoptoza . Bioelectromagnetics 22 : 419-428.PubMed ]
7. Coates A., Abraham S., Kaye SB, Sowerbutts T., Frewin C., Fox RM, și colab. 1983. Privind percepția pacientului final asupra efectelor secundare ale chimioterapiei de cancer . Euro. J. Cancer Clin. Oncol. 19 : 203-208. PubMed ]
8. Schagen SB, Muller MJ, Boogerd W., Mellenbergh GJ și van Dam FS. 2006. Modificarea funcției cognitive după chimioterapie: un studiu prospectiv longitudinal la pacienții cu cancer mamar . J. Natl. Cancer Inst. 98 : 1742-1745. PubMed ]
9. Winocur G., Vardy J., Binns MA, Kerr L., și Tannock I .. 2006. Efectele medicamentelor anti-cancer, metotrexat și 5-fluorouracil, asupra funcției cognitive la șoareci . Pharmacol. Biochem. Behav. 85 : 66-75. PubMed ]
10. Reiriz AB, Reolon GK, Preissler T., Rosado JO, Henriques JA, Roesler R., și colab. 2006. Chimioterapia cancerului și funcția cognitivă în modelele de rozătoare: tulburări de memorie induse de ciclofosfamida la șoareci . Clin. Cancer Res. 12 : 5000; răspuns autor 00-1. PubMed ]
11. Joshi G., Sultana R., Tangpong J., Cole MP, St Clair DK, Vore M., și colab. 2005. Stres oxidativ mediate de radicalii liberi și efecte secundare toxice în creier induse de medicamentul anti-cancer adriamicină: înțelegere în chemobrain . Radic gratuit. Res. 39 : 1147-1154. PubMed ]
12. Belldegrun A., Webb DE, Austin HA III, Steinberg SM, White DE, Linehan WM, și colab. 1987. Efectele interleukinei-2 asupra funcției renale la pacienții care au primit imunoterapie pentru cancer avansat . Ann. Intern. Med. 106 : 817-822. PubMed ]
13. al-Mefty O., Kersh JE, Routh A. și Smith RR. 1990. Efectele secundare pe termen lung ale radioterapiei asupra tumorilor cerebrale benigne la adulți . J. Neurosurg. 73 : 502-512. PubMed ]
14. Stege R. 2000. Efecte secundare potențiale ale tratamentului endocrin de lungă durată în cancerul de prostată . Suplimentul de prostată. 10 : 38-42. PubMed ]
15. Barbault A., Costa FP, Bottger B., Munden RF, Bomholt F., Kuster N., și colab. 2009. Câmpuri electromagnetice modulate cu amplitudine pentru tratamentul cancerului: descoperirea frecvențelor specifice tumorii și evaluarea unei noi abordări terapeutice . J. Exp. Clin. Cancer Res. 28 : 51. PubMed ]
16. Evangelou A., Toliopoulos I., Giotis C., Metsios A., Verginadis I., Simos Y., și colab. 2011. Funcționalitatea celulelor ucigașe naturale de la pacienții cu cancer la etapa finală expusă câmpurilor electromagnetice rezonante . Electromagn. Biol. Med. 30 : 46-56. PubMed ]
17. Ronchetto F., Barone D., Cintorino M., Berardelli M., Lissolo S., Orlassino R., și colab. 2004. Câmpuri magnetice statice modulate în frecvență extrem de joasă pentru tratarea cancerului: un studiu pilot privind pacienții cu neoplasm avansat pentru a evalua siguranța și toxicitatea acută . Bioelectromagnetics 25 : 563-571. PubMed ]
18. Kirson ED, Dbaly V., Tovarys F., Vymazal J., Soustiel JF, Itzhaki A. și colab. 2007. Câmpurile electrice alternante opresc proliferarea celulelor în modelele tumorilor animale și în tumorile cerebrale umane .Proc. Natl. Acad. Sci. USA 104 : 10152-10157. PubMed ]
19. Comitetul pentru utilizarea medicinii complementare și alternative de către publicul american. 2005. Pp. 1-360. Medicină complementară și alternativă în Statele Unite . Academia Națională de presă.
20. Weiger WA, Smith M., Boon H., Richardson MA, Kaptchuk TJ și Eisenberg DM. 2002. Consilierea pacienților care caută terapii complementare și alternative pentru cancer . Ann. Intern. Med. 137 : 889-903.PubMed ]
21. Adams J., Sibbritt DW, Easthope G., și Young AF. 2003. Profilul femeilor care se consultă cu medicii alternativi din Australia . Med. J. Aust. 179 : 297-300. PubMed ]
22. Chrystal K., Allan S., Forgeson G., și Isaacs R .. 2003. Utilizarea medicamentelor complementare / alternative de către pacienții cu cancer într-un centru regional de tratare a cancerului din Noua Zeelandă . NZ Med. J. 116 : U296. PubMed ]
23. Lee MM, Chang JS, Jacobs B. și Wrensch MR. 2002. Utilizarea medicamentelor complementare și alternative în rândul bărbaților cu cancer de prostată în 4 populații etnice . A.m. J. Sănătatea Publică 92 : 1606-1609. PubMed ]
24. Eisenberg DM, Davis RB, Ettner SL, Appel S., Wilkey S., Van Rompay M., și colab. 1998. Tendințe în utilizarea medicamentelor alternative în Statele Unite, 1990-1997: rezultatele unui sondaj național ulterior . JAMA 280 : 1569-1575. PubMed ]
25. Chang KH, Brodie R., Choong MA, Sweeney KJ și Kerin M .. 2011. Utilizarea complementară și alternativă a medicamentelor în oncologie: un sondaj de chestionar al pacienților și al cadrelor medicale . BMC Cancer 11 : 196. PubMed ]
26. Barrie RC, și Deng G .. 2004. Terapii complementare și alternative pentru cancer . Oncolog 9 : 80-89. PubMed ]
27. Zimmerman JW, Jimenez H., Pennison MJ, Brezovich I., Morgan D., Mudry A., și colab. 2013. Tratamentul țintă al cancerului cu câmpuri electromagnetice de radiofrecvență amplitudine-modulate la frecvențele specifice tumorii . Bărbie. J. Cancer 32 : 573-581. PubMed ]
28. Lu W., Dean-Clower E., Doherty-Gilman A. și DS Rosenthal. 2008. Valoarea acupuncturii în îngrijirea cancerului . Hematol. Oncol. Clin. North Am. 22 : 631-648, viii. PubMed ]
29. Azeemi ST și Raza SM. 2005. O analiză critică a cromoterapiei și evoluția ei științifică . Evid. Complement bazat. Alternat. Med. 2 : 481-488. PubMed ]
30. Miles P. 2007. Reiki pentru sprijinul minții, corpului și spiritului pacienților cu cancer . Adv. Mind Body Med. 22 : 20-26.
31. Iannitti T., Fistetto G., Esposito A., Rottigni V. și Palmieri B .. 2013. Terapia electromagnetică pulsată pentru gestionarea durerii, rigidității și funcției fizice legate de osteoartrita: experiență clinică la vârstnici . Clin. Interv. Aging 8 : 1289-1293. PubMed ]
32. Vadala M., Vallelunga A., Palmieri L., Palmieri B., Morales-Medina JC și Iannitti T .. 2015. Mecanisme și aplicații terapeutice ale terapiei electromagnetice în boala Parkinson . Behav. Brain Funct. 11: 26. PubMed ]
33. Ryang We S., Koog YH, Jeong KI și Wi H .. 2013. Efectele câmpului electromagnetic pulsator asupra osteoartritei genunchiului: o revizuire sistematică . Reumatologie (Oxford) 52 : 815-824. PubMed ]
34. Strauch B., Herman C., Dabb R., Ignarro LJ și Pilla AA. 2009. Evidențierea utilizării terapiei cu câmpuri electromagnetice pulsate în chirurgia plastică clinică . Aesthet. Surg. J. 29 : 135-143. PubMed ]
35. Elson EI 2009. Eficacitatea puțin explorată a câmpurilor magnetice în tratamentul cancerului și postularea mecanismului de acțiune . Electromagn. Biol. Med. 28 : 275-282. PubMed ]
36. Repacholi MH și Greenebaum B .. 1999. Interacțiunea câmpurilor electrice și magnetice statice și extrem de joase cu sisteme vii: efectele asupra sănătății și nevoile de cercetare . Bioelectromagnetics 20 : 133-160. PubMed ]
37. Organizația WH. Câmpurile electromagnetice și expunerea la sănătatea publică a câmpurilor cu frecvență extrem de redusă . 2012.
38. Crocetti S., Beyer C., Schade G., Egli M., Frohlich J. și Franco-Obregon A .. 2013. Câmpurile electromagnetice cu intensitate scăzută și de frecvență pulsată selectiv afectează viabilitatea celulelor cancerului mamar . PLoS One 8 : e72944. PubMed ]
39. Cameron IL, Sun LZ, Short N., Hardman WE și Williams CD. 2005. Câmpul electromagnetic terapeutic (TEMF) și iradierea gamma pe creierul xenogrefă al cancerului de sân uman, angiogeneza și metastazarea . Cancer Cell Int. 5 : 23. PubMed ]
40. Zimmerman JW, Pennison MJ, Brezovich I., Yi N., Yang CT, Ramaker R., și colab. 2012. Proliferarea celulelor canceroase este inhibată de frecvențele specifice de modulare . Br. J. Cancer 106 : 307-313. PubMed ]
41. Morabito C., Guarnieri S., Fano G. și Mariggio MA. 2010. Efectele expunerii câmpului electromagnetic acut și cronic de joasă frecvență asupra celulelor PC12 în timpul diferențierii neuronale . Cell. Physiol. Biochem. 26 : 947-958. PubMed ]
42. Chen YC, Chen CC, Tu W., Cheng YT și Tseng FG. 2010. Proiectarea și fabricarea unei microplatforme pentru studiul efectelor de proximitate a ELF-EMF localizate asupra creșterii celulelor in vitro HeLa și PC-12 . J. Micromech. Microeng. 20 : 12
43. Tuffet S., de Seze R., Moreau JM și Veyret B .. 1993. Efectele unui câmp magnetic pulsator puternic asupra proliferării celulelor tumorale in vitro . Bioelectrochem. Bioenerg. 30 : 151-160.
44. Sadeghipour R., Ahmadian S., Bolouri B., Pazhang Y. și Shafiezadeh M .. 2012. Efectele câmpurilor electromagnetice cu impulsuri de joasă frecvență asupra proprietăților morfologice și biochimice ale celulelor carcinomului mamar uman (T47D) . Electromagn. Biol. Med. 31 : 425-435. PubMed ]
45. Loja T., Stehlikova O., Palko L., Vrba K., Rampl I. și Klabusay M .. 2014. Influența câmpului electromagnetic pulsatorial și pulsator magnetic asupra câmpului potențial magnetic asupra creșterii celulelor tumorale . Electromagn. Biol. Med. 33 : 190-197. PubMed ]
46. Fang M., Zhang H. și Xue S .. 1998. Rolul calciului în apoptoza celulelor HL-60 induse de harringtonină . Sci. China C Life Sci. 41 : 600-607. PubMed ]
47. da Silva CP, de Oliveira CR, da Conceicao M. și de Lima P .. 1996. Apoptoza ca un mecanism de moarte celulară indus de diferite medicamente chimioterapeutice în limfocitele T leucemice umane .Biochem. Pharmacol. 51 : 1331-1340. PubMed ]
48. Zhang X., Zhang H., Zheng C., Li C. și Xiong W .. 2002. Câmpurile magnetice pulsate cu gradient extrem de scăzut (ELF) inhibă creșterea tumorilor maligne la diferite nivele biologice . Cell Biol. Int. 26 : 599-603. PubMed ]
49. Harris PA, Lamb J., Heaton B. și Wheatley DN. 2002. Posibilă atenuare a punctului de verificare a ciclului celular de deteriorare a ADN-ului G2 în celulele HeLa prin câmpuri electromagnetice cu frecvență extrem de redusă (ELF) . Cancer Cell Int. 2 : 3. PubMed ]
50. DeHaven C. 2014. Efecte de chimioterapie și radioterapie asupra pielii . Plast. Surg. Nurs. 34 : 192-195. PubMed ]
51. Corcos D. 2013. Spre un tratament universal pentru cancer: chimioterapie asistată de inflamație celulară . Cancer Med. 2 : 421-426. PubMed ]
52. Barton-Burke M., Wilkes GM și Ingwersen K .. 2001. p. 778 în chimioterapia cancerului: o abordare a procesului de îngrijire medicală . Jones & Bartlett Learning Publishers.
53. Barton-Burke M. și Wilkes GM. 2004. Pp. 1-376 în tratamentul cancerului . Jones & Bartlett Learning Publishers.
54. Crocetti S., Piantelli F. și Leonzio C .. 2011. Destabilizarea selectivă a celulelor tumorale cu secvențe electrice și magnetice pulsate: un raport preliminar . Electromagn. Biol. Med. 30 : 128-135. PubMed ]
55. Costa FP, de Oliveira AC, Meirelles R., Machado MC, Zanesco T., Surjan R., și colab. 2011. Tratamentul carcinomului hepatocelular avansat cu niveluri foarte scăzute de câmpuri electromagnetice modulate prin amplitudine . Br. J. Cancer 105 : 640-648. PubMed ]
56. Radeva M. și Berg H .. 2004. Diferențe de letalitate între celulele canceroase și limfocitele umane cauzate de câmpurile electromagnetice LF . Bioelectromagnetics 25 : 503-507. PubMed ]
57. Koh EK, Ryu BK, Jeong DY, Bang IS, Nam MH și Chae KS. 2008. Un câmp magnetic sinusoidal de 60 Hz induce apoptoza celulelor cancerului de prostată prin intermediul speciilor reactive de oxigen . Int. J. Radiat. Biol. 84 : 945-955. PubMed ]
58. Filipovic NDT, Radovic M., Cvetkovic D., Curcic M., Markovic S., Peulic A., et al. 2014. Investigarea câmpului electromagnetic pe diferite linii de celule canceroase . Cancer Cell Int. 14 : 1-10. PubMed ]
59. Swanson KR, Bridge C., Murray JD și Alvord EC Jr., 2003. Tumorile cerebrale virtuale și reale: folosind modelarea matematică pentru cuantificarea creșterii și invaziei gliomului . J. Neurol. Sci. 216 : 1-10. PubMed ]
60. Filipovic ND, Peulic AS, Zdravkovic ND, Grbovic-Markovic VM și Jurisic-Skevin AJ. 2011. Modelarea tranzitorie a elementelor finite de stimulare electrică funcțională . Gen. Physiol. Biophys. 30 : 59-65. PubMed ]
61. Simko M. 2007. Starea redox specifică tipului de celule este responsabilă de diverse efecte de câmp electromagnetic . Curr. Med. Chem. 14 : 1141-1152. PubMed ]
62. Coskun S., Balabanli B., Canseven A. și Seyhan N .. 2009. Efectele câmpurilor magnetice continue și intermitente asupra parametrilor oxidativi in ​​vivo . Neurochem. Res. 34 : 238-243. PubMed ]
63. Grassi C., D’Ascenzo M., Torsello A., Martinotti G., Wolf F., Cittadini A., și colab. 2004. Efectele câmpurilor electromagnetice de 50 Hz asupra canalelor de Ca2 + și a rolului lor în modularea proliferării și morții celulare neuroendocrine . Cell Calcium 35 : 307-315. PubMed ]
64. Liboff AR, Cherng S., Jenrow KA și Bull A .. Activitatea nucleotidică ciclică dependentă de fosfodiesterază este modificată de câmpurile magnetostatice de 20 microT . Bioelectromagnetics 24 : 32-38. PubMed ]
65. Manikonda PK, Rajendra P., Devendranath D., Gunasekaran B., Channakeshava B., Aradhya RS, și colab. 2007. Influența câmpurilor magnetice cu frecvență extrem de joasă asupra semnalizării Ca2 + și a funcțiilor receptorului NMDA la nivelul hipocampului de șobolan . Neurosci. Lett. 413 : 145-149. PubMed ]
66. Morabito C., Rovetta F., Bizzarri M., Mazzoleni G., Fano G. și Mariggio MA. 2010. Modularea stării redox și manipularea calciului prin câmpuri electromagnetice cu frecvență extrem de joasă în celulele musculare C2C12: o abordare în timp real, cu o singură celulă . Radic gratuit. Biol. Med. 48 : 579-589. PubMed ]
67. Vyklicky L. Jr .. 1993. Modularea mediată de calciu a răspunsurilor N-metil-D-aspartat (NMDA) în neuronii hipocampali de șobolan . J. Physiol. 470 : 575-600. PubMed ]
68. Mariggiò MA, Morabito C, Fanò Illic ‘G, Cuccurullo F, Di Ilio C. 2006. Câmpuri electromagnetice de joasă frecvență și stres oxidativ în liniile celulare excitabile . Biol. Eff. Electromagn. Domeniile 4 ( 1 ): 1043-1050.
69. Barrera-Garcia A., O’Hara T., Galvan-Magana F., Mendez-Rodriguez LC, Castellini JM și Zenteno-Savin T .. 2013. Următoarele elemente și indicatori de stres oxidativ în ficat și rinichi Rechinul albastru ( Prionace glauca ) . Comp. Biochem. Physiol. Un Mol. Integr. Physiol. 165 : 483-490. PubMed ]
70. Nicotera P. și Orrenius S .. 1998. Rolul calciului în apoptoză . Cell Calcium 23 : 173-180. PubMed ]
71. Bito H., Deisseroth K. și Tsien RW. 1997. Reglarea dependentă de Ca2 + în expresia genelor neuronaleCurr. Opin. Neurobiol. 7 : 419-429. PubMed ]
72. Morgado-Valle C., Verdugo-Diaz L., Garcia DE, Morales-Orozco C. și Drucker-Colin R .. 1998. Rolul canalelor de Ca2 + cu tensiunea la creșterea neurită a celulelor de cromafină cultivate induse prin stimularea câmpului magnetic extrem de redus (ELF) . Cell Tissue Res. 291 : 217-230. PubMed ]
73. Dolmetsch RE, Pajvani U., Fife K., Spotts JM și Greenberg ME. 2001. Semnalarea către nucleu printr-un complex de tip canal de calciu-calmodulină L prin calea MAP kinazei . Science 294 : 333-339. PubMed ]
74. Ingraham CA și Schor NF. 2009. Necdin și TrkA contribuie la modularea prin p75NTR a rezistenței la stresul oxidant . Exp. Cell Res. 315 : 3532-3542. PubMed ]
75. Wang Z., Yang P., Xu H., Qian A., Hu L. și Shang P .. 2009. Efectele inhibitoare ale unui câmp magnetic static gradient asupra angiogenezei normale . Bioelectromagnetics 30 : 446-453. PubMed ]
76. Tofani S., Cintorino M., Barone D., Berardelli M., De Santi MM, Ferrara A., și colab. 2002. Supraviețuirea mouse-ului a crescut, inhibarea creșterii tumorale și scăderea p53 imunoreactivă după expunerea la câmpurile magnetice . Bioelectromagnetics 23 : 230-238. PubMed ]
77. Williams CD, Markov MS, Hardman WE și Cameron IL. 2001. Efectele câmpului electromagnetic terapeutic asupra angiogenezei și creșterii tumorilor . Anticancer Res. 21 ( 6A ): 3887-3891. PubMed ]
78. Yamaguchi S., Ogiue-Ikeda M., Sekino M. și Ueno S .. 2006. Efectele stimulării magnetice pulsate asupra dezvoltării tumorii și a funcțiilor imunitare la șoareci . Bioelectromagnetics 27 : 64-72. PubMed ]
79. Tofani S., Barone D., Peano S., Ossola P., Ronchetto F. și Cintorino M .. 2002. Activitatea anticanceroasă de către câmpurile magnetice: inhibarea răspândirii și creșterii metastatice la un model de cancer mamar . Trans. Plasma Sci. 30 : 1552-1557.
80. Berg H., Gunther B., Hilger I., Radeva M., Traitcheva N. și Wollweber L .. 2010. Efecte asupra câmpului bioelectromagnetic asupra tumorilor tumorale și celulelor canceroase . Electromagn. Biol. Med. 29 : 132-143. PubMed ]
81. Pinkas J. și Leder P .. 2002. Semnalarea MEK1 mediază transformarea și metastazarea celulelor epiteliale mamare EpH4 independent de o tranziție epitelială la mezenchimală . Cancer Res. 62 : 4781-4790. PubMed ]
82. Reichmann E., Schwarz H., Deiner EM, Leitner I., Eilers M., Berger J., et al. 1992. Activarea unei proteine ​​de fuziune inductibile c-FosER cauzează pierderea polarității epiteliale și declanșează conversia celulară fibroblastoidă epitelială . Cell 71 : 1103-1116. PubMed ]
83. Pinkas J., Martin SS și Leder P. 2004. Supraviețuirea celulară mediată de Bcl-2 promovează metastazarea celulelor epiteliale mamare EpH4 betaMEKDD . Mol. Cancer Res. 2 : 551-556. PubMed ]
84. Iorns E., Drews-Elger K., Ward TM, Dean S., Clarke J., Berry D., și colab. 2012. Un nou model de șoarece pentru studiul metastazei cancerului de sân uman . PLoS One 7 : e47995. PubMed ]
85. Tatarov I., Panda A., Petkov D., Kolappaswamy K., Thompson K., Kavirayani A., et al. 2011. Efectul câmpurilor magnetice asupra creșterii și viabilității tumorilor . Comp. Med. 61 : 339-345. PubMed ]
86. Heindryckx F., Colle I. și Van Vlierberghe H .. 2009. Modele experimentale de șoareci pentru cercetarea carcinomului hepatocelular . Int. J. Exp. Pathol. 90 : 367-386. PubMed ]
87. Goldfarb S., Pugh TD, Koen H. și He YZ. 1983. Proliferarea preneoplastică și neoplazică în timpul hepatocarcinogenezei la șoarecii injectați cu dietilnitrosamină în copilărie . Environ. Perspectiva sănătății. 50 : 149-161. PubMed ]
88. Koen H., Pugh TD și Goldfarb S .. 1983. Distribuția centrilobulară a foci hepatocelulare induse de dietilnitrosamină la șoarece . Lab. Investi. 49 : 78-81. PubMed ]
89. Newell P., Villanueva A., Friedman SL, Koike K. și Llovet JM. 2008. Modelele experimentale de carcinom hepatocelular . J. Hepatol. 48 : 858-879. PubMed ]
90. Leenders MW, Nijkamp MW și Borel Rinkes IH. 2008. Modele de mouse în cercetarea cancerului la ficat: o revizuire a literaturii actuale . Lumea J. Gastroenterol. 14 : 6915-6923. PubMed ]
91. Emara SO, EL-Kholy SM, Kazem AH, Hussein NA și Shams Al-dein RS. 2013. Efectele terapeutice ale câmpurilor electromagnetice pulsate cu frecvență joasă asupra cancerului de ficat de șobolan . Res. Inventy Int. J. Eng. Sci. 2 : 17-18.
92. Overwijk WW și Restifo NP. 2001. B16 ca model de șoarece pentru melanomul uman . Curr. Protoc. Immunol. Capitolul 20 : Unitatea 20.1.
93. Chen X., James Swanson R., Kolb JF, Nuccitelli R. și Schoenbach KH. 2009. Histopatologia pielii și melanoamelor normale după tratamentul cu câmp electric cu impulsuri nanosecunde . Melanoma Res. 19 : 361-371. PubMed ]
94. Kranjc S., Kranjc M., Scancar J., Jelenc J., Sersa G. și Miklavcic D .. 2016. Electrochemoterapia prin tratarea câmpului electromagnetic pulsator (PEMF) în melanomul de șoarece B16F10 in vivo . Radiol. Oncol. 50 : 39-48. PubMed ]
95. Nuccitelli R., Pliquett U., Chen X., Ford W., James Swanson R., Beebe SJ, și colab. 2006. Câmpurile electrice impulsive nanoseccedate provoacă auto-distrugerea melanoamelor . Biochem. Biophys. Res. Commun. 343 : 351-360. PubMed ]
96. White JA, Blackmore PF, Schoenbach KH și Beebe SJ. 2004. Stimularea intrării calitative a calciului în celulele HL-60 prin câmpuri electrice impulsive nanosecunde . J. Biol. Chem. 279 : 22964-22972. PubMed ]
97. Beebe SJ, Fox P., Rec LJ, Somers K., Stark RH și Schoenbach KH. 2002. Efectele câmpului electric impulsiv nanosecundar (nsPEF) asupra celulelor și țesuturilor: inducerea apoptozei și inhibarea creșterii tumorii . IEEE Trans. Plasma Sci. 30 : 286-292.
98. Beebe SJ, Blackmore PF, White J., Joshi RP și Schoenbach KH. 2004. Câmpurile electromagnetice impulsive nanosecundă modulează funcția celulară prin intermediul mecanismelor intracelulare de transducție a semnalului . Physiol. Meas. 25 : 1077-1093. PubMed ]
99. Beebe SJ, Fox PM, Rec LJ, Willis EL și Schoenbach KH. 2003. Câmpurile electrice impulsive nanosecunde, cu intensitate mare, induc apoptoza în celulele umane . FASEB J. 17 : 1493-1495. PubMed]
100. Nuccitelli R., Tran K., Sheikh S., Athos B., Kreis M. și Nuccitelli P .. 2010. Terapia cu câmp electromagnetic optimizat nanosecundă poate determina melanoame maligne murine să se auto-distrugă cu un singur tratament . Int. J. Cancer 127 : 1727-1736. PubMed ]
101. Thomas MB și Zhu AX. 2005. Carcinomul hepatocelular: nevoia de progres . J. Clin. Oncol. 23 : 2892-2899. PubMed ]
102. Costa F., de Oliveira AC, Meirelles R., Zanesco T., Surjan R., Chammas M., și colab. 2007. Un studiu de fază II a câmpurilor electromagnetice modulate cu amplitudine în tratamentul carcinomului hepatocelular avansat (HCC) . J. Clin. Oncol. întâlnire abstract ( 25 ): 15155.
103. Kirson ED, Gurvich Z., Schneiderman R., Dekel E., Itzhaki A., Wasserman Y., și colab. 2004. Perturbarea replicării celulelor canceroase prin alternarea câmpurilor electrice . Cancer Res. 64 : 3288-3295. PubMed ]
104. Nuccitelli R., Chen X., Pakhomov AG, Baldwin WH, Sheikh S., Pomicter JL, și colab. 2009. O nouă terapie cu câmp electric cu impulsuri pentru melanom perturbă alimentarea cu sânge a tumorii și provoacă o remisiune completă fără recurență . Int. J. Cancer 125 : 438-445. PubMed ]
105. Majidian Eydgahi S., Baharara J., Zafar Balanezhad S. și Asadi Samani M .. 2015. Efectul sinergic al acidului glicirizic și câmpul electromagnetic de joasă frecvență asupra angiogenezei în membrana chorioalantoică a puilor . Avicenna J. Phytomed. 5 : 174-181. PubMed ]

Articolele de la Cancer Medicine sunt oferite aici prin amabilitatea lui Wiley-Blackwell

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5119968/

plante chinezesti pentru carcinom hepatocelular

Abstract

Carcinomul hepatocelular (HCC) este una dintre cele mai răspândite afecțiuni maligne la nivel mondial.Gestionarea clinică a HCC rămâne o provocare substanțială. Deși rezecția chirurgicală a țesuturilor tumorale pare a fi promițătoare, o recidivă mare și / sau o rată a metastazelor pentru decesele legate de boală au dus la o nevoie urgentă de intervenție chirurgicală preventivă / terapeutică postoperator îmbunătățită.Dezvoltarea unor agenți terapeutici terapeutici avansați, cum ar fi sorafenibul, pare a fi singura intervenție clinică eficientă pentru pacienții cu HCC până în prezent, dar au fost efectuate doar studii limitate în această privință. Datorită efectelor lor preventive / terapeutice îmbunătățite, compușii derivați din medicinatradițională chineză pe bază de plante (CHM) sunt considerați agenți adecvați pentru tratamentul HCC.Compușii derivați de la plante CHM au, de asemenea, efecte de intervenție multi-nivel, multitarget și coordonate, făcându-le candidați ideali pentru inhibarea progresiei tumorale și a metastazei carcinom hepatocelular HCC. Acest articol analizează activitatea anticanceroasă a diferitelor plante CHM cu speranța de a oferi o mai bună înțelegere a modului în care să se utilizeze cel mai bine plante CHM pentru tratamentul carcinom hepatocelular HCC.

1. Introducere

Carcinomul hepatocelular (HCC) este una dintre cele mai frecvente afecțiuni maligne la nivel mondial și se situează ca a doua cauză principală de deces cauzat de cancer în Taiwan. Într-un context clinic, terapiile curente majore curente, cum ar fi transplantul de ficat, rezecția chirurgicală și ablația locală oferă doar opțiuni limitate pentru tratamentul HCC. 1 Cu toate acestea, mai mult de 70% dintre pacienții cu HCC nu îndeplinesc criteriile de primire a „terapiilor curative” din cauza prezenței extensiei tumorale sau a detectării unei boli hepatice subiacente, cum ar fi ciroza sau ambele. 2 În plus, în ciuda acestor terapii curative, rata de recurență a HCC rămâne ridicată. Pentru a îmbunătăți rezultatul terapeutic, au fost utilizate numeroase metode de tratament adjuvant , cum ar fi chemoembolizarea transarterială (TACE), radioterapia , imunoterapia , chimioterapia și alte tratamente sistemice , cu rezultate frecvent distale. 3 Deși agenții terapeutici terapeutici avansați recent dezvoltați cum ar fi sorafenibul (un receptor al factorului de creștere endotelial vascular și inhibitorul de tirozin kinază) au fost utilizați în setările clinice pentru a prelungi supraviețuirea la pacienții cu HCC avansat, potențialul lor terapeutic până în prezent este limitat costul ridicat și efectele secundare semnificative asociate utilizării acestora. 4 S-au depus multe eforturi în identificarea terapiilor alternative pentru creșterea eficacității medicamentelor anticanceroase, scăderea toxicității sau efectelor secundare și îmbunătățirea calității vieții și a supraviețuirii pacienților. Pe baza rapoartelor recente, medicamentul tradițional chinezesc pe bază de plante (CHM) pare să apară ca o alegere interesantă și viabilă, datorită efectelor sale de intervenție multiple și multiple coordonate împotriva HCC. Aplicarea extensivă a abordărilor fitochimice și biologice în multe compuși derivați de CHM a arătat un mare potențial în dezvoltarea produselor naturale anti-HCC. 5 În acest articol, discutăm despre starea curentă de înțelegere și despre mecanismele farmacologice care stau la baza diferitelor CHM care sunt utilizate ca un agent chemopreventiv / chimioterapeutic pentru tratamentul HCC.

2. Patogeneza moleculară a HCC

HCC este o boală multifactorială cauzată de infecția cu hepatită virală, consumul de alcool , consumul detutun și expunerea la aflatoxină și anumiți alți agenți chimici. 6 Numeroase studii au arătat că dezvoltarea HCC este un proces multistrat. Boala este inițiată prin mutație în diferite gene oncogene . S-a constatat că genele HCC asociate cu virusul hepatitei B sunt implicate în diferite aspecte ale reglementării fiziologice, incluzând sinteza proteinelor [proteina ribozomală S5 ( RPS5 )], organizarea citoscheletică [keratina-8 ( KRT8 )], apoptoza [ ( transfectarea semnalului de tip mitocondrial Fo B1; ATP5F1 ), transducția semnalului ( kinaza kinază kinază kinazică 5 activată de mitogen și proteina de legare a factorului de creștere de tip 2 a insulinei ) și metastază (matrice metallopeptidază-9 sau MMP-9). Alte gene asociate cu structura celulară [vimentin ( vim ) și beta-actin ( ACTB )], glicoliza (gliceraldehidă 3-fosfat dehidrogenază) și adeziunea celulară ( antigenul asociat cu funcția limfocitelor 3; CD58) în țesuturile HCC mediate de virusul hepatitei C , comparativ cu țesuturile normale. Mutațiile genetice în aceste gene declanșează progresia HCC prin activarea anumitor căi oncogene cum ar fi calea Raf-MEK-ERK, ținta de fosfatidilinozitol 3-kinază / Akt / mamifer de calea rapamicinei, calea Wnt / β-catenină, , factorul de creștere a hepatocitului / calea c-MET și semnalarea angiogenică reglată de factorul de creștere. 8 Pe lângă reglementarea genetică / semnalizare intrinsecă, un număr tot mai mare de dovezi a sugerat, de asemenea, că interacțiunile gazdă-virale, inclusiv necroza hepatocitară indusă de răspunsul imun și regenerarea mediată de inflamație, ar putea, de asemenea, să contribuie la hepatocarcinogeneză. Pe scurt, din punct de vedere patologic, în timpul hepatocarcinogenezei predomină următoarele două mecanisme principale: (1) ciroza asociată cu regenerarea hepatică după leziuni tisulare cauzate de infecția cu hepatită, toxine (de exemplu, alcool sau aflatoxină) sau influențe metabolice; și (2) mutații care apar în oncogene simple sau multiple sau gene supresoare tumorale . Deși ambele mecanisme au fost legate de modulații ale numărului de căi de semnalizare celulare, rămâne o provocare substanțială pentru a clarifica modul în care aceste două mecanisme patogene acționează sinergie pentru dezvoltarea HCC. 8

3. Efectele anti-HCC ale CHM-ului tradițional

Spre deosebire de studiile efectuate și de procedurile efectuate pentru combaterea altor tipuri de cancer extrem de răspândite, cum ar fi cancerul pulmonar, sân și colorectal , sunt disponibile mai puține intervenții medicale și studii clinice cu privire la HCC. Acest lucru a dus la o nevoie urgentă de a dezvolta tratamente noi, active și bine tolerate pentru a îmbunătăți supraviețuirea la pacienții cu HCC avansat și pentru a mări remisia de durată după tratamentul curativ. [11] Deși ar fi necesare lucrări suplimentare pentru elucidarea mecanismelor detaliate care stau la baza efectelor anticanceroase mediate de CHM, dovezile acumulate în ultimele câteva decenii confirmă efectele preventive și terapeutice ale utilizării CHM împotriva HCC. În plus, bazele celulare și moleculare ale activității anti-HCC a diferitelor plante CHM au fost, de asemenea, descoperite treptat.

gasiti plantele aici

3.1. Scutellaria baicalensis

Baicalein , un flavonoid prezent în medicina pe bază de plante sho-saiko-to (adică TJ-9, de asemenea cunoscut sub numele de chiao-chai-hu-tang în limba chineză), este un CHM utilizat pe scară largă pentru terapiile antiinflamatorii și anticanceroase. Baicaleinul este raportat că inhibă activitatea topoizomerazei II și suprimă proliferarea liniilor celulare HCC prin stoparea ciclului celular de fază G2 / M in vitro . 12 Mai mult, tratamentul cu Scutellaria baicalensis scade expresia p53 , ETS1, Cdc25B , p63, receptorul factorului de creștere epidermal, ERK1 / 2, inhibitorul legat de X al proteinei apoptozei , factorul 2a inductibil cu hipoxie și Cdc25C și reglează activitatea ciclinei E într-o manieră dependentă de doză, sugerând că S. baicalensisexercită efecte anti-HCC asupra rețelelor largi de semnalizare celulară , conducând astfel la o inhibare colectivă a proliferării celulare . 13 În plus, baicaleinul a redus expresia activatorului de plasminogen de tip MMP-2, MMP-9 și urokinază, precum și inhibarea activității căii de semnalizare ERK, sugerând că baicaleina ar putea regla invazia HCC și metastazarea. 14 Activitatea anti-HCC a baicaleinei a fost descrisă, de asemenea, in vivo într-un studiu recent în care șoarecii tratați cu extract de baicalein au prezentat o creștere semnificativ redusă a xenogrefeilor HepG2 comparativ cu grupurile martor. 15

3.2. berberina

Coptis chinensis și berberina sa principală constitutivă sunt frecvent utilizate în tratarea diabetului zaharat , diareei, enteritei acute, dizenteriei , delirului datorat febrei înalte, leucemiei și otitei medii. Experimentele recente au constatat că atât C. chinensis, cât și berberina au prezentat un potențial anticanceros prin inhibarea proliferării celulare, inducerea apoptozei și oprirea ciclului celular G2 / M. La nivel molecular, C. chinensis / berberină a indus un efect anticancer prin diferite tipuri de reglare moleculară, incluzând inhibarea proteinei anti-apoptotice bcl-2, activarea cascadei caspazice precum și activarea Egr1-NAG-1 (antiinflamatoare nesteroidiene gena activată de droguri) calea proapoptotică. 16 Interesant, un raport recent a arătat că o nouă invenție pe termen lung a berberinei lipozomale bazate pe polietilen glicol a demonstrat potențialul anti-HCC in vitro și in vivo, sugerând în continuare efectul său chemopreventiv în hepatocarcinogeneză. 17

3.3. Chrysanthemum indicum Linn.

Chrysanthemum indicum Linn. (Asteraceae) este un CHM comun care a fost folosit în mod tradițional pentru tratamentul inflamației, hipertensiunii și bolilor neoplazice în China. Un studiu recent a demonstrat că C. indicum Linn. extractele prezintă efecte anti-HCC prin atenuarea protein kinazei mitogene de semnalizare mitogenă / ERK1 / 2 prin receptorul b2-adrenergic asupra creșterii induse de izoproterenol în celulele HepG2 și MHCC97H. 18

3.4. Tanshinone IIA

Danshen ( Salvia miltiorrhiza Radix) a fost utilizat pe scară largă în tratamentul CHM tradițional pentru tratarea bolilor cardiovasculare și hepatice . Tansinona IIA (Tan-IIA; C19H18O3) a fost extrasă din S. miltiorrhiza Radix, iar activitățile antioxidante , antiinflamatorii și antitumorale au fost bine documentate în multe celule canceroase umane. Efectul anticancer al Tan-IIA a fost detectat în principal prin inhibarea creșterii și apoptoza indusă în HCC umană. 19 , 20 , 21 Sa demonstrat că activarea și inhibarea proliferării apoptozei mediate de Tan-IIA pot să apară prin expresia crescuta a proteinelor proapoptotice mediate de stres, calreticulina, caspaza-12 si GADD153. Mai recent, alte câteva studii in vivo au confirmat că Tan-IIA a inhibat creșterea xenogrefeilor hepatocelulare J5 și H22, posibil prin modularea activității proteinelor proapoptotice / antiapoptotice. În plus față de reglarea viabilității celulelor canceroase, s-a crezut, de asemenea, că Tan-IIA suprimă activitatea metastatică prin reducerea activității MMP-2, MMP-9, 25 și modularea tranziției mezenchimale epithelială mediată de factorul 1a indusă de hipoxie proces. 26

3.5. Solanum nigrum L.

Solanum nigrum L., o plantă  indigenă în Asia de Sud-Est, este un medicament oriental administrat în mod curent. Un studiu anterior a arătat că fructele coapte de S. nigrum L. induse inhibarea creșterii și apoptoza în celulele cancerului mamar. 27 Un număr de studii au arătat că extractul polifenolic S. nigrum L. (SNPE) induce oprirea ciclului celular crescut, autofagia crescută și apoptoza crescuta în celulele HCC. 28 , 29 La nivel molecular, SNPE a atenuat regulatoarele ciclului celular Cdc25A, Cdc25B și Cdc25C;mediatorii de apoptoză caspaza-3, caspaza-8 și caspaza-9; precum și proteine ​​de familie Bcl-2 atât in vitro, cât și in vivo . 30

3.6. Tetrandrine

Tetrandrina este un alcaloid de bisbenzilizochinolină izolat din rădăcinile tetranoasei Radix Stephaniae S. Moore. Radix S. tetrandrae S. Moore este un ingredient vechi al CHM tradițional și este utilizat în general în China pentru tratarea pacienților cu artrită , hipertensiune arterială, inflamație și chiar silicoză. 31 Sa demonstrat că tetranrina atinge ameliorarea simptomelor printr-un mecanism farmacologic în care tetraninul blochează canalele Ca2 + ; în plus, tetranrină are proprietăți imunosupresoare, efecte de curățare a radicalilor liberi și trăsături antiproliferative. 32 Mai mult, s-a raportat că administrarea de tetranrină a condus la stoparea ciclului celular în faza G1 și la apoptoza indusă în multe celule canceroase prin inhibarea semnalizării proproliferative ERK. 33 , 34 Tratamentul celulelor cancerigene hepatice cu tetranrină a modificat morfologia lor, a indus fragmentarea cromatinei și a stimulat activitatea caspazei. Interesant, administrarea tetranrină a determinat, de asemenea, acumularea intracelulară a speciilor reactive de oxigen(ROS), în timp ce sclavatorii ROS, cum ar fi N -acetil-l-cisteina și glutationul (GSH), au desființat complet apoptoza indusă de tetranrină sugerând că generația ROS joacă un rol important tetracrină mediată de apoptoză. Mai mult, activitatea apoptotică asociată Akt a fost crescută ca răspuns la generarea ROS, ceea ce indică o posibilă cascadă moleculară pentru efectul anticancer mediat de tetranrină. Luate împreună, aceste constatări sugerează că tetranrina ar putea servi drept regulator ROS / Akt și ar putea fi implicată în tratamentul HCC. 35 în plus, tetranrina a prezentat, de asemenea, un efect anti-HCC in vivo . S-a arătat că nanoparticulele co-încărcate cu paclitaxel / tetranrină pot reprima eficient creșterea tumorală , 36 în timp ce ROS acumulat și autofagia crescută au fost detectate în xenogrefe Huh7 care au dus la scăderea volumului tumoral ca răspuns la tratamentul cu tetranrină. 37

3.7. andrografolid

Andrographis paniculata a fost un CHM pentru tratamentul infecțiilor respiratorii , febră, dizenterie bacteriană și diaree în multe țări din Asia de secole. Andrografolidul ( ANDRO ), un compus activ izolat din A. paniculata, este cunoscut a avea diferite caracteristici fiziologice de reglementare, cum ar fi antiinflamatorii, antibacteriene și hepatoprotecție. ANDRO a inhibat creșterea celulelor hepatomului prin activarea kinazei terminale c-Jun NH2 (JNK) și prin reducerea nivelurilor de GSH. 38 , 39 ANDRO a provocat, de asemenea, stoparea ciclului stimulate de ROS, conducând la intermitența ipotetică dintre activarea JNK, homeostazia celulară GSH și citotoxicitatea în celulele hepatomului. 40 , 41

3.8. Gamboge

Gamboge este, de asemenea, un CHM tradițional folosit de sute de ani. Componenții săi principali, acidul gambogic (GA) și acidul gambogenic sunt izolați din Garcinia hanburyi și s-a dovedit că au efecte antiproliferative în liniile celulare HCC. În plus, s-a constatat de asemenea că 1,3,6,7-tetrahidroxixantonul (TTA), derivat de xantonă din Goodyera oblongifolia , ar putea fi un inductor puternic de apoptoză în celulele HCC. Studiile anterioare au demonstrat că TTA a suprimat HCC prin expresia genei crescute în regiunea p16și 14-3-3. 42 Activitatea anti-HCC in vivo a GA a fost, de asemenea, evidentă prin dimensiunea redusă a tumorii xenotransplantate SMMC-7721 la șoareci, posibil prin inhibarea activității telomerazei . 43

3.9. Cornus officinalis

Cornus officinalis Sieb. et Zucc. (Cornaceae) este un alt CHM utilizat pe scară largă, cu activități antineoplazice și antiinflamatoare. Extrase din C. officinalis Sieb. et Zucc. ar putea, de asemenea, să regleze în jos peroxidarea lipidelor rezultând în hepatoprotecție. În ceea ce privește efectul său anticanceros, studii anterioare au constatat că extractele de C. officinalis Sieb. et Zucc. a prezentat o supresie dependentă de doză a progresiei oncogene mediate de p53 și Ras și a inhibat stresul oxidativ prin eliminarea radicalilor liberi împotriva celulelor HCC, făcând C. officinalis Sieb. et Zucc. un agent chemopreventiv eficient împotriva HCC. 44

3.10. Curcumina

Curcumina este unul dintre principalii agenți fenolici din curcuma ( Curcuma longa ). Există trei curcuminoide majore care formează curcumina, care sunt următoarele: curcumina (curcumina I, 75%), demetoxicurcumina (curcumina II, 20%) și bisdemetoxicurcumina (curcumina III, 5%). Deși curcumina nu este un CHM tradițional, ea a fost considerată ca un agent de chimioprevență care ar putea suprima de secole neoplaziile, inflamațiile, infecțiile virale, stresul oxidativ și patologia mediată de virusul imunodeficienței umane. 46 Un număr de studii au demonstrat că curcumina poate induce stoparea ciclului celular în faza G2 / M, 47 inhibă proliferarea, 48 induce apoptoza, 49 și suprimă angiogeneza și metastazarea 50 în diferite linii celulare HCC. Mai mult, folosind modele in vivo , activitatea de anticanceră a curcuminei a fost de asemenea documentată indicând faptul că curcumina ar putea reduce eficient multiplicitatea celulelor canceroase, 51 atenuarea creșterii tumorii, 52 scăderea activității telomerazei, prevenirea angiogenezei tumorale și inhibarea metastazelor intrahepatice. 53

3.11. resveratrol

Resveratrolul ( trans -3,5,4′-trihidroxistilben) este un compus polifenol natural antioxidant care poate fi găsit într-o varietate largă de plante, inclusiv struguri, arahide și fructe de pădure, și poate fi de asemenea izolat de rădăcinile uscate ale CHM Polygonum cuspidatum Sieb . et Zucc. Studiile recente au constatat că resveratrolul poate preveni sau încetini progresia unei largi varietăți de tumori, inclusiv HCC. La nivel molecular, resveratrolul a inhibat creșterea celulară prin stoparea ciclului celular în faza G1 și a mărit expresia sintazei oxidului nitric inductibil (NOS) și NOS endotelial . Sa sugerat, de asemenea, că resveratrolul induce apoptoza prin activarea caspazei-2, -8 și -10. În plus, tratamentul cu resveratrol a inhibat semnificativ migrarea și invazia celulară, ceea ce a dus la supresia metastazelor. 58

În concluzie, o sinteză a efectelor anticanceroase ale CHM tradiționale menționate mai sus este rezumată în Tabelul 1 . 12 , 13 , 14 , 15 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 35 , 44 , 47 , 48 , 50 , 51 , 52 , 53 , 56 , 57 , 58 Deși CHM au fost aplicate în mod obișnuit în Asia de Est și sunt din ce în ce mai frecvente la nivel mondial, dacă și când multe aspecte antitumorale sunt pe deplin evaluate noua „medicament” alternativă împotriva HCC, având în vedere toxicitatea sa scăzută și activitatea ridicată. Înceea ce privește aspectele terapeutice, CHM a fost propusă a fi activă împotriva inițierii, supraviețuirii, proliferării, angiogenezei și metastazei HCC utilizând diferite modele in vitro și in vivo . În plus, CHM ar putea, de asemenea, să consolideze sinergie creșterea inhibiției HCC și a funcției imune , precum și reducerea efectelor toxice atunci când este combinată cu radioterapia , chimioterapia și TACE. 62 Luate impreuna, desi este clar ca multe CHM au o activitate anticanceroasa excelenta, evaluarea aplicatiilor clinice ale CHM utilizand cohorte clinice randomizate, controlate clinic de pacienti cu cancer hepatic este inca necesara.

Tabelul 1 . Efectele anti-HCC ale CHM.

CHM / compuși Pentru inițiere Pentru supraviețuire / proliferare Pentru angiogeneză / metastază
Scutellaria baicalensis 2 / M oprirea fazei
↓ topoizomeraza II ( in vitro ) 12
↓ p53, ETS1, Cdc25B, p63, EGFR, ERK1 / 2, XIAP, HIF-2a și Cdc25C;
↑ Ciclina E ( in vitro) 13
↓ Dimensiunea tumorii xenogrefei HepG2 ( in vivo15
↓ semnalizare ERK
↓ MMP-2, MMP-9 și uPA ( in vitro ) 14
Berberina / Coptis chinensis Întreruperea fazei de tip G 2 / M ( in vitro ) 15 ↓ Bcl-2;
↑ Activarea procaspase-3 și procaspase-9 și a proteinei NAG-1 ( in vitro ) 15
↓ Dimensiunea tumorii xenogrefei HepG2 ( in vivo17
Chrysanthemum indicum Linn. ↓ Signalizare MAPK / ERK1 / 2 ( in vitro ) 18
Tanshinone IIA ( Salvia miltiorrhizaRadix) Întreruperea fazei G2 / M ( in vitro ) 19 , 20 , 21 ↓ Bcl-2
↑ p53, p21, Bax, calreticulina, caspaza 12 și GADD153 ( in vitro ) 19 , 21 , 22
Dimensiunea tumorii xenogrefei J5 / H22 ( in vivo ) 23 , 24
↓ EGF și EGFR ( in vitro ) 20
↓ MMP-2, MMP-9
↓ EMT mediată de HIF-1α ( in vivo ) 25 , 26
Solanum nigrumL. Întreruperea fazei de tip G 2 / M ( in vitro ) 27 , 28 , 29 ↓ Cdc25A, Cdc25B, Cdc25C; ↓ Bcl-2 ( in vitro ) 30
↓ Dimensiunea tumorii xenogrefei HepG2 ( in vivo30
Tetrandrine ↑ ROS; ↓ cale Akt ( in vitro ) 35
↑ ROS; ↑ Autofagia
↓ Dimensiunea tumorii xenogrefe Huh7 ( in vivo ) 37
andrografolidă ↑ ROS și JNK
↓ Nivelul de glutation ( in vitro ) 39 , 40 , 41
Gamboge ↑ p16; Exprimarea genei 14-3-3σ ( in vitro ) 42
↓ Creșterea tumorii xenogrefă SMMC-7721
↓ Activitatea telomerazei ( in vivo ) 43
Cornus officinalis Sieb.et Zucc. ↑ p53 și mutația Ras ( in vitro ) 44
Curcumina Întreruperea fazei de tip G 2 / M ( in vitro ) 47 ↑ Activitatea telomerazei;mitocondrial și ADN ( in vitro ) 48
↑ 8-OHdG; ↑ ROS ( in vitro ) 50
↓ HIF-1a și VEGF ( in vivo51 , 53
↓ MMP-9 ( in vivo ) 52
resveratrol Întreruperea fazei G / S ( in vitro ) 56 ↓ Cyclin D1, p38 și Akt;
↑ p53, p21, caspaza 2,3, 8 și 10 și fragmentarea ADN ( in vitro ) 57
↓ HIF-1a, VEGF, JNK1 / 2, ADN-ul SP-1, NF-kB, VEGF și uPA ( in vitro ) 58

8-OHdG = 8-hidroxi-2′-deoxiguanozină; CHM = medicină din China pe bază de plante ; EGF = factor de creștere epidermal ; EGFR = receptorul factorului de creștere epidermal; EMT = tranziție epitelio-mezenchimică ; ERK = kinază reglată de semnal extracelular; HIF-1α = factorul 1a indus de hipoxie; HIF-2α = factorul 2a indus de hipoxie; JNK = c-Jun NH-terminal kinază; MAPK = proteină kinază activată de mitogen ; MMP = metallopeptidază matriceală; NF-κB = factor nuclear-κB; ROS = specii reactive de oxigen; uPA = activator de plasminogen de tip urokinază ; VEGF = factor de creștere endotelial vascular ; XIAP = inhibitor legat de X al proteinei de apoptoză .

gasiti plantele aici

Recunoasteri

Această lucrare este susținută de un grant de la Taipei City Hospital / Departamentul de Sănătate, Taipei City Government , Taiwan (Grant No. 102TPECH05 ). Autorii ar dori, de asemenea, să-i mulțumească doctorului Jude Clapper de la Școala Americană din Taipei, Taipei, Taiwan și doamna Courtney Anne Curtis pentru revizuirea critică și corecțiile în limba engleză pentru manuscris.

Referințe

1
CR de Lope, S. Tremosini, A. Forner, M. Reig, J. Bruix Managementul HCC
J Hepatol, 56 (Suppl. 1) (2012), pag. S75-S87
2
G. Lurje, M. Lesurtel, PA Clavien Strategii de tratament multimodal la pacienții supuși unei intervenții chirurgicale de carcinom hepatocelular
Dig Dis, 31 (2013), pp. 112-117
3
S. Kubo, S. Takemura, C. Sakata, Y. Urata, T. Uenishi Terapia adjuvantă după rezecția curativă pentru carcinomul hepatocelular asociat cu virusul hepatitei
Cancer la ficat, 2 (2013), pp. 40-46
4
A. Moeini, H. Cornellà, A. Villanueva Cale de semnalizare emergente în carcinomul hepatocelular
Cancer la ficat, 1 (2012), pp. 83-93
5
Y. Hu, S. Wang, X. Wu, J. Zhang, R. Chen, M. Chen și colab. Medicamente chinezești pe bază de plante derivate din tratamentul cancerului: un accent pe carcinomul hepatocelular
J Ethnopharmacol, 149 (2013), pp. 601-612
6
K. Schütte, J. Bornschein, P. Malfertheiner Carcinomul hepatocelular-epidemiologic și factorii de risc
Dig Dis, 27 (2009), pag. 80-92
7
N. Nishida, M. Kudo Progrese recente în analizele genetice cuprinzătoare pentru carcinomul hepatocelular uman
Oncology, 84 (2013), pp. 93-97
8
S. Whittaker, R. Marais, AX Zhu Rolul căilor de semnalizare în dezvoltarea și tratamentul carcinomului hepatocelular
Oncogene, 29 (2010), pp. 4989-5005
9
MW Smith, ZN Yue, GK Geiss, NY Sadovnikova, VS Carter, L. Boix și colab. Identificarea de noi markeri tumorali în carcinomul hepatocelular asociat virusului hepatitei C
Cancer Res, 63 (2003), pag. 859-864
10
PA Farazi, RA DePinho Patogeneza carcinomului hepatocelular: de la gene la mediu
Nat Rev Cancer, 6 (2006), pag. 674-687
11
JM Llovet, J. Bruix Revizuirea sistematică a studiilor randomizate pentru carcinomul hepatocelular inoperabil: chemoembolizarea îmbunătățește supraviețuirea
Hepatology, 37 (2003), pp. 429-442
12
Y. Matsuzaki, N. Kurokawa, S. Terai, Y. Matsumura, N. Kobayashi, K. Okita Moartea celulelor induse de baicalein în liniile celulare de carcinom hepatocelular uman
Jpn J Cancer Res, 87 (1996), pp. 170-177
13
F. Ye, Y. Che, E. McMillen, J. Gorski, D. Brodman, D. Saw și colab. Efectul Scutellaria baicalensis asupra rețelei de semnalizare în celulele carcinomului hepatocelular
Nutr Cancer, 61 (2009), pp. 530-537
14
K. Chen, S. Zhang, Y. Ji, J. Li, P. An, H. Ren, și colab. Baicaleinul inhibă capacitățile de invazie și metastazare ale celulelor carcinomului hepatocelular prin reglarea în jos a căii ERK
PLoS One, 8 (2013), p. e72927
15
RR Liang, S. Zhang, JA Qi, ZD Wang, J. Li, PJ Liu și colab. Inhibarea preferențială a carcinomului hepatocelular de către baicaleinul flavonoid prin blocarea semnalizării MEK-ERK
Int J Oncol, 41 (2012), pp. 969-978
16
KK Auyeung, JK Ko Coptis chinensis inhibă creșterea celulară a carcinomului hepatocelular prin activarea genei activată antiinflamatoare nesteroidiene
Int J Mol Med, 24 (2009), pp. 571-577
17
YC Lin, JY Kuo, CC Hsu, WC Tsai, WC Li, MC Yu și colab. Optimizarea fabricării berberinei lipozomale cu evaluarea efectelor sale antihepatomice într-un model de xenogrefă murinică
Int J Pharm, 441 (2013), pp. 381-388
18
A. Yuan, Z. Li, X. Li, S. Yi, S. Wang, K. Shi și colab. Efect distinct al extractelor Chrysanthemum indicum Linné asupra creșterii induse de isoproterenol a celulelor carcinomului hepatocelular uman
Oncol Rep, 22 (2009), pp. 1357-1363
19
Yuan Wei, XJ Wang, F. Xiao, SF Li, J. Zhang Inhibarea creșterii și inducerea apoptozei tansinonei II-A asupra celulelor carcinomului hepatocelular uman
World J Gastroenterol, 10 (2004), pp. 2024-2028
20
XM Zhai, SX El, MD Ren, JH Chen, ZL Wang, M. Han și colab. Efectul tanshinonei II A asupra exprimării EGF și EGFR în linia celulară de carcinom hepatocelular SMMC-7721
Zhejiang Da Xue Xue Bao Yi Xue Ban, 38 (2009), pp. 163-169
[Articol în limba chineză]
21
WY Lee, KW Liu, JH Yeung Activarea de kinază mediată de speciile de oxigen reacționată de către dihidrotansinonă în apoptoza indusă de tansinone în celulele HepG2
Cancer Lett, 285 (2009), pp. 46-57
22
CY Cheng, CC Su Tanshinone IIA inhibă celulele Hep-J5 prin creșterea expresiei proteinei calreticulinelor, caspazei 12 și GADD153
Int J Mol Med, 26 (2010), pp. 379-385
23
SY Chien, SJ Kuo, YL Chen, DR Chen, CY Cheng, CC Su Tanshinone IIA inhibă creșterea celulelor J5 ale carcinomului hepatocelular uman prin creșterea Bax și a caspazei 3 și scăderea expresiei CD31 in vivo
Mol Med Rep, 5 (2012), pp. 282-286
24
H. Ma, Q. Fan, J. Yu, J. Xin, C. Zhang Activități anticanceroase ale microemulsiei de tanshinonă împotriva carcinomului hepatocelular in vitro și in vivo
Mol Med Rep, 7 (2013), pp. 59-64
25
X. Yuxian, T. Feng, L. Ren, L. Zhengcai Tanshinone II-A inhibă invazia și metastazarea celulelor carcinomului hepatocelular uman în vitro și in vivo
Tumori, 95 (2009), pp. 789-795
26
WQ Wang, L. Liu, HC Sun, YL Fu, HX Xu, ZT Chai și colab. Tansinone IIA inhibă metastazele după rezecția paliativă a carcinomului hepatocelular și prelungește supraviețuirea în parte prin normalizarea vasculară
J Hematol Oncol, 5 (2012), p. 69
27
YO Son, J. Kim, JC Lim, Y. Chung, GH Chung, JC Lee Ripe de fructe de Solanum nigrum L. inhibă creșterea celulelor și induce apoptoza în celulele MCF-7
Food Chem Toxicol, 41 (2003), pp. 1421-1428
28
HM Lin, HC Tseng, CJ Wang, CC Chyau, KK Liao, PL Peng și colab. Inducerea autofagiei și a apoptozei prin extractul de Solanum nigrum Linn în celule HepG2
J Agric Food Chem, 55 (2007), pp. 3620-3628
29
YB Ji, SY Gao, CF Ji, X. Zou Inducerea apoptozei în celulele HepG2 de către solanină și proteina Bcl-2
J Ethnopharmacol, 115 (2008), pp. 194-202
30
HC Wang, PJ Chung, CH Wu, KP Lan, MY Yang, extract de polifenol CJ Wang Solanum nigrum L. inhibă creșterea celulară a hepatocarcinomului prin inducerea opririi și apoptozei în fază G2 / M
J Sci Food Agric, 91 (2011), pp. 178-185
31
ZF Cao Efect de curățare a tetranrinei de radicali activi de oxigen
Planta Med, 62 (1996), pp. 413-414
32
ST Lin, Y. Wang, Y. Xue, DC Feng, Y. Xu, LY Xu Tetrandrina suprimă activarea astrocitelor indusă de LPS prin intermediul căii de semnalizare modulatoare IKKs-IkappaBalpha-NF-kappaB
Mol Cell Biochem, 315 (2008), pp. 41-49
33
BS Teh, P. Chen, MF Lavin, WK Seow, YH Thong Demonstrarea inducerii apoptozei (moartea programată a celulelor) de tetranrină, un nou agent antiinflamator
Int J Immunopharmacol, 13 (1991), pag. 1117-1126
34
JH Lee, GH Kang, KC Kim, KM Kim, DI Park, BT Choi și colab. Tulburarea ciclului celular indusă de tetranrină și apoptoza în celulele carcinomului pulmonar uman A549
Int J Oncol, 21 (2002), pp. 1239-1244
35
C. Liu, K. Gong, X. Mao, W. Li Tetrandrin induce apoptoza prin activarea speciilor reactive de oxigen și reprimând activitatea Akt în carcinomul hepatocelular uman
Int J Cancer, 129 (2011), pp. 1519-1531
36
X. Li, H. Xu, X. Dai, Z. Zhu, B. Liu, X. Lu îmbunătățită in vitro și in vivo eficacitatea terapeutica a nanoparticulelor incarcate-codrug impotriva cancerului de ficat
Int J Nanomedicine, 7 (2012), pp. 5183-5190
37
K. Gong, C. Chen, Y. Zhan, Y. Chen, Z. Huang, W. Li Autofagia 7 (ATG7) și speciile reactive de oxigen / kinază reglată de semnal extracelular reglează autofagia indusă de tetranrină în carcinomul hepatocelular uman
J Biol Chem, 287 (2012), pp. 35576-35588
38
L. Ji, T. Liu, J. Liu, Y. Chen, Z. Wang Andrografolidul inhibă creșterea Hep3B derivată din hepatomul uman prin activarea kinazei c-Jun N-terminale
Planta Med, 73 (2007), pp. 1397-1401
39
L. Ji, K. Shen, J. Liu, Y. Chen, T. Liu, Z. Wang Glutationul intracelular reglează citotoxicitatea indusă de andrografolidă pe hepatoamele celule Hep3B
Redox Rep, 14 (2009), pp. 176-184
40
J. Li, HY Cheung, Z. Zhang, GK Chan, WF Fong andrografolidă induce oprirea ciclului celular la G 2 / M faza si moartea celulelor din celulele HepG2 prin alterarea speciilor reactive de oxigen
Eur J Pharmacol, 568 (2007), pp. 31-44
41
L. Ji, K. Shen, P. Jiang, G. Morahan, Z. Wang Rolul critic al homeostazei celulare glutation și activarea jnk în moartea celulelor apoptotice mediate de andrografolid în celulele hepatomului uman
Mol Carcinog, 50 (2011), pp. 580-591
42
WM Fu, JF Zhang, H. Wang, HS Tan, WM Wang, SC Chen și colab. Apoptoza indusă de 1,3,6,7-tetrahidroxanton în carcinomul hepatocelular și analiza proteomică
Apoptoza, 17 (2012), pp. 842-851
43
QL Guo, QD Tu, ZQ Wu, ST Yuan, L. Zhao Acizii gambogici generali au inhibat creșterea in vitro ahepatomului uman SMMC-7721 și a șoarecilor nudi
Acta Pharmacol Sin, 25 (2004), pp. 769-774
44
JS Chang, LC Chiang, FF Hsu, CC Lin Chemoprevenție împotriva carcinomului hepatocelular de Cornus officinalis in vitro
Am J Chin Med, 32 (2004), pag. 717-725
45
BB Aggarwal, B. Sung Baza farmacologică pentru rolul curcuminei în bolile cronice: un condiment vechi cu ținte moderne
Trends Pharmacol Sci, 30 (2009), pag. 85-94
46
BB Aggarwal, KB Harikumar Efectele terapeutice potențiale ale curcuminei, agentului antiinflamator, împotriva bolilor neurodegenerative, cardiovasculare, pulmonare, metabolice, autoimune și neoplazice
Int J Biochem Cell Biol, 41 (2009), pp. 40-59
47
WZ Wang, J. Cheng, J. Luo, SM Zhuang ABROGAREA G 2 stop / M sensibilizează celulele hepatoma rezistente la curcumin la apoptoza
FEBS Lett, 582 (2008), pp. 2689-2695
48
J. Cao, Y. Liu, L. Jia, HM Zhou, Y. Kong, G. Yang și colab. Curcumina induce apoptoza prin hiperpolarizarea mitocondrială și deteriorarea mtADN în celulele G2 ale hepatomului uman
Radic gratuit Biol Med, 43 (2007), pp. 968-975
49
J. Xiao, Y. Chu, K. Hu, J. Wan, Y. Huang, C. Jiang și colab. Sinteza și analiza biologică a unui nou analog de curcumină pentru o activitate antitumorală îmbunătățită în celulele HepG2
Oncol Rep, 23 (2010), pp. 1435-1441
50
MK Bae, SH Kim, JW Jeong, YM Lee, HS Kim, SR Kim și colab. Curcumina inhibă angiogeneza indusă de hipoxie prin reglarea în jos a HIF-1
Oncol Rep, 15 (2006), pp. 1557-1562
51
SE Chuang, ML Kuo, CH Hsu, CR Chen, JK Lin, GM Lai și colab. O dietă conținând curcumină inhibă hepatocarcinogeneza murină indusă de dietilnitrosamină
Carcinogenesis, 21 (2000), pp. 331-335
52
L. Ning, L. Wentworth, H. Chen, SM Weber Reglarea în jos a semnalizării de notch1 inhibă creșterea tumorilor în carcinomul hepatocelular uman
Am J Transl Res, 1 (2009), pp. 358-366
53
P. Yoysungnoen, P. Wirachwong, C. Changtam, A. Suksamrarn, S. Patumraj Efectele anticanceroase și antiangiogenice ale curcuminei și tetrahidrocurcuminei asupra carcinomului hepatocelular implantat la șoareci nudi
World J Gastroenterol, 14 (2008), pp. 2003-2009
54
F. Yang, T. Zhang, Y. Ito Separarea pe scară largă a resveratrolului, anthraglicozidului A și anthraglicozidului B din Polygonum cuspidatum Sieb. et Zucc prin cromatografie în contra-curent de mare viteză
J Chromatogr A, 919 (2001), pag. 443-448
55
M. Athar, JH Back, L. Kopelovich, DR Bickers, AL Kim Obiective moleculare multiple ale resveratrolului: mecanisme anti-cancerigene
Arch Biochem Biophys, 486 (2009), pp. 95-102
56
G. Notas, AP Nifli, M. Kampa, J. Vercauteren, E. Kouroumalis, E. Castanas Resveratrol exercită efectul antiproliferativ asupra celulelor carcinomului hepatocelular HepG2 prin inducerea stopării ciclului celular și activării NOS
Biochim Biophys Acta, 1760 (2006), pp. 1657-1666
57
G. Michels, W. Wätjen, N. Weber, P. Niering, Y. Chovolou, A. Kampkötter, et al. Resveratrolul induce moartea celulelor apoptotice la hepatoame H4IIE de șobolan, dar necroza în celulele gliomului C6
Toxicology, 225 (2006), pp. 173-182
58
CB Yeh, MJ Hsieh, CW Lin, HL Chiou, PY Lin, TY Chen și colab. Efectele antimetastatice ale resveratrolului asupra carcinomului hepatocelular prin reglarea în jos a proteazei asociate metastazei prin modularea SP-1
PLoS One, 8 (2013), p. e56661
59
MC Wu Medicina chineza traditionala in prevenirea si tratamentul cancerului hepatic: functie, statut si probleme existente
Zhong Xi Yi Jie El Xue Bao, 1 (2003), pp. 163-164
[Articol în limba chineză]
60
G. Deng, BR Cassileth, KS Yeung Terapii complementare pentru simptome legate de cancer
J Suport Oncol, 2 (2004), pp. 419-426
61
BK Piao, YX Wang, GR Xie, U. Mansmann, H. Matthes, J. Beuth și colab. Impactul tratamentului extractului de vâsc complementar asupra calității vieții la pacienții cu cancer mamar, ovarieni și non-mici cu cancer pulmonar. Un studiu prospectiv clinic randomizat controlat
Anticancer Res, 24 (2004), pp. 303-309
62
Z. Wang, G. Zhang, J. Wu, M. Jia Terapia adjuvantă pentru carcinomul hepatocelular: situația actuală și perspectiva
Drug Discov Ther, 7 (2013), pp. 137-143
Rolul preventiv și terapeutic al medicamentului tradițional chinezesc pe bază de plante în carcinomul hepatocelular
Open Access funded by Chinese Medical Association
Under a Creative Commons license

Conflicts of interest: The authors declare that there are no conflicts of interest related to the subject matter or materials discussed in this article.

Răspuns terapeutic al carcinomului hepatocelular netratabil după aplicarea modulatorilor imunitari InterLeukin-2, BCG(Bacillus Calmette Guerin) și melatonină

SCOP:

Aplicarea imunoterapiei la un pacient cu carcinom hepatocelular netratabil.

RAPORT DE CAZ:

Pacientul a avut o tumoare de 60 mm în ficat. Diagnosticul anato-patologic a fost adenom. Cu toate acestea, după intervenția chirurgicală a tumorii, au apărut șapte leziuni noi, arătând că tumora inițială a fost un carcinom hepatocelular. În plus, atunci când adenomii hepatocelulari cresc până la o dimensiune mai mare de 6-8 cm, ei sunt considerați canceroși și astfel devin un risc pentru carcinomul hepatocelular. Pacientul a fost tratat cu interleukină-2(IMUNOMODULATOR), Bacillus Calmette Guerin(VACCIN IMUNITAR ) și melatonină.

REZULTATE:

În timpul tratamentului, nivelele de alfa-fetoproteină din sânge au scăzut de la 5.000 UI / ml la zero, la care nivel a rămas în perioada de urmărire de doi ani.

Nu a fost detectată nicio tumoare la RMN și CT. 

La șase ani de la diagnosticarea carcinomului hepatocelular netratabil, pacientul rămâne în stare bună.

CONCLUZIE:

În acest caz, terapia combinată imunomodulatoare a fost eficientă.

Pentru pacienții cu tumori metastazate ale ficatului care nu sunt potriviți pentru terapia alopata, imunomodularea poate întârzia progresia tumorii, poate induce regresia tumorii sau chiar poate fi curativă la unii pacienți.

Abordările imunoterapeutice combinate cu metodele alopate pentru tratamentul carcinomului hepatocelular pot fi în măsură să îmbunătățească eficacitatea terapeutică.

PMID: 24123026

 

https://www.ncbi.nlm.nih.gov/pubmed/24123026

Informații despre autor

1
Departamentul de Urologie, VUmc, Amsterdam, Olanda. W.denotter@VUmc.nl; W.den.otter@live.nl.