Arhive etichetă | coronavirus

Aplicarea albastru de metilen , vitamina C , N-acetil cisteină pentru tratamentul pacienților bolnavi COVID-19 în stare critica, raport al unui studiu clinic de fază I.

COVID-19 este un eveniment catastrofal global care provoacă sindrom respirator acut sever. Mecanismul bolii rămâne neclar, iar hipoxia este una dintre principalele complicații. În prezent, nu există un protocol aprobat pentru tratament. Amenințarea microbiană indusă de COVID-19 determină activarea macrofagelor pentru a produce o cantitate imensă de molecule inflamatorii și oxid nitric (NO). Activarea populației de macrofage într-un fenotip proinflamator induce un ciclu de auto-întărire. Stresul oxidativ și NO contribuie la acest ciclu, stabilind o stare inflamatorie în cascadă care poate ucide pacientul. Întreruperea acestui ciclu vicios printr-un remediu simplu poate salva viața pacienților critici.

Nitrit, azotat (metaboliții NO), methemoglobină,și nivelurile echilibrului prooxidant-antioxidant au fost măsurate la 25 de pacienți ICU COVID-19 și la 25 de persoane sănătoase. Ca ultimă opțiune terapeutică, la cinci pacienți li s-a administrat albastru de metilen-vitamina C si N-acetil cisteină (MCN).

Nitriții, nitrații, methemoglobina și stresul oxidativ au crescut semnificativ la pacienți în comparație cu persoanele sănătoase.

Patru din cei cinci pacienți au răspuns bine la tratament.

În concluzie, Oxidul Nitric, methemoglobina și stresul oxidativ pot juca un rol central în patogeneza bolii critice COVID-19. Tratamentul cu MCN pare să crească rata de supraviețuire a acestor pacienți. Luând în considerare ciclul vicios al activării macrofagelor care duce la NO mortal, stres oxidativ și sindromul cascadei de citokine; efectul terapeutic al MCN pare a fi rezonabil. În consecință, a fost conceput un studiu clinic mai amplu.Trebuie remarcat faptul că protocolul folosește medicamente ieftine pe care FDA le-a aprobat pentru alte boli.

NUMĂR ÎNREGISTRARE ÎNCERCARE: NCT04370288.

Obțineți PDF cu LibKey

1. Introducere

Răspândirea rapidă a mortalului COVID-19 cauzată de SARS-CoV-2 este în prezent un coșmar pentru toată lumea. COVID-19 este responsabil pentru această boală pandemică catastrofală. OMS a raportat că 14% dintre pacienții infectați au boli severe și necesită spitalizare, 5% dintre pacienții infectați au afecțiuni foarte severe și necesită internare în terapie intensivă (în special pentru ventilație) și 4% dintre pacienții infectați mor ( Grech, 2020 ).

S-au făcut eforturi uriașe pentru găsirea fiziopatologiei și tratamentul bolii critice COVID-19. Au fost sugerate multe proceduri terapeutice, cu puțin succes. Nu există un protocol global aprobat pentru tratamentul pacienților cu afecțiuni critice care să ducă la o rată de supraviețuire foarte scăzută și la un tratament prelungit în terapia intensivă. Acest lucru adesea nu are succes în îngrijirea ICU, provoacă o povară mare pentru sistemele de sănătate, chiar și în cele mai dezvoltate și bogate țări. Mecanismul exact al leziunii țesuturilor rămâne neclar, iar managementul pacienților subliniază în principal furnizarea de îngrijire de susținere, de exemplu, oxigenare, ventilație și terapie cu fluide ( Galluccio și colab., 2020). A better understanding of the pathogenesis of the critical disease state is crucial to develop rationale-based clinical therapeutic strategies and to determine which subsets of patients are at high risk of the severity of the disease. It is critical to start measuring factors involved in the pathways of disease which can be modulated by the different therapies currently used as a standard of care or in clinical trials.

SARS-CoV-2 determină activarea macrofagelor pentru a produce o cantitate imensă de molecule inflamatorii, care sindromul furtunii de citokine este principala cauză a decesului la pacienții cu COVID-19 ( Alunno și colab., 2020 ). De asemenea, se știe în alte boli că supraproducția de oxid nitric inductibil (iNO) ( Miclescu și Wiklund, 2010 ) și speciile de oxigen reactiv (ROS) ( Shehat și Tigno-Aranjuez, 2019 ) se întâmplă la activarea macrofagelor, ceea ce duce la un ciclu vicios. activării macrofagelor pentru supraproducția de citokine ( Wang și Ma, 2008 ).

Ar putea NO și stresul oxidativ să joace un rol central în creșterea hipoxiei, care este una dintre principalele complicații la pacienții cu COVID-19? Ar putea fi întrerupt acest ciclu vicios de NO și ROS folosind o terapie eficientă și intensă anti-NO și anti-oxidant?

În medicină, albastrul de metilen (MB, forma oxidată, culoare albastră), dar nu și forma redusă (LMB: albastru de leucometilen, incolor), a fost utilizat în diferite boli, cum ar fi malaria, chirurgia, ortopedia, infecțiile bacteriene, virale și et. cetera ( Hamidi Alamdari și colab., 2020 ).

Un motiv probabil pentru hipoxie la pacienții cu COVID-19 este methemoglobinemia care rezultă din oxidarea fierului conținut în hemoglobină de la forma feroasă la cea ferică. Oxidarea este asociată cu o scădere a capacității hemoglobinei de a transporta oxigenul ( Hamidi Alamdari și colab., 2020 ).

În acest studiu, nitritul, nitrații (metaboliții NO), methemoglobina (met-Hb) și echilibrul prooxidant-antioxidant (PAB) au fost considerați ca factori care implică intensificarea hipoxiei la pacienții cu terapie intensivă. Cinci pacienți cu COVID 19 bolnavi critici, după îngrijiri standard, caracterizați ca fiind în stadiul final de către medicii lor, au fost administrați cu MB, vitamina C și N-acetil cisteină ca terapie de compasiune și incluși într-un studiu clinic mai amplu, care este deja ruleaza/ in desfasurare

2. Material și metode

Acest studiu a fost efectuat la Universitatea de Științe Medicale din Mashhad, Mashhad, Iran în 2020, după aprobarea comitetului de etică (  identificator ClinicalTrials.gov : NCT04370288; 19 aprilie 2020) și luând consimțământul scris în cunoștință de cauză. De asemenea, studiul clinic a fost aplicat pentru înregistrare în IRCT (Trial Id 49.767).

Acest studiu efectuat pe 25 de persoane sănătoase și 25 de pacienți cu pneumonie COVID-19 care au fost admiși la ICU cu Pa02 / Fi02 <200. Pentru toate locurile pacienților au fost măsurate gazele sanguine, CBC, LDH, CRP și tomografia computerizată de înaltă rezoluție ( HRCT) s-a făcut.

2.1. Măsurarea nitritului, azotatului în probele de plasmă

NO, datorită duratei sale scurte de viață (câteva milisecunde), a fost determinat pe baza cantității de produse de oxidare: nitrit și azotat. Nitriții și nitrații au fost măsurați în conformitate cu metodele descrise de Yegın care au folosit testul de reacție Griess pentru probele de plasmă ( Yegın și colab., 2015 ).

2.2. Met-Hb

Sângele proaspăt a fost colectat folosind EDTA-K2 ca anticoagulant și transferat în laborator pe gheață. Met-Hb a fost măsurat conform metodei descrise de Sato ( Sato și colab., 1981 ).

2.3. PAB

PAB a fost măsurat în conformitate cu metoda descrisă de Alamdari DH ( Alamdari și colab., 2007 ).

2.4. Pacienți cu studii clinice

Ca ultimă opțiune terapeutică, cinci din 25 de pacienți ICU COVID-19 au fost recrutați în studiile clinice și în tratamentul cu MCN. 

Pacienților li s-a administrat MB (1 mg / kg) împreună cu vitamina C (1500 mg / kg) și N-acetil cisteină (1500 mg / kg) pe cale orală sau intravenoasă, așa cum este descris pentru fiecare caz.

2.5. Criteriile studiilor clinice

Criteriile de incluziune au fost: Cazul confirmat de Covid-19 (prin RT-PCR pe tamponul nazofaringian colectat sau caracteristicile clinice și HR-CT) și vârsta peste 18 ani. Criteriile de excludere au fost: antecedente de deficit de G6PDH, insuficiență renală severă, ciroză, hepatită cronică activă, pacienți cu antecedente de reacție alergică la MB, tratament cu agenți imunosupresori și femeile însărcinate sau care alăptează.

3. Rezultate

Caracterizările demografice ale pacienților și ale persoanelor sănătoase, precum și rezultatele de laborator sunt prezentate în  Tabelul 1 . Datele pacienților înainte și după tratamentul cu albastru de metilen sunt prezentate în  Tabelul 2 .

Tabelul 1. Caracterizări demografice ale pacienților, indivizilor sănătoși (HI) și rezultatelor de laborator.

HI (n = 25)Grup de pacienți (n = 25) Valoarea P
Vârsta (ani)56,6 ± 11,459,9 ± 13,60,22
Masculin Feminin12/1314.110,74
NO2   (μmol / l)7,6 ± 3,910,7 ± 7,90,01  a
NO3   (μmol / l)22,4 ± 15,344,7 ± 30,10,002  a
Met-Hb (%)2,5 ± 0,916,4 * ± 9,10,0001  a
PAB (HK)35,8 ± 15,388,4 * ± 28,40,0001  a
CRP (mg / dl)8,7 ± 4,594,3 * ± 49,50,0001  a
LDH (U / l)251,6 ± 139,91036,6 * ± 348,80,0001  a

Datele sunt prezentate ca medie ± SDa

A existat o diferență semnificativă între pacienți și HI ( p  <0,05).

Tabelul 2. Datele a 4 pacienți înainte și după tratament.

Înainte de tratament (n = 4)După tratament (n = 4) Valoarea P
NO2   (μmol / l)2,8 ± 13,17,0 ± 1,40,009  a
NO3   (μmol / l)68,2 ± 44,740,7 ± 25,20,05  a
Met-Hb (%)14,7 ± 2,24,5 ± 0,50,001  a
PAB (HK)90,5 ± 6,451,7 ± 21,70,001  a
CRP (mg / dl)99,0 ± 31,017,7 ± 2,90,005  a
LDH (U / l)859,75 ± 219,6245,0 ± 100,70,002  a

Datele sunt prezentate ca medie ± SDa

A existat o diferență semnificativă între pacienți și HI ( p  <0,05).

3.1. Cazul 1

1.

La 13 aprilie 2020, un bărbat în vârstă de 49 de ani a fost internat la ICU din cauza febrei, a nivelului scăzut de conștiență, a scăzut SPO2 și a secreției traheale foarte purulente. La internare, pacientul avea RASS -4 (Richmond Agitation Sedation Score), și sub ventilație mecanică cu febră, tahicardie, SPO2 86-88%. Tensiunea sa arterială era în limitele normale.

Nu a avut comorbiditate în istoricul său medical trecut 3.

Pacientul a fost internat anterior pe 15 februarie 2020, la o altă terapie intensivă, din cauza cefaleei, tusei, mialgiei, febrei și dispneei care au început cu 14 zile înainte de internare.

HRCT pulmonar a relevat opacități bilaterale difuze de sticlă macinată (GGO) și consolidare în regiunile pulmonare periferice. Au fost implicați atât lobii superiori, cât și cei inferiori.

WBC: 16 × 103 / μl cu 88% neutrofile și 3,6% limfocite, număr de trombocite: 221 × 103 / μl, LDH: 906 UI / l, CRP: 82 mg / dl, D-dimer: 2078 ng / ml, bilirubină totală : 2 mg / dl, AST: 134 UI / l și ALT: 89 UI / l. RT-PCR a fost pozitiv pentru SARS-CoV-2.6.

El a fost tratat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și meropenem 1 gr TDS.7.

Traheostomia a fost făcută din cauza perioadei lungi de intubație.

Cultura secreției traheale a relevat microorganisme cu rezistență multiplă, cum ar fi Acinetobacter și Pseudomonas.

După trei zile, din cauza suferinței respiratorii progresive, Kaletra (lopinavir / ritonavir, 200/50 mg) și hidrocortizon au fost adăugate la protocolul de tratament.10.

Nitriții și nitrații, met-Hb și PAB au fost de 10,2 μmol / l, 35,1 μmol / l, 14% și respectiv 95 HK.

Pe 24 mai 2020, din cauza unui răspuns slab la antibiotice după 45 de zile și a eșecului de înțărcare, am început să administrăm MB orală (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) în 100 ml dextroză pentru de două ori pe zi.12.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.13.

În aceeași zi de administrare a MB, pacientul a fost decanulat și traheostomia a fost îndepărtată și oxigenoterapia a fost începută cu o mască de sac de rezervă.

Terapia cu antibiotice a fost continuată și a început dexametazona (8 mg QID).

A doua zi după începerea terapiei MB, pacientul a avut un volum mare de secreție traheală de la locul traheostomiei, dar SPO2 a fost de 90-92% la oxigenul cu flux mare.16.

În a doua și a treia zi după începerea terapiei MB, pacientul s-a îmbunătățit semnificativ și SPO2 la 96 printr-o mască simplă.

Din a patra zi după terapia MB, dexametazona a fost redusă și conștiința pacientului a fost îmbunătățită, secreția traheală a scăzut, dar pacientul a avut un grad scăzut de febră.

În a șasea zi după începerea albastrului de metilen, terapia cu oxigen a fost întreruptă.

În a douăzeci și treia zi, el a fost externat din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 6,6 μmol / l, 24,30 μmol / l, 4% și respectiv 62 HK.

3.2. Cazul 2

1.

La 7 mai 2020, o femeie în vârstă de 64 de ani a fost internată în ATI din cauza nivelului scăzut de conștiență și al suferinței respiratorii. Ea a fost imediat intubată.

A avut în trecut un istoric medical de depresie3.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a prezentat o formă moderată a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

HRCT pulmonar a dezvăluit opacități de sticlă macinată (GGO) în plămânul stâng.

WBC: 12 × 103 / μl cu 78% neutrofile și 12,5% limfocite, număr de trombocite: 196 × 103 / μl, LDH: 670 UI / l, CRP: 79 mg / dl, D-dimer:> 5000 ng / ml, total bilirubină: 1 mg / dl, AST: 116 UI / l și ALT: 76 UI / l și SPO2 96%. RT-PCR a fost pozitiv pentru SARS-CoV-2.6.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.7.

Nitriții și nitrații, met-Hb și PAB au fost de 17 μmol / l, 24,3 μmol / l, 16% și, respectiv, 84 HK.

La 11 mai 2020, MB (1 mg / kg / ) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și administrate prin tub nazogastric q12 h timp de 7 zile.

Nu au existat efecte secundare și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.10.

În a doua zi, după terapia MB, pacientul a fost afebril.

În a cincea zi de terapie MB, pacientul a fost întrerupt de la ventilație mecanică și extubat.12.

În a noua zi, a fost externată din UCI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 8,5 μmol / l, 18,9 μmol / l, 5% și respectiv 53 HK.

3.3. Cazul 3

1.

La 1 mai 2020, o femeie în vârstă de 60 de ani a fost internată în UTI din cauza febrei și a suferinței respiratorii.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a avut o formă moderată a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

A avut în trecut un istoric medical de diabet zaharat.

HRCT pulmonar a dezvăluit opacități bilaterale de sticlă macinată (GGO) .5.

WBC: 8,9 × 10 3 / μl cu 79% neutrofile și 13% limfocite, număr de trombocite: 275 × 10 3 / μl, LDH: 712 UI / l, CRP: 90 mg / dl, D-dimer: 1508 ng / ml, bilirubină totală: 1,8 mg / dl, AST: 125 UI / l și ALT: 95 UI / l. RT-PCR a fost negativ pentru SARS-CoV-2.6.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.7.

Nitriții și nitrații, met-Hb și PAB au fost de 12 μmol / l, 109,2 μmol / l, 12% și, respectiv, 86 HK.

La 4 mai 2020, MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) în 100 ml dextroză au fost injectate intravenos timp de 30 de minute și au continuat la fiecare 12 ore timp de 2 zile.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.10.

În a doua zi, după terapia MB, SPO2 a crescut de la 84% la 93% după ce pacientul a fost supus terapiei cu oxigen printr-o mască simplă.

În a patra zi de terapie MB, pacientul a fost externat din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost de 7,8 μmol / l, 74,5 μmol / l, 5% și respectiv 71 HK.

3.4. Cazul 4

1.

La 22 aprilie 2020, un bărbat de 66 de ani a fost internat în secția internă a spitalului din cauza febrei și a suferinței respiratorii.

Nu avea antecedente medicale anterioare ale bolii.

HRCT pulmonar a relevat opacități bilaterale difuze de sticlă macinată (GGO) și consolidare.

WBC: 5,4 × 10 3 / μl cu 59% neutrofile și 34% limfocite, număr de trombocite: 154 × 10 3 / μl, LDH: 906 UI / l, CRP: 124 mg / dl, D-dimer: 1405 ng / ml, bilirubină totală: 0,6 mg / dl, AST: 37 UI / l și ALT: 92 UI / l, SPO2 88%. RT-PCR a fost pozitiv pentru SARS-CoV-2.5.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), hidroxiclorochină (400 mg stat și 200 mg BD) și ceftriaxonă 1 gr BD.6.

După trei zile, din cauza suferinței respiratorii progresive, Ribavirin, Kaletra și dexametazonă au fost adăugate la protocolul de tratament.

După patru zile de internare, pacientul a fost transferat la UCI și a primit o singură dată terapie cu plasmă.

La o săptămână după terapia cu plasmă, starea de oxigenare a pacientului sa înrăutățit (SPO2 59% cu ventilație neinvazivă și 100% FIO2) 9.

Nitriții și nitrații, met-Hb și PAB au fost de 45,1 μmol / l, 89,2 μmol / l, 22% și respectiv 100 HK.

MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și prescrise intravenos. Înainte de injectare, SPO2 era de 54%, iar după 30 de minute de injectare, SPO2 se îmbunătățea la 74% și durează 12 ore. Din cauza limitărilor neașteptate pentru prepararea albastrului de metilen, medicamentul nu a fost continuat.

Nu a existat niciun efect secundar și o reacție alergică.

În a doua zi, acest pacient a întâmpinat șoc septic sever, insuficiență multi-organ și a decedat Acest scenariu se poate datora unei doze tardive și incomplete de albastru de metilen.

3.5. Cazul 5

1.

La 13 mai 2020, o femeie în vârstă de 75 de ani a suferit o operație de urgență pentru grefa de bypass a arterei coronare și două zile mai târziu a prezentat o scădere a SPO2 și a suferinței respiratorii.

Pe baza criteriilor lui  Yang și colab. (2020) , pacientul a prezentat o formă severă a bolii datorită prezenței febrei, simptomelor respiratorii și semnelor radiologice ale pneumoniei.

HRCT pulmonar a dezvăluit opacități de sticlă macinată (GGO). Avea o combinație de consolidare și GGO-uri. Distribuția anomaliilor a fost bilaterală în regiunile pulmonare subpleurale. Au fost implicați atât lobii superiori, cât și cei inferiori.

A avut antecedente medicale de diabet și hipertensiune.

WBC: 8,9 × 10 3 / μl cu 80% neutrofile și 12,6% limfocite, număr de trombocite: 276 × 10 3 / μl, LDH: 1151 UI / l, CRP: 145 mg / dl, D-dimer: 1374 ng / ml, bilirubină totală: 1,5 mg / dl, AST: 115 UI / l și ALT: 90 UI / l. RT-PCR a fost negativ pentru SARS-CoV-2.6.

Pe 15 mai 2020, s-a transferat la ICU, avea o hemodinamică stabilă. SPO2 a fost 65-68% fără oxigenoterapie și 78-80% cu oxigenoterapie printr-o pungă de rezervă.7.

După declararea ventilației neinvazive (NIV) SPO2 a ajuns la 87-88% .8.

Tratamentul a fost inițiat cu azitromicină (500 mg / zi), lopinavir / ritonavir (200/50 mg, 2 comprimate × bid), hidroxiclorochină (400 mg stat), heparină 5000 UI (qidintravenos)., Hidrocortizon (doza inițială 100 mg TDS, în ultimul timp conic) și a continuat timp de cinci zile.9.

Nitriții și nitrații, met-Hb și PAB au fost de 13,5 μmol / l, 104,3 μmol / l, 17% și, respectiv, 97.10.

Pe 16 mai 2020, MB (1 mg / kg) vitamina C (1500 mg), N-acetil cisteină (2gr) au fost adăugate în 100 ml dextroză și prescrise pe cale orală.

Nu a existat niciun efect secundar și o reacție alergică. După 8-12 ore culoarea urinei a devenit albastră sau verde.12.

Datorită operației cardiace și a leucocitozei, a fost administrat antibioticul profilactic.

În prima zi, după terapia MB, nu a existat nicio modificare semnificativă în SPO214.

În a doua zi de terapie MB SPO2 a crescut și durata ventilației neinvazive (VNI) a scăzut.

În a patra zi de terapie MB, pacientul nu avea nevoie de NIV, iar SPO2 a fost de 80-82% fără oxigenoterapie și a ajuns la 97-99% cu oxigenoterapie.16.

În a cincea zi de terapie MB, pacientul nu avea nevoie de oxigenoterapie și SPO2 era de 90-92% și era complet treaz și a început hrănirea orală.17.

În a șaptea zi, a fost externată din ATI.

După tratamentul cu MCN, nitriți și nitrați, met-Hb și PAB au fost 5,1 μmol / l, 45,2 μmol / l, 4% și, respectiv, 21.

4. Discutie

Acest studiu a arătat că nitritul, nitrații, met-Hb și stresul oxidativ sunt semnificativ crescute la pacienți în comparație cu persoanele sănătoase. Acest lucru este compatibil cu procesul inflamator și activarea macrofagelor care au fost observate în boala COVID 19 ( Alunno și colab., 2020 ;  Wang și Ma, 2008 ).

Motivul pentru luarea în considerare a acestor factori implicați în fiziopatologia inducerii hipoxiei sunt următoarele: 1

Amenințarea microbiană este indusă de coronavirus care determină activarea macrofagelor pentru a produce o cantitate imensă de mediatori inflamatori și alte molecule, cum ar fi oxidul azotic (NO). NO acționează ca agent pro-inflamator și antiinflamator, în funcție de cantitatea de NO generată și de sursa sa ( Kobayashi și Murata, 2020 ). Este documentat faptul că oxidul nitric sintază inducibil de macrofage (iNOS) circulă inflamația ( Wang și colab., 2018 ). Se raportează că, după administrarea de citokine, niveluri crescute de nitriți au fost detectate în multe boli, cum ar fi sepsis, colită ulcerativă, artrită, scleroză multiplă și diabet de tip I ( Hibbs și colab., 1992 ). De asemenea, se produce NO excesiv în timpul unei varietăți de boli inflamatorii (Clancy și Abramson, 1995 ). Se raportează că există un rol cheie pentru monocite și macrofage pentru inflamația patologică; și există o discuție în curs de desfășurare cu privire la strategiile terapeutice prospective de modulare a activării macrofagelor la pacienții cu COVID-19 ( Merad și Martin, 2020 ) .2

Rezultatele noastre au arătat creșterea nivelului de nitriți și nitrați ai sângelui la pacienții cu COVID-19. Oxidul azotic sintază inductibil de macrofage (iNOS) poate fi indus de 2 până la 3 ordine de mărime în urma inflamației care eliberează cantități mari de NO ducând la creșteri locale și sistemice de nitriți. ( Kleinbongard și colab., 2003 ) .3

Rezultatele noastre au arătat, de asemenea, niveluri crescute de stres oxidativ la pacienții cu COVID-19. NU este una dintre resursele majore ale stresului oxidativ / nitrosativ. NU poate reacționa cu specii reactive de oxigen, cum ar fi superoxidul (O2 • – ), pentru a forma peroxinitrit (ONOO  ), o specie foarte reactivă care dăunează celulelor. Pe de altă parte, coagulopatia asociată COVID-19 este raportată ca apariție a evenimentelor trombotice venoase și arteriale, inclusiv tromboza venoasă profundă (TVP), embolie pulmonară (PE), accident vascular cerebral ischemic, infarct miocardic (așa cum s-a observat probabil în cazul nostru de Nr. 5) și evenimente arteriale sistemice ( Becker, 2020). Oxidul nitric (NO), generat de iNOS, este considerat un mediator critic al anomaliilor coagulării și al disfuncției organelor. . S-a dovedit că inhibarea selectivă a iNOS este asociată cu atenuarea coagulării induse de sepsis și a disfuncției endoteliale. Reducerea stresului oxidativ / nitrosativ contribuie probabil la efectele benefice oferite de blocarea iNOS ( Matejovic și colab., 2007 ). Numeroase studii au arătat că atât formarea trombului, cât și liza cheagului său sunt reglementate de stresul oxidativ. După rezolvarea trombozei venoase profunde, D-dimerul va fi crescut, iar stresul oxidativ ar putea promova rezoluția ( Gutmann și colab., 2020 ). Am văzut stres oxidativ crescut și D-dimer în cazurile noastre

NO este oxidat rapid în nitrit în sânge de ceruloplasmină. Nitriții și nitrații sunt considerați ca markerul generării de NO și un produs final relativ inert al metabolismului NO ( Shiva și colab., 2006 ). Există o corelație semnificativă între CRP și nitriți în bolile inflamatorii. Se sugerează că măsurarea azotaților ar putea fi un instrument de diagnostic, precum și de prognostic, în timpul tratamentului acestei boli ( Ersoy și colab., 2002 ). De asemenea, am observat o creștere a nivelului de nitriți și CRP la pacienții probabil secundari pentru a crește stresul oxidativ

Nitritul trece prin membrana RBC. Se știe că anionul nitrit oxidează Hb la Met-Hb și degradează Hb, ceea ce a dus la creșterea hipoxiei, a bilirubinei și a fierului. Met-Hb joacă un rol central în inducerea unei hipoxii mai mari, iar corectarea Met-Hb poate fi un punct critic pentru tratament ( Vitturi și colab., 2009 ). În acest studiu, met-Hb a crescut semnificativ la pacienți în comparație cu persoanele sănătoase, ceea ce provoacă hipoxemie. Tratamentul pacienților cu MB a scăzut probabil nivelul met-Hb și ulterior nivelul de hipoxemie, așa cum am observat în rapoartele noastre de caz.6

În plus față de NO, stresul oxidativ duce și la oxidarea hemoglobinei (Fe 2+ ) la met-Hb (Fe 3+ ) ( Gutmann și colab., 2020 ). Rezultatele noastre au arătat creșterea stresului oxidativ și met-Hb la pacienți

Stresul oxidativ și inflamația interacționează simultan una cu cealaltă și le exacerbează efectele prin crearea unui ciclu vicios pentru agravarea bolilor prin supra-producția de oxigen și azot reactiv (ROS și RNS) care contribuie la deteriorarea organelor prin oxidare și nitrozare a diferitelor ținte biologice și componente ale celulei, inclusiv lipide, tioli, resturi de aminoacizi, baze ADN și antioxidanți cu greutate moleculară mică ( Yegın și colab., 2015). După cum am menționat, reducerea MB transformă forma de culoare albastră în una incoloră. După 8-12 ore de consum, am observat că culoarea urinei s-a transformat în albastru sau verde. Acest lucru arată probabil că agenții oxidanți din sânge oxidază forma redusă de MB (incoloră) la forma oxidată (culoare albastră). Această reacție chimică scade probabil stresul oxidativ și ulterior mediatorii inflamatori

Dovezile au arătat că persoanele în vârstă și cele cu condiții multi-morbide preexistente pot prezenta un risc mai mare de a dezvolta consecințe grave asupra sănătății din cauza COVID-19. „Oxi-inflam-îmbătrânire” se referă la fenomenul de inflamație cronică sistemică de grad scăzut care însoțește îmbătrânirea. Celulele în vârstă au o capacitate scăzută de a prolifera, ceea ce această celulă de senescență stimulează secreția de citokine pro-inflamatorii care provoacă inflamație cronică independentă de activarea celulelor imune. Această inflamație duce, de asemenea, la niveluri crescute de ROS și RNS, care ar putea induce stres oxidativ / nitrosativ. Stresul oxidativ / nitrosativ poate duce, de asemenea, la activarea căilor pro-inflamatorii în organism, contribuind la patogeneza multor boli legate de vârstă. Prin urmare, inflamația legată de vârstă agravează producția de NO (de către iNOS),care induce un stres puternic oxidativ / nitrosativ (Matsushita și colab., 2020 ).

În protocolul nostru recent sugerat ( Hamidi Alamdari și colab., 2020 ), am explicat în detaliu rațiunea utilizării MB, vitamina C și N-acetil cisteină pentru tratamentul pacienților în cadrul studiului clinic și vom explica alte motive în următoarele: (1)

Este documentat că MB are efecte inhibitorii directe asupra sintazelor de oxid nitric (NOS), atât constitutive, cât și inductibile, și previne acumularea de guanozin monofosfat ciclic (cGMP) prin inhibarea enzimei guanilat ciclază ( Miclescu și Wiklund, 2010 ). Într-un studiu clinic, este documentat că NO este un potențial mediator al modificărilor hemodinamice asociate cu sepsis. Efectul advers al NO asupra hemodinamiei poate fi parțial antagonizat de albastru de metilen, prin inhibarea enzimei guanilat ciclază ( Brown și colab., 1996 ). (2)

MB crește activitatea căii NADPH-methemoglobin reductazei lente în mod normal, care scade hipoxia prin reducerea met-Hb. O cantitate mică de met-Hb se formează întotdeauna, dar este redusă în interiorul eritrocitului de către aceste enzime: (1) citocrom-b5 reductază NADH, (2) NADPH-methemoglobin reductază. Unul dintre tratamentele FDA pentru methemoglobinemie este aplicarea MB (1-2 mg / kg IV peste 5-30 min) și alte tratamente sunt acidul ascorbic și glutationul redus ( McPherson, 2017 ). (3)

Nivelurile crescute de methemoglobină sunt secundare activității reduse (citocrom-b5 reductazei NADH ereditare sau dobândite) (A); în deficitul de homozigot NADH-citocrom-b5 reductază, nivelurile de met-Hb sunt de 10% –50% (cianotice). Concentrațiile de Met-Hb de 10% -25% nu pot da simptome aparente; nivelurile de 35% -50% duc la simptome ușoare, cum ar fi dispneea de efort și durerile de cap; iar nivelurile care depășesc 70% sunt probabil letale; (B) producția crescută de met-Hb poate fi indusă de medicamente sau agenți chimici precum nitriți, nitrați, clorați, chinone și compuși aromatici amino și nitro. 26  Nivelul mediu de met-Hb la cei 25 de pacienți cu terapie intensivă a fost crescut ( Tabelul 1 ). (4)

Am emis ipoteza ( Wang și Ma, 2008 ) că forma redusă de MB (Leucometilen: LMB) poate reduce, de asemenea, methemoglobinemia la pacienții cu COVID-19 prin aceste mecanisme: (A) Efect direct rapid: reducerea met-Hb (așa cum am văzut în cazul 4); (B) Scăderea stresului oxidativ: LMB, ca agent reducător, stinge ROS, cu toate acestea MB (forma oxidată) induce stresul oxidativ prin absorbția electronului (ca un radical liber) din alte molecule (NADH-H + , NADPH-H + , GSH) și apoi scade met-Hb prin mecanism enzimatic ( McPherson, 2017). Prin urmare, am folosit forma redusă de MB care nu putea induce stresul oxidativ. (C) Scăderea inflamației: Aceasta reduce stresul oxidativ și invers. Studiile clinice și experimentale au arătat, de asemenea, că MB scade inflamația ( Shehat și Tigno-Aranjuez, 2019 ). (5)

MB poate interzice efectul citopatic și reduce propagarea virusului ARN (cum ar fi poliovirusul) prin aceste moduri: (1) efect mecanic de MB ușor de pătruns, care ar putea ocupa competitiv site-urile celulare necesare pentru atașarea, penetrarea și / sau multiplicarea virusului; (2) Scăderea stresului oxidativ prin decuplarea oxidării și fosforilării; (3) efectul virucid al MB, o substanță lipofilă, prin intrarea în virus prin membrana lipidică și legarea de ARN ( Kovács, 1960 ). (6)

Proprietăți antibacteriene: MB a constituit baza chimioterapiei antimicrobiene – în special în zona antimalarică – și a familiilor de medicamente neuroleptice. Este utilizat într-un pansament antibacterian cu spumă pentru gestionarea rănilor cronice cu infecție locală ( Woo și Heil, 2017 ). (7)

MB este un puternic eliminator de oxigen care elimină rapid acest ion pentru a nu deteriora țesutul. Acest anion este produs în timpul ischemiei-reperfuziei în condiții precum infarctul miocardic acut și așa mai departe. ( Wülfert și colab., 2003 ). Un alt efect antioxidant al MB este blocarea enzimelor care conțin fier, cum ar fi xantina oxidaza, care împiedică producerea ROS ( Miclescu și Wiklund, 2010 ). (8)

MB previne activarea, aderența și agregarea trombocitelor prin inhibarea metabolismului acidului arahidonic din trombocite ( Miclescu și Wiklund, 2010 ). Acest lucru este foarte important la pacienții cu COVID-19, deoarece una dintre principalele complicații sunt evenimentele trombotice ( Becker, 2020 ).

5. Concluzie

Rezultatele preliminare ale acestui studiu clinic au arătat că tratamentul COVID-19 sever cu un amestec de MB, vitamina C și N-acetil cisteină este sigur și fezabil. MB redus are efecte rapide și întârziate. Efectul rapid crește SPO2% (Toți pacienții au primit 100% oxigen) prin reducerea met-Hb. Efectele întârziate sunt prin accelerarea normală a NADPH-methemoglobin reductazei, îmbunătățirea markerilor inflamatori, cum ar fi nivelul CRP și LDH, scăderea severității bolii care se poate datora și efectului antimicrobian. Vă sugerăm că timpul optim de administrare redusă cu albastru de metilen (LMB) ar trebui să fie înainte de a intra în pacient într-un stadiu foarte sever al bolii și implicarea și eșecul multi-organe.Este de părerea autorilor că rezultatele observate dacă sunt verificate la mai mulți pacienți și un studiu clinic multicentric randomizat ar putea reduce semnificativ mortalitatea infecției cu COVID-19 și durata medie a șederii ICU/ATI.

Aprobare etică

IR.MUMS.REC.1399.122;  Identificator Clinic  Trials.gov : NCT04370288; 19 aprilie 2020.

Informații de finanțare

Această lucrare a fost susținută de un grant de la Universitatea de Științe Medicale din Mashhad (numărul grantului:  990096 ). Brevetul a fost solicitat pentru o formulare specială (IR-139950140003002083), (1 iunie 2020, PCT).

Date de cercetare

Orice medic dorește să efectueze un studiu clinic randomizat ca studiu multicentric, autorii dornici să împărtășească experiențele lor și ultima actualizare a informațiilor lor.

Declarație de contribuție a autorului CRediT

Daryoush Hamidi Alamdari:  Conceptualizare, Curarea datelor, Analiza formală, Achiziționarea de fonduri, Investigație, Metodologie, Administrarea proiectelor, Resurse, Software, Supraveghere, Validare, Vizualizare, Scriere – schiță originală, Scriere – revizuire și editare.  Ahmad Bagheri Moghaddam:  Conceptualizare, conservarea datelor, analiză formală, investigație, metodologie, supraveghere, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Shahram Amini:  Conceptualizare, curatarea datelor, investigație, validare, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Mohammad Reza Keramati:  Conceptualizare, conservarea datelor, metodologie, scriere – schiță originală, scriere – recenzie și editare.  Azam Moradi Zarmehri: Conceptualizare, conservarea datelor, metodologie, scriere – schiță originală, scriere – recenzie și editare.  Aida Hamidi Alamdari: Curarea  datelor, investigații, metodologie, scriere – versiune originală, scriere – recenzie și editare.  Mohammadamin Damsaz: Curarea  datelor, metodologie, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Hamed Banpour:  Analiză formală, software, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  Amir Yarahmadi:  achiziționarea de fonduri, metodologie, validare, vizualizare, scriere – schiță originală, scriere – recenzie și editare.  George Koliakos:  Conceptualizare, Curarea datelor, Metodologie, Scriere – schiță originală, Scriere – recenzie și editare.

Declarație de interes concurent

Nu există conflicte de interese la toți autorii.

Mulțumiri

Autorii recunosc cu recunoștință tuturor asistentelor medicale ale spitalului Imam Reza pentru cooperarea lor excelentă.

Referințe

Alamdari și colab., 2007 D.H. Alamdari, K. Paletas, T. Pegiou, M. Sarigianni, C. Befani, G. Koliakos O nouă analiză pentru evaluarea echilibrului prooxidant-antioxidant, înainte și după administrarea de vitamine antioxidante în tipul II bolnavi de diabet Clin. Biochem., 40 (2007), pp. 248-254 Articol Descărcați PDF Vizualizați înregistrarea în Scopus Google Academic Alunno și colab., 2020 A. Alunno, F. Carubbi, J. Rodríguez-Carrio Storm, taifun, ciclon sau uragan la pacienți cu COVID-19? Feriți-vă de aceeași furtună care are o origine diferită RMD Open, 6 (2020), articolul e001295 CrossRef Google Scholar Becker, 2020 R.C. BeckerActualizare COVID-19: coagulopatie asociată cu Covid-19 J. Thromb. Thrombolysis, 1 (2020) Google Scholar Brown și colab., 1996 G. Brown, D. Frankl, T. Phang Infuzie continuă de albastru de metilen pentru șocul septic Postgrad. Med., 72 (1996), pp. 612-614 CrossRef View Record in Scopus Google Scholar Clancy și Abramson, 1995 R.M. Clancy, SB Abramson Oxidul nitric: un nou mediator al inflamației PSEBM (Proc. Soc. Exp. Biol. Med.), 210 (1995), pp. 93-101 Vizualizați înregistrarea în Scopus Google Scholar Ersoy și colab., 2002 Y. Ersoy, E. Özerol, Ö. Baysal, I. Temel, R. MacWalter, Ü. Meral, Z. AltayNivelul nitratului seric și al nitriților la pacienții cu poliartrită reumatoidă, spondilită anchilozantă și osteoartrită Ann. Rheum. Dis., 61 (2002), pp. 76-78 Vizualizați înregistrarea în Scopus Google Scholar Galluccio și colab., 2020 F. Galluccio, T. Ergonenc, AG Martos, AE-S. Allam, M. Pérez-Herrero, R. Aguilar, G. Emmi, M. Spinicci, IT Juan, M. Fajardo-Pérez Algoritm de tratament pentru COVID-19: un punct de vedere multidisciplinar Clin. Rheumatol., 1 (2020) Google Scholar Grech, 2020 V. Grech Necunoscute necunoscute – COVID-19 și potențială mortalitate globală Early Hum. Dev. (2020), p. 105026 Articol Descărcați PDF Google Scholar Gutmann și colab., 2020C. Gutmann, R. Siow, AM Gwozdz, P. Saha, A. Smith Specii reactive de oxigen în tromboza venoasă Int. J. Mol. Sci., 21 (2020), p. 1918 CrossRef Google Scholar Hamidi Alamdari și colab., 2020 D. Hamidi Alamdari, A. Bagheri Moghaddam, S. Amini, A. Hamidi Alamdari, M. Damsaz, A. Yarahmadi Aplicarea unui colorant redus utilizat în ortopedie ca tratament nou împotriva coronavirusului (COVID-19): un protocol terapeutic sugerat Arh. Bone Joint Surg., 8 (2020), pp. 291-294 Google Scholar Hibbs și colab., 1992 J. Hibbs, C. Westenfelder, R. Taintor, Z. Vavrin, C. Kablitz, R. Baranowski, J. Ward , R. Menlove, M. McMurry, J. KushnerDovezi pentru sinteza oxidului nitric inductibil de citokine de la L-arginină la pacienții care primesc terapie interleukină-2 The Journal of clinic research, 89 (1992), pp. 867-877 CrossRef View Record in Scopus Google Scholar Kleinbongard et al., 2003 P. Kleinbongard, A. Dejam, T. Lauer, T. Rassaf, A. Schindler, O. Picker, T. Scheeren, A. Gödecke, J. Schrader, R. Schulz Nitritul plasmatic reflectă activitatea constitutivă a oxidului nitric sintază la mamifere Radic liber. Biol. Med., 35 (2003), pp. 790-796 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Kobayashi și Murata, 2020 J. Kobayashi, I. MurataInhalarea oxidului nitric ca terapie de salvare intervențională pentru sindromul de detresă respiratorie acută indusă de COVID-19 Ann. Terapie intensivă, 10 (2020), pp. 1-2 CrossRef View Record în Scopus Google Scholar Kovács, 1960 E. Kovács Prevenirea efectului citopatic și propagarea poliovirusului prin albastru de metilen Z. Naturforsch. B Chem. Sci., 15 (1960), pp. 588-592 CrossRef View Record in Scopus Google Scholar Matejovic et al., 2007 M. Matejovic, A. Krouzecky, J. Radej, H. Kralova, P. Radermacher, I. Novak Coagulation și disfuncție endotelială în timpul bacteriemiei porcine hiperdinamice pe termen lung – efectele inhibării selective a oxidului nitric sintază inductibilăTromb. Haemostasis, 97 (2007), pp. 304-309 Vizualizare înregistrare în Scopus Google Scholar Matsushita și colab., 2020 K. Matsushita, N. Ding, M. Kou, X. Hu, M. Chen, Y. Gao, Y. Honda, D. Dowdy, Y. Mok, J. Ishigami Relația severității COVID-19 cu bolile cardiovasculare și factorii de risc tradiționali: o revizuire sistematică și meta-analiză medRxiv (2020) Google Scholar McPherson, 2017 R.A. McPherson Henry’s Clinical Diagnosis and Management by Laboratory Methods: First South Asia Edition_e-Book Elsevier India (2017) Google Scholar Merad și Martin, 2020 M. Merad, JC MartinInflamația patologică la pacienții cu COVID-19: un rol cheie pentru monocite și macrofage Nat. Pr. Immunol. (2020), pp. 1-8 Google Scholar Miclescu și Wiklund, 2010 A. Miclescu, L. Wiklund Albastru de metilen, un medicament vechi cu indicații noi J Rom Anest Terap Int, 17 (2010), pp. 35-41 View Record în Scopus Google Scholar Sato și colab., 1981 K. Sato, Y. Katsumata, M. Aoki, M. Oya, S. Yada, O. Suzuki O metodă practică pentru determinarea exactă a methemoglobinei în sânge care conține carboxihemoglobină Forensic Sci. Int., 17 (1981), pp. 177-184 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Shehat și Tigno-Aranjuez, 2019MG Shehat, J. Tigno-Aranjuez Măsurarea citometrică a fluxului producției ROS în macrofage ca răspuns la reticularea FcγR JoVE (2019), articolul e59167 Google Scholar Shiva și colab., 2006 S. Shiva, X. Wang, LA Ringwood, X Xu, S. Yuditskaya, V. Annavajjhala, H. Miyajima, N. Hogg, ZL Harris, MT Gladwin Ceruloplasmin este o NO oxidază și nitrit sintază care determină endocrin NO homeostazie Nat. Chem. Biol., 2 (2006), pp. 486-493 CrossRef View Record in Scopus Google Scholar Vitturi et al., 2009 D.A. Vitturi, X. Teng, JC Toledo, S. Matalon, JR Lancaster Jr., RP Patel Reglarea transportului nitriților în celulele roșii din sânge prin saturația fracțională a oxigenului hemoglobineiA.m. J. Fiziol. Heart Circ. Physiol., 296 (2009), pp. H1398-H1407 CrossRef View Record in Scopus Google Scholar Wang and Ma, 2008 H. Wang, S. Ma Furtuna de citokine și factorii care determină secvența și severitatea disfuncției organelor în sindromul disfuncției organelor multiple A.m. J. Emerg. Med., 26 (2008), pp. 711-715 Articol Descărcare PDF Vizualizare înregistrare în Scopus Google Scholar Wang și colab., 2018 X. Wang, Z. Gray, J. Willette-Brown, F. Zhu, G. Shi, Q. Jiang, N.-Y. Song, L. Dong, Y. Hu oxid nitric sintaz inductibil de macrofage circulă inflamația și promovează carcinogeneza pulmonară Moartea celulară Discov., 4 (2018), pp. 1-12 Articol Descărcați PDFCrossRef View Record în Scopus Google Scholar Woo and Heil, 2017 K.Y. Woo, J. Heil O evaluare prospectivă a pansamentului cu albastru de metilen și violetă de gențiană pentru tratarea rănilor cronice cu infecție locală Int. Wound J., 14 (2017), pp. 1029-1035 CrossRef View Record in Scopus Google Scholar Wülfert și colab., 2003 E. Wülfert, A. Atkinson, A. Salomon Utilizarea terapeutică și profilactică a formelor reduse de compuși farmaceutici Google Brevete (2003), pp. 1-6 Vizualizare înregistrare în Scopus Google Scholar Yang și colab., 2020 W. Yang, A. Sirajuddin, X. Zhang, G. Liu, Z. Teng, S. Zhao, M. LuRolul imagisticii în 2019 pneumonie cu coronavirus (COVID-19) Eur. Radiol. (2020), pp. 1-9 CrossRef View Record in Scopus Google Scholar Yegın et al., 2015 S.Ç. Yegın, F. Yur, S. Çetın, A. Güder Efectul licopenului asupra nivelului seric de nitriți-nitrați la șobolanii diabetici Indian J. Pharmaceutical. Sci., 77 (2015), p. 357 CrossRef View Record in Scopus Google Scholar 

Vizualizați articolul @ European Journal of Pharmacology (poate fi necesară conectarea)

Int J Biol Sci . 2020; 16 (10): 1708-1717.Publicat online 2020 15 mar. Doi:  10.7150 / ijbs.45538PMCID: PMC7098036PMID: 32226288

Medicina tradițională chineză în tratamentul pacienților infectați(SARS-CoV-2) Covid19: o revizuire și o perspectivă

Yang Yang , Md Sahidul Islam , Jin Wang , Yuan Li și Xin Chen Informații despre autor Note despre articol Informații privind drepturile de autor și licență RenunțareAcest articol a fost citat de alte articole din PMC.

Date asociate

Materiale suplimentare

Abstract

În prezent, sindromul respirator acut sever Coronavirus 2 (SARS-CoV-2, cunoscut anterior sub numele de 2019-nCoV, agentul patogen cauzal al bolii Coronavirus 2019 (COVID-19)) s-a răspândit rapid în China și în întreaga lume, provocând un focar de pneumonie infecțioasă. Nu sunt disponibile medicamente antivirus sau vaccinuri specifice pentru tratamentul acestei boli bruște și letale. Singura opțiune în prezent este îngrijirea de susținere și tratamentul nespecific pentru ameliorarea simptomelor pacientului. În partea de TOP a acestor terapii convenționale, mai mult de 85% dintre pacienții infectați cu SARS-CoV-2 din China beneficiază de tratament pentru medicina tradițională chineză (TCM). În acest articol, literaturile relevante publicate sunt revizuite cu atenție și sunt analizate aplicațiile curente ale TCM în tratamentul pacienților cu COVID-19. Datorită omologiei în epidemiologie,genomică și patogenia SARS-CoV-2 și SARS-CoV și utilizarea pe scară largă a TCM în tratamentul SARS-CoV, sunt discutate dovezile clinice care arată efectul benefic al TCM în tratamentul pacienților cu infecții coronavirale SARS . Studiile experimentale actuale care oferă o perspectivă asupra mecanismului care stă la baza efectului terapeutic al TCM și acele studii au identificat noi compuși naturali cu activitate anti-coronavirală..

Cuvinte cheie: SARS-CoV-2, Medicină tradițională chineză (TCM), pneumonie coronavirus

Introducere

În decembrie 2019, a existat un focar de pneumonie inexplicabilă în orașul Wuhan, provincia Hubei, China 1 . Până la 7 ianuarie 2020, s-a confirmat că a apărut un nou tip de coronavirus numit SARS-CoV-2 (denumit anterior 2019-nCoV) 2 . Organizația Mondială a Sănătății (OMS) a numit pneumonia Wuhan drept boala Coronavirus-2019 (COVID-19) pe 11 februarie 2020 3 . Pacienții cu COVID-19 au prezentat simptome respiratorii tipice (cum ar fi tuse, febră și leziuni pulmonare) și alte simptome, cum ar fi oboseala, mialgia și diareea 4 , 5 . Începând cu 17 februarie 2020, în China și în alte 25 de țări au fost raportate un total de 73.332 cazuri de pneumonie infectată cu SARS-CoV-2, din care 72.528 cazuri au fost găsite în China 6. Datorită răspândirii rapide a SARS-CoV-2 prin transmiterea de la om la om, cazurile în prezent continuă să crească. SARS-CoV-2 extras de la pacienții cu pneumonie din Wuhan este un beta-coronavirus de tip ARN monocatenar învelit 7 . Secvențele genomice ale SARS-CoV-2 au împărțit 79,5% identitatea secvenței cu coronavirusurile asociate sindromului respirator acut sever (SARS-CoV) 8 , 9 . În plus, proteina spike (S) a SARS-CoV-2 și SARS-CoV intră în celulele epiteliale alveolare umane prin legarea receptorului 8 al enzimei de conversie a angiotensinei 2 (ACE2) 8 .

COVID-19 poate fi diagnosticat fie prin radiografie CT toracică, fie printr-un test de laborator. Din păcate, medicamentele antivirale specifice sau vaccinurile în prezent nu au fost disponibile pentru tratament10 , 11 . Conform ghidului clinic actual din China și experiențelor în tratamentul pacienților cu SARS sau cu sindrom respirator din Orientul Mijlociu (MERS), atât medicina convențională, cât și medicina tradițională chineză (TCM) sunt utilizate pentru tratamentul pacienților cu infecție cu SARS-CoV-. 2 în China , de 12 – pe 14 . Această revizuire se concentrează în principal pe discuția despre utilizarea TCM în tratamentul pacienților cu COVID-19, în contextul managementului convențional actual. Datorită omologiei în epidemiologie, genomică și patogenie a SRAS-CoV-2 și SARS-CoV8 , 9 și utilizarea pe scară largă a TCM în tratamentul pacienților infectați cu SARS-CoV în 2002-2003 15 , dovezile clinice care arată eficacitatea și siguranța TCM în tratamentul pacienților cu coronaviral emergent vor fi rezumate și analizate, inclusiv studiile de laborator care oferă o perspectivă asupra bazei moleculare a beneficiilor terapeutice.

Tratamentul convențional al SARS-CoV-2: există loc pentru medicina chineză?

Datorită absenței unei terapii antivirale specifice și a unui vaccin, strategia principală de tratament pentru COVID-19 este îngrijirea de susținere, care este completată de combinația de antibiotice cu spectru larg, antivirale, corticosteroizi și plasmă convalescentă 16 (Tabel(…)(Tabelul 1).1). Inhibitorii de protează HIV ritonavir și lopinavir au fost utilizați, de obicei în combinație cu antibiotice adecvate sau cu IFNα-2b, în ​​tratamentul pacienților infectați cu SARS-CoV-2 7 , 17 . Analogii nucleozidici, cum ar fi ribavirina 12, pot fi potențial benefici pentru tratamentul COVID-19, deoarece ribavirina a fost aprobată pentru tratarea infecției cu virusul sincițial respirator (RSV) 18 și utilizată pe scară largă în timpul focarului SARS și MERS 10 . Cu toate acestea, ribavirina a avut efecte secundare severe, cum ar fi anemia 18și dacă a avut suficientă activitate antivirală împotriva SARS-CoV-2 este neclar. Analogii nucleozidici favipiravir (T-705) pot inhiba în mod eficient activitatea ARN polimerazei virusurilor ARN, cum ar fi gripa 19 . Un studiu recent in vitro a constatat că avea activitatea anti-SARS-CoV-2 20 , dar efectul in vivo rămâne evaziv. Remdesivirul poate fi cel mai promițător medicament antiviral pentru tratamentul COVID-19. Are activitate antivirală in vitro și in vivo împotriva unei game largi de viruși ARN, inclusiv SARS și MERS 21 , și ar putea scădea încărcăturile virale și patologia plămânilor la modelele animale 22. Un studiu a arătat că remdesivirul a inhibat semnificativ infecția cu SARS-CoV-2 în celulele Vero E6 20 , iar majoritatea simptomelor primului pacient din SUA infectat cu SARS-CoV-2 s-au rezolvat rapid după administrarea intravenoasă cu remdesivir 23 . În prezent, se află în studiu clinic pentru a evalua siguranța și eficacitatea remdesivirului intravenos la pacienții cu infecție SARS-CoV-2 24 . Oseltamivirul oral a fost utilizat pentru tratamentul cazurilor cu SARS-CoV-2 7 , în timp ce eficacitatea sa rămâne în prezent incertă.

tabelul 1

Tratamentul convențional al pacienților cu infecție cu SARS-CoV-2

Tipul tratamentuluiAgent sau dispozitiv terapeuticReferinţă
Terapia cu oxigen
Canulă nazală
Ventilație mecanică neinvazivă Ventilație
mecanică invazivă
ECMO *
16
Combinație de antibioticeAmoxicilină
Azitromicină
Fluorochinolonele
16
Antivirale

Lopinavir / ritonavir16 , 17
Ribavirină16 , 18
Favipiravir (T-705)19 , 20
Remdesivir20 – 23
Oseltamivir7
Clorochina20 , 36
Interferon7 , 17
CorticosteroiziMetilprednisolon7
Plasma convalescentăPlasma convalescentă22

* ECMO, oxigenare cu membrană extracorporală.

Moleculele mici vizate de gazdă aprobate pentru alte boli umane pot modula interacțiunile virus-gazdă ale SARS-CoV-2. Clorochina, un potențial medicament antiviral cu spectru larg 25 , 26 , a fost demonstrat de un studiu recent cu activitate anti-SARS-CoV-2 20 . Eficacitatea sa clinică este în curs de studiu într-un studiu deschis (ChiCTR2000029609) 12 . Inhalarea de atomizare IFNα (5 milioane U) a fost recomandată ca terapie antivirală pentru tratarea SARS-CoV-2 16 . A fost inițiat un test de testare a combinației IFNα-2b a inhibitorilor anti-HCV aprobați 17 , cu toate acestea, nu este clar dacă ar putea acționa sinergic împotriva SARS-CoV-2.

Corticosteroizii au fost folosiți frecvent pentru a suprima nivelurile crescute de citokine la pacienții cu SARS-CoV 27 , 28 și MERS-CoV 29 , 30 . Cu toate acestea, nu există dovezi care să arate că mortalitatea pacienților cu SARS și MERS a fost redusă prin tratamentul cu corticosteroizi, în timp ce clearance-ul viral a fost întârziat cu un astfel de tratament 31 – 33 . În consecință, nu se recomandă utilizarea corticosteroizilor în mod sistemic la pacienții infectați cu SARS-CoV-2 34 , 35 .

Anterior, s-a demonstrat că, fie în gripa severă, fie în infecția cu SARS-CoV, tratamentul cu plasmă convalescentă ar putea scădea semnificativ încărcătura virală și reduce mortalitatea 31 , 36 . Plasma convalescentă a fost utilizată pentru infecția severă cu SARS-CoV-2 în China 22 , deși promițătoare, eficacitatea și siguranța trebuie să fie evaluate în continuare cu atenție.

În conformitate cu analiza anterioară, OMS a concluzionat, de asemenea, „până în prezent, nu există niciun medicament specific recomandat pentru prevenirea sau tratarea SARS-CoV-2” 37 . 

TCM a fost utilizat în combaterea bolilor infecțioase de mii de ani. Există loc pentru intervenția TCM ca terapie complementară pentru pacienții cu COVID-19. Se raportează că pacienții cu infecție SARS-CoV au beneficiat de tratament TCM 38 , inclusiv ameliorarea efectului secundar al terapiei convenționale 39 , 40 . Pe baza acestor factori, există o așteptare generală că TCM ar fi o armă valoroasă împotriva SARS-CoV-2.

Medicina tradițională chineză în tratamentul pacienților infectați cu SARS-CoV: dovezi clinice

Aplicarea TCM în tratamentul SARS-CoV-2 este în mare măsură inspirată de tratamentul SARS cauzat de focarul de coronavirus SARS (SARS-CoV) la sfârșitul anului 2002 în provincia Guangdong din China, care s-a răspândit rapid în 2003, cu numărul cumulat la nivel mondial de peste 8.000 41 – 43 . De la rapoarte de cazuri, serii de cazuri, studii observaționale controlate și studii clinice randomizate, au fost efectuate și raportate studii clinice care vizează examinarea efectului TCM asupra SARS. Există dovezi destul de convingătoare care susțin ideea că TCM are un efect benefic în tratamentul sau prevenirea SARS. De exemplu, rata de fatalitate în Hong Kong și Singapore a fost de aproximativ 18%, în timp ce rata de la Beijing a fost inițial mai mult de 52% până la 5 leadin mai și a scăzut treptat până la 4% -1% după 20 – lea mai in 2003. dramatica reducere de fatalitate de la sfârșitul lunii mai de la Beijing a fost considerata a fi asociata cu utilizarea TCM ca un supliment la terapia convențională 44 . Lau și colegii săi au raportat că, în timpul focarului SARS, 1063 de voluntari, inclusiv 926 de muncitori din spitale și 37 de tehnicieni de laborator care lucrează în laboratoare cu virusuri cu risc ridicat, au folosit un extract din plante TCM, și anume Sang Ju Yin plus Yu Ping Feng San . În comparație cu 0,4% din infecția din grupul de control, niciunul dintre utilizatorii TCM nu s-a infectat. Mai mult, au existat unele dovezi că Sang Ju Yin plus Yu Ping Feng Sanar putea modula celulele T într-o manieră pentru a spori capacitatea de apărare a gazdei 45 , 46 . Într-un studiu clinic controlat, tratamentul suplimentar cu TCM a dus la îmbunătățirea marcată a simptomelor și a scurtat evoluția bolii 47 . Efectul benefic clinic al TCM pare să fie susținut de studii de laborator. De exemplu, o cercetare de înaltă calitate publicată în Lancet a raportat că glicirizina, o rădăcină constitutivă activă majoră de lemn dulce, care este cea mai frecvent utilizată plantă chineză, a inhibat puternic replicarea izolatelor clinice ale virusului SARS 48. Un alt studiu independent a confirmat activitatea antivirus a glicirizinei prin teste de reducere a plăcii și acest studiu a constatat că un alt compus din plante chinezesc baicalin a avut, de asemenea, activitatea anti-SARS 49 . Mai mult, Wang și colab . găsit MOL376, un compus derivat din TCM, poate deveni un compus de plumb pentru terapia SARS prin inhibarea catepsinei L, o țintă pentru tratamentul SARS 50 .

Există o mulțime de literatură despre tratamentele TCM pentru SARS publicate după epidemia de SARS din China. O analiză critică a acestor publicații ar fi utilă pentru a confirma efectul benefic al TCM. Liu și colab. a analizat sistematic opt studii controlate randomizate și a concluzionat că, prin combinație cu medicina convențională, TCM a arătat efectele benefice, cum ar fi scăderea mortalității și ameliorarea simptomelor, precum și controlul infecțiilor fungice la pacienții cu SARS. Cu toate acestea, dovezile nu sunt suficiente, din cauza calității slabe a metodologiei utilizate în studii 13. Leung a analizat 90 de lucrări peer-review cu o calitate rezonabilă din 130 de publicații și a concluzionat că TCM utilizat împreună cu tratamentul convențional a avut unele efecte pozitive, inclusiv un control mai bun al febrei, eliminarea mai rapidă a infecției toracice și alte simptome. Cu toate acestea, un astfel de efect benefic al TCM nu este concludent și sunt necesare studii clinice de înaltă calitate 15 . Într-o altă analiză aprofundată a literaturii, Liu și colegii au ajuns la concluzia că nu există niciun beneficiu al tratamentului adjuvant cu TCM în ceea ce privește mortalitatea 39 . Datorită lipsei studiilor TCM de înaltă calitate și a prejudecăților care au influențat validitatea rezultatelor, Wu și colegii săi au sugerat să repete testele clinice ale TCM pentru tratamentul infecțiilor acute ale tractului respirator (ARTI) 51 .

Identificarea compusului anti-covid19 din medicina tradițională chineză

Produsele naturale utilizate în TCM rămân a fi o sursă bogată pentru identificarea unor agenți terapeutici noi pentru tratamentul bolilor umane 52 . În ultimul deceniu, oamenii de știință au depus un efort considerabil pentru a identifica formule pe bază de plante cu componente multiple în TCM cu activitate anti-SARS-CoV (Tabel(…)(Masa 2).2). S-a urmărit, de asemenea, identificarea ulterioară a entităților chimice conținute în plante TCM responsabile de efectul anti-SARS-CoV (Tabel(…)(Tabelul 3).3). Datorită omologiei SARS-CoV și SARS-CoV-2, aceste studii anterioare pot arunca lumina asupra compușilor naturali care au capacitatea de a inhiba SARS-CoV-2.

tabel 2

Formule de plante TCM utilizate pentru Tratamentul infecției cu SARS-CoV

Formula TCMCompoziţieEfect terapeuticReferinţă
Yin Qiao SanFructus Forsythiae, Flos Lonicerae, Radix Platycodonis, Herba Menthae, Herba Lophatheri, Radix Glycyrrhizae, Herba Schizonepetae, Soia fermentată , Fructus arctii și Rhizoma Phragmitis„Dispersează căldura vântului, curăță căldura și ameliorează toxicitatea”, conform teoriei TCM
Tratamentul infecției tractului respirator superior.
Îmbunătățirea funcției sistemului imunitar al mucoasei căilor respiratorii superioare
111 , 112
Yu Ping Feng SanAstragali radix, Astragalus membranaceus, Atractylodes macrocephala și Saposhnikoviae Radix„Tonifiant qi ” pentru a proteja împotriva agenților patogeni externi ”, conform teoriei TCM
Se pare că au efecte antivirale, antiinflamatorii și imunoreglatorii
113 – 115
Sang Ju Yin și Yu Ping Feng SanSang Ju Yin [făcut cu crizantemă, frunze de dud și alte 6 ierburi] și Yu Ping Feng SanSe pare că au efecte antivirale și imunoregulatoare46
Lian Hua Qing Wen CapsuleSuspensa forsythia , Ephedra sinica, Lonicera japonica, Isatis indigotica, Mentha haplocalyx, Dryopteris crassirhizoma, Rhodiola rosea, Gypsum Fibrosum , Pogostemon cablin, Rheum palmatum , Houttuynia cordata, Glycyrrhizae, uralensis, și armeniaca sibirica„Se curăță căldura și se detoxifică, îndepărtează căldura pulmonară”, conform teoriei TCM
Se pare că au efecte antivirale, antiinflamatorii și imunoregulatoare.
8283
Shuang Huang LianLonicera japonica, Scutellaria baicalensis, and Forsythia suspensa“Clear heat and detoxify, remove lung hotness”, according to TCM theory
Reportedly has anti-SARS-CoV-2 activity
Reportedly has immunosuppressive effects
7880116
Ma Xin Gan Shi TangEphedrae herba, Armeniacae semenamarum), Glycyrrhizae radix et rhizome, Gypsum fibrosum, and Da Yuan Yin [Arecae semen, Magnoliae officinalis cortex, Tsaoko fructus,Anemarrhenae rhizoma, Dioscoreae rhizoma, Scutellariae radix, and Glycyrrhizae raadix et rhizome]„Facilitează fluxul pulmonar„ qi ” și îndepărtează căldura”, conform teoriei TCM
Se pare că au activitate anti-SARS-CoV
117 , 118

Deschideți într-o fereastră separată

Tabelul 3

Extracte din plante TCM sau compuși derivați TCM cu activitate anti-HCoV

Compuși TCMModul de acțiuneReferinţă
Compuși fenolici derivați din plante și extract de rădăcină de Isatis indigoticaInhibați activitatea de scindare a enzimei SARS-3CLpro57
Extract apă din Houttuynia cordataInhibați activitatea SARS-3CLpro
virală Blocați activitatea virală a ARN-polimerazei dependente de ARN (RdRp)
Imunomodulare
54 , 55
Scutellarein și myricetinInhibați nsP13 afectând activitatea ATPazei61
Glicirizina din Glycyrrhizae radixInhibă adsorbția și penetrarea virală48 , 75
Herbacetină, quercetină, izobavascalconă, 3-β-D-glucozidă și helichrysetinăInhibă activitatea de scindare a enzimei MERS-3CLpro60
Tetrandrina, fangchinolina și cefarantinaInhibați expresia proteinei HCoV-OC43 și a proteinei nucleocapsidice.
Imunomodulare
106 , 119
Extractele de rubarbă chinezăInhibați activitatea SARS-3CLpro53
Flavonoide (de exemplu: extras din semințe de litchi, herbacetină, rhoifolin, pectolinarină, quercetină, epigalocatechină galat și galocatechină galat)Inhibați activitatea SARS-3CLpro56 , 58 , 59
Quercetin și TSL-1 de la Toona sinensis RoemInhibați intrarea celulară a SARS-CoV76
Emodin derivat din genul Rheum și PolygonumInhibați interacțiunea proteinei SARS-CoV Spike și ACE2
Inhibați canalul ionic 3a al coronavirusului SARS-CoV și HCoV-OC43
67 , 72
Derivați de kaempferolInhibați canalul ionic 3a al coronavirusului73
Baicalin din Scutellaria baicalensisInhibați enzima de conversie a angiotensinei (ECA)44 , 68
SaikosaponinsPreveniți stadiul incipient al infecției cu HCoV-22E9, inclusiv atașamentul și penetrarea virală74
Tetra- O -galloyl-β-D-glucoză și luteolina, de la Galla chinensis și Veronicalina riifolia respectivSe leagă avid de proteina vârf de suprafață a SARS-CoV71

Deschideți într-o fereastră separată

Proteaza asemănătoare chimotripsinei (3CLpro) este vitală pentru replicarea virusului și, prin urmare, reprezintă o țintă promițătoare a medicamentului pentru dezvoltarea agenților terapeutici pentru SARS-CoV, precum și pentru alte coronavirusuri umane, inclusiv SARS-CoV-2. Sa raportat că în urma TCM extracte din plante au capacitatea de a inhiba activitatea enzimatică a SARS 3CLpro: chineză rubarbă extracte (IC50: 13,76 ± 0,03 pg / ml) 53 , apă extract de Houttuynia cordata 54 , 55 , flavonoid extras din litchi semințe de 56 și beta-sitosterol (IC50: 1210µM) extras din extractul de rădăcină de Isatis indigotica 57. Mai mult, urmând compuși naturali obținuți din plante, inclusiv sinigrină (IC50: 217µM), indigo (IC50: 752µM), aloe-emodină (IC50: 366 µM), hesperetin (IC50: 8,3 µM) 57 , quercetin (IC50: 73µM), galatul de epigalocatechină (IC50: 73 uM), galatul de galocatechină (IC50: 47 uM) 58 , herbacetina, rhoifolina și pectolinarina 59 au fost capabili să inhibe activitatea SARS 3CLpro. Mai mult, flavonoidele și anume herbacetina, izobavascalcona, quercetina 3-β-D-glucozidă și helichrysetina au potențialul de a bloca activitatea enzimatică a proteazei MERS-CoV 3CL 60 .

Proteina helicază este, de asemenea, considerată ca o țintă potențială pentru dezvoltarea agenților anti-HCoV (coronavirus uman). Yu și colab. scutellareina și myricetina raportate au inhibat puternic nsP13 (proteina helicază SARS-CoV) in vitro prin afectarea activității ATPazei 61 . ARN-polimeraza dependentă de ARN (RdRp), o enzimă cheie responsabilă atât pentru sinteza ARN pozitivă cât și pentru cea negativă, reprezintă, de asemenea, o altă țintă potențială drogabilă. S-a arătat că extractele de Kang Du Bu Fei Tang (IC50: 471,3 µg / mL), Sinomenium acutum (IC50: 198,6 µg / mL), Coriolus versicolor (IC50: 108,4 µg / mL) și Ganoderma lucidum(IC50: 41,9 µg / ml) a inhibat SARS-CoV RdRp într-o manieră dependentă de doză 54 . Wu și colab. a efectuat screening la scară largă a medicamentelor existente, a produselor naturale și a compușilor sintetici (> 10000 de compuși) pentru a identifica agenți anti-SARS-CoV eficienți printr-un test pe bază de celule cu virusul SARS și celulele Vero E6 62 . Au descoperit că ginsenozida-Rb1 izolată din ginsengul Panax , aescina izolată din castanul de cal, reserpina conținută în genul Rauwolfia și extractele de eucalipt și Lonicera japonica au inhibat replicarea SARS-CoV la concentrații netoxice 62 .

La fel ca SARS-CoV și HCoV-NL63, SARS-CoV-2 folosește receptorul gazdă ACE2 pentru intrarea celulară 63 – 66 . Prin urmare, TCM cu capacitatea de a viza ACE2 deține promisiunea de a preveni infecția cu SARS-CoV-2. Emodin din genul Rheum și Polygonum 67 , baicalin din Scutellaria baicalensis 44 , 68 , nicotianamină din alimente (în special „inhibitor de soia ACE2 (ACE2iSB)”) 69 , scutellarin 70 , tetra- O -galoyl-β-D-glucoză (TGG) din Galla chinensis și luteolină din Veronicalina riifolia 71a inhibat semnificativ interacțiunea SARS-CoV S-protein și ACE2. Cu toate acestea, activitatea anti-SARS-CoV a acestor compuși rămâne de evaluat. În plus, inhibarea canalului de ioni 3a de către emodina 72 sau derivații de kaempferol – juglanina 73 ar putea preveni eliberarea virală din celulele infectate. Saikosaponinele 74 , glicirizina 48 , 75 , quercetina și TSL-1 extrase din Toona sinensis Roem 76 ar fi avut efecte puternice anti-SARS-CoV prin inhibarea intrării celulare virale, adsorbție și penetrare.

Răspunsurile inflamatorii copleșitoare sunt atribuite deceselor pacienților cu infecție cu SARS-CoV sau MERS-CoV sau COVID-19. Astfel, agenții antiinflamatori probabil ar putea reduce severitatea și mortalitatea 77 . Shuang Huang Lian, un produs pe bază de plante TCM preparat din Lonicerae japonicae Flos, Scutellariae radix și Fructus Forsythiae, ar fi avut activitatea de a inhiba SARS-CoV-2 78 . Interesant, am arătat că acest preparat pe bază de plante inhibă puternic sindromul de șoc toxic stafilococic producerea de citokine (IL-1β, IL-6, TNF-α, IFN-γ) și chemokine (MIP-1α) induse de toxina 1 (TSST-1) , MIP-1β și MCP-1) de celule mononucleare din sânge periferic (PBMC)79 . În conformitate cu rezultatele noastre, sa demonstrat că acest produs pe bază de plante reduce semnificativ nivelurile transcripționale și translaționale ale citokinelor inflamatorii TNF-α, IL-1β și IL-6 în macrofagele alveolare murine stimulate de lipopolizaharide 80 . Indirubina este un ingredient activ al unui preparat TCM Dang Gui Long Hui Pill, a avut efecte antivirale și imunomodulatoare puternice, după cum se arată într-un studiu bazat pe observarea macrofagelor umane infectate cu virusul H5N1 și a celulelor epiteliale alveolare de tip I 81 .S-a raportat că Lian Hua Qing Wen Capsule are in vitroactivitate în inhibarea propagării diferitelor virusuri gripale. Acest produs pe bază de plante TCM nu numai că a blocat stadiile incipiente ale infecției cu virusul gripal, dar a inhibat și expresia genică indusă de virus a IL-6, IL-8, TNF-a, IP-10 și MCP-1 82 . În plus, un studiu realizat de Dong și colab . a raportat că nivelurile de IL-8, TNF-α, IL-17 și IL-23 în spută și de IL-8 și IL-17 în sânge au fost semnificativ scăzute după tratamentul cu Lian Hua Qing Wen Capsule la pacienții cu acută exacerbarea bolii pulmonare obstructive cronice 83 . Un studiu de autocontrol realizat de Poon și colab. a arătat că administrarea formulelor pe bază de plante TCM ( Sang Ju Yin și Yu Ping Feng San) poate avea efecte imunomodulatoare benefice pentru prevenirea infecțiilor virale, inclusiv SARS-CoV 46 .

Mai mult, un număr de agenți anti-coronavirali au fost identificați din plante TCM, deși mecanismele de acțiune nu au fost încă elucidate. De exemplu, extracte din Lycoris radiata , Artemisia annua , Pyrrosia lingua și agregat Lindera posedau activitatea anti-SARS-CoV 84 , 3β-Friedelanol izolat din Euphorbia neriifolia 85 , Blancoxanthone izolat din rădăcinile Calophyllum blancoi 86 au prezentat anti-HCoV- 229E activitate.Mergi la:

Medicina tradițională chineză utilizată în tratamentul pacienților infectați cu SARS-CoV-2: situațiile actuale

TCM este foarte apreciat de guvernul Chinei în campania sa de conținere și eradicare a SRAS-CoV-2. De exemplu, Comisia de sănătate din 26 de provincii a declarat oficial că TCM ar trebui utilizat în combinație cu medicina convențională în tratamentul pacienților cu COVID-19. La 17 februarie, Comisia Națională de Sănătate (NHC) din Republica Populară Chineză a raportat că 60.107 pacienți confirmați cu COVID-19 (85,20% din totalul cazurilor confirmate) au fost tratați cu TCM 87. În ceea ce privește 1 martie 2020, în China au fost lansate un total de 303 de studii clinice aflate în desfășurare cu scopul de a evalua eficacitatea și siguranța tratamentelor pentru pacienții cu CoV-19. Dintre acestea, 50 de studii (16,5%) se referă la utilizarea TCM, inclusiv 14 cazuri (4,6%) pentru a examina efectul tratamentului combinat cu TCM și medicina occidentală. În 22 de studii TCM (7,3%), se examinează efectul preparatelor pe bază de plante auto-fabricate, cum ar fi Formula Xin Guan-1 , Formula Xin Guan-2 și Qing Yi-4 . În alte 14 studii TCM (4,6%), sunt studiate produsele TCM disponibile comercial, cum ar fi injecția Tan Re Qing și capsula Lian Hua Qing Wen ((Tabelul 44).

Tabelul 4

Încercări clinice TCM în curs pentru tratamentul infecției cu SARS-CoV-2


Număr de înregistrare
Tipul de proiectareTitluMedicină pe bază de plante TCMMarime de mostraFază
ChiCTR2000029432CCTUn studiu real pentru eficacitatea și siguranța dozei mari de injecție Tanreqing în tratamentul pacienților cu pneumonie coronavirusă nouă (COVID-19)Injecție Tan Re Qing724
ChiCTR2000029434RCTUn studiu randomizat, deschis, controlat în gol, pentru Lian-Hua Qing-Wen Capsule / Granule în tratamentul unei noi pneumonii cu coronavirus (COVID-19)Lian Hua Qing Wen Capsulă / Granulă4004
ChiCTR2000029487CCTStudiu clinic pentru Gu-Biao Jie-Du-Ling în prevenirea pneumoniei cu coronavirus (COVID-19) la copiiGu Biao Jie Du Ling2000
ChiCTR2000029589CCTUn studiu clinic deschis, prospectiv, multicentric pentru eficacitatea și siguranța injecției Reduning în tratamentul pneumoniei cu coronavirus ovel (COVID-19)Re Du Ning
Injection
600
ChiCTR2000029605RCTUn studiu randomizat, deschis, controlat în gol, multicentric, pentru soluția orală Shuang-Huang-Lian în tratamentul pneumoniei coronavirus noi (COVID-19)Shuang Huang Lian Lichid oral4004
ChiCTR2000029780RCTUn studiu multicentric, randomizat, deschis, controlat pentru eficacitatea și siguranța injecției Shen-Qi Fu-Zheng în tratamentul unei noi pneumonii cu coronavirus (COVID-19)Injecție Shen Qi Fu Zheng1604
ChiCTR2000029781RCTUn studiu multicentric, randomizat, deschis și controlat pentru eficacitatea și siguranța granulelor Kang-Bing-Du în tratamentul pneumoniei cu coronavirus noi (COVID-19)Kang Bing Du Granules1604
ChiCTR2000029822RCTUn studiu controlat randomizat pentru decoct de caprifoi în tratamentul pacienților cu infecție nouă cu coronavirus (COVID-19)Jin Yin Hua Tang1100
ChiCTR2000029991RCTA randomized, open-label, controlled trial for the safety and efficiency of Kesuting syrup and Keqing capsule in the treatment of mild and moderate novel coronavirus pneumonia (COVID-19)Ke Su Ting Syrup
/Ke Qing Capsule
724
ChiCTR2000030043RCTShen-Fu injection in the treatment of severe novel coronavirus pneumonia (COVID-19): a multicenter, randomized, open-label, controlled trialShen Fu Injection3004
ChiCTR2000030117RCTA multicenter, randomized, open, parallel controlled trial for the evaluation of the effectiveness and safety of Xiyanping injection in the treatment of common type novel coronavirus pneumonia (COVID-19)Xi Yan Ping Injection3484
ChiCTR2000030255RCTEfficacy and safety of Jing-Yin Granule in the treatment of novel coronavirus pneumonia (COVID-19) wind-heat syndromeJing Yin Granule3004
ChiCTR2000030388RCTEficacitatea și siguranța injecției Xue-Bi-Jing în tratamentul cazurilor severe de pneumonie coronavirusă nouă (COVID-19)Injecție Xue Bi Jing600
ChiCTR2000029813RCTStudiu clinic pentru capsulele Tanreqing în tratamentul pneumoniei cu coronavirus nou (COVID-19)Capsule Tan Re Qing720

Deschideți într-o fereastră separată

Note: RCT: studiu controlat randomizat; CCT: studiu clinic controlat.

Până în prezent, NHC a publicat 6 ediții Ghiduri de diagnostic și tratament pentru COVID-19 88 . Începând cu a patra versiune, diferite medicamente pe bază de plante utilizate în sistemul TCM au fost recomandate pentru tratamentul COVID-19, pe baza stadiului bolii și a diferențierii simptomelor 89 . Conform celei mai recente ediții a Ghidului 88 , după recomandarea produselor pe bază de plante din China cu mai multe componente pentru pacienții din perioada de observare medicală, probabil ca măsură preventivă: Huo Xiang Zheng Qi Shui , Lian Hua Qing Wen Capsule , S hu Feng Jie Du Capsule și Jin Hua Qing Gan Granule . În perioada de tratament clinic, Qing Fei Pai Du TangInjecția Xi Yan Ping , injecția Xue Bi Jing , injecția Re Du Ning, injecția Tan Re Qing , injecția Xing Nao Jing și alte formule de medicină chineză ar trebui selectate 90 . În plus, pentru pacienții aflați în stare critică, trebuie administrată injecția Shen Fu , injecția Sheng Mai , injecția Shen Mai , pilula Su He Xiang și pilula An Gong Niu Huang (Tabelul 5).

Tabelul 5

TCM recomandat de ediția a 6-a Ghiduri de diagnostic și tratament pentru COVID-19 88 .

Stadiul boliiSimptomMedicină chineză brevetată recomandată
Perioada de observare medicalăOboseală cu disconfort gastro-intestinalHuo Xiang Zheng Qi Shui
Oboseală cu febrăLian Hua Qing Wen Capsule, Shu Feng Jie Du Capsule, Jin Hua Qing Gan Capsule
Perioada de tratament clinic
(pacienți confirmați)
Cazuri ușoareQing Fei Pai Du Tang
Cazuri generaleQing Fei Pai Du Tang
Mai multe cazuriXi Yan Ping Injection, Xue Bi Jing Injection, Re Du Ning Injection, Tan Re Qing Injection, Xing Nao Jing Injection, Qing Fei Pai Du Tang
Cazuri criticeInjecție Xue Bi Jing, injecție Re Du Ning, injecție Tan Re Qing, injecție Shen Fu, injecție Sheng Mai, injecție Shen Mai, pilula Su He Xiang, o pastilă Gong Niu Huang

Prin analiza frecvenței TCM utilizată în 23 de provincii, Luo și colab. 37 au concluzionat că Astragalus membranaceus, Glycyrrhizae uralensis, Saposhnikoviae divaricata, Rhizoma Atractylodis Macrocephalae, Lonicerae Japonicae Flos, Fructus forsythia, Atractylodis Rhizoma, Radix platycodonis, Agastache rugosa și Cyrtomium fortune folosită în mod obișnuit în cele mai folosite obiecte din Cyrtomium pentru fortăreața J. SmID au fost 10 cele mai folosite pentru a fi folosite în Cyrtomium fortune J. Sm. -19. Xu și colab. 91 a raportat că Astragalus membranaceus și Yu Ping Feng au fost utilizate în cele 13 programe de prevenire (la Beijing, Tianjin și colab.) Pentru „consolidarea qi-ului vital ”, o terminologie utilizată în TCM care este similară cu creșterea capacității de apărare a gazdei.Ophiopogon japonicas și Scrophularia ningpoensis și sunt plante TCM care au fost utilizate cel mai frecvent pentru „hrănirea yinului ” în nordul Chinei, în timp ce Atractylodis Rhizoma, Agastache rugosa și alte plante medicinale chinezești cu proprietatea „dezumidificării aromatice” au fost utilizate în mod obișnuit în sudul Chinei (tabel(…)(Tabelul 66).

Tabelul 6

Ierburi TCM utilizate frecvent pentru prevenirea infecției COVID-19

Raportat deIerburi (nume latin)Ierburi (Pin chinezesc Yin)Regiuni aplicabile
Luo și colab . 37Astragalus membranaceusHuangqi23 de provincii acopereau nord-estul, nordul, centrul (inclusiv Wuhan), sudul, estul, nord-vestul și sud-vestul Chinei.
Glycyrrhizae uralensisGancao
Saposhnikoviae divaricataFangfeng
Rhizoma Atractylodis MacrocephalaeBaizhu
Lonicerae Japonicae FlosJinyinhua
Fructus ForsythiaeLianqiao
Atractylodis RhizomaCangzhu
Radix platycodonisJiegeng
Agastache rugosaHuoxiang
Cyrtomium fortune J. SmGuanzhong
Xu și colab. 91Astragalus membranaceusHuangqiBeijing, Tianjin, Shandong, Shaanxi, Gansu, Hebei, Shanxi, Henan, Hubei, Jiangxi, Hunan și Yunnan
Atractylodis RhizomaCangzhuCinci regiuni din sudul Chinei (Hubei, Jiangxi, Hunan, Yunnan și Wuhan)
Eupatorii HerbaPeilan
Agastache rugosaHuoxiang
Ophiopogon japonicasMaidongOpt regiuni din nordul Chinei (Beijing, Tianjin, Hebei, Henan, Shaanxi, Shanxi, Gansu și Shandong)
Scrophularia ningpoensisXuanshen
Rhizoma phragmitisLugen
Adeinophora stricta MiqShashen
Dendrobium nobile Lindl.Shihu

Deschideți într-o fereastră separată

Conform raportului Administrației Naționale de Medicină Tradițională Chineză, până la 5 februarie 2020, 214 pacienți cu COVID-19 au fost tratați cu Qing Fei Pai Du Tang în provinciile Shanxi, Hebei, Heilongjiang și Shaanxi, cu o rată efectivă globală ≥ 90%. Dintre aceștia, simptomele majorității pacienților (≥60%) au fost semnificativ îmbunătățite, în timp ce boala altora (30%) a fost stabilizată 92 .
După aceea, 701 de pacienți cu COVID-19 au fost tratați cu Qing Fei Pai Du Tangîn 10 provincii din China. Rezultatul a arătat că 130 de pacienți (18,5%) s-au vindecat complet după tratament. Tratamentul a dus, de asemenea, la dispariția simptomelor caracteristice ale COVID-19, cum ar fi febra și tusea, la 51 de pacienți (7,27%). În plus, îmbunătățirea sau stabilizarea simptomelor au fost observate la 268 pacienți (38,2%) și la 212 pacienți (30,2%), respectiv 87 .
Yao și colab . și Lu și colab. 93 , 94 au analizat retrospectiv eficacitatea clinică a capsulei Lian Hua Qing Wen în tratamentul pacienților cu COVID-19 confirmați și suspectați. Rezultatele au indicat faptul că acest produs pe bază de plante ar putea ameliora semnificativ simptomele majore, cum ar fi febra și tusea și avea capacitatea de a promova recuperarea.

Unii pacienți cu o boală ușoară în stadiul incipient ar putea evolua brusc către o boală severă și, în cele din urmă, au murit din cauza șocului septic cu sindrom de disfuncție a mai multor organe (MODS), care a fost asociat cu furtuna de citokine 95 . Există dovezi convingătoare că unele produse pe bază de plante TCM sau componentele sale au efecte imunosupresoare puternice, după cum arată studiile noastre 79 și 96 – 103 . De exemplu, Wang și colab . 104 au raportat că injecția Shen Fu ar putea inhiba inflamația pulmonară și ar putea scădea nivelurile de IL-1β, IL-6 și alte citokine. Chang și colab . 105 au raportat căInjecția Re Du Ning ar putea reduce semnificativ nivelurile de IL-1β, TNF-α, IL-8, IL-10 și alte câteva citokine ale modelului indus de LPS de leziuni pulmonare acute la șobolani. Am raportat recent că tetrandrina, un compus izolat dintr-o plantă antireumatică chineză, ar putea inhiba puternic răspunsurile proinflamatorii Th1, Th2 și Th17 la șoarecii cu LPS 106 . Prin urmare, TCM cu capacitatea de a inhiba furtuna de citokine și consecințele sale devastatoare pot fi valorificate în tratamentul pacienților cu COVID-19 severe.

În prezent, studiul de laborator asupra efectului TCM se pare că rămâne în urma aplicării clinice a TCM în tratamentul pacienților cu COVID-19. Cu toate acestea, unii oameni de știință au început să examineze efectul produselor TCM sau al componentelor sale asupra SARS-CoV-2 în laboratoarele lor. De exemplu, un studiu in vitro a arătat că S huang Huang Lian Oral Liquid a avut efect inhibitor asupra SARS-CoV-2 78 . Cu toate acestea, eficacitatea clinică și siguranța sa pentru tratamentul pacienților cu COVID-19 nu au fost evaluate. Am observat că acest produs TCM nu a fost recomandat de Ghidul 89 al HNC . La fel ca SARS-CoV, SARS-CoV-2 folosește receptorul ACE2 pentru intrarea celulară 8. Teoretic, blocarea ACE2 poate preveni infecția cu SARS-CoV-2. Chen și Du au efectuat astfel studiul de andocare moleculară și au descoperit că compușii derivați de TCM, inclusiv baicalina, scutellarina, hesperetina, glicirizina și nicotianamina ar putea interacționa cu ACE2 107 . Prin urmare, acești compuși, precum și ierburile care conțin aceste ingrediente, pot avea capacitatea de a inhiba infecția cu SARS-CoV-2. Anticipăm mai multe studii experimentale care arată activitatea anti-SARS-CoV-2 a TCM sau a componentelor sale vor fi publicate în viitorul apropiat.Mergi la:

Observații de încheiere

TCM a acumulat experiențe de mii de ani în tratamentul bolilor pandemice și endemice. Furnizarea de tratamente complementare și alternative este încă urgent necesară pentru gestionarea pacienților cu infecție cu SARS-CoV-2, experiențele în TCM merită cu siguranță să fie învățate. Lupta împotriva epidemiilor actuale oferă, de asemenea, o oportunitate de a testa adevărata valoare a TCM în tratarea bolilor contagioase emergente. Studiile randomizate, dublu-orb și controlate cu placebo sunt cel mai bun mod de a furniza cele mai fiabile dovezi pentru o terapie, inclusiv TCM. Este încurajator faptul că au fost efectuate și raportate studii clinice controlate pentru a evalua eficacitatea TCM în tratamentul SARS-CoV. In orice caz,cele mai multe dintre aceste studii s-au dovedit a fi slab concepute și rezultatele ar putea duce la posibile prejudecăți în evaluarea eficacității tratamentului TCM13 . Sperăm că studiul clinic actual pentru a evalua efectul TCM asupra COVID-19 va utiliza protocoale mai stricte, ascunderea alocării și dublu-orbire, pentru a asigura conformitatea standardelor internaționale acceptabile. Mai mult, produsele standardizate ale TCM, mai degrabă decât formulările auto-preparate, ar trebui utilizate în studiile clinice. Studiul experimental poate fi capabil să elucideze mecanismul care stă la baza efectului terapeutic al TCM în tratamentul COVID-19. Studiul suplimentar al TCM poate duce la identificarea de noi compuși anti-coronavirus umani care se pot dovedi în cele din urmă utile în tratamentul SARS-CoV-2 sau a altor boli virale fatale emergente ca agenți terapeutici convenționali.

Siguranța TCM în tratamentul bolilor emergente cu coronavirus nu a fost inclusă în observația la pacienții cu SARS 13 . S-a raportat că unele plante folosite în TCM conțin nefrotoxine și mutageni 108 , în timp ce caracteristicile toxicologice ale majorității medicamentelor pe bază de plante chineze rămân a fi pe deplin înțelese 109 . Mai mult, ierburile utilizate în TCM pot imita sau mări sau opune efectul medicamentelor convenționale 110 . Astfel, siguranța TCM utilizată în tratamentul infecțiilor emergente cu coronavirus ar trebui evaluată cu atenție. Este deosebit de important să se evite toxicitatea sau să se interfereze cu eficacitatea tratamentului convențional cauzat de interacțiunea medicament-plante.

Material suplimentar

Cifre și tabele suplimentare.Faceți clic aici pentru fișier de date suplimentare. (178K, pdf)Mergi la:

Mulțumiri

Acest proiect a fost finanțat din subvenția de cercetare 201/2017 / A3 și 0056/2019 / AFJ din grantul de cercetare Fondul de dezvoltare științifică și tehnologică din Macau (FDCT) MYRG2017-00120- ICMS și MYRG2019-00169-ICMS.Mergi la:

Referințe

1. Gralinski LE, Menachery VD. Revenirea Coronavirusului: 2019-nCoV. Viruși. 2020. 12. [ Articol gratuit PMC ] [ PubMed ]2. Burki TK. Coronavirus în China. Lancet Respir Med. 2020. [ Articol gratuit PMC ] [ PubMed ]3. Organizația Mondială a Sănătății. Observațiile directorului general al OMS în cadrul ședinței media pe 2019-nCoV din 11 februarie 2020. https://www.who.int/dg/speeches/detail/who-director-general-s-remarks-at-the-media- briefing-on-2019-ncov-on-11-februarie-2020. 2020.4. Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, Caracteristici clinice ale infecției cu coronavirus noi din 2019 în China. medRxiv. 2020. 2020. 02.06.20020974.5. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y. și colab. Caracteristici clinice ale pacienților infectați cu noul coronavirus din 2019 în Wuhan, China. Lancet. 2020; 395 (10223): 497-506. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]6. Organizația Mondială a Sănătății. Raport de situație-29. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200218-sitrep-29-covid-19.pdf?sfvrsn=6262de9e_2. 2020.7. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y. și colab. Caracteristicile epidemiologice și clinice ale 99 de cazuri de pneumonie coronavirusă nouă din 2019 în Wuhan, China: un studiu descriptiv. Lancet. 2020; 395 (10223): 507–513. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]8. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, Un focar de pneumonie asociat cu un nou coronavirus de origine probabilă a liliecilor. Natură. 2020. [ Articol gratuit PMC ] [ PubMed ]9. Wu A, Peng Y, Huang B, Ding X, Wang X, Niu P, Genome Composition and Divergence of the Novel Coronavirus (2019-nCoV) Originare din China. Microbi gazdă celulară. 2020. [ Articol gratuit PMC ] [ PubMed ]10. Zumla A, Chan JF, Azhar EI, Hui DS, Yuen KY. Coronavirusuri – descoperirea medicamentelor și opțiuni terapeutice. Nat Rev Drug Discov. 2016; 15 : 327–47. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]11. Xie X, Zhong Z, Zhao W, Zheng C, Wang F, Liu J. Chest CT pentru pneumonia tipică 2019-nCoV: relația cu testarea negativă RT-PCR. Radiologie. 2020: 200343. [ Articol gratuit PMC ] [ PubMed ]12. Li G, Clercq ED. Opțiuni terapeutice pentru noul coronavirus din 2019 (2019-nCoV) Nat Rev Drug Discov. 2020. [ PubMed ]13. Liu J, Manheimer E, Shi Y, Gluud C. Medicina din plante chineze pentru sindromul respirator acut sever: o revizuire sistematică și meta-analiză. J Altern Complement Med. 2004; 10 : 1041–51. [ PubMed ] [ Google Scholar ]14. Li T, Peng T. Medicina tradițională din plante din China ca sursă de molecule cu activitate antivirală. Antivirale Res. 2013; 97 : 1-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]15. Leung PC. Eficacitatea medicinei chineze pentru SARS: o revizuire a publicațiilor chinezești după criză. Sunt J Chin Med. 2007; 35 : 575–81. [ PubMed ] [ Google Scholar ]16. Jin YH, Cai L, Cheng ZS, Cheng H, Deng T, Fan YP. și colab. Un ghid de sfaturi rapide pentru diagnosticul și tratamentul pneumoniei infectate cu coronavirusul nou (2019-nCoV) din 2019 (versiunea standard) Mil Med Res. 2020; 7 : 4. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]17. Habibzadeh P, Stoneman EK. The Novel Coronavirus: A Bird’s Eye View. Int J Occup Environ Med. 2020; 11 : 65–71. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]18. Jordan PC, Stevens SK, Deval J. Nucleozide pentru tratamentul infecțiilor cu virus ARN respirator. Antivir Chem Chemother. 2018; 26 : 2040206618764483. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]19. De Clercq E. Noi analogi nucleozidici pentru tratamentul infecțiilor cu virusul febrei hemoragice. Chem Asian J. 2019; 14 : 3962–8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]20. Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, Remdesivir și clorochina inhibă efectiv noul coronavirus recent apărut (2019-nCoV) in vitro. Rez. Celulare 2020. [ Articol gratuit PMC ] [ PubMed ]21. Sheahan TP, Sims AC, Graham RL, Menachery VD, Gralinski LE, Case JB, antiviral cu spectru larg GS-5734 inhibă atât coronavirusurile epidemice, cât și cele zoonotice. Sci Transl Med. 2017. 9. [ Articol gratuit PMC ] [ PubMed ]22. Zhang L, Liu Y. Intervenții potențiale pentru coronavirusul nou în China: o revizuire sistemică. J Med Virol. 2020. [ Articol gratuit PMC ] [ PubMed ]23. Holshue ML, DeBolt C, Lindquist S, Lofy KH, Wiesman J, Bruce H, Primul caz al romanului Coronavirus din 2019 în Statele Unite. N Engl J Med. 2020. [ Articol gratuit PMC ] [ PubMed ]24. Lai CC, Shih TP, Ko WC, Tang HJ, Hsueh PR. Sindromul respirator acut sever coronavirus 2 (SARS-CoV-2) și boala virusului corona-2019 (COVID-19): epidemia și provocările. Int J Agenți antimicrobieni. 2020: 105924. [ Articol gratuit PMC ] [ PubMed ]25. Savarino A, Di Trani L, Donatelli I, Cauda R, Cassone A. Noi perspective asupra efectelor antivirale ale clorochinei. Lancet Infect Dis. 2006; 6 : 67-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]26. Yan Y, Zou Z, Sun Y, Li X, Xu KF, Wei Y. și colab. Medicamentul anti-malaric clorochină este extrem de eficient în tratarea infecției cu virusul gripei aviare A H5N1 la un model animal. Rez. Celulare 2013; 23 : 300–2. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]27. Wong CK, Lam CW, Wu AK, Ip WK, Lee NL, Chan IH. și colab. Citokine și chemokine inflamatorii plasmatice în sindromul respirator acut sever. Clin Exp Immuno. 2004; 136 : 95–103. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]28. He L, Ding Y, Zhang Q, Che X, He Y, Shen H. și colab. Exprimarea nivelurilor crescute de citokine pro-inflamatorii la celulele ACE2 + infectate cu SARS-CoV la pacienții cu SARS: relația cu leziunea pulmonară acută și patogeneza SARS. J Pathol. 2006; 210 : 288-97. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]29. Faure E, Poissy J, Goffard A, Fournier C, Kipnis E, Titecat M. și colab. Răspuns imunitar distinct la doi pacienți infectați cu MERS-CoV: putem merge de la bancă la pat? Plus unu. 2014; 9 : e88716. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]30. Falzarano D, de Wit E, Rasmussen AL, Feldmann F, Okumura A, Scott DP. și colab. Tratamentul cu interferon-alfa2b și ribavirină îmbunătățește rezultatul macacilor rhesus infectați cu MERS-CoV. Nat Med. 2013; 19 : 1313–7. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]31. Stockman LJ, Bellamy R, Garner P. SARS: revizuirea sistematică a efectelor tratamentului. PLoS Med. 2006; 3 : e343. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]32. Lansbury L, Rodrigo C, Leonardi-Bee J, Nguyen-Van-Tam J, Lim WS. Corticosteroizii ca terapie adjuvantă în tratamentul gripei. Cochrane Database Syst Rev. 2019; 2 : Cd010406. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]33. Arabi YM, Mandourah Y, Al-Hameed F, Sindi AA, Almekhlafi GA, Hussein MA. și colab. Terapia cu corticosteroizi pentru pacienții cu afecțiuni critice cu sindrom respirator din Orientul Mijlociu. Am J Respir Crit Care Med. 2018; 197 : 757-67. [ PubMed ] [ Google Scholar ]34. Russell CD, Millar JE, Baillie JK. Dovezile clinice nu susțin tratamentul cu corticosteroizi pentru leziunile pulmonare 2019-nCoV. Lancet. 2020. [ Articol gratuit PMC ] [ PubMed ]35. Organizația Mondială a Sănătății. https://www.who.int/internal-publications-detail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus-(ncov)-infection-is-suspected. 2020.36. Hung IFN, To KKW, Lee CK, Lee KL, Yan WW, Chan K. și colab. Tratamentul cu imunoglobulină hiperimună IV: un studiu controlat randomizat dublu-orb multicentric pentru pacienții cu infecție severă gripală A (H1N1) din 2009. Cufăr. 2013; 144 : 464–73. [ PubMed ] [ Google Scholar ]37. Luo H, Tang QL, Shang YX, Liang SB, Yang M, Robinson N, Poate fi utilizată medicina chineză pentru prevenirea bolii virusului Corona 2019 (COVID-19)? O revizuire a clasicilor istorici, a dovezilor de cercetare și a programelor actuale de prevenire. Chin J Integr Med. 2020. [ Articol gratuit PMC ] [ PubMed ]38. Tong X, Li A, Zhang Z, Duan J, Chen X, Hua C. și colab. Tratamentul TCM al pneumoniei atipice infecțioase – un raport de 16 cazuri. J Tradit Chin Med. 2004; 24 : 266-9. [ PubMed ] [ Google Scholar ]39. Liu X, Zhang M, He L, Li Y. Ierburi chinezești combinate cu medicina occidentală pentru sindromul respirator acut sever (SARS) Cochrane Database Syst Rev. 2012; 10 : Cd004882. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]40. Zhang MM, Liu XM, He L. Efectul medicinei tradiționale chineze și occidentale integrate asupra SARS: o revizuire a dovezilor clinice. World J Gastroenterol. 2004; 10 : 3500–5. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]41. Zhong N, mai RM, McLean AR, Pattison J, Weiss RA. Managementul și prevenirea SARS în China. Philos Trans R Soc Lond B Biol Sci. 2004; 359 : 1115–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]42. JSM P, DP, Yuen KY ea. Sindromul respirator acut sever. New Engl J Med. 2003; 249 : 2431–41. [ Google Scholar ]43. Jr TMF, Tsang KWT. Sindromul respirator acut sever. Nat Med. 2005; 4 : 95–106. [ Google Scholar ]44. Chen Z, Nakamura T. Dovezi statistice privind utilitatea medicinei chineze în tratamentul SARS. Cercetarea fitoterapiei: PTR. 2004; 18 : 592–4. [ PubMed ] [ Google Scholar ]45. TF Lau, Leung PC, Wong ELY, Fong C, Cheng KF, Zhang SC și colab. Folosirea medicamentelor pe bază de plante ca mijloc de prevenire în timpul crizei SARS. Sunt J Chin Med. 2005; 33 : 345–56. [ PubMed ] [ Google Scholar ]46. Poon PM, Wong CK, Fung KP, Fong CY, Wong EL, Lau JT. și colab. Efectele imunomodulatoare ale unei medicamente tradiționale chinezești cu activitate antivirală potențială: un studiu de autocontrol. Sunt J Chin Med. 2006; 34 : 13–21. [ PubMed ] [ Google Scholar ]47. Hsu CH, Hwang KC, Chao CL, Chang SG, Ho MS, Chou P. Medicina pe bază de plante poate ajuta împotriva gripei aviare? Învățând din experiența utilizării tratamentului suplimentar cu medicina chineză pe SARS sau boli infecțioase asemănătoare SARS în 2003. J Altern Complement Med. 2006; 12 : 505–6. [ PubMed ] [ Google Scholar ]48. Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW. Glicirizina, o componentă activă a rădăcinilor de lemn dulce și replicarea coronavirusului asociat SARS. Lanceta. 2003; 361 : 2045–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]49. Chen F, Chan KH, Jiang Y, Kao RY, Lu HT, Fan KW. și colab. Sensibilitatea in vitro a 10 izolate clinice ale coronavirusului SARS la compuși antivirali selectați. J Clin Virol. 2004; 31 : 69–75. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]50. Wang SQ, Du QS, Zhao K, Li AX, Wei DQ, Chou KC. Screening virtual pentru găsirea unui inhibitor natural împotriva catepsinei-L pentru terapia SARS. Aminoacizi. 2007; 33 : 129–35. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]51. Wu T, Yang X, Zeng X, Poole P. Medicina tradițională chineză în tratamentul infecțiilor acute ale tractului respirator. Resp Med. 2008; 102 : 1093-8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]52. Cragg GM, Newman DJ. Produse naturale: o sursă continuă de noi medicamente. Biochimica et biophysica acta. 2013; 1830 : 3670-95. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]53. Luo W, Su X, Gong S, Qin Y, Liu W, Li J, Anti-SARS coronavirus 3C-like protease effects of Rheum palmatum L. extracts. Tendințe BioScience. 2009. 3. [ PubMed ]54. Fung KP, Leung PC, Tsui KW, Wan CC, Wong KB, Waye MY. și colab. Activități imunomodulatoare ale formulei pe bază de plante Kwan Du Bu Fei Dang la subiecți sănătoși: un studiu randomizat, dublu-orb, controlat cu placebo. Hong Kong Med J. 2011; 17 (Supliment 2): 41-3. [ PubMed ] [ Google Scholar ]55. Lau KM, Lee KM, Koon CM, Cheung CS, Lau CP, Ho HM. și colab. Activități imunomodulatoare și anti-SARS ale Houttuynia cordata. J Etnofarmacol. 2008; 118 : 79-85. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]56. Gong SJ, Su XJ, Yu HP, Li J, Qin YJ, Xu Q. și colab. Un studiu asupra proteinei anti-SARS-CoV 3CL a flavonoidelor din nucleul son litchi chinensis. Buletin farmacologic chinez. 2008; 24 : 699–700. [ Google Scholar ]57. Lin CW, Tsai FJ, Tsai CH, Lai CC, Wan L, Ho TY. și colab. Efectele proteazei asemănătoare coronavirusului 3C ale rădăcinii de Isatis indigotică și ale compușilor fenolici derivați din plante. Antivirale Res. 2005; 68 : 36–42. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]58. Nguyen TTH, Woo HJ, Kang HK, Nguyen VD, Kim YM, Kim DW. și colab. Inhibarea mediată de flavonoizi a proteazei asemănătoare coronavirusului 3C SARS exprimată în Pichia pastoris. Biotechnol Lett. 2012; 34 : 831-8. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]59. Jo S, Kim S, Shin DH, Kim MS. Inhibarea proteazei SARS-CoV 3CL de către flavonoizi. J Enzyme Inhib Med Chem. 2020; 35 : 145–51. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]60. Jo S, Kim H, Kim S, Shin DH, Kim MS. Caracteristicile flavonoidelor ca inhibitori puternici ai proteazei de tip MERS-CoV 3C. Chem Biol Drug Des. 2019. [ Articol gratuit PMC ] [ PubMed ]61. Yu MS, Lee J, Lee JM, Kim Y, Chin YW, Jee JG. și colab. Identificarea miricetinei și scutellareinei ca inhibitori chimici noi ai SARS coronavirus helicazei, nsP13. Bioorg Med Chem Lett. 2012; 22 : 4049–54. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]62. Wu CY, Jan JT, Ma SH, Kuo CJ, Juan HF, Cheng YSE. și colab. Molecule mici care vizează sindromul respirator acut sever coronavirus uman. Proc Natl Acad Sci US A. 2004; 101 : 10012–7. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]63. Kuhn JH, Radoshitzky SR, Li W, Wong SK, Choe H, Farzan M. SARS Coronavirus receptor ACE 2 O țintă potențială pentru terapia antivirală. În: Holzenburg A, Bogner E, editori. Noi concepte de terapie antivirală. Boston, MA: Springer SUA. 2006. p. 397-418.64. Letko M, Munster V. Evaluarea funcțională a intrării celulelor și a utilizării receptorilor pentru linia B β-coronavirusuri, inclusiv 2019-nCoV. bioRxiv. 2020. 2020. 01.22.915660. [ Articol gratuit PMC ] [ PubMed ]65. Lin HX, Feng Y, Wong G, Wang L, Li B, Zhao X. și colab. Identificarea reziduurilor din domeniul de legare la receptor (RBD) al proteinei spike ale coronavirusului uman NL63 care sunt critice pentru interacțiunea receptorului RBD-ACE2. J Gen Virol. 2008; 89 : 1015–24. [ PubMed ] [ Google Scholar ]66. Xu XT, Chen P, Wang JF, Feng JN, Zhou H, Li X, Evoluția noului coronavirus din focarul în curs de desfășurare de la Wuhan și modelarea proteinei sale de vârf pentru riscul transmiterii umane. Știință China Viață Știință. 2020. [ Articol gratuit PMC ] [ PubMed ]67. Ho T, Wu S, Chen J, Li C, Hsiang C. Emodin blochează interacțiunea SARS a coronavirusului și interacțiunea enzimei de conversie a angiotensinei 2. Antivirale Res. 2007; 74 : 92–101. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]68. Deng YF, Aluko RE, Jin Q, Zhang Y, Yuan LJ. Activități inhibitorii ale baicalinei împotriva reninei și a enzimei de conversie a angiotensinei. Pharm Biol. 2012; 50 : 401–6. [ PubMed ] [ Google Scholar ]69. Takahashi S, Yoshiya T, Yoshizawa-Kumagaye K, Sugiyama T. Nicotianamina este un nou inhibitor al enzimei 2 de conversie a angiotensinei din soia. Biomed Res. 2015; 36 : 219–24. [ PubMed ] [ Google Scholar ]70. Wang W, Ma X, Han J, Zhou M, Ren H, Pan Q. și colab. Efectul neuroprotector al scutellarinei asupra leziunilor cerebrale ischemice prin reglarea descendentă a expresiei enzimei de conversie a angiotensinei și a receptorului AT1. Plus unu. 2016; 11 : e0146197. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]71. Yi L, Li Z, Yuan K, Qu X, Chen J, Wang G. și colab. Molecule mici care blochează intrarea coronavirusului sindrom respirator acut sever în celulele gazdă J Virol. 2004; 78 : 11334-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]72. Schwarz S, Wang K, Yu WJ, Sun B, Schwarz W. Emodin inhibă curentul prin proteina coronavirus 3a asociată cu SARS. Res antivirale. 2011; 90 : 64-9. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]73. Schwarz S, Sauter D, Wang K, Zhang R, Sun B, Karioti A. și colab. Derivați de Kaempferol ca medicamente antivirale împotriva proteinei de canal 3a a coronavirusului. Planta Medica. 2014; 80 : 177–82. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]74. Cheng PW, Ng LT, Chiang LC, Lin CC. Efectele antivirale ale saikosaponinelor asupra coronavirusului uman 229E in vitro. Clin Exp Pharmacol Physiol. 2006; 33 : 612–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]75. Pilcher H. Licorice poate aborda SRAS. Natură. 2003.76. Chen CJ, Michaelis M, Hsu HK, Tsai CC, Yang KD, Wu YC. și colab. Extractul de frunze roșii Toona sinensis inhibă replicarea coronavirusului SARS. J Etnofarmacol. 2008; 120 : 108-11. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]77. Lu H. Opțiuni de tratament medicamentos pentru noul 2019 coronavirus (2019-nCoV) Biosci Trends. 2020. [ PubMed ]78. Știință CAo. Cercetătorii de la Shanghai Institute of Drugs și Wuhan Virus Institute au descoperit că medicamentul chinezesc brevetat lichid oral Shuanghuanglian poate inhiba noul coronavirus din 2019 .; 2020.79. Chen X, Howard OM, Yang X, Wang L, Oppenheim JJ, Krakauer T. Efectele Shuanghuanglian și Qingkailing, două componente multiple ale preparatelor medicinale tradiționale chinezești, asupra funcției leucocitelor umane. Life Science. 2002; 70 : 2897–913. [ PubMed ] [ Google Scholar ]80. Gao Y, Fang L, Cai R, Zong C, Chen X, Lu J. și colab. Shuang-Huang-Lian exercită activități antiinflamatorii și anti-oxidative în macrofagele alveolare murine stimulate de lipopolizaharide. Fitomedicina. 2014; 21 : 461-9. [ PubMed ] [ Google Scholar ]81. Chan MC, Chan RW, Mok CK, Mak NK, Wong RN. Indirubin-3′-oxima ca agent antiviral și imunomodulator în tratamentul infecției severe a virusului gripal uman. Hong Kong Med J. 2018; 24 (Supliment 6): 45-7. [ PubMed ] [ Google Scholar ]82. Ding Y, Zeng L, Li R, Chen Q, Zhou B, Chen Q. și colab. Capsula chineză lianhuaqingwen cu prescripție exercită activitate anti-gripală prin inhibarea propagării virale și afectează funcția imună. BMC Complement Altern Med. 2017; 17 : 130. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]83. Dong L, Xia JW, Gong Y, Chen Z, Yang HH, Zhang J. și colab. Efectul capsulelor Lianhuaqingwen asupra inflamației căilor respiratorii la pacienții cu exacerbare acută a bolii pulmonare obstructive cronice. Complement Evid Based Alternat Med. 2014; 2014 : 1-11. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]84. Li S, Chen C, Zhang H, Guo H, Wang H, Wang L. și colab. Identificarea compușilor naturali cu activități antivirale împotriva coronavirusului asociat SARS. Antivirale Res. 2005; 67 : 18–23. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]85. Chang FR, Yen CT, Ei-Shazly M, Lin WH, Yen MH, Lin KH. și colab. Triterpenoizi anti-Coronavirus (anti-HCoV) din frunzele Euphorbia Neriifolia. Nat Prod Commun. 2012; 7 : 1934578X1200701103. [ PubMed ] [ Google Scholar ]86. Shen YC, Wang LT, Khalil AT, Chiang LC, Cheng PW. Piranoxantoni bioactivi din rădăcinile Calophyllum blancoi. Chem Pharm Bull. 2005; 53 : 244-7. [ PubMed ] [ Google Scholar ]87. Comisia Națională de Sănătate din Republica Populară Chineză. Transcrierea conferinței de presă din 17 februarie 2020. http://www.nhc.gov.cn/xcs/s3574/202002/f12a62d10c2a48c6895cedf2faea6e1f. shtml. 2020.88. Comisia Națională de Sănătate din Republica Populară Chineză. Notificare privind punerea în aplicare a liniilor directoare de diagnostic și tratament pentru pneumonia infectată cu 2019-nCoV (versiunea 6) 6 ed; http://www.nhc.gov.cn/yzygj/s7653p/202002/8334a8326dd94d329df351d7da8aefc2.shtml?from=timeline. 2020.89. Han YY, Zhao MR, Shi B, Song ZH, Zhou SP, He Y. Aplicarea protocoalelor de medicină integrativă pentru tratamentul bolii coronavirus 2019. Chi Tradit Herbal Drugs. 1-5.90. Zhu YG, Deng ZW, Liu LH, Liu XH, Li XZ, Chen WH, Compilarea informațiilor despre medicamente pentru diagnosticul și tratamentul COVID-19 (versiunea 1) Central South Pharmacy. 1-14.91. Xu X, Zhang Y, Li X, Li XX. Analiza planului de prevenire a bolii virusului corona-19 (COVID-19) de către medicina tradițională chineză în diferite regiuni. Chin Herb Med. 2020. pp. 1-7.92. Zhao J, Tian SS, Yang J, Liu J, Zhang WD. Investigarea mecanismului Qing-Fei-Pai-Du-Tang pentru tratamentul pneumoniei cu coronavirus nou prin farmacologie de rețea. Chin Herb Med. 2020. pp. 1-7.93. Yao KT, Liu MY, Li X, Huang JH, Cai HB. Analiza clinică retrospectivă privind tratamentul pneumoniei noi infectate cu coronavirus cu medicina tradițională chineză Lianhua Qingwen. Chin J Exp Tradit Med Form. 2020. pp. 1-7.94. Lv RB, Wang WJ, Li X. Tratamentul suspectat de pneumonie cu coronavirus nou cu medicina chineză Lianhua Qingwen Observarea clinică a 63 de cazuri suspecte. J Tradit Chin Med. 2020. pp. 1–5.95. Zhang JW, Hu X, Jin PF. Furtuni de citokine cauzate de 2019-nCoV și terapia medicamentoasă. Jurnalul farmaceutic chinez. 2020. pp. 1-9. 96.96. Chen X, Yang D, Shen W, Dong HF, Wang JM, Oppenheim JJ. și colab. Caracterizarea acidului chenodeoxicolic ca antagonist endogen al receptorilor peptidici formilici cuplați la G. Inflamm Res. 2000; 49 : 744–55. [ PubMed ] [ Google Scholar ]97. Chen X, Mellon RD, Yang L, Dong H, Oppenheim JJ, Howard OM. Efectele de reglementare ale acidului deoxicolic, o componentă a medicinei tradiționale antiinflamatoare chineze Niuhuang, asupra răspunsului leucocitelor umane la chimiotratanți Biochem Pharmacol. 2002; 63 : 533–41. [ PubMed ] [ Google Scholar ]98. Chen X, Beutler JA, McCloud TG, Loehfelm A, Yang L, Dong HF. și colab. Acidul tanic este un inhibitor al CXCL12 (SDF-1alpha) / CXCR4 cu activitate antiangiogenă. Clin Cancer Res. 2003; 9 : 3115–23. [ PubMed ] [ Google Scholar ]99. Chen X, Yang L, Zhang N, Turpin JA, Buckheit RW, Osterling C. și colab. Shikonin, o componentă a medicinei de plante chinezești, inhibă funcția receptorilor de chemokine și suprimă virusul imunodeficienței umane de tip 1. Agenți antimicrobieni Chemother. 2003; 47 : 2810–6. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]100. Chen X, Oppenheim JJ, Howard OM. Chemokinele și receptorii chemokinelor ca ținte terapeutice noi în artrita reumatoidă (RA): efecte inhibitoare ale componentelor medicinale tradiționale chinezești. Cell Mol Immunol. 2004; 1 : 336–42. [ PubMed ] [ Google Scholar ]101. Chen X, Murakami T, Oppenheim JJ, Howard OM. Triptolida, un element constitutiv al medicinei chinezești imunosupresoare, este un puternic supresor al maturării și traficului celulelor dendritice. Sânge. 2005; 106 : 2409-16. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]102. He J, He ZD, Chen X. Efectele componentelor medicinale chinezești asupra receptorilor de chemokine: teorie, rezultate și metodologie. Metode de cercetare bazate pe dovezi pentru medicina chineză. 2016. pp. 187–97.103. Chen YB, Chen X. Componenta din plante antice poate fi un nou tratament terapeutic pentru artrita gută. J Leukoc Biol. 2019; 105 : 7-9. [ PubMed ] [ Google Scholar ]104. Wang J, Qiao LF, Li YS, Yang GT. Injecția Shen Fu activează macrofagul NF-kB alveolar al șobolanilor indus de LPS. Acta Medicinae Universitatis Scientiae și Technologiae Huazhong. 2009; 1 : 15–8. [ Google Scholar ]105. Chang XJ, Xiao W, Zhang S, Chang YP, Chen CM, Chen J. și colab. Mecanismul injecției Re Du Ning asupra leziunii pulmonare anti-acute la șobolani pe baza furtunii de citokine. Chin Herb Med. 2014; 46 : 236-9. [ Google Scholar ]

106. Zou HM, He TZ, Chen X. Tetrandrina inhibă diferențierea subgrupurilor proinflamatorii de celule T helper, dar schimbă diferențierea de novo a celulelor iTreg. Int Immunopharmacol. 2019; 69 : 307-12. [ PubMed ] [ Google Scholar ]

107. Chen H, Du Q. Compuși naturali potențiali pentru prevenirea infecției 2019-nCoV. Preimprimări. 2020.

108. Ng AWT, Poon SL, Huang MN, Lim JQ, Boot A, Yu W, acizii Aristolochic și derivații lor sunt implicați pe scară largă în cancerele de ficat din Taiwan și din toată Asia. Sci Trans Med. 2017. 9. [ PubMed ]

109. Zeng ZP, Jiang JG. Analiza reacțiilor adverse induse de medicamentele derivate din produse naturale. Br J Pharmacol. 2010; 159 : 1374–91. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

110. Fugh-Berman A. Interacțiuni dintre plante și medicamente. Lancet. 2000; 355 : 134–8. [ PubMed ] [ Google Scholar ]

111. Liu LS, Lei N, Lin Q, Wang WL, Yan HW, Duan XH. Efectele și mecanismul pulberii Yinqiao asupra infecției tractului respirator superior. Int J Biotechnol Wellness Ind. 2015; 4 : 57–60. [ Google Scholar ]

112. Fu YJ, Yan YQ, Qin HQ, Wu S, Shi SS, Zheng X. și colab. Efectele diferitelor principii ale tratamentului cu medicina tradițională chineză asupra căii de semnalizare TLR7 / NF-κB la șoarecii infectați cu virusul gripal. Chin Med. 2018; 13 : 42. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

113. Lau JT, Leung PC, Wong EL, Fong C, Cheng KF, Zhang SC. și colab. Utilizarea unei formule pe bază de plante de către lucrătorii din domeniul spitalului în timpul epidemiei de sindrom respirator acut sever din Hong Kong pentru a preveni transmiterea severă a sindromului respirator acut, ameliorarea simptomelor legate de gripă și îmbunătățirea calității vieții: un studiu prospectiv de cohortă. J Altern Complement Med. 2005; 11 : 49–55. [ PubMed ] [ Google Scholar ]

114. Du CY, Zheng KY, Bi CW, Dong TT, Lin H, Tsim KW. Yu Ping Feng San, un decoct din plante vechi din China, induce expresia genică a proteinelor antivirale și inhibă activitatea neuraminidazei. Phytother Res. 2015; 29 : 656-61. [ PubMed ] [ Google Scholar ]

115. Gao J, Li J, Shao X, Jin Y, Lu XW, Ge JF. și colab. Efectele antiinflamatorii și imunoreglatorii ale glucozidelor totale din pulberea de Yupingfeng. Chin Med J (Engl) 2009; 122 : 1636–41. [ PubMed ] [ Google Scholar ]

116. Zhang H, Chen Q, Zhou W, Gao S, Lin H, Ye S. și colab. Medicină chineză injecție shuanghuanglian pentru tratamentul infecției acute a tractului respirator superior: o revizuire sistematică a studiilor controlate randomizate. Complement Evid Based Alternat Med. 2013; 2013 : 987326. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]

117. Xiao GL, Song K, Yuan CJ ea. Un raport literar despre tratamentul SARS pe etape cu medicina tradițională chineză. J Emerg Chin Med Hunan. 2005. pp. 53-5.

118. Bao L, J M. Progresul cercetării lui Da Yuan Yin privind tratamentul bolilor infecțioase. Emerg Tradit Chin Med. 2010; 2 : 263-87. [ Google Scholar ]

119. Kim DE, Min JS, Jang MS, Lee JY, Shin YS, Song JH. și colab. Alcaloizii Bis-Benzilizochinolinei naturali-Tetrandrina, Fangchinolina și Cefarantina, inhibă infecția cu Coronavirus uman OC43 Infecția cu celulele pulmonare umane MRC-5. Biomolecule. 2019; 9 : 696. [ Articol gratuit PMC ] [ PubMed ] [ Google Scholar ]


Articolele din Jurnalul Internațional de Științe Biologice sunt furnizate aici prin amabilitatea Ivyspring International Publisher

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7098036/

(Mana) Maicii Domnului ne scapa de covid19 mai rapid – studiu clinic

Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea noului coronavirus SARS-CoV-2 și accelerează negativarea PCR pacienților infectați Covid19

Descoperiri celulare volum 6 , Număr articol:  54 ( 2020 ) Citați acest articol

Draga editorule,

Pandemia bolii Coronavirus 2019 (COVID-19) este una dintre cele mai grave crize de sănătate publică la nivel mondial până în prezent. Începând cu 12 iulie 2020, peste 12,6 milioane de cazuri de infecție COVID-19 cu 0,56 milioane de decese au fost confirmate în întreaga lume 1 . Deoarece nu există terapii eficiente pentru tratarea sindromului respirator acut sever coronavirus 2 (SARS-CoV-2, virusul cauzal al infecției cu COVID-19) până acum, pandemia se răspândește rapid în întreaga lume. Este urgent să se dezvolte terapii eficiente, nu numai pentru a trata pacienții infectați, ci și pentru a controla pandemia.

Studiile noastre anterioare au demonstrat că un microARN al plantei, MIR2911, care este îmbogățit în decoct de caprifoi/Mana Maicii Domnului (HD), vizează în mod direct virusurile gripei A (IAV), inclusiv subtipurile H1N1, H5N1 și H7N9 prin legarea la ARNm și blocarea translației proteinelor. Administrarea orală de Mana Maicii Domnului HD poate preveni infecția IAV și reduce moartea de șoarece indusă de H5N1 2 . Studiile ulterioare au arătat că MIR2911 inhibă, de asemenea, direct replicarea diferiților viruși, în plus față de IAV-urile 3 , 4 . După absorbția dietetică, acești microARN se autoasamblează în exosomi și sunt apoi secretați în circulație și livrați în țesuturile țintă sau celule specifice, inclusiv ficatul, plămânul, splina, pancreasul și celulele T 5 , 6 , 7. Având în vedere compoziția unică de nucleotide îmbogățită cu GC a MIR2911 (GGCCGGGGGACGGACACGGGA) și după ce am analizat secvența genomului SARS-CoV-2, este cel mai probabil ca genomul virusului să conțină situri de legare MIR2911 și că MIR2911 poate inhiba SARS-CoV-2 replicare directă. În studiul de față, am evaluat efectul inhibitor al absorbției MIR2911 în HD asupra replicării SARS-CoV-2 și am efectuat un studiu clinic pentru a investiga eficacitatea HD la pacienții cu COVID-19.

Prin utilizarea analizei bioinformatice, am prezis că există 179 site-uri putoase de legare MIR2911 în genomul SARS-CoV-2. Douăzeci și opt de situri de legare (tabelul suplimentar S1 ) au fost confirmate prin testul clasic al luciferazei (fig. Suplimentară S1 ), care sunt distribuite pe scară largă în genomul virusului (fig. 1a ), indicând faptul că MIR2911 ar putea inhiba traducerea a aproape toate proteinele SARS-CoV-2.

figura 1
Fig. 1: MIR2911 absorbit în HD inhibă direct replicarea SARS-CoV-2.

Pentru a evalua efectul direct al MIR2911 absorbit asupra replicării SARS-CoV-2, exosomii celulari au fost colectați din mediul de cultură al celulelor HEK293T transfectate cu MIR2911 sintetic sau ARN necodificator de control (ncRNA), ca metodă similară raportului anterior 5 ( Fig. 1b ). Exosomii celulari izolați cu / fără MIR2911 au fost pre-incubați separat cu 5 × 10 4 celule Vero E6 (ATCC-1586) în 0,25 ml mediu celular timp de 8 ore. După schimbarea mediului de cultură, celulele au fost infectate cu SARS-CoV-2 (nCoV-2019BetaCoV / Wuhan / WIV04 / 2019 8) la o multiplicitate de infecție (MOI) de 0,01. Eficacitățile au fost evaluate prin cuantificarea numărului de copii virale în supernatantul celular prin RT-PCR cantitativă în timp real (qRT-PCR) la 24 ore după infecție (pi) (Fig. 1b ). Așa cum se arată în Fig. 1c , exosomul celular-MIR2911 la concentrația de 13,2 pM a inhibat replicarea virusului 93% (de la 4,09 × 10 9 la 2,87 × 10 8 copii / ml), indicând faptul că MIR2911 absorbit inhibă direct și suficient replicarea SARS-CoV-2 (Fig. 1c). Apoi, am evaluat efectul inhibitor al MIR2911 absorbit în HD asupra replicării SARS-CoV-2. Deoarece MIR2911 absorbit în HD este livrat în plămâni prin exosomi prin circulație, exosomii izolați din 62,5 μl de ser donator înainte și după ce au băut 200 ml HD (30 g caprifoi uscat) separat au fost pre-incubați cu 5 × 10 4 celule Vero E6, ca condiție similară cu cea a exosomului celular-MIR2911 (Fig. 1b ). Concentrația MIR2911 în 200 ml HD a fost de 52,5 pM (10,5 pmol / 200 ml / 30 g de caprifoi uscat). Nivelurile serice de MIR2911 în trei receptoare de sănătate după ce au băut timp de 2 ore au fost de 0,42, 0,45 și 1,13 pM (Fig. 1d), care erau nedetectabile înainte de băut). Exozomii (niveluri MIR2911: înainte de băut, nedetectabili; după băut, au fost 9,9, 14,4 și 19,4 amoli) au fost pre-incubați cu 5 × 10 4 celule (Fig. 1e , ~ 180 de copii ale MIR2911 / celulă). Așa cum se arată în Fig. 1e , exosomii care conțin MIR2911 au inhibat semnificativ replicarea virusului (Fig. 1e ). Nu există nicio diferență de viabilitate celulară între exosomi cu / fără MIR2911 colectate de la același donator înainte și după consumul HD (Fig. S2 suplimentar ). Aceste rezultate sugerează cu tărie că MIR2911 este suficient absorbit de consumatorii care consumă HD și că MIR2911 absorbit blochează semnificativ replicarea SARS-CoV-2.

Studiu clinic

Pentru a evalua efectul antiviral al MIR2911 în HD asupra pacienților cu COVID-19, am efectuat un studiu clinic. Șaptezeci și cinci de pacienți de tip moderat COVID-19 care au primit terapie antivirală de rutină (RT) la Spitalul II din Nanjing din ianuarie 2020 până în martie 2020 au fost înscriși în acest studiu. Pacienții au fost împărțiți în două grupuri pe baza tratamentului suplimentar cu MIR2911 în grupul Mana Maicii Domnului HD (MIR2911 + ) sau amestec de medicină tradițională chineză (TCM) (MIR2911  ) în plus față de terapia de rutina antivirala RT. Obiectivul principal a fost rata de conversie negativă în a 7-a zi de la primul tratament. Au fost 6 și 69 pacienți din MIR2911 + și MIR2911  grupuri, respectiv (Tabelele suplimentare S2 – S4). Rata de conversie negativă în a 7-a zi în grupul MIR2911 +  fost de 83,3%, care a fost îmbunătățită dramatic comparativ cu cea a pacienților tratați cu MIR2911  (26,1%, P  = 0,004) (Fig. 1g, f ).

Timpul necesar pentru a deveni SARS-CoV-2 PCR-negativ (TTN) a fost de asemenea, in favoarea pacienții tratați cu HD-MIR2911 (mediană 4.0 vs. 12,0 zile, HR 0,28, IC 95% 0,12-0,67, P  = 0,005) (Fig. 1g , f ).

TTN median al pacienților bărbați în MIR2911 + (1 caz) și MIR2911  (38 cazuri) este de 5,0 zile și 11,0 zile (HR 0,003, IC 95% 0,000018-0,52, P  = 0,027), respectiv.

TTN median al pacienților de sex feminin în MIR2911 +(5 cazuri) și grupurile MIR2911  (31 cazuri) sunt de 3,0 zile și 12,0 zile (HR 0,15, IC 95% 0,031-0,68, P  = 0,014), respectiv.

Mana Maicii Domnului/HD este folosita pentru a trata infecțiile virale de o mie de ani în China. Studiile anterioare au demonstrat că MIR2911 (0,06-0,18 pmol / zi) în 1-3 ml HD inhibă în mod semnificativ replicarea virusului gripal la 20 g șoarece 2 . În plus față de Farmacopeea din Republica Populară Chineză 9 , am ales 30 g de caprifoi uscat (nivel MIR 2911: 10,5 pmol) pe zi pentru utilizare. Rezultatele noastre demonstrează că 30 g de caprifoi uscat este sigur pentru utilizare (tabelul suplimentar S4 ) și are o funcție antivirală suficientă (Fig. 1d, e). Pe de altă parte, datele conform cărora MIR2911 (~ 60 fM) în exosomi inhibă semnificativ replicarea virusului nu numai că confirmă activitatea antivirală extra-ridicată a MIR2911 (comparativ cu cea a remdesivirului: 3,7 μM și a Clorochinei: 10 μM10, dar oferă și o strategie nouă conform căreia utilizarea exosomilor serici colectați de la un donator sănătos oferă cea mai similară condiție in vivo pentru a evalua eficacitatea potențialelor medicamente in vitro.

Pe scurt, rezultatele noastre sugerează că MIR2911 absorbit de plante caprifoi/Mana Maicii Domnului/ HD inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Tratamentul cu Mana Maicii Domnului HD ar putea ajuta la vindecarea pacienților infectați și la oprirea pandemiei COVID-19.

Referințe

  1. 1.OMS. Raport de situație a bolii coronavirus 2019 (COVID-19)-174. https://www.who.int/docs/default-source/coronaviruse/situation-reports/20200712-covid-19-sitrep-174 (2020).
  2. 2.Zhou, Z. și colab. MicroRNA2911 atipic codificat cu caprifoi vizează direct virusurile gripei A. Rez. Celulare 25 , 39–49 (2015).CAS Articol Google Scholar 
  3. 3.Huang, Y. și colab. MicroRNA2911 derivat din caprifoi inhibă direct replicarea virusului varicela-zoster prin direcționarea genei IE62. J. Neurovirol. 25 , 457–463 (2019).CAS Articol Google Scholar 
  4. 4.Li, X. și colab. MicroRNA2911 codificat cu caprifoi inhibă replicarea Enterovirus 71 prin direcționarea genei VP1. Antivir. Rez. 152 , 117–123 (2018).CAS Articol Google Scholar 
  5. 5.Zhang, L. și colab. Planta exogenă MIR168a vizează în mod specific LDLRAP1 la mamifere: dovezi ale reglării încrucișate prin microARN. Rez. Celulare 22 , 107–126 (2012).CAS Articol Google Scholar 
  6. 6.Zhao, C., Sun, X. și Li, L. Biogeneza și funcția miARN extracelulare. ExRNA 1 , 38 (2019).Articol Google Scholar 
  7. 7.Zhang, S. & Hong, Z. ARN-uri mobile – elful magic care călătorește între plantă și organismele asociate. ExRNA 1 , 8 (2019).Articol Google Scholar 
  8. 8.Zhou, P. și colab. Un focar de pneumonie asociat cu un nou coronavirus de origine probabilă a liliecilor. Natura 579 , 270-273 (2020).CAS Articol Google Scholar 
  9. 9.Comisia, Farmacopeea CP din Republica Populară Chineză , Vol. I 221 (Editura Medicală a Poporului, 2010).
  10. 10.Wang, M. și colab. Remdesivirul și clorochina inhibă în mod eficient noul coronavirus recent apărut (2019-nCoV) in vitroRez. Celulare 30 , 269-271 (2020).CAS Articol Google Scholar 

Descărcați referințele

Mulțumiri

Mulțumim lui Wei Ye, Yun Chi, Cong Cheng, Lanlan Ma, Guangchang Dai și Qian Shi, de la cel de-al doilea spital din Nanjing, pentru asistența lor în studiul clinic (numărul de registru al studiului clinic chinez, ChiCTR2000029822). În plus, îi mulțumim dr. Zhibin Hu (Universitatea de Medicină din Nanjing) pentru comentariile sale asupra lucrării. Această lucrare a fost susținută de subvenții din cadrul proiectului chinez de știință și tehnologie major al Chinei (2015ZX09102023-003), Programul național de cercetare de bază din China (Programul 973) (2014CB542300 și 2012CB517603), Fundația Națională de Științe Naturale din China (81250044, 81602697 și 31742075 ) și Fundația pentru Științe Naturale din provincia Jiangsu (BE2016737), Fondurile fundamentale de cercetare pentru universitățile centrale (020814380146) și Talentul pentru tineret medical din provincia Jiangsu (QNRC2016056).

Informatia autorului

Note de autor

  1. Acești autori au contribuit în mod egal: Li-Kun Zhou, Zhen Zhou, Xia-Ming Jiang, Yishan Zheng

Afilieri

  1. Nanjing Drum Tower Hospital Center of Molecular Diagnostic and Therapy, Laboratorul cheie de stat de biotehnologie farmaceutică, Jiangsu Engineering Research Center for MicroRNA Biology and Biotechnology, NJU Advanced Institute of Life Sciences (NAILS), NJU Institute of AI Biomedicine and Biotechnology, School of Life Sciences , Universitatea Nanjing, Nanjing, Jiangsu 210023, ChinaLi-Kun Zhou, Zhen Zhou, Xi Chen, Zheng Fu și Chen-Yu Zhang
  2. Tianjin Medical University Cancer Institute and Hospital, Centrul Național de Cercetare Clinică pentru Cancer, Centrul de Cercetare Clinică pentru Cancer din Tianjin, Laboratorul cheie de prevenire și terapie a cancerului, Tianjin, 300060, ChinaLi-Kun Zhou
  3. Laboratorul cheie de stat de virologie, Institutul de virologie Wuhan, Centrul pentru Mega-Științe în domeniul biosecurității, Academia Chineză de Științe, Wuhan, Hubei 430071, ChinaXia-Ming Jiang, Gengfu Xiao și Lei-Ke Zhang
  4. Departamentul de Medicină de îngrijire critică și Centrul de boli infecțioase din Nanjing, al doilea spital din Nanjing, Universitatea de Medicină Chineză din Nanjing, Nanjing, Jiangsu 210003, ChinaYishan Zheng și Yongxiang Yi

Contribuții

YY, L.-K.Zhang și C.-YZ au conceput și proiectat experimentele; L.-K.Zhou, ZZ, X.-MJ, YZ și ZF au participat la mai multe experimente; L.-K.Zhou, ZZ, GX, CZ, L.-K.Zhang și XC au analizat datele. L.-K.Zhou, ZZ, C.-YZ și L.-K.Zhang au scris lucrarea. C.-YZ, L.-K.Zhang și YY au furnizat aprobarea finală a lucrării.

Autori corespondenți

Corespondență cu Chen-Yu Zhang sau Lei-Ke Zhang sau Yongxiang Yi .

Declarații de etică

Conflict de interese

Autorii declară că nu au niciun conflict de interese.

Informatii suplimentare

Nota editorului Springer Nature rămâne neutră în ceea ce privește revendicările jurisdicționale din hărțile publicate și afilierile instituționale.

Informatie suplimentara

Informatie suplimentara

Acces liber Acest articol este licențiat sub o licență internațională Creative Commons Attribution 4.0, care permite utilizarea, partajarea, adaptarea, distribuirea și reproducerea în orice mediu sau format, atâta timp cât acordați creditul autorului (autorilor) original (e) și sursei, furnizați un link către licența Creative Commons și indicați dacă s-au făcut modificări. Imaginile sau alte materiale ale terților din acest articol sunt incluse în licența Creative Commons a articolului, cu excepția cazului în care se indică altfel într-o linie de credit pentru material. Dacă materialul nu este inclus în licența Creative Commons a articolului și utilizarea intenționată a dvs. nu este permisă de reglementările legale sau depășește utilizarea permisă, va trebui să obțineți permisiunea direct de la titularul drepturilor de autor. Pentru a vizualiza o copie a acestei licențe, vizitațihttp://creativecommons.org/licenses/by/4.0/ .

Reimprimări și permisiuni

Despre acest articol

Verificați moneda și autenticitatea prin CrossMark

Citați acest articol

Zhou, L., Zhou, Z., Jiang, X. și colab. Planta absorbită MIR2911 în decoctul de caprifoi inhibă replicarea SARS-CoV-2 și accelerează conversia negativă a pacienților infectați. Cell Discov 6, 54 (2020). https://doi.org/10.1038/s41421-020-00197-3

Descărcați citația

  • Primit07 iunie 2020
  • Admis12 iulie 2020
  • Publicat05 august 2020

https://www.nature.com/articles/s41421-020-00197-3

vitamina D, magneziu și vitamina B12 (DMB) in tratarea COVID-19

Un studiu de cohortă pentru a evalua efectul combinației de vitamina D, magneziu și vitamina B12 (DMB) asupra progresiei către rezultatul sever la pacienții mai în vârstă cu COVID-19.

Obiectiv: Determinarea rezultatelor clinice ale pacienților mai în vârstă cu COVID-19 care au primit DMB comparativ cu cei care nu au primit. Am emis ipoteza că mai puțini pacienți cărora li s-a administrat DMB ar necesita terapie cu oxigen și / sau asistență pentru terapie intensivă decât cei care nu au făcut-o.

Metodologie: Studiu observațional de cohorta la toți pacienții COVID-19 spitalizați consecutiv cu vârsta de peste 50 de ani într-un spital universitar terțiar care au primit D3MgB12(DMB) comparativ cu o cohortă recentă care nu a primit. Pacienților li s-au administrat vitamina D3 orală 1000 UI OD, magneziu 150 mg OD și vitamina B12 500 mcg OD (DMB) la internare dacă nu au necesitat oxigenoterapie. Rezultatul primar a fost deteriorarea administrării post-DMB, ducând la orice formă de terapie cu oxigen și / sau asistență pentru terapie intensivă.

Rezultate: Între 15 ianuarie și 15 aprilie 2020, au fost identificați 43 de pacienți consecutivi cu COVID-19 cu vârsta ≥50.17 pacienți au primit DMB și 26 de pacienți nu au primit. Caracteristicile demografice de bază între cele două grupuri au fost semnificativ diferite în ceea ce privește vârsta. În analiza univariantă, vârsta și hipertensiunea au arătat o influență semnificativă asupra rezultatului, în timp ce DMB a păstrat semnificația de protecție după ajustarea separată pentru vârstă sau hipertensiune în analiza multivariată.

Mai puțini pacienți cu DMB decât controalele au necesitat inițierea terapiei cu oxigen în timpul spitalizării (17,6% față de 61,5%, P = 0,006). Expunerea la DMB a fost asociată cu cote de 0,13 (IÎ 95%: 0,03 – 0,59) și 0,20 (IÎ 95%: 0,04 – 0,93) pentru oxigenoterapie și / sau asistență pentru terapie intensivă pe analize univariate și respectiv multivariate. Concluzii:Combinația DMB la pacienții vârstnici cu COVID-19 a fost asociată cu o reducere semnificativă a proporției pacienților cu deteriorare clinică care necesită sprijin pentru oxigen și / sau sprijin pentru terapie intensivă.

Acest studiu susține alte studii de control randomizat mai mari pentru a stabili beneficiul deplin al DMB în ameliorarea severității COVID-19.

Chuen Wen Tan , Liam Pock Ho , Shirin Kalimuddin , Benjamin Pei Zhi Cherng , Yii Ean Teh , Siew Yee Thien , Hei Man Wong , Paul Jie Wen Tern , Jason Wai Mun Chay , Chandramouli Nagarajan , Rehena Sultana , Jenny Guek Hong Low , Heng Joo Ngdoi:https://doi.org/10.1101/2020.06.01.20112334Publicat acum în Nutriție doi: 10.1016 / j.nut.2020.111017

https://www.medrxiv.org/content/10.1101/2020.06.01.20112334v2

tratament covid19 confirmat – vitamina D3 – impact asupra severitatii bolii

reiau acest studiu clinic care arata ca un nivel optim de vitamina D3 ( mai precis peste 40 ng/ml …de preferat 60 ng/ml 25 hidroxivitaminaD , nivel atins cu administrare zilnica de 8000-10.000 UI sau , de preferat pentru a evita hipercalcemia 50.000 UI intr-o doza saptamanala ) reduce drastic severitatea bolii ( din 50 de pacienți tratați cu calcifediol, unul a necesitat internare în ATI (2%), nici unul nu a murit, toti au fost externati, în timp ce din 26 de pacienți netratați, 13 au necesitat admitere ATI (50%), 2 au murit valoare p X 2 test Fischer p <0,001)

administrarea unei doze mari de calcifediol sau 25-hidroxivitamină D, principalul metabolit al sistemului endocrin al vitaminei D, a redus semnificativ nevoia de tratament ICU(ATI) la pacienții care necesită spitalizare datorită COVID-19 dovedit

Va rog sa il recititi integral:

https://tratamenteanticancer.wordpress.com/2020/09/09/efectul-tratamentului-cu-calcifediol-si-cea-mai-buna-terapie-disponibila-versus-cea-mai-buna-terapie-disponibila-la-admiterea-in-unitati-de-terapie-intensiva-si-mortalitate-la-pacientii-spitalizati

puteti reciti si acest studiu care arata ca deficitul de vitamina D VDD a fost mai răspândit în rândul pacienților care au necesitat internarea în ATI și, prin urmare, VDD ar putea fi un factor determinant al gravității bolii https://tratamenteanticancer.wordpress.com/2020/09/10/nivelurile-serice-scazute-de-25-hidroxivitamina-d-25-oh-d-la-pacientii-spitalizati-cu-covid-19-sunt-asociate-cu-o-severitate-mai-mare-a-bolii/

Eficacitatea Ivermectinei ca terapie suplimentară în managementul COVID-19 (studiu Pilot )

medRxiv – Boli infecțioase 

Pub Data: 2020-07-08 , DOI: 10.1101 / 2020.07.07.20145979 

Faiq I. Gorial; Sabeeh Mashhadani; Hend M Sayaly; Basim Dhawi Dakhil; Marwan M AlMashhadani; Adnan M Aljabory; , Hassan M Abbas; Mohammed Ghanim; Jawad I Rasheed

Context: Până în prezent nu a fost demonstrată nicio terapie eficientă pentru COVID-19. In vitro, studiile au indicat că ivermectina (IVM) are efect antiviral.

Obiective: Evaluarea eficacității ivermectinei (IVM) ca terapie suplimentară la hidroxiclorochină (HCQ) și azitromicină (AZT) în tratamentul COVID-19.

Metode: Acest studiu clinic pilot efectuat pe pacienți adulți spitalizați cu COVID-19 ușor până la moderat diagnosticat în conformitate cu îndrumările intermediare ale OMS. Șaisprezece pacienți au primit o doză unică de IVM 200Mcg / kg în ziua internării ca tratament suplimentar la hidroxiclorochină (HCQ) și azitromicină (AZT) și au fost comparați cu 71 de controale primite HCQ și AZT, potrivite în funcție de vârstă, sex, caracteristici clinice și comorbidități. Rezultatul principal a fost procentul de pacienți vindecați,definite ca simptome libere de externare din spital și 2 teste consecutive PCR negative din tampoane nazofaringiene la cel puțin 24 de ore distanță. Rezultatele secundare au fost timpul de vindecare în ambele grupuri și evaluate prin măsurarea timpului de la internarea pacientului la spital până la externare.

Rezultate: Din 87 de pacienți incluși în studiu, vârsta medie ± SD (interval) a pacienților din grupul IVM a fost similară cu martorii [44,87 ± 10,64 (28-60) față de 45,23 ± 18,47 (8-80) ani, p = 0,78] Majoritatea pacienților din ambele grupuri au fost bărbați, dar statistic nesemnificativi [11 (69%) față de 52 (73%), cu raport bărbați: femei 2,21 față de 2,7-, p = 0,72)

Toți pacienții din grupul IVM au fost vindecați comparativ cu controalele [16 (100%) vs 69 (97,2%)]. Doi pacienți au murit la controale.

Timpul mediu de ședere în spital a fost semnificativ mai mic în grupul IVM comparativ cu controalele (7,62 ± 2,75 față de 13,22 ± 0,90 zile, p = 0,00005, dimensiunea efectului = 0,82).

Nu s-au observat evenimente adverse

Concluzii: utilizarea suplimentară a IVM la HCQ și AZT a avut o eficacitate mai bună, ședere mai scurtă la spital și relativ sigur în comparație cu controalele. cu toate acestea, poate fi necesar un studiu prospectiv mai amplu, cu urmărire mai lungă, pentru a valida aceste rezultate

.更新 日期 : 08-07-2020

https://www.x-mol.com/paper/1281102007506747392

perfuzie cu doză mare de vitamina C pentru tratamentul bolilor critice COVID-19

Jing Zhang, Xin Rao, Yiming Li, Yuan Zhu, Fang Liu, Guangling Guo, Guoshi Luo, Zhongji Meng, Daniel De Backer, Hui Xiang, Zhi-Yong Peng
DOI:
10.21203 / rs.3.rs-52778 / v1
Descărcați PDF
LICENȚĂ:
Această lucrare este licențiată sub o licență internațională Creative Commons Attribution 4.0. Citiți licența completă

Abstract

fundal

Niciun medicament specific nu s-a dovedit eficient pentru tratamentul pacienților cu boală coronavirus severă 2019 (COVID-19). Aici, am testat dacă perfuzia cu doze mari de vitamina C a fost eficientă pentru COVID-19 sever.

Metode

Acest studiu clinic randomizat și controlat a fost efectuat la 3 spitale din Hubei, China. Pacienții cu infecție confirmată cu sindrom respirator acut sever coronavirus 2 (SARS-CoV-2) în UCI au fost repartizați în mod aleatoriu în raport de 1: 1 fie cu doza mare de vitamina C intravenoasă (HDIVC), fie cu placebo. Grupul HDIVC a primit 12 g de vitamina C / 50 ml la fiecare 12 ore timp de 7 zile la o rată de 12 ml / oră, iar grupul placebo a primit apă bacteriostatică pentru injecție în același mod. Rezultatul principal a fost zile invazive fără ventilație mecanică în 28 de zile (IMVFD28). Rezultatele secundare au fost mortalitatea de 28 de zile, insuficiența organelor și progresia inflamației.

Rezultate

Cincizeci și patru de pacienți critici cu COVID-19 au fost recrutați în cele din urmă. Nu a existat nicio diferență în IMVFD28 între două grupuri. În timpul perioadei de tratament de 7 zile, pacienții din grupul HDIVC au avut o creștere constantă a PaO 2 / FiO 2 (ziua 7: 229 față de 151 mmHg, IC 95% 33 la 122, P = 0,01). Pacienții cu scoruri SOFA ≥ 3 din grupul HDIVC au prezentat o reducere semnificativă a mortalității de 28 de zile (P = 0,05) în analiza de supraviețuire univariată. IL-6 în grupul VC a fost mai mic decât cel din grupul placebo (19,42 vs. 158,00; 95% CI -301,72 până la -29,79; P = 0,04) în ziua 7.

Concluzie

Adăugarea HDIVC poate oferi un efect clinic protector fără evenimente adverse la pacienții cu boală critică cu COVID-19.

Identificator Clinicaltrial.gov: NCT04264533

CUVINTE CHEIE
Doza mare de vitamina C intravenoasă, boala Coronavirus 2019, Sindromul respirator acut sever Coronavirus 2

Figures

Figure 1

Figure 1Figure 2

Figure 2Figure 3

Figure 3

Introducere

Infecția cu sindrom respirator acut sever coronavirus 2 (SARS-CoV-2) a devenit o problemă de sănătate globală, cu peste 400.000 de decese în întreaga lume [1, 2]. În timp ce majoritatea pacienților prezentau simptome ușoare și nici măcar nu aveau nevoie de spitalizare [3], aproape 30% dintre pacienții adulți suferă de pneumonie severă și sindrom de detresă respiratorie acută (ARDS), adesea asociată cu sepsis sau șoc septic și organ multiplu ( insuficiență renală, hepatică și cardiacă). Pacienții cu ARDS și complicații sistemice necesită îngrijiri critice și [4] se complică cu un risc mai mare de deces (28%) [5, 6] Din cauza lipsei de medicamente eficiente împotriva SARS-COV-2, principalul tratament este terapia de susținere.

Similar cu fiziopatologia sindromului respirator acut sever (SARS), infecția cu SARS-CoV-2 stimulează sistemul imunitar înnăscut, provocând numeroase tipuri de eliberare de citokine, și anume, o „furtună de citokine”, inducând răspuns inflamator sistemic [7, 8] și insuficiență multiplă a organelor [9, 10]. Un studiu retrospectiv asupra SARS a sugerat că agravarea după 2 săptămâni nu a fost legată de replicarea virală necontrolată, ci de afectarea imunopatologică [11]. Prin urmare, terapia antivirală singură poate fi insuficientă pentru tratarea pacienților cu COVID-19.

Vitamina C (acid ascorbic, ascorbat) funcționează ca un puternic antioxidant solubil în apă prin eliminarea directă a radicalilor liberi de oxigen și acționează ca un co-factor esențial pentru producerea de catecolamine, vasopresină și cortizol în corpul uman [12]. Vitamina C se găsește și în concentrații mari în leucocite și implicată în mai multe răspunsuri și funcții imune [13]. Dovezile emergente din studiile preclinice au indicat faptul că vitamina C a jucat un rol crucial în ameliorarea efectelor inflamației prin inhibarea producției de citokine proinflamatorii, asistarea imunoreglării, neutralizarea speciilor reactive de oxigen (ROS) și protejarea celulelor gazdă [14, 15]. Hipovitaminoza C a fost omniprezentă la pacienții cu afecțiuni critice și aproximativ 40% dintre pacienți prezentau un deficit sever [16],în timp ce nivelul seric scăzut al vitaminei C nu poate fi corectat prin suplimentarea orală din cauza farmacocineticii [17]. Astfel, doza mare de vitamina C intravenoasă (HDIVC) a fost adăugată la terapia standard a pacienților cu afecțiuni critice în studii recente, cum ar fi sepsis [18-20], ARDS [20, 21], chirurgie cardiacă [22] și arsură [ 23]. Rezultatele au arătat că HDIVC a fost sigur pentru pacienții cu afecțiuni critice și a redus semnificativ suportul vasopresor [24], leziunea limitată a organelor [25], a scurtat durata ventilației mecanice [26] și a șederii în terapie intensivă [27] și a îmbunătățit ratele de supraviețuire [18] . În plus, vitamina C are activitate antivirală nespecifică directă in vitro [28], deși nu este clar dacă aceasta conferă o protecție oamenilor cu COVID-19.doza mare de vitamina C intravenoasă (HDIVC) a fost adăugată la terapia standard a pacienților cu afecțiuni critice în studii recente, cum ar fi sepsis [18-20], ARDS [20, 21], chirurgie cardiacă [22] și arsură [23] . Rezultatele au arătat că HDIVC a fost sigur pentru pacienții cu afecțiuni critice și a redus semnificativ suportul vasopresor [24], leziunea limitată a organelor [25], a scurtat durata ventilației mecanice [26] și a șederii ICU [27] și a îmbunătățit ratele de supraviețuire [18] . În plus, vitamina C are activitate antivirală nespecifică directă in vitro [28], deși nu este clar dacă aceasta conferă o protecție oamenilor cu COVID-19.doza mare de vitamina C intravenoasă (HDIVC) a fost adăugată la terapia standard a pacienților cu afecțiuni critice în studii recente, cum ar fi sepsis [18-20], ARDS [20, 21], chirurgie cardiacă [22] și arsură [23] . Rezultatele au arătat că HDIVC a fost sigur pentru pacienții cu afecțiuni critice și a redus semnificativ suportul vasopresor [24], leziunea limitată a organelor [25], a scurtat durata ventilației mecanice [26] și a șederii în terapie intensivă [27] și a îmbunătățit ratele de supraviețuire [18] . În plus, vitamina C are activitate antivirală nespecifică directă in vitro [28], deși nu este clar dacă aceasta conferă o protecție oamenilor cu COVID-19.leziuni organice limitate [25], a scurtat durata ventilației mecanice [26] și a șederii în terapie intensivă [27] și a îmbunătățit ratele de supraviețuire [18]. În plus, vitamina C are activitate antivirală nespecifică directă in vitro [28], deși nu este clar dacă aceasta conferă o protecție oamenilor cu COVID-19.leziuni organice limitate [25], a scurtat durata ventilației mecanice [26] și a șederii în terapie intensivă [27] și a îmbunătățit ratele de supraviețuire [18]. În plus, vitamina C are activitate antivirală nespecifică directă in vitro [28], deși nu este clar dacă aceasta conferă o protecție oamenilor cu COVID-19.

Prin urmare, am emis ipoteza că HDIVC împreună cu tratamentele convenționale ar îmbunătăți rezultatele pentru pacienții adulți admiși la ICU din cauza COVID-19 severă prin prevenirea furtunilor de citokine și reducerea leziunilor pulmonare și a altor organe. În acest context, am realizat acest studiu clinic multicentric, randomizat, orb, pentru a oferi o strategie terapeutică pentru pacienții cu boală critică cu COVID-19.

Metode

Acest studiu este un studiu multicentric, randomizat, care a fost aprobat de comitetul de etică al spitalului Zhongnan al Universității Wuhan (# 2020001). Acest studiu a fost realizat în ICU-urile Spitalului Zhongnan din Universitatea Wuhan, Spitalul Leishenshan (Thunder God Mountain) și Spitalul Taihe din 14 februarie 2020 până pe 29 martie 2020. ICU-urile special pentru COVID-19 de la Spitalul Zhongnan și Spitalul Leishenshan au fost conduse de aceeași echipă. Procesul a fost înregistrat pe site-ul ClinicalTrials.gov (ID: NCT04264533) înainte de recrutarea pacientului.

Înscrierea pacientului

Pacienții au fost examinați și înscriși în urma admiterii la cele trei ICU-uri. Au fost îndeplinite următoarele criterii de includere: (1) vârsta ≥18 și <80 de ani; (2) RT-PCR pozitiv pentru SARS-CoV-2 [29]; (3) pneumonie confirmată prin imagistica toracică [29]; (4) PaO 2 / FiO 2(P / F) <300 mmHg; și (5) admiterea la ICU. Criteriile de excludere au fost alergia la vitamina C, sarcina sau alăptarea, durata de supraviețuire așteptată <24 ore și istoricul anterior de deficit de glucoză-6-fosfat dehidrogenază sau boală pulmonară în stadiu final. Pacienții care au fost deja înrolați în alte studii clinice au fost, de asemenea, excluși. În cazul în care aceste criterii au fost îndeplinite în termen de 48 de ore de la admiterea la ICU, s-a obținut consimțământul informat de la pacienți sau membrii familiei lor. Când timpul efectiv de tratament al pacienților a fost mai mic de 3 zile din cauza decesului sau externării din UTI, aceștia au fost eliminați din acest studiu. Motivul a fost că eficacitatea tratamentelor nu a putut fi evaluată cu perioade limitate de tratament.

Randomizare și alocare

Fiecare ICU a fost alocată cu un tabel numeric aleatoriu independent generat de Microsoft Excel 2019 numai de către investigatorul primar. Fiecare tabel avea un număr egal de 1 și 2, care reprezentau grupul placebo (perfuzie bacteriostatică cu apă) și respectiv grupul de tratament (HDIVC). Participanții au fost înscriși în grupul corespunzător în mod ordonat.

Intervenții de studiu

Pacienții au fost randomizați pentru a primi vitamina C sau placebo în termen de 48 de ore de la internare în UTI. Pentru a controla cu precizie ratele de perfuzie și a nu afecta gestionarea fluidelor la pacienții severi, am perfuzat vitamina C sau placebo prin cateterizare venoasă centrală controlată de o pompă. Grupurile de studiu din acest studiu au fost 1) HDIVC: 24 g vitamina C pe zi. Pacienților li s-a administrat perfuzie cu 12 g vitamina C diluată în 50 ml apă bacteriostatică la fiecare 12 ore la o rată de 12 ml / oră prin pompă de perfuzie timp de 7 zile. 2) Placebo: 50 ml de apă bacteriostatică perfuzată la fiecare 12 ore în același ritm. Intervențiile de studiu au fost inițiate în aceeași zi cu consimțământul informat și randomizarea. Pregătirea, transportul, depozitarea și utilizarea terapiilor (VC și apă bacteriostatică pentru injecție) au fost în conformitate cu protocolul de gestionare a medicamentelor din fiecare spital.În plus, alte tratamente generale au urmat cele mai recente linii directoare COVID-19 [29]. Evenimentele adverse legate de HDIVC au inclus (1) greață sau vărsături în timpul sau după perfuzia de VC; (2) perturbarea electrolitului; și (3) leziuni renale acute. Dacă s-au observat evenimente adverse la pacienții cu HDIVC, perfuzia cu medicament a fost oprită imediat și pacientul a fost eliminat din studiu.

Colectarea și gestionarea datelor

Datele de referință, care includeau date demografice, antropometrice, condiții comorbide, semne vitale, scoruri de Fiziologie acută și evaluare a sănătății cronice II (APACHE II) și scoruri ale scării de coma Glasgow (GCS), au fost obținute în ziua randomizării. Date de laborator, secventiala evaluare insuficienta de organ (SOFA) , scoruri, PaO 2 / FIO 2 , precum și alte tratamente utilizate au fost monitorizate în zilele 1, 3 și 7 (ziua 1 a fost definită ca în ziua primei administrări de vitamina C).

Rezultatul principal al studiului a fost zile fără IMV în 28 de zile (IMVFD28). Rezultatele secundare au inclus mortalitatea de 28 de zile, funcțiile organelor și parametrii inflamatori, inclusiv numărul de globule albe, numărul de neutrofile, numărul de limfocite, procalcitonina, interleukina-6 (IL-6) și proteina C-reactivă (CRP). Disfuncția multi-organ a fost evaluată utilizând scorurile SOFA. În plus, zile vasopresoare, zile de suport respirator, zile libere de ventilație mecanică invazivă (IMV), rata de îmbunătățire a stării pacientului, rata de deteriorare a stării pacientului, durata ICU și a spitalizării, ICU și mortalitatea în spital a fost înregistrată ca rezultate secundare suplimentare ale acestei cercetări. Zilele fără IMV au fost definite ca numărul de zile în care un pacient a fost extubat după recrutare până în ziua 28. Dacă pacientul a murit cu MV, i s-a atribuit o valoare zero.Deteriorarea stării pacientului a fost definită ca pacientul care necesită HFNC sau NIV în ziua 1 și care necesită ECMO sau IMV, sau care moare, după 7 zile de tratament. Îmbunătățirea stării pacientului a fost definită ca pacientul care necesită ECMO sau IMV în ziua 1 și trecerea la HFNC, NIV sau externat de la ICU după 7 zile de tratament. P / F a fost calculat pe baza PaO2 / FiO 2 și alegem cele mai mici valori înregistrate în ziua specifică. Toate datele au fost colectate din sistemul de informații clinice a trei ICU-uri.

analize statistice

Mărimea eșantionului a fost calculată în funcție de obiectivul primar, cu o rată de eroare unilaterală (α) de 2,5%, o putere de 80% și o rată de retragere de 10%. Odată cu controlul epidemiei, acest studiu a fost oprit devreme, iar numărul pacienților cu COVID-19 eligibili nu a satisfăcut dimensiunea eșantionului anticipat (140). Variabilele numerice sunt descrise ca medie cu deviație standard (SD) sau mediană cu interval intercuartil (IQR) în funcție de distribuție și au fost comparate cu testul t / testul U Mann-Whitney. Datele de categorie sunt reprezentate ca frecvențe și proporții și comparate cu testul chi-pătrat și testul exact al lui Fisher. Pentru variabilele de rezultat, raportul de risc și IC 95% au fost estimate de modelul de risc proporțional Cox pentru mortalitate, iar raporturile de șanse cu IC 95% au fost calculate prin regresie logistică binară pentru celelalte variabile.Analiza Kaplan-Meier a fost utilizată pentru a estima mortalitatea de 28 de zile pentru a reflecta diferențele de supraviețuire timpurie pentru cele două grupuri, iar curbele de supraviețuire au fost comparate cu testul Wilcoxon. Analizele de supraviețuire au fost efectuate în continuare în subgrup cu scor SOFA mai mare de 3. Testarea a fost față-verso și o valoare P <0,05 a fost considerată semnificativă statistic. SPSS 20.0 și GraphPad Prism 8.0 au fost utilizate pentru a finaliza prelucrarea datelor și analiza statistică.0 au fost utilizate pentru a finaliza prelucrarea datelor și analiza statistică.0 au fost utilizate pentru a finaliza prelucrarea datelor și analiza statistică.

Rezultate

Caracteristicile inițiale ale pacienților

Un total de 119 pacienți au fost identificați, dintre care 56 au fost în cele din urmă incluși, după cum se arată în Figura 1. Doi pacienți (unul din grupul HDIVC și unul din grupul placebo) au fost excluși din cauza perioadei de tratament de mai puțin de trei zile din cauza moarte. În total, 54 de pacienți au finalizat acest studiu în perioada 14 februarie 2020 – 29 martie 2020. Pacienții au fost înscriși în spitalul Leishenshan (Thunder God Mountain) (38 de pacienți), spitalul Zhongnan al Universității Wuhan (10 pacienți) și spitalul Taihe de la Universitatea de Medicină Hubei (6 pacienți). Dintre cei 54 de pacienți incluși în această analiză, 48 (88,9%) au primit cursul complet de tratament de 7 zile și 6 (11,1%) au primit doar 5 sau 6 zile de tratament din cauza decesului (2) sau externării din UTI (4) . Tabelul 1 prezintă caracteristicile demografice și clinice inițiale ale celor 54 de pacienți.

Vârsta medie a pacienților din studiu a fost de 67,4 ± 12,4 ani, iar 67% dintre pacienți erau de sex masculin. Scorul APACHE II al tuturor pacienților a fost de 13,5 (IQR, 10,2-15,7), fără diferențe între grupuri. Cea mai frecventă comorbiditate a fost hipertensiunea (44%), urmată de diabet (30%) și boli coronariene (22%). Timpul mediu de la debutul simptomelor până la începerea tratamentului cu HDIVC a fost de 17 (11-25) zile. Nu s-au observat diferențe semnificative în semnele vitale, rezultatele de laborator, severitatea bolii sau tratamentele între grupuri la momentul inițial.

Rezultatul primar

IMVFD28 a fost de 26,5 zile [1,5-28,0] în HDIVC și de 10,5 zile [0,0-28,0] în grupul placebo, dar această diferență nu a fost semnificativă statistic ((P = 0,56, HR, 4,8 [-2,3 până la 11,9]) (Tabel 2).

Rezultate secundare

Nu a existat nicio diferență statistic semnificativă în mortalitatea de 28 de zile între două grupuri (Figura 2). Cu toate acestea, perfuzia cu vitamina C a prezentat o reducere semnificativă a mortalității de 28 de zile (P = 0,05) la pacienții mai severi (scor SOFA ≥3) utilizând analiza supraviețuirii univariate, dar semnificația s-a pierdut după ajustare (P = 0,06, HR, 0,32 [IC 95% 0,10-1,06]) (Figura 2).

După cum se arată în Figura 3, scorul SOFA median a crescut de la 2,00 la 6,00 în grupul placebo, în timp ce a scăzut ușor de la 3,50 la 3,00 în grupul HDIVC în ziua 7. Cu toate acestea, nu a existat nicio diferență semnificativă statistic în scorurile SOFA între cele două grupuri. în zilele 3 și 7. În perioada de tratament de 7 zile, P / F din grupul HDIVC a fost mai bun decât cel din grupul de control (ziua 7: 228,52 față de 150,70 mmHg; IC 95% 33,17 până la 122,47; P = 0,01 ), și îmbunătățit în timp (Figura 3). IL-6 în grupul HDIVC a fost mai mic decât cel din grupul placebo (19,42 vs. 158,00 pg / ml; 95% CI -301,72, -29,79; P = 0,04) în ziua 7. Nu a existat nicio diferență semnificativă în alte tipuri infecțioase anticipate. indicatori și biomarkeri de inflamație între cele două grupuri (Tabelul 2). În plus, bilirubina totală a fost îmbunătățită și cu HDIVC (HDIVC vs placebo: 8,40 vs. 14,85,IC 95% -18,33 până la -0,59; P = 0,03, Tabelul 3). Mortalitatea ATI a pacienților severi (scorul SOFA inițial ≥3) a fost îmbunătățită în grupul HDIVC (P = 0,03, HR, 0,22 [IÎ 95% 0,06-0,90]).

Diferențele celorlalte tratamente

Tabelul 1 demonstrează diferențele în alte tratamente între cele două grupuri. Nu au existat diferențe semnificative între corticosteroizi, agenți antivirali sau antibiotice.

Evenimente adverse

În timpul perioadei de perfuzie de 7 zile, nu au fost raportate evenimente adverse legate de studiu și niciun pacient nu a fost retras din studiu din cauza acestor probleme.

Discuţie

Datele noastre oferă dovezi că adăugarea de doză mare (24 g pe zi timp de 7 zile) de vitamina C intravenoasă la tratamentul standard de îngrijire pentru COVID-19 sever a indus un efect benefic semnificativ, îmbunătățind P / F, IL- 6 și chiar mortalitate de 28 de zile. După părerea noastră, a fost primul studiu pe o doză mare de perfuzie de vitamina C la pacienții cu COVID-19 sever.

Niveluri ridicate de IL-6 au fost observate la pacienții cu COVID-19 și ar putea servi drept biomarker predictiv pentru severitatea bolii [5, 30, 31]. Mecanic, IL-6 acționează ca o citokină critică în răspunsul inflamator sistemic [32], ducând la o multitudine de efecte biologice care contribuie la infiltrarea pulmonară și la deteriorarea organelor [33, 34]. Într-un studiu recent, tocilizumab [35], un anticorp uman uman recombinant anti-IL-6, a îmbunătățit simptomele clinice prin atenuarea inflamației în COVID-19. Rezultatele declinului IL-6 în cohorta noastră au fost în concordanță cu cercetările de bază care arată că vitamina C a inhibat producția și eliberarea citokinelor proinflamatorii din monocitele umane (IL-1, IL-2, IL-6 și TNF-α) [36]. Studiile anterioare efectuate pe animale cu SARS-CoV au demonstrat, de asemenea, că inhibarea NF-κB, împreună cu niveluri reduse de IL-6,ar putea crește rata de supraviețuire la animalele infectate [31].

În plus, acest studiu a fost în concordanță cu alte studii care au arătat rolul protector al perfuziei de vitamina C în leziunile pulmonare acute (ALI) și ARDS [20]. Mai mult decât atât, cea mai recentă meta-analiză din opt studii cu vitamina C pe un total de 685 de pacienți a indicat faptul că vitamina C a scurtat durata ventilației mecanice la pacienții cu boli critice [26]. SARS-CoV-2 afectează în principal plămânii și provoacă pneumonie. Insuficiența respiratorie din cauza ARDS este principala cauză de mortalitate prin COVID-19 [37]. Similar cu ALI / ARDS indus de sepsis, creșterea rapidă a citokinelor din COVID-19 determină sechestrarea neutrofilelor în plămâni, ceea ce dăunează capilarelor alveolare [9, 10]. În modelarea sepsisului șoarecilor, VitC injectat parenteral a demonstrat un efect protector asupra plămânului [38, 39]. Mecanismele potențiale au inclus limitarea creșterilor de citokine,îmbunătățirea clearance-ului lichidului alveolar, prevenirea leziunilor vasculare, restabilirea integrității epiteliale endoteliale și alveolare și creșterea funcției celulare a barierei pulmonare. În studiul nostru, P / F a crescut rapid după inițierea HDIVC, care a fost probabil rezultatul îmbunătățirii funcției de ventilație pulmonară, pe baza mecanismelor de mai sus.

Această constatare a fost în concordanță cu studiile clinice anterioare care arată că HDIVC a redus gradul de insuficiență multiplă a organelor și a îmbunătățit rezultatele pe termen scurt ale sepsisului. În plus, nivelurile de acid ascorbic plasmatic au fost corelate invers cu incidența insuficienței multiple a organelor și a riscului de mortalitate [40]. Am suspectat că pacienții cu o disfuncție organică mai gravă pot avea un deficit mai sever de vitamina C, în timp ce doza mare de VC intravenoasă a îmbunătățit în mod eficient deficiența și ulterior a îmbunătățit funcția organelor [16]. Astfel, îmbunătățirea supraviețuirii a fost mai semnificativă la pacienții cu COVID-19 mai severi cu un scor SOFA de bază mai mare în studiul nostru.

Acest studiu are mai multe limitări. În primul rând, studiul a fost început în a doua jumătate a focarului epidemic, iar numărul pacienților cu COVID-19 calificați a scăzut odată cu controlul epidemiei, astfel încât a trebuit să ne oprim studiul înainte de a atinge dimensiunea eșantionului predefinită. În al doilea rând, inițierea vitaminei C a avut loc la mai mult de 10 zile după primul simptom, ceea ce poate afecta eficacitatea HDIVC. Cu toate acestea, infecția cu SARS-CoV-2 a fost caracterizată inițial de simptome ușoare, urmată de o săptămână mai târziu de o deteriorare rapidă care a condus la spitalizare, iar ARDS a apărut întotdeauna în ziua 8 după primul simptom [4]. Ca și în alte studii, administrarea de vitamina C a fost inițiată la scurt timp după apariția ARDS [20], care a început cu câteva zile mai devreme decât studiul nostru. Al treilea,absența datelor privind monitorizarea concentrației serice de acid ascorbic și a încărcării virale a făcut neclar dacă vitamina C are activitate antivirală directă împotriva SARS-CoV-2. În al patrulea rând, nu am măsurat variabilele anti-oxidative datorită complexității tratamentului probei de sânge, care a fost, de asemenea, o caracteristică importantă pentru vitamina C. În cele din urmă, dezechilibrul la sexul pacientului

distribuția între grupurile la momentul inițial poate influența ușor rezultatele.

Concluzie

Pe scurt, am constatat că adăugarea de HDIVC poate oferi un efect clinic protector fără evenimente adverse la pacienții cu boală critică cu COVID-19. HDIVC a oferit una dintre opțiunile alternative de tratament, deoarece nu a existat niciun medicament sau tratament eficient pentru a vindeca COVID-19 în prezent. Cu toate acestea, sunt încă necesare studii suplimentare pentru a ne confirma înțelegerea efectului terapiei HDIVC asupra pacienților cu afecțiuni critice cu COVID-19.

Declarații

Aprobarea etică și consimțământul de participare

Acest studiu este un studiu multi-centru, randomizat, care a fost aprobat de comitetul de etică al Spitalului Zhongnan al Universității Wuhan (# 2020001). A fost înregistrat pe site-ul ClinicalTrials.gov (ID: NCT04264533) înainte de recrutarea pacientului. Au fost obținute consimțământuri informate de la pacienți sau membri ai familiei.

Consimțământul pentru publicare

Nu se aplică.

Disponibilitatea datelor și a materialelor

Seturile de date utilizate și analizate în timpul studiului actual sunt disponibile de la autorul corespunzător, la cerere rezonabilă.

Interese concurente

Autorii nu declară interese concurente.

Finanțarea

Această lucrare a fost finanțată de Departamentul de Știință și Tehnologie din provincia Hubei (2020FCA024, 2020FCA020) și de fondurile fundamentale de cercetare pentru universitățile centrale (2042020kfxg18, 2042020kfxg13).

Contribuțiile autorilor

Concept și design: Zhang, Rao, Li.

Achiziționarea, analiza sau interpretarea datelor: Zhang, Rao, Li, Xiang, Guo, Luo, Meng.

Redactarea manuscrisului: Zhang, Rao, Li, Backer, Peng.

Revizuirea critică a manuscrisului pentru un conținut intelectual important: Zhang, Xiang, Backer, Peng.

Analiză statistică: Zhang, Zhu, Liu.

Finanțare obținută: Xiang, Peng.

Suport administrativ, tehnic sau material: Xiang, Rao, Peng.

Supraveghere: Xiang, Backer, Peng.

Mulțumiri

Zhang, Xiang și Peng au avut acces deplin la toate datele din studiu și își asumă responsabilitatea pentru integritatea datelor și acuratețea analizei datelor. Zhang, Rao și Li au contribuit în mod egal și împărtășesc prima autorie. Xiang și Peng sunt autorul corespondent.

Referințe

  1. Tian S, Hu W, Niu L, Liu H, Xu H, Xiao SY (2020) Patologie pulmonară a fazei timpurii 2019 Coronavirus nou (COVID-19) pneumonie la doi pacienți cu cancer pulmonar. J Thorac Oncol 15 (5): 700-704. doi: 10.1016 / j.jtho.2020.02.010
  2. Munster VJ, Koopmans M, van Doremalen N, van Riel D, de Wit E (2020) Un roman Coronavirus emergent în China – Întrebări cheie pentru evaluarea impactului. N Engl J Med 382 (8): 692-694. doi: 10.1056 / NEJMp2000929
  3. Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, Liu L, Shan H, Lei CL, Hui DSC, Du B, Li LJ, Zeng G, Yuen KY, Chen RC, Tang CL, Wang T , Chen PY, Xiang J, Li SY, Wang JL, Liang ZJ, Peng YX, Wei L, Liu Y, Hu YH, Peng P, Wang JM, Liu JY, Chen Z, Li G, Zheng ZJ, Qiu SQ, Luo J, Ye CJ, Zhu SY, Zhong NS, China Expert Medical Treatment Group for C (2020) Characteristics Clinical of Coronavirus Disease 2019 in China. N Engl J Med 382 (18): 1708-1720. doi: 10.1056 / NEJMoa2002032
  4. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, Xiang H, Cheng Z, Xiong Y, Zhao Y, Li Y, Wang X, Peng Z (2020) Caracteristici clinice ale a 138 de pacienți spitalizați Cu noua pneumonie infectată cu coronavirus 2019 din Wuhan, China. JAMA. doi: 10.1001 / jama.2020.1585
  5. Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z, Xiang J, Wang Y, Song B, Gu X, Guan L, Wei Y, Li H, Wu X, Xu J, Tu S, Zhang Y , Chen H, Cao B (2020) Curs clinic și factori de risc pentru mortalitatea pacienților adulți internați cu COVID-19 în Wuhan, China: un studiu retrospectiv de cohortă. Lancet (Londra, Anglia) 395 (10229): 1054-1062. doi: 10.1016 / S0140-6736 (20) 30566-3
  6. Richardson S, Hirsch JS, Narasimhan M, Crawford JM, McGinn T, Davidson KW, Barnaby DP, Becker LB, Chelico JD, Cohen SL, Cookingham J, Coppa K, Diefenbach MA, Dominello AJ, Duer-Hefele J, Falzon L, Gitlin J, Hajizadeh N, Harvin TG, Hirschwerk DA, Kim EJ, Kozel ZM, Marrast LM, Mogavero JN, Osorio GA, Qiu M, Zanos TP (2020) Prezentând caracteristici, comorbidități și rezultate la 5700 de pacienți spitalizați cu COVID-19 în zona New York City. JAMA. doi: 10.1001 / jama.2020.6775
  7. Braciale TJ, Sun J, Kim TS (2012) Reglarea răspunsului imun adaptiv la infecția cu virusul respirator. Nature reviews Immunology 12 (4): 295-305. doi: 10.1038 / nri3166
  8. Chen G, Wu D, Guo W, Cao Y, Huang D, Wang H, Wang T, Zhang X, Chen H, Yu H, Zhang X, Zhang M, Wu S, Song J, Chen T, Han M, Li S , Luo X, Zhao J, Ning Q (2020) Caracteristici clinice și imunologice ale bolii coronavirusului sever și moderat 2019. Jurnalul de investigații clinice 130 (5): 2620-2629. doi: 10.1172 / JCI137244
  9. Xu Z, Shi L, Wang Y, Zhang J, Huang L, Zhang C, Liu S, Zhao P, Liu H, Zhu L, Tai Y, Bai C, Gao T, Song J, Xia P, Dong J, Zhao J , Wang FS (2020) Constatări patologice ale COVID-19 asociate cu sindromul de detresă respiratorie acută. Lancet Respir Med 8 (4): 420-422. doi: 10.1016 / S2213-2600 (20) 30076-X
  10. Qin C, Zhou L, Hu Z, Zhang S, Yang S, Tao Y, Xie C, Ma K, Shang K, Wang W, Tian DS (2020) Disregularea răspunsului imun la pacienții cu COVID-19 din Wuhan, China. Clin Infect Dis. doi: 10.1093 / cid / ciaa248
  11. Peiris JS, Chu CM, Cheng VC, Chan KS, Hung IF, Poon LL, Law KI, Tang BS, Hon TY, Chan CS, Chan KH, Ng JS, Zheng BJ, Ng WL, Lai RW, Guan Y, Yuen KY , Group HUSS (2003) Progresia clinică și încărcătura virală într-un focar comunitar de pneumonie SARS asociată coronavirusului: un studiu prospectiv. Lancet 361 (9371): 1767-1772. doi: 10.1016 / s0140-6736 (03) 13412-5
  12. Carr AC, Shaw GM, Fowler AA, Natarajan R (2015) Sinteza vasopresorului dependent de ascorbat: o rațiune pentru administrarea vitaminei C în sepsis sever și șoc septic? Crit Care 19: 418. doi: 10.1186 / s13054-015-1131-2
  13. Koekkoek WA, van Zanten AR (2016) Vitamine antioxidante și oligoelemente în boli critice. Nutr Clin Pract 31 (4): 457-474. doi: 10.1177 / 0884533616653832
  14. Nieman DC, Peters EM, Henson DA, Nevines EI, Thompson MM (2000) Influența suplimentării cu vitamina C asupra modificărilor citokinelor după un ultramaraton. J Interferon Citokine Res 20 (11): 1029-1035. doi: 10.1089 / 10799900050198480
  15. Vassilakopoulos T, Karatza MH, Katsaounou P, Kollintza A, Zakynthinos S, Roussos C (2003) Antioxidanții atenuează răspunsul citokinelor plasmatice la exerciții la om. J Appl Physiol (1985) 94 (3): 1025-1032. doi: 10.1152 / japplphysiol.00735.2002
  16. Carr AC, Rosengrave PC, Bayer S, Chambers S, Mehrtens J, Shaw GM (2017) Deficitul de hipovitaminoză C și vitamina C la pacienții cu afecțiuni critice, în ciuda aporturilor enterale și parenterale recomandate. Crit Care 21 (1): 300. doi: 10.1186 / s13054-017-1891-y
  17. Padayatty SJ, Sun H, Wang Y, Riordan HD, Hewitt SM, Katz A, Wesley RA, Levine M (2004) Farmacocinetica vitaminei C: implicații pentru utilizarea orală și intravenoasă. Ann Intern Med 140 (7): 533-537. doi: 10.7326 / 0003-4819-140-7-200404060-00010
  18. Fowler AA, Syed AA, Knowlson S, Sculthorpe R, Farthing D, DeWilde C, Farthing CA, Larus TL, Martin E, Brophy DF, Gupta S, Fisher BJ, Natarajan R (2014) Faza I de siguranță a acidului ascorbic intravenos în pacienți cu sepsis sever. J Transl Med 12:32. doi: 10.1186 / 1479-5876-12-32
  19. Fujii T, Luethi N, Young PJ, Frei DR, Eastwood GM, French CJ, Deane AM, Shehabi Y, Hajjar LA, Oliveira G, Udy AA, Orford N, Edney SJ, Hunt AL, Judd HL, Bitker L, Cioccari L , Naorungroj T, Yanase F, Bates S, McGain F, Hudson EP, Al-Bassam W, Dwivedi DB, Peppin C, McCracken P, Orosz J, Bailey M, Bellomo R (2020) Efectul vitaminei C, hidrocortizonului și tiaminei vs Hidrocortizon singur în timp viu și fără suport vasopresor la pacienții cu șoc septic: studiul clinic randomizat VITAMINE. JAMA. doi: 10.1001 / jama.2019.22176
  20. Fowler AA, Truwit JD, Hite RD, Morris PE, DeWilde C, Priday A, Fisher B, Thacker LR, Natarajan R, Brophy DF, Sculthorpe R, Nanchal R, Syed A, Sturgill J, Martin GS, Sevransky J, Kashiouris M , Hamman S, Egan KF, Hastings A, Spencer W, Tench S, Mehkri O, Bindas J, Duggal A, Graf J, Zellner S, Yanny L, McPolin C, Hollrith T, Kramer D, Ojielo C, Damm T, Cassity E, Wieliczko A, Halquist M (2019) Efectul perfuziei cu vitamina C asupra insuficienței organelor și a biomarkerilor de inflamație și leziuni vasculare la pacienții cu septicemie și insuficiență respiratorie acută severă: studiul clinic randomizat CITRIS-ALI. JAMA 322 (13): 1261-1270. doi: 10.1001 / jama.2019.11825
  21. Fowler Iii AA, Kim C, Lepler L, Malhotra R, Debesa O, Natarajan R, Fisher BJ, Syed A, DeWilde C, Priday A, Kasirajan V (2017) Vitamina C intravenoasă ca terapie adjuvantă pentru suferința respiratorie acută indusă de enterovirus / rinovirus sindrom. World J Crit Care Med 6 (1): 85-90. doi: 10.5492 / wjccm.v6.i1.85
  22. Hu X, Yuan L, Wang H, Li C, Cai J, Hu Y, Ma C (2017) Eficacitatea și siguranța vitaminei C pentru fibrilația atrială după o intervenție chirurgicală cardiacă: o metaanaliză cu analiză secvențială a studiilor controlate randomizate. Int J Surg 37: 58-64. doi: 10.1016 / j.ijsu.2016.12.009
  23. Tanaka H, ​​Matsuda T, Miyagantani Y, Yukioka T, Matsuda H, Shimazaki S (2000). Arch Surg 135 (3): 326-331. doi: 10.1001 / archsurg.135.3.326
  24. Li J (2018) Dovezile sunt mai puternice decât credeți: o meta-analiză a utilizării vitaminei C la pacienții cu sepsis. Crit Care 22 (1): 258. doi: 10.1186 / s13054-018-2191-x
  25. Xu Y, Zheng X, Liang B, Gao J, Gu Z (2018) Vitamine pentru prevenirea leziunilor renale acute induse de contrast: o analiză sistematică și o analiză secvențială de încercare. Am J Cardiovasc Drugs 18 (5): 373-386. doi: 10.1007 / s40256-018-0274-3
  26. Hemila H, Chalker E (2020) Vitamina C poate reduce durata ventilației mecanice la pacienții cu boli critice: o analiză meta-regresie. J Terapie Intensivă 8:15. doi: 10.1186 / s40560-020-0432-y
  27. Hemila H, Chalker E (2019) Vitamina C poate scurta durata șederii în terapia intensivă: o meta-analiză. Nutrienți 11 (4). doi: 10.3390 / nu11040708
  28. Madhusudana SN, Shamsundar R, Seetharaman S (2004) Inactivarea in vitro a virusului rabiei de acid ascorbic. Revista internațională a bolilor infecțioase: IJID: publicație oficială a Societății Internaționale pentru Boli Infecțioase 8 (1): 21-25
  29. Thamm K, Schrimpf C, Retzlaff J, Idowu TO, van Meurs M, Zijlstra JG, Ghosh CC, Zeitvogel J, Werfel TA, Haller H, Parikh SM, David S (2018) Molecular Regulation of Acute Tie2 Suppression in Sepsis. Medicină de îngrijire critică 46 (9): e928-e936. doi: 10.1097 / ccm.0000000000003269
  30. Chen X, Zhao B, Qu Y, Chen Y, Xiong J, Feng Y, Men D, Huang Q, Liu Y, Yang B, Ding J, Li F (2020) Sarcină virală detectabilă a SARS-CoV-2 (RNAaemia) este strâns corelată cu nivelul interleukinei 6 crescut drastic (IL-6) la pacienții cu COVID-19 bolnavi critici. Bolile infecțioase clinice: o publicație oficială a Societății de boli infecțioase din America. doi: 10.1093 / cid / ciaa449
  31. Ruan Q, Yang K, Wang W, Jiang L, Song J (2020) predictori clinici ai mortalității datorate COVID-19 pe baza unei analize a datelor a 150 de pacienți din Wuhan, China. Medicină de terapie intensivă 46 (5): 846-848. doi: 10.1007 / s00134-020-05991-x
  32. Liu B, Li M, Zhou Z, Guan X, Xiang Y (2020) Putem folosi blocajul interleukinei-6 (IL-6) pentru boala coronavirusului 2019 (COVID-19) sindromul de eliberare a citokinelor indus (CRS)? J Autoimmun: 102452. doi: 10.1016 / j.jaut.2020.102452
  33. Tanaka T, Narazaki M, Kishimoto T (2016) Implicații imunoterapeutice ale blocadei IL-6 pentru furtuna de citokine. Imunoterapie 8 (8): 959-970. doi: 10.2217 / imt-2016-0020
  34. Pathan N, Hemingway CA, Alizadeh AA, Stephens AC, Boldrick JC, Oragui EE, McCabe C, Welch SB, Whitney A, O’Gara P, Nadel S, Relman DA, Harding SE, Levin M (2004) Rolul interleukinei 6 în disfuncția miocardică a șocului septic meningococic. Lancet 363 (9404): 203-209. doi: 10.1016 / S0140-6736 (03) 15326-3
  35. Xu X, Han M, Li T, Sun W, Wang D, Fu B, Zhou Y, Zheng X, Yang Y, Li X, Zhang X, Pan A, Wei H (2020) Tratamentul eficient al pacienților cu COVID-19 sever cu tocilizumab. Proc Natl Acad Sci US A. doi: 10.1073 / pnas.2005615117
  36. Hartel C, Strunk T, Bucsky P, Schultz C (2004) Efectele vitaminei C asupra producției de citokine intracitoplasmatice în monocitele și limfocitele din sângele integral uman. Citokina 27 (4-5): 101-106. doi: 10.1016 / j.cyto.2004.02.004
  37. Ruan Q, Yang K, Wang W, Jiang L, Song J (2020) predictori clinici ai mortalității datorate COVID-19 pe baza unei analize a datelor a 150 de pacienți din Wuhan, China. Terapie intensivă Med 46 (5): 846-848. doi: 10.1007 / s00134-020-05991-x
  38. Fisher BJ, Kraskauskas D, Martin EJ, Farkas D, Wegelin JA, Brophy D, Ward KR, Voelkel NF, Fowler AA, 3rd, Natarajan R (2012) Mecanismele de atenuare a sepsisului abdominal induse de leziuni pulmonare acute de acid ascorbic. Am J Physiol Lung Cell Mol Physiol 303 (1): L20-32. doi: 10.1152 / ajplung.00300.2011
  39. Fisher BJ, Seropian IM, Kraskauskas D, Thakkar JN, Voelkel NF, Fowler AA, 3rd, Natarajan R (2011) Acidul ascorbic atenuează leziunile pulmonare acute induse de lipopolizaharide. Crit Care Med 39 (6): 1454-1460. doi: 10.1097 / CCM.0b013e3182120cb8
  40. De Grooth HMS-dM, AM; Oudermans-van Straaten, HM (2014) Concentrația timpurie a vitaminei C din plasmă, disfuncție a organelor și mortalitatea prin ICU. Terapie intensivă Med: 40, S199

Mese

Tabelul 1 Caracteristici inițiale ale tuturor pacienților

VariabilToți pacienții (n = 54)Vitamina C (n = 26)Placebo (n = 28)Valoarea P
Demografie
 Vârstă, ani67,4 ± 12,467,1 ± 10,667,7 ± 14,00,86
 Sex, bărbat, n,%36 (66,7)14 (53,8)22 (78,6)0,08
 Înălțime, cm168,8 ± 6,6167,0 ± 6,9170,8 ± 5,80,08
 Greutate, kg62,0 ± 10,559,7 ± 11,264,4 ± 9,40,16
Centre
 Spitalul Zhongnan al Universității Wuhan, n,%10 (18,5)5 (19,2)5 (17,9)
 Spitalul Leishenshan (Thunder God Mountain), n,%38 (70,4)18 (69,2)20 (71,4)
 Spitalul Taihe, n,%6 (11.1)3 (11,5)3 (10,7)
Stare generală în ziua randomizării
 Cea mai ridicată temperatură, ℃37 ± 1,037,3 ± 0,837,4 ± 1,10,65
 Cea mai mare frecvență cardiacă, ori / min93,2 ± 18,496,6 ± 18,690,2 ± 18,10,21
 Cea mai mică MAP, mmHg91,0 (17,9)88,4 (16,6)93,4 (18,9)0,31
 Cel mai mare RR, ori / min25 [20-36]25 [21-31]24 [20-30]0,19
 Cel mai mic SPO 2 ,%93 [88-98]93 [81-98]93 [90-97]0,93
 Scorul APACHE II13,5 [10,3-15,8]14.0 [11.0-16.0]13.0 [9.5-15.0]0,24
 Scorul GCS15,0 [14,5-15,0]15.0 [13.0-15.0]15.0 [15.0-15.0]0,75
Comorbidități, n,%
 Diabet16 (29,6)7 (26,9)9 (32,1)0,77
 Hipertensiune24 (44,4)10 (38,5)14 (50,0)0,42
 Boală coronariană12 (22,2)4 (15.40)8 (28,6)0,33
 Boli pulmonare cronice3 (5,6)1 (3,8)2 (7.1)1,00
 Insuficiență renală cronică1 (1,85)1 (3,8)0 (0,0)0,48
 Tumoare maligna3 (5,6)3 (11,5)0 (0,0)0,11
 Boli ale sistemului nervos11 (20,4)7 (26,9)4 (14,3)0,32
Durata medie a simptomelor înainte de terapia HDIVC, zile17.0 [11.0-25.0]22.0 [11.0-33.0]15.0 [11.0-22.0]0,18
Alte tratamente în timpul terapiei HDIVC de 7 zile
Utilizarea corticosteroizilor, n,%18 (33,3)8 (36,4)109 (38,5)1,00
Antibiotic, n,%51 (94,4)24 (92,3)27 (96,4)1,00
Bilanț net de lichide, ml / kg / 24 ore
 Ziua 1190 [-1487-662]252 [-252-810]155 [-520-499]0,39
 Ziua 2156 [-349 -653]192 [-508-883]121 [-90 -577]0,94
 Ziua 362 [-703-768]-240 [-1004 -233]463 [5-1351]0,02
        

Datele au fost exprimate ca medie ± deviație standard, ca mediană [interval intercuartilic] sau ca numere (procent). Comparațiile au fost efectuate folosind testul t Student, Wilcoxon – Man – Whitney, Chi square sau exact Fischer.

Abrevieri: SD, deviație standard; IQR, gama interquartile; APACHE, Fiziologie acută și evaluarea sănătății cronice; GCS, scara coma Glasgow; HDIVC: doză mare de vitamina C. intravenoasă.

Tabelul 2 Rezultate într-un studiu de HDIVC la pacienții cu Covid-19.

VariabilZiVitamina C (n = 26)Placebo (n = 28)Diferență,  coeficient (IC 95%)Valoarea P
Scoruri SOFA13,5 [3-6,8]2.0 [3.0-5.0]0,7 (-0,9 până la 2,3)0,37
34.0 [2.0-8.0]4.0 [3.0-7.0]-0,3 (-2,6 până la 1,9)0,50
73.0 [2.0-5.8]6,0 [2,50-8,0]-1,14 (-3,1 până la 0,8)0,24
Cel mai mic P / F1188,7 ± 95,4210,6 ± 128,534,6 (-91,9 până la 48,0)0,53
3217,3 ± 96,5189,5 ± 101,930,7 (-34,3 până la 89,9)0,37
7228,5 ± 72,6150,7 ± 75,322,1 (33,2 până la 122,5)0,01
Suport de viață avansat, n,%
 CRRT 11 (3,8)3 (10,7)OR0,3 (0,0 la 3,5)0,61
 73 (12,5)1 (3,8)OR3,57 (0,4 – 36,9)0,34
 ECMO 11 (3,8)2 (7.1)OR0,5 (0,0 la 6,0)1,00
 70 (0,0)2 (9,1)OR0,5 (0,4 – 0,7)0,50
 Utilizarea vasopresorului19 (36,0)6 (21,4)OR2.1 (0,6 – 6,9)0,36
 74 (16,7)4 (17,4)OR1.2 (0,4 – 3,8)1,00
 Categoria de susținere a oxigenului
 HFNC17 (26,9)11 (39,3)OR0,6 (0,2 până la 1,8)0,40
 711 (47,8)9 (39,1)OR14,3 (0,4 – 4,6)0,77
 NIV17 (26,9)7 (25,0)OR1.1 (0,3 până la 3,7)1,00
 77 (30,4)2 (8,7)OR4,6 (0,8 – 25,2)0,14
 IMV110 (38,5)11 (39,3)OR1.0 (0.3 la 2.9)1,00
 710 (43,5)11 (47,8)OR0,8 (0,3 până la 2,7)1,00
Complicații, n,%
 Șoc septic9 (34,6)8 (28,6)OR1,3 (0,4 – 2,4)0,77
 Leziunea cardiacă acută7 (26,9)13 (48,1)OR0,4 (0,1 până la 1,3)0,16
 Traumatism hepatic acut12 (48,0)13 (48,1)OR1.0 (0.3 la 3.0)1,00
 Leziuni renale acute3 (12,0)6 (22,2)OR0,5 (0,1 până la 2,2)0,50
 Tulburări de coagulare9 (34,6)7 (25,9)OR1,5 (0,5 la 5,0)0,56
Rezultate
 HFNC zile până la ziua 28, zile0,5 [0,0 -8,3]2,0 [0,0 -7,0]0,2 (-2,9-3,3)0,85
 NIV zile până în ziua 28, zile0,0 [0,0 -3,3]0,0 [0,0 -1,8]1,2 (-1,2 până la 3,7)0,68
 IMV zile până la ziua 28, zile1,5 [0,0 -19,0]6,0 [0,0-16,0]-0,8 (-6,4 până la 4,9)0,60
 IMV- zile libere până la ziua 28, zile  c26,5 [1,5-28,0]10,5 [0,0 -28,0]4,8 (-2,3 până la 11,9)0,56
 Deteriorarea stării pacienților, n,%  d3 (11,5)6 (24,0)0,4 (0,1 până la 1,7)0,19
 Ameliorarea stării pacienților, n,%  e5 (19,2)6 (21,4)0,9 (0,2-3,3)0,84
 Mortalitate în UCI, n,%5 (19,2)10 (35,7)HR0,6 (0,7 până la 1,6)0,23
 Mortalitatea ICU a pacienților cu SOFA ≥3, n,%4 (18,2)10 (50,0)HR0,2 (0,1 până la 0,9)0,03
 Ședere în terapie intensivă, zile23,6 ± 14,618,4 ± 13,25,2 (-2,4 până la 12,8)0,17
 Mortalitate spitalicească, n,%5 (19,2)10 (35,7)HR0,6 (0,7 până la 1,6)0,23
 Mortalitatea spitalicească a pacienților cu SOFA ≥3, n,%4 (18,2)10 (50,0)HR0,2 (0,1 până la 0,9)0,03
 Spitalizare, zile36,3 ± 16,233,8 ± 16,42,4 (-7,1 până la 11,9)0,61
 Mortalitate pe 28 de zile, n,%5 (19,2)9 (32,1)HR0,5 (0,1 până la 1,8)0,36
 Mortalitate pe 28 de zile a pacienților cu SOFA ≥3, n,%4 (18,2)9 (45,0)HR0,3 (0,1 până la 1,1)0,06

Datele au fost exprimate ca medie ± deviație standard, ca mediană [interval intercuartilic] sau ca numere (procent). Raportul de pericol și IC 95% au fost estimate prin modelul de risc proporțional Cox. Raportul impar cu IC 95% a fost calculat prin regresie logistica binară pentru restul. Diferența absolută a fost exprimată ca procent cu intervalul CI 95%. Valorile P au fost calculate prin regresie logistică.

 leziune cardiacă acută a fost definită ca nivelurile serice ale troponinei I fiind peste limita superioară de referință percentilă 99 sau au fost prezentate noi anomalii în electrocardiografie și ecocardiografie.

 Leziunea renală acută a fost identificată în conformitate cu definiția Boli renale: îmbunătățirea rezultatelor globale.

c  Zilele fără IMV au fost definite ca numărul de zile în care un pacient a fost extubat din ventilație mecanică, după internarea în UCI până în ziua 28. Au fost scăzute zilele care necesită reintubare. Dacă pacientul a murit în spital după extubare, i s-a atribuit o valoare zero.

 Deteriorarea stării pacienților a fost definită ca pacientul a necesitat HFNC sau NIV în ziua 1 și a fost transferat la ECMO sau IMV sau mort în ziua 7.

 îmbunătățirea starea pacienților a fost definită ca pacientul au necesitat ECMO sau IMV în ziua 1 și transferat la HFNC, sau NIV sau evacuate de la terapie intensivă în ziua 7.

Abrevieri: HDIVC: doză mare de vitamina C intravenoasă; COVID-19, boala coronavirusului 2019; SD, deviație standard; IQR, gama interquartile; HR, raport de pericol; SAU, raport impar; CI, interval de încredere; SOFA: evaluarea secvențială a insuficienței organelor; P / F, PaO 2 / FIO 2 ; CRRT, terapie de substituție renală continuă; ECMO, oxigenare cu membrană extracorporală; HFNC, canulă nazală cu flux mare; IV, ventilație invazivă; IMV, ventilație mecanică invazivă; NIV, ventilație mecanică neinvazivă; UTI, unitate de terapie intensivă.

Tabelul 3 Constatări de laborator într-un studiu de HDIVC la pacienții cu Covid-19.

VariabilZiVitamina C (n = 26)Placebo (n = 28)Diferență, coeficient (IC 95%)Valoarea P
Număr de leucocite, 10 ^ 919,50 ± 5,0411,45 ± 7,22-1,95 (-5,38 până la -1,47)0,26
38,59 [5.74-11.48]8,44 [7.09-12.23]-0,40 (-3,50 până la 2,70)0,67
710,23 ± 6,739,64 ± 5,410,59 (-2,96 până la 4,14)0,74
Numărul de neutrofile, 10 ^ 918,21 ± 4,8110,19 ± 7,08-1,98 (-5,31 până la 1,35)0,24
36,19 [4.52-10.45]7.07 [5.68-9.94]-0,51 (-3,48 până la 2,47)0,50
78,05 ± 6,478,15 ± 5,45-0,11 (-3,58 până la 3,37)0,95
Raportul neutrofilelor,%183,50 ± 9,6385,83 ± 9,92-2,33 (-7,74 până la -3,07)0,39
385,65 [77.05-91.42]83,30 [75,53-91,78]4,03 (-6,32 până la 14,38)0,70
778,45 ± 15,7681,66 ± 11,45-3,21 (-11,22 până la 4,79)0,42
IL-6122,56 [8.87-85.54]54,73 [12,34-145,47]-6,21 (-129,71 până la 117,29)0,61
3113.10 [21.80-288.73]37,24 [5.59-85.28]92,44 (-25,13 până la 210,01)0,07
719.42 [10.59-29.16]158,00 [15,29-259,60]-165,76 (-301,72 până la -29,79)0,04
Numărul de limfocite, 10 ^ 910,55 [0,36-0,99]0,53 [0,37-0,95]0,09 (-0,17 până la 0,36)0,49
30,56 [0,33-0,95]0,71 [0,47-1,05]-2,61 (-8,59 până la 3,37)0,50
70,81 [0,43-1,05]0,65 [0,42-0,97]1,11 (-0,76 până la 2,98)0,25
Raport limfocite,%19,68 ± 6,978,12 ± 7,331,62 (-2,32 până la 5,57)0,41
310,08 ± 9,228,71 ± 4,901,37 (-2,67 până la 5,40)0,88
713,14 ± 11,316,83 [5,05 -13,42]3,34 (-2,13 până la 8,81)0,23
PCT, ng / ml10,16 [0,08-0,6]0,19 [0,05-0,53]-9,94 (-29,28 până la 9,41)0,80
30,35 [0,09-3,22]0,31 [0,08-1,11]-6,59 (-20,46 până la 7,28)0,84
70,26 [0,13-14,79]0,20 [0,07-0,74]13,28 (-17,91 până la 44,48)0,18
CRP, mg / L139,86 [3.91-86.85]56,84 [40.19-100.20]-23,16 (-69,46 până la 23,14)0,19
343,52 [3,41- 65,72]66,34 [29,76-107,39]-4,78 (-68,08 până la 58,53)0,28
729,47 [10.95-110.93]30,20 [2.3-131.70]-12,60 (-75,34, 50,14)0,68
Bilirubină totală, umol / L18,55 [6,78- 15,60]10.80 [7.40-18.30]-1.45 (-7.30 – 4.41)0,28
38.40 [6.70-16.10]14,85 [9.85-25.48]-9,46 (-18,33 până la -0,59)0,03
78.30 [6.53-16.15]15.30 [9.03-27.68]-4,19 (-15,88 până la 7,50)0,11
, umol / L164,20 [46,58-85,45]64,20 [52,00 -81,70]26,35 (-50,86 până la 103,56)0,57
360,30 [37,65-80,38]70,35 [49,80-100,88]2,52 (-39,89 până la -44,93)0,15
757,50 [39,95-71]63,50 [51,70-104,50]-12,43 (-45,59 până la 20,73)0,13
BUN, mmol / L17.11 [4.48-11.10]6,50 [4,90-9,94]9,34 (-8,75 – 27,44)0,84
37,58 ± 5,018.56 [5.13-11.39]-2,10 (-5,22 până la -1,02)0,11
78,48 ± 5,697.80 [5.10-10.50]-0,73 (-4,12-2,66)0,48
PT, s113.25 [12.35-14.63]12.90 [12.50-13.80]-0,58 (-2,35 la 1,19)0,97
313,90 ± 3,2413.25 [12.70-15.05]-0,29 (-1,97 – 1,39)0,33
712,99 ± 2,5513.05 [12.35-14.60]-0,27 (-1,67 până la 1,14)0,08

Datele au fost exprimate ca medie ± deviație standard, ca mediană [interval intercuartil]. Raportul impar cu 95% CI a fost calculat prin regresie logistica binară pentru restul. Valorile P au fost calculate prin regresie logistică.

Abrevieri: SD, deviație standard; IQR, gama interquartile; HR, raport de pericol; SAU, raport impar; CI, interval de încredere; HDIVC: doză mare de vitamina C intravenoasă; COVID-19, boala coronavirusului 2019; SD, deviație standard; IQR, gama interquartile; PCT, procalcitonină; CRP, proteină C reactivă; BUN, azot uree din sânge; PT, timp de protrombină, IL-6, interleukină-6.

Beta Glucanii impotriva Covid19

  • Beta-glucanii sunt tipuri de fibre solubile care pot ajuta la reducerea citokinelor inflamatorii și la prevenirea furtunii de citokine, care este asociată cu infecție severă COVID-19 și deces
  • Beta-glucanii oferă, de asemenea, o protecție puternică împotriva altor infecții virale, cum ar fi răceala obișnuită și gripa
  • Pe lângă faptul că contribuie la creșterea imunității, beta-glucanii pot contribui la îmbunătățirea rezistenței la insulină, la creșterea diversității bacteriene din intestin, la prevenirea cancerului și la contribuția la pierderea în greutate
  • Alți nutrienți care pot spori imunitatea și pot ajuta la combaterea COVID-19 includ vitamina C, vitamina D și zinc

Când vine vorba de COVID-19, par să existe mult mai multe întrebări decât răspunsuri. Dar, pe măsură ce continuăm să aflăm despre fiziopatologia virusului, apar mai multe cercetări cu privire la modul de combatere și / sau prevenire a acestuia.

Cercetătorii dintr-un studiu din august 2020 publicat în Știința mediului total sunt primii care se uită la beta-glucani, tipuri de fibre solubile și cum pot fi capabili să vă protejeze de SARS-CoV-2, virusul care cauzează COVID- 19. 1

Una dintre complicațiile majore ale COVID-19 este pneumonia, care este, de asemenea, însoțită de replicarea rapidă a virusului. În timpul acestei replicări rapide, sistemul dvs. imunitar eliberează citokine pro-inflamatorii care duc la o reacție exagerată a răspunsului imun numit furtună de citokine. Furtuna de citokine poate duce la leziuni pulmonare, sindrom de detresă respiratorie acută (ARDS) și moarte.

În acest studiu, cercetătorii au luat extract de beta-glucani dintr-o formă de ciupercă shiitake numită Lentinus edodes și au combinat-o cu un model de leziuni pulmonare in vitro.

Au descoperit că beta-glucanii au redus interleukina 1 beta și interleukina-6, două citokine care pot declanșa furtuna de citokine care cauzează ARDS în cazuri severe de COVID-19. Beta-glucanii au redus, de asemenea, stresul oxidativ și activează substanțele imune numite macrofage care distrug potențialii invadatori, cum ar fi virușii.

Potrivit altor studii, beta-glucani spori , de asemenea, activitatea celulelor si functia de celulele natural killer (NK), 2  un tip de celule albe din sange , care joaca un rol critic în sistemul imunitar înnăscut și acționează ca prima linie de apărare împotriva virușilor . 3  Cercetările arată că numărul și funcția celulelor NK scad considerabil odată cu infecția cu COVID-19, în special la cei care se îmbolnăvesc critic. 4, 5

Pe baza acestor informații, cercetătorii sugerează că creșterea imunității înnăscute prin intermediul unor suplimente de beta-glucan poate contribui la atenuarea infecției cu COVID-19 și poate aplatiza curba. 6

Beta-glucanii pot ajuta la prevenirea răcelii și a gripei

Cercetările privind beta-glucanii și COVID-19 sunt promițătoare, dar din moment ce virusul este încă nou, există doar un număr limitat de studii disponibile în acest moment. Cu toate acestea, o serie de studii au confirmat că beta-glucanii oferă o protecție puternică împotriva altor infecții virale, cum ar fi răceala obișnuită și gripa, care pot duce la răspunsuri imune similare. De exemplu:

  • Un studiu din 2013 a constatat că administrarea a 900 mg de beta-glucani sub formă de drojdie de bere timp de 16 săptămâni a redus rata infecțiilor cu răceală cu 25% și a ameliorat simptomele la cei bolnavi cu 15%. 7
  • Alergătorii de maraton care au luat 250 mg de beta-glucani care conțin drojdie de bere timp de 28 de zile după un maraton au fost cu 37% mai puține șanse de a contracta simptome de răceală sau gripă comparativ cu cei care au luat un placebo. 8
  • Persoanele care au luat 250 mg de beta-glucani pe zi timp de 90 de zile au raportat cu 43 de zile mai puține simptome de infecție a tractului respirator superior, comparativ cu cei care au luat un placebo. 9
  • Un studiu efectuat pe animale în 2015 a constatat că hrănirea șoarecilor cu beta-glucani timp de două săptămâni „a redus semnificativ efectele infecției gripale asupra mortalității totale”. 10  Potrivit autorilor, „aceste efecte sunt cauzate de stimularea atât a reacției imune celulare cât și a reacției imune umorale care are ca rezultat o sarcină virală mai mică”.
Faceți clic aici pentru a citi mai multe

Alte beneficii pentru sănătate ale beta-glucanilor

Pe lângă faptul că ajută la combaterea COVID-19 și a altor boli virale, beta-glucanii au și alte beneficii pentru sănătate, inclusiv următoarele:

• Îmbunătățirea rezistenței la insulină – S-a demonstrat că beta-glucanii reduc răspunsurile la glucoză și insulină după masă, îmbunătățesc sensibilitatea la insulină la persoanele diabetice și nediabetice și ajută la controlul glicemic. 11  Deși și alte tipuri de fibre solubile au acest efect, comparativ cu celelalte, sunt necesare cantități mai mici de beta-glucani pentru a obține aceleași rezultate.

• Îmbunătățirea diversității microbiene în intestin – Beta-glucanii pot contribui la promovarea creșterii bacteriilor benefice din intestin, acționând ca un prebiotic. Într-un studiu, beta-glucanii au îmbunătățit rata de creștere a Lactobacillus plantarum în intestin atât în ​​condiții nestresate, cât și în condiții de stres.

Poate cel mai important, beta-glucanii au fost capabili să protejeze  probioticele  de stresul gastro-intestinal cauzat de pH scăzut, săruri biliare și enzime digestive, crescând rata de supraviețuire a acestora în timp ce călătoreau prin sistemul digestiv. 12

• Prevenirea cancerului – Beta-glucanii au fost folosiți ca tratament al cancerului în Japonia din 1980. 13  Conform unui raport din 2007 în Medicina, beta-glucanii pot preveni oncogeneza – procesul în care celulele sănătoase devin celule canceroase – prin protejarea împotriva agenților cancerigeni care deteriorează ADN-ul celular.

Raportul notează că beta-glucanii au demonstrat, de asemenea, că inhibă creșterea tumorii prin activarea macrofagelor și a celulelor NK. Beta-glucanii contribuie, de asemenea, la reducerea inflamației asociate cu cancerul și la lupta împotriva metastazelor, recurenței cancerului și rezistenței la medicamente tumorale. 14

• Reducerea poftei de mâncare și scăderea în greutate – Într-un studiu realizat pe anul 2018 în PLOS One, cercetătorii au împărțit șoarecii în două grupuri. Un grup a fost hrănit cu o dietă bogată în grăsimi cu beta-glucani, în timp ce celălalt a fost hrănit cu o dietă bogată în grăsimi cu celuloză, un alt carbohidrat bogat în fibre, timp de 12 săptămâni.

După perioada de testare, șoarecii cărora li s-a administrat beta-glucanii au avut o creștere în greutate și o masă de grăsime semnificativ mai mică în comparație cu grupul celulozic. De asemenea, au avut o producție crescută de acizi grași cu lanț scurt, în special butirat, și secreții mai mari de hormoni intestinali peptida YY și GLP-1, care ajută la reducerea poftei de mâncare și la îmbunătățirea sensibilității la insulină. 15

Puteți găsi beta-glucani sub formă suplimentară, dar, ca întotdeauna, cel mai bine este să obțineți acest tip de fibre din surse alimentare 16 întregi,  cum ar fi ciupercile (Reishi,  Shiitake , Maitake), drojdia de panificație sau  algele marine . Anumite boabe cum ar fi ovăzul, orzul, sorgul, secara și orezul îl conțin, de asemenea.

Alți nutrienți care ajută la creșterea imunității

În timp ce beta-glucanii sunt imunomodulatori importanți, există și alți nutrienți care stimulează imunitatea, inclusiv:

• Vitamina C –  Vitamina C  este un puternic antioxidant și unul dintre cei mai puternici nutrienți implicați atât în ​​sistemul imunitar înnăscut, cât și în cel adaptiv. Vitamina protejează împotriva stresului oxidativ, ajută la distrugerea microbilor și susține bariera epitelială a pielii, care împiedică agenții patogeni să pătrundă în corpul dumneavoastră. Vitamina C ajută, de asemenea, la eliminarea celulelor albe din sângele locurilor de infecție și la scăderea potențialelor leziuni tisulare. 17

Într-un studiu din 2020 publicat în Pneumologie, cercetătorii au analizat dacă doza mare de vitamina C administrată intravenos ar putea ajuta la tratarea pacienților cu COVID-19 bolnavi în mod critic. 18  Cincizeci și patru de pacienți au fost împărțiți în două grupuri. Unui grup i s-au administrat 12 grame de vitamina C la fiecare 12 ore timp de șapte zile, iar celuilalt grup a primit un placebo.

Pacienții din grupul cu doze mari de vitamina C au prezentat niveluri mai scăzute de interleukină-6, o citokină pro-inflamatorie care este unul dintre factorii care au contribuit la furtuna de citokine și au înregistrat o reducere semnificativă a mortalității de 28 de zile.

De regulă, nu recomand doze mari de vitamina C decât dacă este sub formă lipozomală. De asemenea, nu recomand suplimentarea pe termen lung sau cronică cu doze mari de vitamina C, deoarece acest lucru poate provoca dezechilibre nutriționale. De exemplu, administrarea de doze mari de vitamina C (acid ascorbic) în mod regulat scade nivelul de cupru, deci dacă sunteți deja deficitar în cupru și luați doze mari de vitamina C, vă puteți compromite sistemul imunitar.

Vitamina D – Vitamina D, care este produsă în piele ca răspuns la expunerea la soare, este un hormon steroid cu activitate antimicrobiană puternică capabilă să lupte împotriva bacteriilor, virușilor și ciupercilor. Dovezile sunt clare că cu cât nivelul de  vitamina D este mai scăzut , cu atât riscul de a contracta o răceală sau o gripă este mai mare. 19

O analiză științifică a confirmat suplimentarea cu vitamina D crește imunitatea și reduce ratele de răceală și gripă. 20  Cercetătorii consideră că vitamina D oferă protecție prin creșterea peptidelor antimicrobiene în plămâni și că „[t] poate fi unul dintre motivele pentru care răcelile și gripele sunt cele mai frecvente în timpul iernii, când expunerea la soare (și, prin urmare, producerea naturală de vitamina D a corpului ) este cel mai scăzut … ” 21

Potrivit unui raport din 2020 publicat în The Lancet Diabetes & Endocrinology, vitamina D a fost utilizată pentru a preveni sau trata infecțiile respiratorii acute încă din anii 1930. 22  Recent, similitudinile dintre factorii de risc ai deficitului de vitamina D și factorii de risc pentru infecția severă cu COVID-19 i-au determinat pe cercetători să analizeze dacă suplimentarea cu vitamina D ar putea fi benefică pentru prevenirea sau tratarea noului virus.

Într-un studiu indonezian, cercetătorii au descoperit că majoritatea cazurilor severe de COVID-19 cu niveluri inadecvate de vitamina D sau de inadecvare a vitaminei D au murit, determinându-i să ajungă la concluzia că starea vitaminei D este puternic corelată cu mortalitatea prin COVID-19. 23

Într-un alt studiu publicat în Aging Clinical and Experimental Research, cercetătorii britanici au analizat date din 20 de țări europene diferite, comparând ratele de COVID-19 și ratele de mortalitate cu nivelul mediu de vitamina D al populației. 24

Au descoperit țări precum Spania și Italia, care au raportat rate mai mari de deces, de asemenea, au avut niveluri mai ridicate de deficit de vitamina D în populație. În schimb, țările cu rate mai scăzute de COVID-19 și mortalitate, precum Suedia și Norvegia, au avut, de asemenea, rate mai mici de deficit de vitamina D.

• Zinc – Zincul afectează mai multe părți diferite ale sistemului imunitar. Nutrientul este esențial pentru dezvoltarea normală și funcționarea neutrofilelor, a celulelor NK și a macrofagelor. Zincul  funcționează și ca antioxidant și ajută la prevenirea deteriorării radicalilor liberi în timpul inflamației asociate bolilor virale. 25

De asemenea, s-a demonstrat că zincul inhibă replicarea virală a virușilor dependenți de ARN, care includ COVID-19, rinovirusurile (care cauzează răceli comune) și gripa. Din această cauză, cercetătorii dintr-un raport din 2020 din Hypotheses Medical afirmă că este posibil ca zincul să fie benefic pentru prevenirea și tratarea COVID-19. 26

https://articles.mercola.com/sites/articles/archive/2020/08/31/beta-glucans-may-help-combat-covid-19.aspx

Ivermectinei cu Doxiciclina tratament covid19

Un studiu recent efectuat în perioada 2 mai – 5 iunie 2020 la primul spital afiliat Universitatea Xi’an Jiaotong, care a implicat 116 pacienți care au dat test pozitiv pentru COVID-19, a concluzionat că în ceea ce privește rezultatul tratamentului, efectele adverse și siguranța, deși ambele regimuri de tratament au fost eficientă în acest studiu, combinația Ivermectinei cu Doxiciclina a fost superioară celei din terapia cu hidroxiclorochină și azitromicină pentru utilizare în cazurile de infecții ușoare până la moderate.  

Studiul a început cu 181 de pacienți, dar 42 au fost excluși din cauza condițiilor comorbide care ar fi putut afecta timpul de recuperare, 14 nu au fost dispuși să participe la studiu și 9 nu au participat. Restul de 116 au avut grade ușoare până la moderate de boală cu radiografie toracică normală sau aproape normală și saturație de oxigen de peste 95%, care au fost tratați ca un protocol ambulatoriu. 

Participanții au fost împărțiți în 2 grupuri: grupul A care a primit 200 ugm / kg doză unică de ivermectină și 100 mg BID de doxiciclină timp de 10 zile; și grupul B care a primit 400 mg de hidroxiclorochină în prima zi urmată de 200 mg timp de 9 zile plus 500 mg de azitromicină timp de 5 zile. Ambele grupuri au primit îngrijiri standard pentru orice plângeri, cum ar fi febră, dureri de cap, tuse, au fost sfătuiți cu privire la alimentația adecvată, hidratarea și autoizolarea în condiții sanitare. Pacienții au fost evaluați la fiecare 2 zile începând cu a cincea zi sau a doua zi nesimptomatică din prima zi a tratamentului prin studiu PCR sau tampon nazofaringian și gât. 

Grupa A Ivermectina / Doxiciclina a cunoscut o rată de recuperare de 100%, cu o recuperare simptomatică medie de 5,93 zile și o PCR negativă în 8,93 zile. 55,10% au câștigat recuperare simptomatică în ziua 5 cu un grad ușor de efect advers în 31,67% cu raportări de letargie la 14 pacienți, greață la 11 și vertij ocazional la 7 pacienți.  

Grupa B Hidroxiclorochină / Azitromicină a înregistrat o rată de recuperare de 96,36%, cu o recuperare simptomatică medie de 6,99 zile și o PCR negativă la 9,33 zile, cu un anumit grad de efecte adverse, cu raportări de tipuri ușoare de vedere neclară și dureri de cap la 13 pacienți, letargie crescută și amețeli la 22 de pacienți, palpitații ocazionale la 10 și greață și vărsături la 9 pacienți. 

Cercetătorii au ajuns la concluzia că cercetătorii de la Universitatea Upazila pentru sănătate și planificare familială (UHFPO), Chakoria, Cox’s Bazar, în colaborare cu Abu Taiub Mohammad Mohiuddin Chowdhury, Primul Spital Afiliat Universitatea Xi’an Jiaotong din China, au concluzionat că, în ceea ce privește rezultatele tratamentului COVID-19, efecte adverse și siguranță, terapia combinată Ivermectină / Doxiciclină a fost observată mai buna decât terapia combinată Hidroxiclorochină / Azitromicină în cazurile de boală de grad ușor până la moderat la pacienți. S-a observat că atât echipele chineze, cât și cele din Bangladesh au găsit că ambele tratamente sunt eficiente în acest studiu, dar una a fost superioară celeilalte, potrivit echipelor de cercetare.

Materiale furnizate de:

Conținutul poate fi editat în funcție de stil și lungime.

Acest articol nu este destinat să ofere diagnostic medical, sfaturi, tratament sau aprobare.

http://en.xjtu.edu.cn/info/1005/2174.htm

https://clinicaltrials.gov/ct2/show/NCT04434144

https://www.worldhealth.net/news/ivermectin-displaying-promising-results/

Efectele probioticelor în afecțiuni sau infecții similare cu COVID-19 asupra rezultatelor din sănătate: o analiză a probelor

Dr. Mary Rozga , RDN Feon W. Cheng PhD, MPH, RDN Deepa Handu PhD, RD, LDN

Afișați mai multe

https://doi.org/10.1016/j.jand.2020.07.016

Abstract

Probioticele au fost sugerate ca o intervenție potențială pentru îmbunătățirea rezultatelor, în special a pneumoniei asociate cu ventilația, la pacienții infectați cu boala coronavirus 2019 (COVID-19). Cu toate acestea, odată cu dezvoltarea rapidă a pandemiei COVID-19, există puține dovezi directe disponibile la pacienții infectați. Obiectivul acestei analize de abordare este de a examina disponibilitatea și natura literaturii care descrie efectul probioticelor la adulți cu afecțiuni sau infecții similare cu infecția cu COVID-19 asupra rezultatelor legate de sănătate. MEDLINE, Index cumulativ la literatura de îngrijire medicală și aliate de sănătate și baze de date Cochrane au fost căutate pentru studii publicate din 1999 până la 1 mai 2020, care examinează efectul probioticelor în condiții aplicabile persoanelor infectate cu COVID-19, inclusiv, dar fără a se limita la, alte forme de coronavirus,boli critice și ventilație mecanică. Căutarea în bazele de date a identificat 1925 de articole unice, 77 de articole cu text complet au fost revizuite și 48 de studii au fost incluse în această revizuire a obiectivelor, incluzând 31 de studii primare și 17 recenzii sistematice. Studiile primare au examinat o serie de intervenții care au variat în funcție de diversitatea și tipurile probiotice, inclusiv 8 studii care s-au concentrat pe sinbiotice, care includ atât pre- și probiotice. Câteva analize sistematice au examinat efectul probioticelor asupra pneumoniei asociate ventilatorului și a altor infecții. Deși cele mai multe analize sistematice concluzionate probiotice pot îmbunătăți aceste rezultate, cei mai mulți autori de revizuire sistematică au concluzionat că dovezile erau scăzute de calitate și ridicate în eterogenitate. În absența dovezilor directe cu pacienți infectați cu COVID-19,studiile efectuate în populații comparabile sunt în prezent cea mai bună resursă pentru a ghida intervențiile probiotice în corelație cu expertiza clinică și planificarea multidisciplinară a asistenței medicale.

metode

Această revizuire a scopurilor a fost realizată pe baza protocolului de către Arksey și O’Malley 11  și ulterior dezvoltată de Levac și colab 14  și Joanna Briggs Institute. 15  Protocolul pentru această revizuire de abordare aderă la elementele de raportare preferate pentru revizuirile sistematice și  metaanalizele pentru verificările de analizare 16 și a fost înregistrat la Open Science Framework (osf.io/2etbd). 17

Criterii de eligibilitate

Întrebarea de cercetare a fost formulată folosind abordarea populație-concept-context. 15  O descriere completă a criteriilor de eligibilitate poate fi găsită în  figura 1 . Studiile au fost incluse dacă includeau adulți cu afecțiuni care erau aplicabile persoanelor cu infecție cu COVID-19, incluzând, dar fără a se limita la adulții cu alte forme de coronavirus, sindrom de detresă respiratorie acută, boli critice sau cu ventilație mecanică. Utilizarea probioticelor pentru a  preveni infecțiile virale, cum ar fi rinovirusul sau gripa, la persoane sănătoase nu au fost incluse în această revizuire a scopului. Conceptul major explorat a fost intervenția probioticelor. Au fost incluse intervenții cu sinbiotice, care conțin atât pre și probiotice. Deși principalul obiectiv al acestei revizuiri a fost acela de a raporta studiile care vizează indivizii din UCI, contextul a fost lăsat deschis pentru a include și persoane cu viață liberă cu infecții respiratorii sau virale similare cu COVID-19. Proiectarea studiului s-a limitat la studii de intervenție primară, analize sistematice sau ghiduri de practică bazate pe dovezi.Studiile au fost limitate la cele publicate în limba engleză din cauza constrângerilor de resurse și din 1999 pentru a surprinde studii care ar fi putut fi efectuate în timpul sau după sindromul respirator acut sever sau focare ale sindromului respirator din Orientul Mijlociu.

Figura 1. Criterii de eligibilitate pentru revizuirea obiectivelor studiilor care examinează efectul probioticelor asupra rezultatelor legate de COVID-19.

CategorieCriterii de includereCriteriu de excludere
Tipul de studiuArticole publicate în reviste revizuite de la egal la egalRezumate de conferințe, literatură gri, precum rapoarte organizaționale, documente guvernamentale și cărți albe
populațieOamenii adulți care • au prezentat semne și simptome sau au fost pozitivi pentru infecții virale legate de coronavirus (COVID-19, un  SARS, b  MERS c ) • au boli respiratorii acute (ARDS d ) • au pneumonie • prezintă risc de ventilator- pneumonie asociată • au infecții ale căilor respiratorii • au boli critice • sunt pe cale de ventilație planificată / mecanică • au sepsis • au boli virale, în special gripaStudii pe animale; studii celulare sau in vitro; copii, adulți sănătoși, sportivi, femei însărcinate; persoane care nu au o infecție sau o stare de interes; persoane cu următoarele afecțiuni: HIV e , SIDA f , HPV g , hepatită, posturgie, traumatism sau leziuni sau arsuri cerebrale, BPOC h , pancreatită acută
Rezultate comparative ale intervențieiProbiotice, sinbioticeSuplimente din plante
Fără limiteFără limite
Rezultate, dar fără a se limita la: • Mortalitate • Calitatea vieții • Dezvoltarea COVID-19 sau a unei pneumonii sau a unei alte pneumonii asociate ventilatorului • internare în spital • Intubare • Zile pe ventilator • Durata șederii în spital • Gravitatea simptomului • Starea nutriției • Simptomele gastro-intestinale • Infecții noi • Markeri inflamatori • Bacterii gastrointestinale / microbioteRezultate care nu au legătură cu COVID-19 sau nutriție
reglajFără limiteFără limite
Marime de mostraFără limiteFără limite
Proiecte de studiuStudii primare de intervenție și observație și revizuire sistematică și metaanalizeRecenzii narative, comentarii, editoriale, scrisori către editor
Interval de anIanuarie 1999 – 1 mai 2020Articole publicate înainte de 1999 sau după căutarea de la 1 mai 2020
LimbaEnglezăNon-engleză

A

COVID-19 = boala coronavirus 2019.b

SARS = sindrom respirator acut sever.c

MERS = sindromul respirator din Orientul Mijlociu.d

ARDS = sindrom de detresă respiratorie acută.e

HIV = infecție cu virusul imunodeficienței umane.f

SIDA = sindromul imunodeficienței dobândite.g

HPV = papilomavirus uman.h

BPOC = boală pulmonară obstructivă cronică.

Strategia de căutare

Literatura a fost căutată folosind MEDLINE (EBSCO), Index cumulativ la Nursing & Allied Health Literature (EBSCO), baze de date Cochrane de teste controlate și recenzii sistematice pentru articole publicate în limba engleză din ianuarie 1999 și până la data căutării din 1 mai 2020. Au fost căutate bazele de date folosind termeni atât pentru populație, cât și pentru probiotice. Termenii de căutare pentru COVID-19 au fost adaptați de la Institutul Național de Excelență în Sănătate și Îngrijire. 18  Planul de căutare pentru baza de date MEDLINE poate fi găsit în  figura 2 .

Figura 2. Strategie de căutare a eșantionului din baza de date MEDLINE pentru revizuirea scopurilor care examinează efectul probioticelor asupra bolii coronavirusului rezultatele legate de 2019.

Nu.întrebareLimitatoare și expandatoareUltima rulare prin
S18S16 ȘI S17Limitante: data publicării: 19990101-20201231
Moduri de căutare: Booleană / frază
Interfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S17S1 SAU S2 SAU S3Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S16S4 SA S5 SAU S6 SAU S7 SA S8 SAU S9 SAU S10 SAU S11 SAU S12 SAU S13 SAU S14 SAU S15Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S15(MH ”gripă umană”) OR (MH ”Virus Boli +”) SAU (MH ”Viremia +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S14(MH „Sepsis +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S13„Sindrom de detresă respiratorie acută” SAU (MH „Sindromul de detresă respiratorie, adult”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S12(MH „Infecții ale tractului respirator +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S11(MH „Boală critică”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S10(MH „Respirație, artificial +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S9(MH „Pneumonie, asociată cu ventilatorul”) SAU (MH „Pneumonie +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S8(MH „Coronavirusul sindromului respirator din Orientul Mijlociu”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S7(MH „SARS Virus”) SAU (MH „Sindromul respirator sever acut”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S6coronavirus ∗ SAU coronovirus ∗ SAU coronavirinae ∗ OR Coronavirus ∗ SAU Coronovirus ∗ SAU Wuhan ∗ Sau Hubei ∗ SAU Huanan OR „2019-nCoV” SAU 2019nCoV SAU nCoV2019 SAU „nCoV-2019 ″ SAU„ COVID-19 ″ SAU COVID-19 ″ 19 ″ SAU CORVID19 SAU „WN-CoV” SAU WNCoV SAU „HCoV-19 ″ SAU HCoV19 SAU COV SAU„ Roman nou 2019 ”OR Ncov SAU„ N-cov ”SAU„ SARS-CoV-2 ″ SAU „SARSCoV-2 ″ SAU „SARSCoV2” SAU „SARS-CoV2” SAU SARSCov19 SAU „SARS-Cov19” SAU „SARSCov-19” SAU „SARS-Cov-19” SAU Ncovor SAU Ncorona ∗ SAU Ncorono ∗ Sau NcovWuhan ∗ SAU NcovHubei ∗ SAU NcovChina ∗ NcovChinese *Moduri de căutare: Căutare SmartTextInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S5((corona ∗ SAU corono ∗) N0 (virus ∗ SAU viral ∗ SAU virinae ∗)) OR ((corona ∗ SAU corono ∗) N0 (virus ∗ SAU viral ∗ SAU virinae ∗))Moduri de căutare: Căutare SmartTextInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S4(MH „Coronavirus +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S3(MH „Bifidobacterium +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S2(MH „Lactobacillus +”)Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet
S1(„Probiotice”) SAU „probiotice”Moduri de căutare: Boolean / frazăInterfață: Bază de date de cercetare EBSCOhost
Ecran de căutare
: Baza de date de căutare avansată : MEDLINE complet

Selectarea studiului și graficul datelor

Studiile duplicate au fost încărcate pe Rayyan, un titlu online și un program de screening abstract. 19  Titlul și screeningul abstract a fost realizat în 2 faze. În prima fază, 1 examinator (MR) a exclus toate studiile efectuate cu animale sau celule sau nu a examinat intervenția probioticelor. Toate titlurile și rezumatele eligibile rămase au fost examinate independent de 2 recenzori utilizând criterii de eligibilitate a priori ( Figura 1) (MR și FWC) și discrepanțele au fost soluționate prin consens sau o a treia revizuire (DH). Toate titlurile și rezumările potențial incluse au trecut la revizuirea textului complet. Pentru fiecare studiu potențial, un recenzor a examinat criteriile de eligibilitate și a extras date privind următoarele: proiectarea studiului; starea de boală a populației țintă (de exemplu, UCI, ventilată mecanic), intervenție, inclusiv numărul și tipul de tulpini probiotice, 20 dacă intervenția a fost realizată în contextul unui sinbiotic și al modului de livrare; tratament comparativ; și rezultatele raportate. Eligibilitatea și extragerea datelor au fost confirmate de un al doilea evaluator, cu întrebări și discrepanțe determinate de consens sau de un al treilea evaluator. Așa cum se obișnuiește pentru analize de evaluare, criteriile de eligibilitate au fost clarificate în timpul revizuirii textului complet, iar autorii au stabilit că traumatismele, arsurile și pancreatita acută au fost afecțiuni sau infecții care nu se aplică populației COVID-19. Procesul de căutare și selecție a fost documentat pe un diagramă de flux de articole preferate pentru evaluări sistematice și metaanalize. 21  Rezultatele au fost sintetizate în mod narativ și au fost cartografiate folosind o hartă de căldură, grafic grafic și bare grafice.

Rezultate

Bazele de date și căutările de mână au identificat 1925 titlu sau rezumate unice. Textele complete ale 77 de studii au fost revizuite și 48 de studii au fost incluse în revizuirea scopului, inclusiv 17 recenzii sistematice, 22 ,  23 ,  24 ,  25 ,  26 ,  27 ,  28 ,  29 ,  30 ,  31 ,  32 ,  33 ,  34 ,  35 ,  36 ,  37 ,  38  26 studii randomizate controlate, 39 ,  40 ,  41 ,  42,  43 ,  44 ,  45 ,  46 ,  47 ,  48 ,  49 ,  50 ,  51 ,  52 ,  53 ,  54 ,  55 ,  56 ,  57 ,  58 ,  59 ,  60 ,  61 ,  62 ,  63 ,  64  și 5 studii neautorizate controlate ( incluzând atât studii controlate non-recunoscute, cât și studii observaționale) 65 ,  66 , 67 ,  68 ,  69  ( figura 3 ).

Prezentare generală a articolelor incluse

Din cele 48 de articole incluse, 23 de articole 23 ,  24 ,  25 ,  26 30 , 31 , 36 , 37 , 40 , 43 ,  44 ,  45 ,  46 ,  47 49 , 50 , 52 , 53 , 55 , 58 , 60 , 64 , 69  s-au concentrat pe participanții care au fost bolnavi de critică, dar nu au fost ventilați mecanic, 20 de articole 22 ,27 , 28 , 32 ,  33 ,  34 ,  35 38 , 39 , 41 , 42 , 51 , 59 , 61 ,  62 ,  63 66 ,  67 ,  68 ,  69  adulți vizați care erau bolnavi de critică și ventilați mecanic și 5 articole 29 , 54 , 56 , 57 , 65 a inclus indivizi cu diverse afecțiuni, cum ar fi infecțiile tractului respirator sau gripa ( figura 4 ). Toate articolele s-au concentrat asupra populației adulte, care poate include adulți în vârstă, dar niciunul nu s-a concentrat exclusiv pe populații mai în vârstă.

Rezultatele cele mai frecvent raportate au fost mortalitatea, urmată de dezvoltarea pneumoniei asociate ventilatorului, noi infecții, lungimea spitalului, simptome gastrointestinale, microbiota gastrointestinală, evenimente adverse, markeri inflamatori, zile la ventilator, dezvoltarea pneumoniei, starea de nutriție, disfuncția organului sau insuficiență, calitatea vieții și gravitatea simptomelor simptomelor virale. Disponibilitatea și natura studiilor incluse sunt demonstrate pe o hartă a căldurii ( figura 4 ), care ilustrează distribuția rezultatelor evaluate în articolele incluse în funcție de proiectul studiului și de starea pacienților. De exemplu, din cele 9 studii randomizate controlate cu pacienți bolnavi critici și ventilat mecanic, 28 , 39 , 41 ,42 , 49 , 51 , 59 , 61 , 62  dezvoltarea pneumoniei asociate ventilatorului a fost raportată ca rezultat în 8 dintre acestea. 28 , 39 , 41 , 42 , 49 , 51 , 59 , 61

Studii primare incluse în Scoping Review

Din cele 31 de studii primare de cercetare incluse, mărimile eșantionului au variat de la 15 la 259 de participanți, iar durata de intervenție a variat de la 2 la 60 de zile. Cu toate acestea, durata de intervenție a fost adesea variabilă chiar și în cadrul unui studiu, în funcție de cât timp a fost participantul la UCI sau de la ventilația mecanică. Opt studii primare incluse au examinat probioticele în contextul sinbioticelor (pre- și probiotice combinate). 59 ,  60 ,  61 ,  62 ,  63 ,  64 67 , 69  Numărul de tulpini probiotice a variat între studii, 42% dintre studii intervenind cu 1 tulpină probiotică și 16% intervenind cu 7 – 10 tulpini probiotice ( Figura 5). Genul probiotic cel mai frecvent utilizat în intervenții a fost lactobacilul (90,3% din intervenții), urmat de bifidobacterium (32,2% din intervenții) și streptococ (19,4% din intervenții) ( figura 6 ); mai multe specii din aceste genuri au fost incluse în cadrul intervențiilor de studiu. Intervențiile au fost administrate integral printr-un tub de alimentare datorită stării critice a aproape tuturor participanților la studii incluse, cu excepția a 2 studii fiecare în care probeoticele au fost ingerate oral 56 , 57  sau aplicate topic. 48 , 49  În 4 studii, autorii au indicat mai multe rute de livrare a probioticelor. Pacienților li s-a administrat probiotice oral vs printr-un tub de alimentare, în funcție de starea pacientului în Kwon et al,50  McNaught și colab., 53  și Forestier și colab., 46  și probiotice au fost administrate topic în orofaringele combinate cu enteral în Morrow și colab. 54

Recenzii sistematice și metaanalize și linii directoare incluse în revizuirea scopului

Șaptesprezece analize sistematice și linii directoare au fost incluse în această revizuire a obiectivelor. 22 ,  23 ,  24 ,  25 ,  26 ,  27 ,  28 ,  29 ,  30 ,  31 ,  32 ,  33 ,  34 ,  35 ,  36 ,  37 ,  38  Concluziile autorilor și certitudinea probelor pentru revizuirile sistematice publicate din 2010 până în 2020 sunt prezentat în  figura 7. În aceste analize sistematice, concluziile autorilor sunt eterogene, deși nu au existat analize sistematice care să descrie dovezi de înaltă calitate care să examineze efectul probioticelor în populațiile de interes. Cele mai multe analize sistematice descriu că probioticele au scăzut incidența pneumoniei asociate ventilatorului, 26 ,  27 ,  28 34 ,  35 , 36 ,   deși alte recenzii sistematice care s-au concentrat în mod special pe incidența pneumoniei asociate ventilatorului au încheiat niciun efect benefic din probiotice. 22 , 29 , 32  Mai mulți autori descriu că eterogenitatea intervenției 22 , 2526 , 29 , 32 , 34 , 36  sau riscul de prejudecată 24 ,  25 ,  26 29 , 34 , 36  au fost un motiv de îngrijorare. Deși cele mai multe analize sistematice au inclus o analiză a riscului de prejudecată a studiilor incluse, 22 , 24 ,  25 ,  26 28 ,  29 ,  30 33 ,  34 ,  35 37 , 38 puțini au raportat asupra certitudinii probelor pentru rezultate. 30 , 34  Analiza sistematică realizată de Cochrane Collaboration în 2014 a descris dovezi de calitate scăzută pentru efectul probioticelor asupra pneumoniei asociate ventilatorului. 34  Au fost mai puține concluzii care descriu efectul probioticelor asupra altor rezultate. Autorii au ajuns la concluzia că probioticele pot reduce infecțiile, dar nu au avut efect asupra mortalității. O revizuire sistematică s-a concentrat în special pe rezultatul evenimentelor adverse și nu a găsit niciun risc crescut pentru pacienții bolnavi critici administrați probiotice. 30

Figura 7. Concluziile autorilor în recenzii sistematice sau ghiduri publicate din 1999 până în 2020 care examinează efectul probioticelor la persoanele cu afecțiuni comparabile cu infecția cu coronavirus 2019.

Revizuire sistematică sau ghidPopulația / contextul țintăConcluzia autorilorGrad pentru siguranța dovezilor
Fan et al 2019 35Prevenirea VAP a„Pe baza clasificării eficacității,„ B. longum  +  L. bulgaricus  +  S. termofile ”ar trebui să fie prima alegere [simbiotică] pentru prevenirea VAP, în timp ce Synbiotic 2000FORTE are potențialul de a reduce mortalitatea în spital și mortalitatea UCI.”NR b ; eficacitatea intervențiilor clasificate în metaanaliza rețelei
Manzanares et al 2016, 36Boală criticăProbioticele arata promisiunea in reducerea infectiilor, inclusiv VAP in bolile critice. În prezent, eterogenitatea clinică și prejudecata potențială a publicării reduc recomandările clinice puternice și indică necesități suplimentare de studii clinice de înaltă calitate pentru a dovedi aceste avantaje. ”NR
Bo et al 2014 34Prevenirea VAP„Dovada sugerează că utilizarea probioticelor este asociată cu o reducere a incidenței VAP. Cu toate acestea, calitatea dovezilor este scăzută. . . Dovada disponibilă nu este clară în ceea ce privește o scădere a UCI sau a mortalității spitalicești cu uz de probiotice. . . Rezultatele acestei meta-analize nu oferă dovezi suficiente pentru a trage concluzii privind eficacitatea și siguranța probioticelor pentru prevenirea VAP la pacienții cu UCI. ”Incidența VAP: scăzută
ATI c  și mortalitate spital: foarte scăzută
Barraud et al 2013, 33Boală critică„Prezenta meta-analiză sugerează că administrarea de probiotice nu a redus semnificativ rata de mortalitate a UCI sau a spitalului, ci a redus incidența pneumoniei dobândite de UCI și durata de ședere a UCI”.NR
Wang et al. 2013 29Prevenirea VAP„Profilaxia probiotică a [VAP] a rămas neconcludentă și nu a reușit să îmbunătățească prognosticul pacienților generali cu ventilație mecanică. De remarcat că infecțiile cauzate de P. aeruginosa au fost reduse prin administrarea de probiotice. În plus, se recomandă ca studiile avansate să exploateze transformarea microorganismelor patogene datorită administrării probioticelor, precum și a populației specifice. ”NR
Gu et al 2012, 22Prevenirea VAP„Dovada limitată sugerează că probioticele nu prezintă niciun efect benefic la pacienții care sunt ventilați mecanic; astfel, probioticele nu trebuie recomandate pentru aplicarea clinică de rutină. Cu toate acestea, rezultatele acestei metaanalize ar trebui interpretate cu precauție, din cauza eterogenității dintre proiectele de studiu. Studiile viitoare ar trebui să se axeze pe siguranța probioticelor. ”NR
Liu et al 2012 25Boală critică„Utilizarea probioticelor a fost asociată cu o reducere semnificativă statistic a incidenței pneumoniei nosocomiale la pacienții bolnavi critici. Cu toate acestea, sunt necesare studii mari, bine proiectate, randomizate, multicentru pentru a confirma orice efecte ale punctelor clinice probiotice, cum ar fi mortalitatea și lungimea UCI și șederea spitalului.NR
Petrof et al 2012 26Boală criticăProbioticele par să reducă complicațiile infecțioase, inclusiv [VAP] și pot influența mortalitatea [UCI]. Cu toate acestea, eterogenitatea clinică și statistică și estimările imprecise împiedică recomandările clinice puternice. Cercetările suplimentare privind probioticele la bolnavul critic sunt justificate. ”NR
Bailey et al 2011 32Prevenirea VAPStudiile clinice nu au reușit să demonstreze un efect benefic consecvent al probioticelor la pacienții cu ventilație mecanică; astfel, nu sunt recomandate pentru utilizarea clinică de rutină. Cu toate acestea, eterogenitatea dintre proiectele de studiu poate împiedica această evaluare, iar desenele ar trebui unificate în cercetările viitoare. „NR
Hempel și colab., 2011 30Include boală critică„Există o lipsă de evaluare și raportare sistematică a evenimentelor adverse în studiile de intervenție probiotică, iar intervențiile sunt slab documentate. Dovada disponibilă în ECR [studii randomizate controlate] nu indică un risc crescut; Cu toate acestea, evenimentele adverse rare sunt greu de evaluat și, în ciuda numărului substanțial de publicații, literatura actuală nu este bine echipată pentru a răspunde cu încredere la întrebările privind siguranța intervențiilor probiotice. „Boală insuficientă, dar critică, care nu este examinată separat
Schultz et al 2011 27Prevenirea VAP„Utilizarea profilactică a antibioticelor la pacienții bolnavi critici este eficientă în reducerea incidenței VAP. Strategiile probiotice merită luate în considerare în viitoarele teste bine alimentate. Sunt necesare studii viitoare pentru a determina dacă este preventiv. . . strategiile probiotice sunt sigure în ceea ce privește dezvoltarea. . . infecții probiotice. Trebuie stabilit dacă eficacitatea probioticelor se îmbunătățește atunci când acești agenți sunt furnizați simultan la gură și intestine. ”NR
Siempos et al 2010 28Prevenirea VAP„Administrarea probioticelor este asociată cu o incidență mai mică a [VAP] decât a controlului. Având în vedere rezistența antimicrobiană din ce în ce mai mare, această strategie promițătoare merită luată în considerare în studiile viitoare, care ar trebui să aibă o supraveghere activă a bolilor induse de probiotice. ”NR
Jack et al 2010 23Boală critică„Datele care susțin utilizarea probioticelor în tratarea diareei [alimentării cu tuburi enterale] la pacienții bolnavi critici rămân neclare. Acest document susține că probioticele nu ar trebui administrate pacienților bolnavi critic până când nu sunt efectuate cercetări suplimentare pentru a examina relația de cauzalitate dintre probiotice și mortalitate, indiferent de starea de boală a pacientului sau beneficiul profilactic proiectat de administrarea probiotică. „NR
Koretz 2009 24Boală critică„Probioticele nu par să influențeze mortalitatea sau durata spitalizării. Cu toate acestea, receptorii probioticelor au avut mai puține episoade infecțioase. . . nu este clar că probioticele sunt benefice (și pot fi chiar dăunătoare) în grupul bolnavului critic. ”NR
Isakow și colab. 2007 31Prevenirea HAP d„Nu există dovezi clinice actuale care să sprijine utilizarea probioticelor la. . . reduce ratele HAP. „NR
Watkinson și colab., 2007 37Boală critică„Utilizarea de pre- sau sinbiotice la pacienții adulți bolnavi de critică nu oferă niciun beneficiu semnificativ statistic [pentru infecții nosocomiale, durata șederii în UCI, mortalitatea spitalului și în special pneumonia]. În prezent, există o lipsă de dovezi care să sprijine utilizarea pre- sau sinbiotice la pacienții internați în UCI adulte și este nevoie de un studiu bine proiectat în acest domeniu. ”NR
Heyland et al 2003 38 eBoală critică, ventilată mecanic„Nu există date suficiente pentru a face o recomandare privind utilizarea probioticelor la pacienții bolnavi critici”.NR

A

VAP = pneumonie asociată ventilatorului.b

NR = ne raportat.c

UCI = unitate de terapie intensivă.d

HAP = pneumonie asociată spitalului.e

Ghid de practică bazat pe dovezi.

Discuţie

Această revizuire a scopurilor a determinat faptul că a existat o cercetare considerabilă, inclusiv recenzii sistematice recente, privind utilizarea probioticelor pentru tratarea pneumoniei asociate ventilatorului la pacienții bolnavi critici cu ventilație mecanică, care poate fi aplicabilă pacienților infectați cu COVID-19. Au existat, de asemenea, recenzii sistematice care descriu efectul probioticelor asupra duratei șederii în spital, a mortalității, a noilor infecții și a simptomelor gastro-intestinale la pacienții bolnavi critici care au fost sau nu au fost ventilate mecanic. Nu au existat analize sistematice sau studii primare incluse care au examinat efectele probioticelor la pacienții infectați cu COVID-19 sau alte forme de coronavirus și nu au existat puține dovezi cu privire la tratarea altor infecții virale, cum ar fi gripa. Au fost rezultate importante,inclusiv calitatea vieții și severitatea simptomelor provenite de la o infecție virală, care nu au fost abordate în studiile primare sau în revizuirile sistematice.

Aplicație practicienilor în contextul Pandemiei COVID-19

Practica bazată pe dovezi depinde de practicienii care se află la curent cu cele mai recente dovezi și îl interpretează și pun în aplicare prin lentila expertizei clinice și luând în considerare fiecare pacient în parte. Pandemia COVID-19 s-a dezvoltat atât de rapid încât practicienii trebuie să analizeze dovezi indirecte în populații care pot fi comparabile pentru a determina ce intervenții vor avea ca rezultat cele mai optime.

Această revizuire a scopurilor a demonstrat că, în prezent, nu există analize sistematice sau studii primare care să examineze efectul probioticelor la pacienții cu COVID-19 sau alte forme de coronavirus. Prin urmare, în prezent nu există dovezi directe care să demonstreze că probioticele pot fi eficiente în reducerea simptomelor COVID-19 pentru pacienții cu infecții ușoare sau moderate, care gestionează îngrijirea la domiciliu. Există dovezi disponibile la pacienții cu boală critică, în special la cei care sunt ventilați mecanic, iar acest studiu de cercetare poate fi aplicabil persoanelor infectate cu COVID-19 în îngrijire critică. Deși a existat 1 ghid care descrie utilizarea probioticelor la adulții bolnavi critici ventilat mecanic 38 acest ghid a fost din 2003 și a descris dovezi insuficiente pentru a face o recomandare. Astfel, pentru practicieni să găsească un punct de plecare pentru îndrumări cu privire la intervențiile probiotice pentru pacienții cu COVID-19, este posibil să fie nevoie să interpreteze concluziile din recenzii sistematice prin lentila expertizei clinice, având în vedere modul în care infecția cu COVID-19 poate modifica relațiile observate în mod specific. la pacienții bolnavi critici fără COVID-19. În plus, practicienii vor trebui să ia în considerare considerente pragmatice care sunt de obicei încorporate în recomandările de ghid, inclusiv fezabilitatea și acceptabilitatea față de alți furnizori din echipele de asistență medicală 70 precum și factori specifici indivizilor infectați cu COVID-19. De exemplu, un raport recent COVID-19 privind terapia nutrițională de la Societatea de Medicină pentru Îngrijirea Critică și Societatea Americană pentru Nutriție Parenterală și Enterală descrie că alimentația suplimentară administrată în doze discrete, cum ar fi probioticele, ar trebui administrată o dată pe zi pentru îngrijirea clusterului. . 71

Orice intervenție poate duce la consecințe nedorite, iar raportul risc-beneficiu trebuie luat în considerare atunci când se stabilește dacă trebuie să intervină cu probiotice. Mecanismele probioticelor în ceea ce privește modularea sistemului imunitar pentru prevenirea și tratarea infecțiilor nu sunt bine înțelese, 72  și astfel, practicienii ar trebui să acționeze cu precauție atunci când recomandă probiotice persoanelor infectate cu COVID-19.

Nevoile de cercetare

Eterogenitatea descoperirilor descrise între analizele sistematice poate fi indicativă pentru populațiile eterogene din cadrul îngrijirii critice sau datorită variației tipurilor și dozelor de probiotice administrate în cadrul intervențiilor. Cele mai multe analize sistematice incluse au considerat probioticele ca intervenție, dar așa cum s-a demonstrat în studiile primare, probioticele pot fi livrate într-o varietate de genuri, specii, doze, moduri și durate. În 14 studii, inclusiv 8 studii primare 59 ,  60 ,  61 ,  62 ,  63 ,  64 67 , 69  și 6 recenzii sistematice, 32 ,  33 ,  34 , 35 ,  36 ,  37 de  autori au inclus intervenții cu sinbiotice, care includ un prebiotic împreună cu probioticul pentru a stimula, activa sau îmbunătăți supraviețuirea microorganismelor probiotice. 73 Deși nu au existat diferențe clare în concluziile revizuirii sistematice în funcție de dacă intervenția a fost realizată doar într-o problemă sinbiotică vs probiotică, această diferență în studiile primare incluse ar fi putut contribui la eterogenitatea demonstrată între revizuirile sistematice. Prin urmare, revizuirile sistematice viitoare ar trebui să stratifice rezultatele narative și cantitative în funcție de tipurile sau diversitatea tulpinilor din intervențiile studiilor primare pentru a-l determina folosind probiotice specifice sau o diversitate mai mare de organisme probiotice este avantajoasă în îmbunătățirea rezultatelor. În plus, este nevoie de mai multe cercetări privind rezultatele centrate pe pacient, cum ar fi calitatea vieții și severitatea simptomelor din infecțiile virale.

Nevoia mai mare de cercetare este de a înțelege eficacitatea și riscurile utilizării probioticelor la pacienții infectați cu COVID-19 în mod specific. În prezent, sunt efectuate studii de cercetare pentru a determina efectul probioticelor în tratarea infecției cu COVID-19. 74 ,  75 ,  76  Dieteticienii care lucrează cu persoane infectate cu COVID-19 și care utilizează probiotice în îngrijire sunt încurajați să documenteze experiențe cu Academia de Nutriție și Dietetică Infrastructura Sănătății. 77  Acest forum le permite practicienilor să contribuie cu experiențe la o bază de dovezi pentru practica nutrițională, cu scopul de a îmbunătăți îngrijirea pacientului.

Puncte forte si limitari

Această revizuire a obiectivelor a examinat efectele probioticelor pe o gamă largă de afecțiuni care pot fi aplicabile pacienților infectați cu COVID-19. Cu toate acestea, datorită dezvoltării rapide a pandemiei COVID-19, a existat puțin timp pentru cercetările publicate cu privire la efectul probioticelor la pacienții infectați cu COVID-19. Prin urmare, deși dovezile raportate în această revizuire a scopurilor sunt un bun punct de plecare pentru a găsi literatură aplicabilă pe probiotice care se pot aplica pacienților infectați cu COVID-19, patologia specifică și complicațiile secundare ale infecției cu COVID-19 impun ca practicienii să evalueze potențialele beneficii. și risc pentru fiecare pacient în parte înainte de a recomanda probiotice.

Concluzie

Probbioticele au fost sugerate ca o metodă potențială de modulare a sistemului imunitar pentru a îmbunătăți rezultatele, cum ar fi pneumonia asociată ventilatorului, la pacienții infectați cu COVID-19. În prezent, nu există dovezi directe care să examineze utilizarea probioticelor în îmbunătățirea rezultatelor la pacienții infectați cu COVID-19 sau alte infecții virale similare. Au existat mai multe analize sistematice care examinează efectele probioticelor la persoanele cu boală critică cu sau fără ventilație mecanică asupra rezultatelor centrate pe pacient, cum ar fi mortalitatea și noile infecții, inclusiv pneumonia asociată ventilatorului. Cu toate acestea, riscul de prejudecăți în aceste studii și eterogenitatea dintre studii împiedică concluziile consistente între analizele sistematice,și practicienii ar trebui să ia în considerare aceste limitări atunci când determină prioritățile de tratament pentru pacienții bolnavi critici cu COVID-19.

Referințe

1 Handu D, Moloney L, Rozga M, Cheng F. Îngrijirea malnutriției în timpul pandemiei COVID-19: Considerații pentru centrul de analiză a dovezilor nutriționiștii dietetici înregistrați. J Acad Nutr Diet . Disponibil online înainte de tipărire 14 mai 2020.  https://doi.org/10.1016/j.jand.2020.05.012 . Google Scholar 2 Centrul Național pentru Probiotice Complementare și Integrative pentru Sănătate : Ce trebuie să știți. Departamentul Sănătății și Serviciilor Umane din SUA https://www.nccih.nih.gov/health/probiotics-what-you-need-to-know Publicat 2020. Actualizat în august 2019. Accesat la 2 iunie 2020 Google Scholar 3 J.WY Mak, FKL Chan, SC Ng Probiotics și COVID-19: o dimensiune nu se potrivește tuturorLancet Gastroenterol Hepatol, 5 (2020), p. 644-645 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 4 Q.Y. Gao, YX Chen, JY Fang 2019 Roman infecție cu coronavirus și tract gastrointestinal J Dig Dis, 21 (3) (2020), p. 125-126 CrossRef View Record in Scopus Google Scholar 5 R. Jayawardena, P. Sooriyaarachchi, M. Chourdakis , C. Jeewandara, P. Ranasinghe Îmbunătățirea imunității în infecțiile virale, cu accent special pe COVID-19: O recenzie Diabetes Metab Syndr, 14 (4) (2020), pp. 367-382 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 6 L. Romano, F. Bilotta, M. Dauri, și colab. Raport scurt – Terapia nutrițională medicală pentru pacienții bolnavi critici cu COVID-19 Eur Rev Med Pharmacol Sci, 24 (7) (2020), p. 4035-4039 Vizualizare înregistrare în Scopus Google Scholar 7 C.KY Chan, J. Tao, OS Chan, HB Li, H. Pang Prevenirea infecțiilor tractului respirator prin intervenții sinbiotice: O revizuire sistematică și meta-analiză a studiilor controlate randomizate Adv Nutr, 11 (2020), p. 979-988 CrossRef View Record în Scopus Google Scholar 8 T.P. Wypych, LC Wickramasinghe, BJ Marsland Influența microbiomului asupra sănătății respiratorii Nat Immunol, 20 (10) (2019), p. 1279-1290 CrossRef View Record in ScopusGoogle Scholar 9 A. Dumas, L. Bernard, Y. Poquet, G. Lugo-Villarino, O. Neyrolles Rolul microbiotei pulmonare și a axei intestinale-pulmonare în bolile infecțioase respiratorii Cell Microbiol, 20 (12) (2018) , Articolul e12966 CrossRef Google Scholar 10 S. Anand, dieta SS Mande , microbiota și conexiunea intestin-plămâni Front Microbiol, 9 (2018), p. 2147 Google Scholar 11 H. Arksey, L. O’Malley Studii de abordare : către un cadru metodologic Int J Soc Res Methodol, 8 (1) (2005), p. 19-32 CrossRef View Record în Scopus Google Scholar 12 D. Handu , L. Moloney, T. Wolfram, P. Ziegler, A. Acosta, A. SteiberMetodologia Academiei de Nutriție și Dietetică pentru efectuarea de recenzii sistematice pentru biblioteca de analiză de dovezi J Acad Nutr Diet, 116 (2) (2016), p. 311-318 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 13 C. Papoutsakis, L. Moloney , RC Sinley, A. Acosta, D. Handu, AL Metodologia Academiei de Nutriție și Dietetică AL Steiber pentru elaborarea de ghiduri de practică nutrițională bazate pe dovezi J Acad Nutr Diet, 117 (5) (2017), p. 794-804 Articolul Descarcă PDF Vezi Înregistrare în Scopus Google Scholar 14 D. Levac, H. Colquhoun, KK O’Brien Studii de aplicare: avansarea metodologiei Implement Sci, 5 (2010), p. 69Vizualizați înregistrarea în Scopus Google Scholar 15 Peters MDJ GC, McInerney P, Munn Z, Tricco AC, Khalil, H. Capitolul 11: Scoping Review (versiunea 2020). În: Aromataris E, Munn Z, (Eds.),  Joanna Briggs Institute Reviewer’s Manual , Adelaide, Australia: Joanna Briggs Institute.  https://wiki.jbi.global/display/MANUAL ;  https://doi.org/10.46658/JBIRM-20-01 . Google Scholar 16 A. C. Tricco, E. Lillie, W. Zarin  și colab. PRISMA Extension for Scoping Reviews (PRISMA-ScR): Lista de verificare și explicații Ann Intern Med, 169 (7) (2018), pp. 467-473 CrossRef View Record in Scopus Google Scholar 17 M. RozgaEfectul probioticelor asupra rezultatelor legate de COVID-19: o revizuire a scopurilor. Open Science Framework osf.io/2etbd Publicat 2020. Accesat 13 mai 2020 Google Scholar 18 Institutul Național pentru excelență în Sănătate și Îngrijire Proces intermediar și metode pentru elaborarea de orientări rapide pentru COVID-19 https://www.nice.org.uk/ process / pmg35 / resource / interim-process-and-metodes-for-development-rapid-instructions-on-covid19-pdf-72286777565125 Publicat 2020. Accesat 25 iunie 2020 Google Scholar 19 M. Ouzzani, H. Hammady, Z. Fedorowicz, A. Elmagarmid Rayyan – o aplicație web și mobilă pentru recenzii sistematice Syst Rev, 5 (1) (2016), p. 210 Google Scholar 20Khalighi A. Probioticele: o revizuire cuprinzătoare a clasificării, a modului de acțiune și a rolului lor în alimentația umană. În: IntechOpen; 2016.  https://doi.org/10.5772/63646 . Google Scholar 21 D. Moher, A. Liberati, J. Tetzlaff, DG Altman Elementele de raportare preferate pentru recenzii sistematice și meta-analize: declarația PRISMA J Clin Epidemiol, 62 (10) (2009), p. 1006-1012 Articolul descarcă PDF Vizualizare înregistrare în Scopus Google Scholar 22 W.-J. Gu, C.-Y. Wei, R.-X. Yin Lipsa eficacității probioticelor în prevenirea pneumoniei asociate ventilatorului probiotice pentru pneumonia asociată ventilatorului: o revizuire sistematică și meta-analiză a studiilor controlate aleatorizateChest, 142 (4) (2012), p. 859-868 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 23 L. Jack, F. Coyer, M. Courtney, B. Venkatesh Probioticele și administrarea diareei în tubul enteral alimentat critic bolnav pacienți – care sunt dovezile? Intensive Crit Care Nurs, 26 (6) (2010), p. 314-326 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 24 R. L. Koretz Probiotice, boli critice și prejudecăți metodologice Nutr Clin Pract, 24 (1) (2009), pp. 45-49 CrossRef View Record în Scopus Google Scholar 25 K-x Liu, Yg Zhu, J. Zhang  și colab.Efectele probioticelor asupra incidenței pneumoniei nosocomiale la pacienții bolnavi critici: O revizuire sistematică și meta-analiză Crit Care, 16 (3) (2012), p. R109 Google CrossRef Scholar 26 E.O. Petrof, R. Dhaliwal, W. Manzanares, J. Johnstone, D. Cook, DK Heyland Probiotics în bolnavii critici: O revizuire sistematică a probelor randomizate din testul Crit Care Med, 40 (12) (2012), p. 3290- 3302 View Record in Scopus Google Scholar 27 M.J. Schultz, LE Haas Antibiotice sau probiotice ca măsuri preventive împotriva pneumoniei asociate ventilatorului: O revizuire a literaturii Crit Care, 15 (1) (2011), p. R18 CrossRef Google Scholar 28Siempos II, TK Ntaidou, ME Falagas Impactul administrării probioticelor asupra incidenței pneumoniei asociate ventilatorului: O meta-analiză a studiilor controlate randomizate Crit Care Med, 38 (3) (2010), p. 954-962 Vizualizare în Scopus Google Scholar 29 J. Wang, Kx Liu, F. Ariani, L.-L. Tao, J. Zhang, J.-M. Qu Probiotice pentru prevenirea pneumoniei asociate ventilatorului: o revizuire sistematică și meta-analiză a studiilor controlate randomizate de înaltă calitate PloS One, 8 (12) (2013), articolul e83934 CrossRef Google Scholar 30 S. Hempel, S. Newberry, A. Ruelaz  și colab. Siguranța probioticelor utilizate pentru a reduce riscul și a preveni sau trata tratamentul bolilorEvid Rep Technology Assess (200) (2011), p. 1-645 Vizualizare înregistrare în Scopus Google Scholar 31 W. Isakow, LE Morrow, MH Kollef Probiotice pentru prevenirea și tratarea infecțiilor nosocomiale: Revizuirea probelor actuale și recomandări Chest, 132 ( 1) (2007), p. 286-294 Articolul Descarcă PDF CrossRef View Record în Scopus Google Scholar 32 J.L. Bailey, SY Yeung Probiotice pentru prevenirea bolilor: un accent pe pneumonia asociată ventilatorului Ann Pharmacother, 45 (11) (2011), pp. 1425-1432 Vizualizare înregistrare în Scopus Google Scholar 33 D. Barraud, P.-E. Bollaert, S. GibotImpactul administrării probioticelor asupra mortalității la pacienții adulți bolnavi critici: o meta-analiză a studiilor controlate randomizate Chest, 143 (3) (2013), p. 646-655 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 34 L. Bo , J. Li, T. Tao  și colab. Probiotice pentru prevenirea pneumoniei asociate ventilatorului Cochrane Database Syst Rev (10) (2014), p. CD009066 Google Scholar 35 Q.L. Fan, XM Yu, QX Liu, W. Yang, Q. Chang, YP Zhang Sinbiotice pentru prevenirea pneumoniei asociate ventilatorului: o meta-analiză de rețea specifică tulpinii probiotice J Int Med Res, 47 (11) (2019), pp 5349-5374 Înregistrare CrossRef View în ScopusGoogle Scholar 36 W. Manzanares, M. Lemieux, PL Langlois, PE Wischmeyer Terapie probiotică și sinbiotică în boli critice: o revizuire sistematică și meta-analiză Crit Care, 19 (2016), p. 262 Google Scholar 37 P.J. Watkinson, VS Barber, P. Dark, JD Young Utilizarea pre- și pro-sinbiotice la pacienții pentru unitățile de terapie intensivă pentru adulți: Recenzie sistematică Clin Nutr, 26 (2) (2007), p. 182-192 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 38 D.K. Heyland, R. Dhaliwal, JW Drover  și colab. Linii directoare de practică clinică canadiană pentru asistența nutrițională la pacienții adulți bolnavi critic, ventilate mecanicJPEN J Parenteral Enteral Nutr, 27 (5) (2003), p. 355-383 CrossRef View Record în Scopus Google Scholar 39 Rongrungruang,  et al. Studiu controlat aleatoriu al probioticelor care conțin Lactobacillus casei (tulpina Shirota) pentru prevenirea pneumoniei asociate ventilatorului J Med Assoc Thai, 98 (3) (2015), p. 253-259 Vizualizare înregistrare în Scopus Google Scholar 40 C. Alberda, L. Gramlich, J. Meddings  și colab. Efectele terapiei probiotice la pacienții bolnavi critici: Un studiu randomizat, dublu-orb, controlat cu placebo Am J Clin Nutr, 85 (3) (2007), p. 816-823 Vezi înregistrarea în Scopus Google Scholar 41D. Barraud, C. Blard, F. Hein  și colab. Probiotice la pacientul bolnav critic: Un studiu dublu orb, randomizat, controlat cu placebo Intens Care Med, 36 (9) (2010), p. 1540-1547 CrossRef View Record în Scopus Google Scholar 42 D.J. Cook, J. Johnstone, JC Marshall  și colab. Probiotics: Prevention of Pneumonia Severa and Endotracheal Colonization Trial-PROSPECT: A pilot trial Trials, 17 (2016), p. 377 CrossRef Google Scholar 43 G.G. de Castro Soares, CH Marinho, R. Pitol  și colab. Bacilul sporulat ca tratament alternativ pentru diaree la pacienții adulți spitalizați sub nutriție enterală: Un studiu pilot controlat randomizatClin Nutr ESPEN, 22 (2017), p. 13-18 Articol Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 44 M. Ebrahimi-Mameghani, S. Sanaie, A. Mahmoodpoor, H. Hamishehkar Efectul unui preparat probiotic (VSL # 3 ) la pacienții bolnavi critici: Un studiu randomizat, dublu-orb, controlat cu placebo (studiu pilot) Pak J Med Sci, 29 (2) (2013), p. 490-494 Google Scholar 45 S. Ferrie, M. Daley Lactobacillus GG ca tratament pentru diaree în timpul alimentării enterale în boli critice: studiu controlat aleatoriu JPEN J Parenter Enteral Nutr, 35 (1) (2011), p. 43-49 CrossRef View Record în Scopus Google Scholar 46C. Forestier, D. Guelon, V. Cluytens  și colab. Probiotic oral și prevenirea infecțiilor cu Pseudomonas aeruginosa: Un studiu pilot randomizat, dublu-orb, controlat cu placebo la pacienții din unitățile de terapie intensivă Crit Care, 12 (3) (2008) R69-R69 Google Scholar 47 T.J. Frohmader, WP Chaboyer, IK Robertson, J. Gowardman Scăderea frecvenței scaunului lichid la pacienții bolnavi critici alimentați enteral, dat fiind probioticul multispecie VSL # 3: Un studiu pilot Am J Crit Care, 19 (3) (2010), p. E1 -e11 CrossRef Vizualizare înregistrare în Scopus Google Scholar 48 B. Klarin, G. Molin, B. Jeppsson, A. LarssonUtilizarea probeiotic Lactobacillus plantarum 299 pentru a reduce bacteriile patogene la orofaringele pacienților intubați: Un studiu pilot controlat aleatoriu, Crit Care, 12 (6) (2008), p. R136 CrossRef Google Scholar 49 B. Klarin, A. Adolfsson, A. Torstensson, A. Larsson Probiotice pot fi o alternativă la clorhexidină pentru îngrijirea orală la un pacient ventilat mecanic? Un studiu multicentric, prospectiv, randomizat, controlat, Crit Care, 22 (1) (2018), p. 272 Google Scholar 50 J.H. Kwon, KM Bommarito, KA Reske  și colab. Studiu controlat aleatoriu pentru a determina impactul administrării probioticelor asupra colonizării cu organisme rezistente la multe medicamente la pacienții bolnavi criticiInfec Control Hosp Epidemiol, 36 (12) (2015), p. 1451-1454 CrossRef View Record in Scopus Google Scholar 51 A. Mahmoodpoor, H. Hamishehkar, R. Asghari, R. Abri, K. Shadvar, S. Sanaie Effect a unui preparat probiotic pe pneumonie asociată ventilatorului la pacienții bolnavi critici admiși în unitatea de terapie intensivă: Un studiu prospectiv controlat randomizat dublu-orb Nutr Clin Pract, 34 (1) (2019), p. 156-162 CrossRef View Record în Scopus Google Scholar 52 A.A. Malik, R. Rajandram, PC Tah, V.-R. Hakumat-Rai, K.-F. Pregătirea celulelor microbiene Chin în hrănirea enterală la pacienții bolnavi critici: Un studiu clinic randomizat, dublu-orb, controlat cu placeboJ Crit Care, 32 (2016), p. 182-188 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 53 C.E. McNaught, NP Woodcock, ADG Anderson, J. MacFie Un studiu randomizat prospectiv al probioticelor la pacienții bolnavi critici Clin Nutr, 24 (2) (2005), p. 211-219 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 54 L.E. Morrow, MH Kollef, TB Casale, LE Morrow, MH Kollef, TB Casale Profilaxia probiotică a pneumoniei asociate ventilatorului: Un studiu orbit, randomizat, controlat Am J Respir Crit Care Med, 182 (8) (2010), p. 1058- 1064 Vizualizare înregistrare în Scopus Google Scholar 55S. Sanaie, M. Ebrahimi-Mameghani, H. Hamishehkar, M. Mojtahedzadeh, A. Mahmoodpoor Efectul unei probeotice multispecie asupra markerilor inflamatori la pacienții bolnavi critici: Un studiu randomizat, dublu-orb, controlat cu placebo J Res Med Sci, 19 (9) (2014), p. 827-833 Vezi înregistrare în Scopus Google Scholar 56 H.J. Song, J.-Y. Kim, S.-A. Jung  și colab. Efectul Lactobacillus probiotice (Lacidofil® cap) pentru prevenirea diareei asociate cu antibiotice: Un studiu multicentric prospectiv, randomizat, dublu-orb, J Korean Med Sci, 25 (12) (2010), p. 1784-1791 CrossRef View Record în Scopus Google Scholar 57 V. Stadlbauer, A. Horvath, I. Komarova  și colab.Dysbiosis în sepsis precoce poate fi modulată de un probiotic multispecie: Un studiu pilot randomizat controlat Benef Microbes, 10 (3) (2019), p. 265-278 CrossRef View Record în Scopus Google Scholar 58 J. Zeng, C.-T. Wang, F.-S. Zhang  și colab. Efectul probioticelor asupra incidenței pneumoniei asociate ventilatorului la pacienții bolnavi critici: Un studiu multicentric controlat randomizat Intens Care Med, 42 (6) (2016), p. 1018-1028 CrossRef View Record în Scopus Google Scholar 59 E.J. Giamarellos-Bourboulis, S. Bengmark, K. Kanellakopoulou, K. Kotzampassi Pro- și sinbiotice pentru a controla inflamația și infecția la pacienții cu multiple leziuniJ Trauma, 67 (4) (2009), p. 815-821 Vezi înregistrarea în Scopus Google Scholar 60 P.K. Jain, CE McNaught, ADG Anderson, J. MacFie, CJ Mitchell studiu Un studiu randomizat , controlat: Influența conține Lactobacillus acidophilus sinbiotic LA5, Bifidobacterium lactis Bb 12, Streptococcus thermophilus, Lactobacillus bulgaricus și oligofructoza asupra funcției de barieră a intestinului si sepsis la pacientii in stare critica Clin Nutr, 23 (4) (2004), p. 467-475 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 61 D.JW Knight, D. Gardiner, A. Banks  și colab.Efectul terapiei sinbiotice asupra incidenței pneumoniei asociate ventilatorului la pacienții bolnavi critici: Un studiu randomizat, dublu orb, controlat cu placebo Intens Care Med, 35 (5) (2009), p. 854-861 Vizualizare înregistrare în Scopus Google Scholar 62 K. Kotzampassi, EJ Giamarellos-Bourboulis, A. Voudouris, P. Kazamias, E. Eleftheriadis Beneficiile unei formule sinbiotice (Synbiotic 2000Forte) la pacienții cu traumatism critic: rezultate timpurii ale unui studiu controlat randomizat World J Surg, 30 (10) ) (2006), pp. 1848-1855 CrossRef View Record în Scopus Google Scholar 63 K. Shimizu, T. Yamada, H. Ogura,  et al.Sinbioticele modulează microbiota intestinală și reduc enterita și pneumonia asociată ventilatorului la pacienții cu sepsis: Un studiu randomizat controlat Crit Care, 22 (1) (2018), p. 239 Google Scholar 64 A. Spindler-Vesel, S. Bengmark, I. Vovk, O. Cerovic, L. Kompan Sinbiotice, prebiotice, glutamină sau peptidă în alimentația enterală timpurie: Un studiu randomizat la pacienții cu traumatism JPEN J Parenter Enteral Nutr, 31 (2) (2007), p. 119-126 CrossRef Google Scholar 65 X. Hu, H. Zhang, H. Lu,  și colab. Efectul tratamentului probiotic asupra pacienților infectați cu virusul gripal H7N9 PloS One, 11 (3) (2016), articol e0151976 CrossRef Google Scholar 66J. Kenna, L. Mahmoud, AR Zullo  și colab. Efectul probioticelor asupra incidenței infecțiilor asociate asistenței medicale la pacienții cu îngrijire neurocritică ventilată mecanic Nutr Clin Pract, 31 (1) (2016), p. 116-120 CrossRef View Record în Scopus Google Scholar 67 K. Shimizu, H. Ogura, D. Kabata  și colab. Asocierea sinbioticelor profilactice cu reducerea diareei și a pneumoniei la pacienții bolnavi critici ventilați mecanic: O analiză a scorului de propensiune J Infect Chemother, 24 (10) (2018), p. 795-801 Articolul Descarcă PDF Vezi înregistrarea în Scopus Google Scholar 68 G.J. Oudhuis, DC Bergmans, T. Dormans  și colab.Probiotice versus decontaminarea antibiotică a tractului digestiv: Infecție și mortalitate Intensive Care Med, 37 (1) (2011), p. 110-117 CrossRef View Record in Scopus Google Scholar 69 B. Klarin, M. Wullt, I. Palmquist, G Molin, A. Larsson, B. Jeppsson Lactobacillus plantarum 299v reduce colonizarea Clostridium difficile la pacienții bolnavi critici tratați cu antibiotice Acta Anaesthesiol Scand, 52 (8) (2008), p. 1096-1102 Înregistrare CrossRef în Scopus Google Scholar 70 P. Alonso-Coello, HJ Schünemann, J. Moberg  și colab.Evidență GRAD la cadrele de decizie (EtD): O abordare sistematică și transparentă pentru a face alegeri bine informate privind asistența medicală. 1: Introducere BMJ, 353 (2016), p. i2016 CrossRef Google Scholar 71 R.PJ Martindale, B. Teylor, M. Warren, SA Terapia nutrițională McClave la pacientul cu boala COVID-10 care necesită ICU ​​Care Society of Critical Care Medicine, Societatea americană de nutriție parentală și enterală (2020) https : //www.sccm.org/getattachment/Disaster/Nutrition-Therapy-COVID-19-SCCM-ASPEN.pdf? lang = en-SUA , Accesat 18 mai 2020 Google Scholar 72 J. Suez, N. Zmora, E. Segal, E. Elinav Pro, contra și multe necunoscute ale probioticelorNat Med, 25 (5) (2019), p. 716-729 CrossRef View Record în Scopus Google Scholar 73 P. Markowiak, K. Slizewska Efectele probiotice, prebiotice și sinbiotice asupra sănătății umane Nutrients, 9 (9) (2017) ) 1021 Google Scholar 74 ClinicalTrials.gov . Studiu pentru evaluarea efectului unui probiotic în COVID-19 NCT04390477. Biblioteca Națională de Medicină din SUA.  https://clinicaltrials.gov/ct2/show/NCT04390477 . Publicat 2020. Actualizat 15 mai 2020. Accesat 15 mai 2020. Google Scholar 75 Asociația Științifică Internațională pentru Probiotice și Prebiotice Cum lucrează unii oameni de știință probiotici pentru a aborda COVID-19https://isappscience.org/how-some-probiotic-and-prebiotic-scientists-are-working-to-address-covid-19/ Publicat 2020. Actualizat 4 mai 2020. Accesat 15 mai 2020 Google Scholar 76 World Studii clinice ale Organizației de Sănătate Un studiu prospectiv, multicentric, open-label, randomizat, controlat în paralel pentru probiotice pentru a evalua eficacitatea și siguranța la pacienții infectați cu o pneumonie coronavirusă nouă (COVID-19) ChiCTR2000029974 https://apps.who.int/ trialsearch / Trial2.aspx? TrialID = ChiCTR2000029974 Publicat 2020. Actualizat 18-18-2020. Accesat 15 mai 2020 Google Scholar 77 Academy of Nutrition and Dietetics ANDHII Academy of Nutrition and Dietetics Health Informatics Infrastructurehttps://www.andhii.org/info/ Publicat 2020. Accesat Google Scholar din 15 mai 2020

M. Rozga este cercetător în nutriție, Academia de Nutriție și Dietetică Evidence Analysis Center, Chicago, IL.

FW Cheng este cercetătoriîn nutriție, Academia de Nutriție și Dietetică Evidence Analysis Center, Chicago, IL.

D. Handu este director științific principal, Academia de Nutriție și Dietetică Evidence Analysis Center, Chicago, IL.

DECLARAȚIA POTENȚIALULUI CONFLICT DE INTERES Nu s-a raportat niciun potențial conflict de interese de către autori.

FINANțARE / SUPORT Această lucrare a fost susținută de Academia de Nutriție și Dietetică.

CONTRIBUȚIILE AUTORILOR Toți autorii au scris secțiuni ale primului proiect, au editat detaliat manuscrisul și au aprobat proiectul final.

https://www.sciencedirect.com/science/article/pii/S2212267220309308